KR20190042370A

KR20190042370A - Sorafenib resistance cancer therapeutic agent

Info

Publication number: KR20190042370A
Application number: KR1020170134208A
Authority: KR
Inventors: 조광현; 황채영; 원재경; 윤정환; 유수종
Original assignee: 한국과학기술원; 서울대학교산학협력단
Priority date: 2017-10-16
Filing date: 2017-10-16
Publication date: 2019-04-24

Abstract

The present invention relates to an anticancer agent and, more specifically, to a sorafenib-resistant anticancer agent. The present invention provides a sorafenib-resistant anticancer agent comprising sorafenib and a protein disulfide isomerase (PDI) inhibitor. According to the present invention, through co-administration of the sorafenib and the PDI inhibitor, the resistance to sorafenib can be overcome, and the efficacy of the anticancer agent can be improved.

Description

Sorapenib resistance cancer therapeutic agent < RTI ID = 0.0 >

본 발명은 암 치료제에 관한 것으로서, 더 상세하게는 소라페닙 저항성 암 치료제에 관한 것이다.[0001] The present invention relates to a cancer therapeutic agent, and more particularly to a therapeutic agent for the treatment of sorafenib.

첫번째 경구용 다중인산화효소(multikinase) 저해제인 소라페닙(sorafenib)은 몇 년 전에 간세포 암종(hpatocellular carcinoma, HCC) 치료제로 승인되었지만 효능이 제한적인 이유로 HCC 환자의 약 10% 환자만이 소라페닙에 대한 임상 반응을 나타내었고 30-40%는 질병통제율(disease control rate)을 입증하였다. SHARP 임상시험에서 소라페닙 투여로 인한 평균 생존 기간은 3개월까지 연장되었지만, 가격이 높고 환자에 따라 효능이 다양하다는 점을 감안하면 그 효과는 충분하지 못했다(Llovet JM, et al., N Engl J Med, 359:378-390, 2008). 일반적으로 표적 항암제는 임상반응을 예측하는 바이오 마커(biomarker)가 있어야 하는데 타르세바(표피성장인자수용체[EGFR] 억제제) 또는 크리조티닙(미분화 림프종 키나아제[ALK] 억제제)과 같은 단일 키나아제 억제제는 각각 EGFR과 ALK 유전자의 변이를 예측 마커로 갖고 있지만 소라페닙은 v-Raf 뮤린 육종 바이러스성 종양 유전자 동족체 B1 (BRAF), 혈관내피 성장인자 수용체 2(VEGFR2), 혈소판유래 성장인자 수용체(PDGFR), FMS 유사 티로신 키나아제 수용체 3(FLT3), 고양이 육종 바이러스성 종양 유전자 v-kit의 세포 동족체(cellular homolog, KIT) 등 여러 키나아제들을 타겟으로 하기 때문에 그 작용기전이 복잡하여 뚜렷한 예측 마커가 존재하지 않는다(Cervello M, et al., Oncotarget, 3:236-260. 2012). 따라서 소라페닙의 저항성 기전을 연구하고 효능을 향상시킬 수 있는 새로운 치료전략을 개발하는 것이 임상적으로 중요하다. The first oral multikinase inhibitor, sorafenib, was approved a few years ago for the treatment of hepatocellular carcinoma (HCC), but because of its limited efficacy, only about 10% of patients with HCC have been treated with sorafenib Showed clinical response and 30-40% demonstrated disease control rate. In the SHARP trial, the mean survival time of patients treated with sorafenib was extended to 3 months, but the effect was not sufficient given the high price and varying efficacy of each patient (Llovet JM, et al., N Engl J Med. , 359: 378-390, 2008). In general, targeted anticancer agents should have a biomarker that predicts clinical response, whereas single kinase inhibitors such as tarceva (epidermal growth factor receptor [EGFR] inhibitor) or clitorotinib (undifferentiated lymphoma kinase [ALK] inhibitor) EGFR and ALK genes, but Sorapenib has been implicated as a marker of v-Raf murine sarcoma viral tumor gene homolog B1 (BRAF), vascular endothelial growth factor receptor 2 (VEGFR2), platelet derived growth factor receptor (PDGFR) Because it targets several kinases such as the tyrosine kinase receptor 3 (FLT3) and the cellular homolog (KIT) of the viral tumor cell line v-kit, the mechanism of action is complicated and there are no clear predictive markers (Cervello M, et al., Oncotarget, 3: 236-260, 2012). It is therefore clinically important to study the resistance mechanism of sorafenib and to develop new therapeutic strategies to improve efficacy.

