KR20190049074A - Modified RNA aptamer specifically binding to surface protein TSA56 of the orientia tsutsugamushi Karp strain - Google Patents

Abstract

The present invention relates to a modified RNA aptamer specifically binding to the surface protein TSA56 of Orientia Tsutsugamushi, the bacteria causing an acute febrile disease in autumn, Tsutsugamushi disease. According to the present invention, provided is a single-stranded nucleic acid aptamer which binds specifically to the surface protein TSA56 of Orientia Tsutsugamushi and includes at least one base sequence from base sequences of SEQ ID NO: 1 or SEQ ID NO: 2. In addition, as the single-stranded nucleic acid aptamer has a base sequence of SEQ ID NO: 1 or 2 in which among those bases, the 2′-hydroxyl group of uracil (U) and cytosine (C) is substituted with a fluoro group, the modified RNA aptamer useful in detection of Orientia Tsutsugamushi, the bacteria causing Tsutsugamushi disease can be provided.

Description

[0001] The present invention relates to a modified RNA aptamer specifically binding to surface protein TSA56 of the oriental tsutsugamushi Karp strain which specifically binds to surface protein TSA56 of Orientia tsutsugamushi strain,

The present invention relates to a modified RNA plasmid that specifically binds to the surface protein TSA56 of Orientia tsutsugamushi strain.

In recent 20 years, new and reemerged infectious diseases have become a major cause of serious health and social harm to the human race worldwide. In addition, about 75% of these new infections are common or mediated Related infectious diseases.

Acute febrile illnesses such as tsutsugamushi disease, leptospirosis, and rash fever among the common infectious diseases that have recently increased in frequency frequently appear as common cold fever and symptoms such as cold body aches and various complications It is a disease that can die.

Tsutsugamushi disease, which has been growing annually since 2009, is a type of febrile disease known as tick ticks, bush tuppies, grass fever fever, and grass fever disease, and is caused by a larva of Oriental tsutsugamushi infected by Orientia tsutsugamushi , Microorganisms enter the body and spread throughout the body through blood and lymph (fluid), causing fever and vasculitis.

The major outbreaks of Tsutsugamushi disease include the Asian countries such as Korea, Japan, China, Taiwan, and the Philippines, the Russian Far East and northern Australia. The infectious strains of Tsutsugamushi are present in various genotypes depending on the area where they occur, and they belong to the representative strains of Karp, Kato and Gilliam species (see Non-Patent Documents 1 and 2). The infectious strains of Tsutsugamushi- The most frequently reported infectious organisms are the Karp species. (Refer to non-patent documents 3 and 4)

 Diagnosis of acute febrile diseases such as Tsutsugamushi can be diagnosed clinically by showing characteristic features such as scab and rash. However, in some cases, rash or scarring is rarely present in patients with Tsutsugamushi disease. Therefore, diagnosis of Tsutsugamushi disease Many cases are difficult to diagnose by serological diagnostic methods, gene detection methods, and bacterial isolation.

Serologic diagnosis is the most commonly used diagnostic method, which is used to diagnose the presence of antibodies in the blood due to a specific infection. The indirect immunofluorescence test, which confirms that a specific protein is fluorescently stained through a microscope, because the immune antibody of the patient first binds to the slide containing the antigen and the secondary fluorescent antibody binds to the immune antibody secondarily Indirect immunofluorescent antibody, IFA), Indirect immunoperoxidase (ELISA), which is similar to indirect immunofluorescence, is used instead of a secondary antibody conjugated with fluorescence, followed by binding of the enzyme to the secondary antibody, followed by measurement of the absorbance when the color is changed by a simple substrate solution Expert experts, expensive equipment, and a long time to take the disadvantage. In addition, the bacteria present in the blood of the patient can be isolated using cell culture, or the bacteria can be isolated using a mouse, a gene can be extracted from the blood, and amplified to detect fluorescence by PCR , And Nested PCR test), but this also requires time-consuming, skilled professionals and expensive equipment.

 Among the acute febrile diseases, leptospirosis, tsutsugamushi, and rash fever are the diseases that require differential diagnosis showing similar clinical characteristics. Especially, in case of not treating antibiotics early in the treatment, complications such as septic shock, respiratory failure, renal failure, Sometimes it occurs or it leads to death, so quick and accurate early diagnosis is very important.

 In particular, tsutsugamushi disease can be treated at the beginning of antibiotics, but if missed treatment period, the mortality rate is 30% due to complications, and the most characteristic feature of tsutsugamushi disease, It is often the case that the patient receives or is neglected by the wrong treatment. Rapid diagnosis based on the serological diagnosis method is required, which can be easily and objectively interpreted everywhere without the help of a fast and accurate manpower, as shown in the conventional diagnostic methods. The conventional serologic diagnosis method is a method of detecting an antibody reacting with an antigen protein in the blood of an infected person. As a result, a cross reaction due to a nonspecific reaction with other antigens is frequent and sensitivity and specificity are low.

 The aptamer is a three-dimensional recognition structure unlike protein antibody, and has cross-reactivity because it has affinity with target protein and high specificity. In addition, aptamer has the advantage of being able to be used not only for medical purpose but also for in vitro use such as diagnosis because it has high thermal and chemical stability and excellent durability as compared with protein antibody. Since the production is mainly carried out in animal cells, the aptamer produced by organic synthesis as compared with the low productivity antibody is easy to mass-produce, and it is advantageous in terms of ease of production and number, and can maintain unchanged quality.

 The disadvantages of the conventional serologic diagnosis method can be improved if aptamer which is easy to diagnose the tsutsugamushi disease which is an acute febrile disease in the autumn is discovered and replaced with the existing antibody.

As is well known, nucleic acids are linear polyamides in which the nucleotides are linked by covalent bonds, and the nucleotides are composed of small organic compounds such as phosphoric acid, sugar, and purines (adenine or guanine) or pyrimidines (cytosine, thymidine and uracil).

Nucleic acid exists as a single strand or a double strand, wherein a single strand forms a unique three-dimensional structure by bonding hydrogen bonds and interactions between nucleotides under specific physical conditions, and this structure is determined by the single strand base sequence .

 Generally, nucleic acids such as DNA and RNA have been reported as a storage material for expressing proteins having activity such as cell structure and enzymes. However, since it has been reported that RNA has activity as an enzyme by forming a specific structure in 1982, There are a lot of reports about the structural characteristics and the specific functions accordingly.

 The nucleic acid is composed of repeats of four bases and maintains a high diversity to form a large number of three-dimensional structures. These three-dimensional structures interact with specific substances to form a complex and stabilize.

Nucleic acid can serve as a ligand for a specific substance containing a protein, and it is possible to obtain a high binding force and specificity through a certain sorting process and a base sequence determination from a combined library of single-stranded nucleic acids arranged in various base sequences Nucleotides that bind specific substances are being screened.

A method of selecting a nucleic acid binding to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential Enrichment), and the nucleic acid which is the product thus selected is generally referred to as aptamer (see Non-Patent Document 5).

These SELEXs select molecules that can bind with very high affinity to a variety of biomolecules, including proteins that can bind to nucleic acids in their natural state, as well as proteins that are not associated with nucleic acids.

Shishido, A., Ohtawara, M., Tateno, S., Mizuno, S., Ogura, M., & Kitaoka, M. (1958) .The nature of immunity against scrub typhus in mice i. The resistance of mice, surviving subcutaneous infection of scrub typhus rickettsia, to intraperitoneal reinfection of the same agent. Japanese Journal of Medical Science and Biology, 11 (5), 383-399. Kelly, D.J., Fuerst, P.A., Ching, W.M., & Richards, A.L. (2009). Scrub typhus: the geographic distribution of phenotypic and genotypic variants of Orientia tsutsugamushi. Clinical Infectious Diseases, 48 (Supplement 3), S203-S230. Chang WH, Kang JS, Lee WK, Choi MS, and Lee JH. Serological classification by monoclonal antibodies of Rickettsia tsutsugamushi isolated in Korea. J Clin Microbiol. 1990; 28: 685-688. J., Kim, Y. S., Wie, S. H., Hur, J., Gill, B., ... & Lee, J. (2017, September). Molecular epidemiology of Orientia tsutsugamushi from scrub typhus patients in Korea, 2016. IN INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS (Vol. 50, pp. S137-S137). PO BOX 211, 1000 AE AMSTERDAM, NETHERLANDS: ELSEVIER SCIENCE BV. Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249 (4968), 505-510. Kim, Y., Park, S., Premaratna, R., Selvaraj, S., Park, S. J., Kim, S., ..., Kwon, S. H. (2016). Clinical evaluation of rapid diagnostic test kit for scrub typhus with improved performance. Journal of Korean medical science, 31 (8), 1190-1196.  Seo, H. S., & Lee, S. W. (2000). In vitro selection of the 2'-fluoro-2'-deoxyribonucleotide decoy RNA inhibitor of myasthenic autoantibodies. Journal of microbiology and biotechnology, 10 (5), 707-713. Han, S. R., & Lee, S. W. (2013). In vitro selection of RNA aptamer specific to Salmonella typhimurium. J Microbiol Biotechnol, 23 (6), 878-884. Bae, S.J., Oum, J.H., Sharma, S., Park, J., & Lee, S.W. (2002). In vitro selection of specific RNA inhibitors of NFATc. Biochemical and biophysical research communications, 298 (4), 486-492. HWANG, B., CHO, J. S., YEO, H. J., KIM, J. H., CHUNG, K. M., HAN, K., ... & LEE, S. W. (2004). Isolation of specific and high-affinity RNA aptamers against NS3 helicase domain of hepatitis C virus. Rna, 10 (8), 1277-1290. Schutze, T., Wilhelm, B., Greiner, N., Braun, H., Peter, F., Morl, M., ... & Arndt, P. F. (2011). Probing the SELEX process with next-generation sequencing. PloS one, 6 (12), e29604. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic acids research, 31 (13), 3406-3415.