그러나 상기 선행기술의 경우, 소라페닙의 경우 10-40%의 낮은 치료 반응과 치료 후 거의 모든 환자에서 저항성이 나타나는 문제가 있는 반면 단일 키나아제 억제제에 비해 치료 효과를 예측할 수 있는 예측 마커나 저항성 예측 마커도 존재하지 않는다. However, in the case of the above prior art, there is a problem that the treatment response of 10-40% in case of Sorapenib and the resistance of almost all patients after the treatment have a problem, whereas the predictive marker or the resistance prediction marker which can predict the therapeutic effect as compared with the single kinase inhibitor There is no.

본 발명은 상기와 같은 문제점을 포함하여 여러 문제점들을 해결하기 위한 것으로서, 소라페닙에 대한 내성을 극복하고 효능을 향상시킬 수 있는 소라페닙 저항성 암 치료제를 제공하는 것을 목적으로 한다. 그러나 이러한 과제는 예시적인 것으로, 이에 의해 본 발명의 범위가 한정되는 것은 아니다.Disclosure of Invention Technical Problem [8] Accordingly, the present invention has been made to solve the above-mentioned problems, and it is an object of the present invention to provide a therapeutic agent for sorafenib resistant cancer that can overcome tolerance to sorafenib and improve its efficacy. However, these problems are exemplary and do not limit the scope of the present invention.

본 발명의 일 관점에 따르면, 소라페닙 및 단백질 이황화 이성질화 효소(PDI) 억제제를 포함하는, 소라페닙 저항성 암 치료제가 제공된다. According to one aspect of the present invention, there is provided a therapeutic agent for sorafenib resistant cancer, which comprises sorapenib and a protein disulfide isomerase (PDI) inhibitor.

본 발명의 다른 일 관점에 따르면, 치료적으로 유효한 양의 소라페닙 저항성 암 치료제를 암에 걸린 개체에 투여하는 단계를 포함하는 암의 치료방법이 제공된다. According to another aspect of the present invention, there is provided a method of treating cancer comprising administering a therapeutically effective amount of a therapeutic agent for sorapenib resistant cancer to a subject having cancer.

본 발명의 다른 일 관점에 따르면, 피검 화합물 또는 피검 천연물을 PDI(protein disulfide isomerase) 및 상기 PDI의 기질과 반응시키는 단계; 및 상기 기질의 환원 정도를 측정하는 단계를 포함하는 소라페닙 저항성 암 치료제의 스크리닝 방법이 제공된다.According to another aspect of the present invention, there is provided a method for screening a test compound, comprising: reacting a test compound or a test substance with a substrate of PDI (protein disulfide isomerase) and the PDI; And measuring the degree of reduction of the substrate.

본 발명의 다른 일 관점에 따르면, 피검 화합물 또는 피검 천연물을 PDI(protein disulfide isomerase) 및 상기 PDI의 기질과 반응시키는 단계; 상기 기질의 환원 정도를 측정하는 단계; 대조군과 비교하여 상기 기질의 환원 정도를 억제한 피검 화합물 또는 피검 천연물을 1차 선별하는 단계; 선별된 피검 화합물 또는 피검 천연물을 소라페닙 저항성을 나타내는 암세포에 소라페닙과 함께 처리하는 단계; 및 소라페닙 저항성을 감소시키는 피검 화합물 또는 피검 천연물을 2차 선별하는 단계를 포함하는 소라페닙 저항성 암 치료제의 스크리닝 방법이 제공된다. According to another aspect of the present invention, there is provided a method for screening a test compound, comprising: reacting a test compound or a test substance with a substrate of PDI (protein disulfide isomerase) and the PDI; Measuring the degree of reduction of the substrate; A step of firstly screening the test compound or the test natural substance inhibiting the degree of reduction of the substrate as compared with the control group; Treating the selected test compound or the tested natural substance with sorapenib in a cancer cell showing resistance to sorapenib; And a second step of screening a test compound or a natural product to be tested for reducing the resistance to sorafenib.