It is an object of the present invention to provide a modified RNA plasmid for diagnosis of Tsutsugamushi disease, which is an acute febrile disease of autumn, and its use.

The present invention relates to a surface protein-specific binding protein having the amino acid sequence of SEQ ID NO: 1 or 2, which specifically binds to the surface protein TSA56 of Orientia tsutsugamushi strain and has the 2 'hydroxyl group of U (uracil) and C (cytosine) Lt; RTI ID = 0.0 > RNA < / RTI >

According to the modified RNA strand that specifically binds to the TSA56 surface protein of Orientia tsutsugamushi bacteria according to the present invention described above, the specific binding of TSA56 surface proteins of the modified RNA strand of the present invention to the TSA56 surface protein of Orientia tsutsugamushi And the binding pattern can be detected to diagnose Tsutsugamushi disease more quickly and accurately, so it is expected that it will provide better quality medical service to Tsutsugamushi patients.

FIG. 1 is an SDS-PAGE diagram of the His-tagged TSA56 protein purified product, wherein T6 to T11 represent fractions of the protein purification process.
FIG. 2 is an agarose gel electrophoresis of PCR products per 10 rounds of SELEX showing the results of the first repeated (1R) to the 10th repeated (10R) samples.
FIG. 3 is an agarose gel electrophoresis of the PCR fragment from which the T7 RNA polymerase promoter portion has been removed, and shows the results of the 5th (1) and 10th (2) samples of SELEX.
FIG. 4 is a statistical table for NGS sequence analysis, showing the maximum frequency of analyzed sequences, the total number of analyzed sequences, and the total number of analyzed sequences per sample.
FIG. 5 is a statistical drawing for NGS sequence analysis, which shows the maximum frequency of the analyzed sequences, the total number of types of analyzed sequences, and the total number of analyzed sequences per sample.
FIG. 6 is a secondary structure diagram of the RNA uterus for the nucleotide sequence 1, which shows the structure of the nucleotide sequence and the Gibbs free energy value.
FIG. 7 is a diagram showing a secondary structure of RNA abatum for nucleotide sequence 2, which shows the structure of the nucleotide sequence and the Gibbs free energy value.

The present invention provides a modified RNA plasmid useful for the diagnosis of tsutsugamushi, an acute febrile disease of autumn.

The modified RNA aptamer of the present invention specifically binds to the surface protein TSA56 present in the Karp species of Oriental tsutsugamushi which is one of the causative bacteria of Tsutsugamushi disease.

The modified RNA aptamer according to the present invention includes the nucleotide sequence of SEQ ID NO: 1 or 2 in which the 2 'hydroxyl group of uracil (U) and cytosine (C) in the base sequence of each sequence is substituted with a fluoro group. This modification of the base structure is intended to produce modified RNA that is resistant to RNA degrading enzymes.

The nucleotide sequences of the RNA tyramata of SEQ ID NOS: 1 and 2 are as follows.

5 'GGGAGAGCGGAAGCGUGCUGGGCCGUGCGUCAAUUAAGGGUUGUCGUGCGAUCUUGUUCGUUUC

CAUAACCCAGAGGUCGAUGGAUCCCCCC 3 '(SEQ ID NO: 1)

5 'GGGAGAGCGGAAGCGUGCUGGGCCGCGUCGGUGAACGUUGUGGUUCGUGCAUGUUUCUUGGUCC

CAUAACCCAGAGGUCGAUGGAUCCCCCC 3 ' (SEQ ID NO: 2)

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings and embodiments. The following specific examples are illustrative of the present invention but are not intended to limit the scope of the present invention.

Example 1: Construction of antigen surface protein of Tsutsugamushi disease

Primer 1 and 2 were prepared based on the genetic information (GeneBank accession number: AY956315) of the surface protein TSA56 present in Orientia tsutsugamushi Karp species causing tsutsugamushi, and the PCR fragment was amplified (see Non-Patent Document 6)

The nucleotide sequences of primers 1 and 2 above are as follows.

5 'CCGGCGATGGCCATG AAAAAAATTATGTTAATTG 3' (Primer 1)

5 'GGTGGTGGTGCTCGAG GAAGTTATAGCGTACACC 3' (Primer 2)

The gene PCR fragment was inserted into the NcoI and XhoI restriction sites of the pET22b expression vector. In order to reduce the insolubilization of the expressed protein in the XhoI restriction enzyme site of the vector into which the gene was inserted, an IF2 vector fragment having both ends designed as XhoI restriction enzyme sites was added. And a vector in which the IF2 domain was inserted at the C-terminus was transformed into Escherichia coli to produce a protein having 6 histidine terminal (His-tag) at the C-terminal of the amino acid sequence (FIG.

Example 2: Construction of an RNA abstamer library

92 single oligonucleotide sequences containing 40 random sequences and specific sequences at both ends were designed to screen for RNA tympanism binding to the TSA56 protein by the SELEX procedure. The DNA library was amplified by polymerase chain reaction (PCR) in order to prepare an RNA library using the synthesized single oligonucleotide fragment as a template. Primer 3 and 4 containing a specific sequence of a single oligonucleotide sequence were used for PCR amplification, and a promoter portion of T7 RNA polymerase was included in Primer 3 for RNA synthesis.

The nucleotide sequences of the above primers 3 and 4 are as follows.

5 'GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGCGTGCTGGG 3' (Primer 3)

5 'GGGGGGATCCATCGACCTCTGGGTTATG 3' (Primer 4)

0.25 μM Primer 3, 0.25 μM Primer 4, 10 × PCR buffer, 200 μM dNTP mixture and 5 units of DNA Taq polymerase (BioFact) were mixed as a constituent of the PCR amplification process. The PCR reaction was carried out at 95 ° C for 5 minutes, followed by repeating 20 cycles at 95 ° C for 30 seconds, 58 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by reaction at 72 ° C for 5 minutes. Respectively.

An RNA library was prepared using T7 RNA polymerase (Epicenter Technologies) with a DNA library containing a promoter of T7 polymerase as a template. In vitro transcription was performed using a pyrimidine base (Epicenter Technologies) in which the 2'hydroxy group of CTP and UTP was substituted with a fluorine group to have resistance to RNA degradation enzymes (see Non-Patent Document 7)

In vitro transcription was performed by mixing DNA library, 10X transcription buffer, 5 mM DTT, 5 mM ATP, GTP, 2'-F CTP, 2'-F UTP, T7 polymerase mixture (Epicenter Technologis) And reacted at 37 ° C for 4 hours. DNaseI (Epaicentre Technologies) was added to the synthesized RNA reagent, followed by reaction at 37 ° C for 15 minutes to remove DNA used as a template, followed by ethanol precipitation to prepare an RNA library.

The RNA library has the following sequences in which bases of A and G and C and U in which the 2 'hydroxyl group is substituted with a fluorine group are respectively incorporated into the same molar number at the N40 position.

The RNA library sequence of SEQ ID NO: 3 is as follows.

5 'GGGAGAGCGGAAGCGUGCUGGGCCN40CAUAACCCAGAGGUCGAUGGAUCCCCCC 3' (nucleotide sequence 3)

Example 3: Detection of RNA plasmids using SELEX

SELEX technology was used to isolate RNA tyramar that binds to the surface protein TSA56 of Orientia tsutsugamushi. (Refer to non-patent documents 8, 9 and 10)

The SELEX method is as follows.

To remove nonspecific RNA reacting with Ni-NTA agarose beads, 150 pmol of RNA library and Ni-NTA agarose beads were added to 200 μl of binding buffer (30 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1.5 mM MgCl ₂ , 2 mM dithiothreitol, and 1% BSA) and allowed to react at room temperature for 20 minutes. After the reaction, the supernatant was transferred to a new tube. The RNA library and TSA56 protein were mixed with Ni-NTA beads in the binding buffer and reacted at room temperature for 20 minutes. The TSA56 protein and RNA complexes were washed with Ni-NTA agarose beads 5 times with 400 μl binding buffer and heated at 95 ° C for 5 minutes to separate RNA from the protein. Separated RNA was reacted with reverse transcriptase (BioFact) and the first SELEX product was obtained by PCR. The above procedure was repeated 10 times in total, and a PCR fragment was obtained for each repetition and used for sequence analysis (FIG. 2)

Example 4: Analysis of NGS sequence using SELEX product

The 5th and 10th PCR products obtained from the SELEX repeat procedure were used for NGS sequence analysis to analyze the nucleotide sequences of the tympanic membrane reacting with the TSA56 protein (see Non-Patent Document 11)

To use the SELEX PCR product for NGS sequencing, Primer 5 was prepared by removing the promoter portion of T7 RNA polymerase.

The nucleotide sequence of the above primer 5 is as follows.

5'GCGGAAGCGTGCTGGGCC3 '(Primer 5)

For PCR amplification, 0.25 μM Primer 4, 0.25 μM Primer 5, 10 × PCR buffer, 200 μM dNTP mixture and 5 units of DNA Taq polymerase (BioFact) were mixed and reacted at 95 ° C for 5 minutes. The PCR was performed by repeating 10 cycles at 58 ° C for 30 seconds and 72 ° C for 30 seconds, and then reacting at 72 ° C for 5 minutes (FIG. 3).

As a result of the NGS sequencing analysis, RNA plasmids of SEQ ID NO: 1 and SEQ ID NO: 2 having 92 RNA base sequences were excavated.

As a result of NGS, the maximum frequency of the sequence analyzed in the 5th and 10th products of SELEX, the total number of the analyzed sequences, and the total number of analyzed sequences per sample were confirmed (FIG. 4). 5). As a result, it can be seen that as the number of repetitions of SELEX increases, the number of specific sequences included in the SELEX product increases and the total number of analyzed sequences increases, thereby eliminating non-specific sequences.

Example 5: Identification of RNA secondary structure

The RNA secondary structure of the nucleotide sequence 1 and the nucleotide sequence 2 was predicted through the mfold program, and the Gibbs free energy value of each structure was deduced (see Non-Patent Document 12).

The RNA secondary structure for nucleotide sequence 1 is identified in three forms, and the Gibbs free energy values are stable at -35.8 (kcal / mol), -34.6, -34.2 (Figure 6). (SEQ ID NO: 2) forms two types of RNA secondary structure and has a structure of -38.9 (kcal / mol) and a Gibbs free energy value of 38.8 (FIG. 7). 92 nucleotide sequences of nucleotide sequence 1 and 2 Have a stable structure in the form of a stem loop (Stem-loop).

<110> BIOIS <120> TSA56 <130> TSA56 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Orientia tsutsugamushi Karp <400> 1 gggagagcgg aagcgugcug ggccgugcgu caauuaaggg uugucgugcg aucuuguucg 60 uuuccauaac ccagaggucg auggaucccc cc 92 <210> 2 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> Orientia tsutsugamushi Karp <400> 2 gggagagcgg aagcgugcug ggccgcgucg gugaacguug ugguucgugc auguuucuug 60 gucccauaac ccagaggucg auggaucccc cc 92 <210> 3 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> RNA Aptamer sequence <400> 3 gggagagcgg aagcgugcug ggccnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnncauaac ccagaggucg auggaucccc cc 92

Claims (2)

A modified RNA plasmid having the nucleotide sequence of SEQ ID NO: 1 or 2 that specifically binds to the TSA56 surface protein of Orientia tsutsugamusi The Uracil (U) and the cytosine (C) of SEQ ID NO: 1 or 2, wherein the 2 'hydroxyl group is substituted with a fluorine group,

Images