상기한 바와 같이 이루어진 본 발명의 일 실시예에 따르면, 소라페닙 및 PDI 억제제의 병용 치료를 통해 소라페닙의 내성을 극복하여 효능을 향상시킬 수 있는 새로운 암 치료효과를 구현할 수 있다. 물론 이러한 효과에 의해 본 발명의 범위가 한정되는 것은 아니다.According to one embodiment of the present invention as described above, a new cancer treatment effect that can improve the efficacy by overcoming tolerance of sorapenib can be achieved through the combined treatment of sorapenib and PDI inhibitor. Of course, the scope of the present invention is not limited by these effects.

도 1은 HCC 세포주(HepG2, Hep3B, Huh7, SNU475 및 SNU761)에 소라페닙을 처리하고 세포 생존력을 분석한 그래프이다.
도 2a는 소라페닙을 처리한 SNU761 세포에서 분리한 phospho-elF2a(p-elF2a)을 웨스턴 블랏으로 분석한 겔사진이다.
도 2b는 소라페닙 및 탑시가르긴을 처리한 SNU761 세포의 CHOP mRNA 발현을 RT-PCR로 분석한 겔사진이다.
도 2c는 소라페닙을 처리한 Huh7 세포에서 분리한 phospho-elF2a을 웨스턴 블랏으로 분석한 겔사진이다.
도 2d는 소라페닙을 처리한 Huh7 세포에서 CHOP mRNA 발현을 RT-PCR로 분석한 겔사진이다.
도 2e는 CHOP mRNA 발현은 실시간 PCR에 의해 정량화한 그래프이다.
도 3은 Hep3B 세포에 scrambled shRNA 또는 CHOP shRNA를 발현하는 세포주를 만들어 소라페닙의 농도에 따른 세포 생존력을 분석한 그래프이다.
도 4는 SNU761 세포에서 소라페닙을 처리 시 상향조절된 분자를 갖는 ER 경로 네트워크를 나타내는 개요도이다.
도 5a는 ER 스트레스 네트워크에서 소라페닙 처리에 따른 UPR 신호 변환기 유전자 발현을 분석한 그래프이다.
도 5b는 ER 스트레스 네트워크에서 소라페닙 처리에 따른 세포 사멸에 관여하는 분자 발현을 분석한 그래프이다.
도 5c는 ER 스트레스 네트워크에서 소라페닙 처리에 따른 ER 단백질 폴딩 및 품질 조절에 관여하는 분자 발현을 분석한 그래프이다.
도 5d는 ER 스트레스 네트워크에서 소라페닙 처리에 따른 유비퀴틴 - 프로테아좀 시스템 관련 유전자의 발현을 분석한 그래프이다.
도 5e는 ER 스트레스 네트워크에서 소라페닙 처리에 따른 레트로 전이(retrotranslocation)에 관여하는 분자의 발현을 분석한 그래프이다.
도 6a은 ER 스트레스 네트워크에서 HepG2 세포주에 소라페닙 처리에 따른 UPR 신호 변환기 관련 유전자의 발현을 분석한 그래프이다.
도 6b는 ER 스트레스 네트워크에서 HepG2 세포주에 소라페닙 처리에 따른 세포 사멸에 관여하는 분자의 발현을 분석한 그래프이다.
도 6c는 ER 스트레스 네트워크에서 HepG2 세포주에 소라페닙 처리에 따른 ER 단백질 폴딩 및 품질 조절에 관여하는 분자의 발현을 분석한 그래프이다.
도 6d는 ER 스트레스 네트워크에서 HepG2 세포주에 소라페닙 처리에 따른 유비퀴틴 - 프로테아좀 시스템 관련 유전자의 발현을 분석한 그래프이다.
도 6e는 ER 스트레스 네트워크에서 HepG2 세포주에 소라페닙 처리에 따른 레트로 전이(retrotranslocation)에 관여하는 분자의 발현을 분석한 그래프이다.
도 7a은 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 UPR 신호 변환기 관련 유전자의 발현을 분석한 그래프이다.
도 7b는 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 세포 사멸에 관여하는 분자의 발현을 분석한 그래프이다.
도 7c는 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 ER 단백질 폴딩 및 품질 조절에 관여하는 분자의 발현을 분석한 그래프이다.
도 7d는 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 당단백질 처리 관련 유전자의 발현을 분석한 그래프이다.
도 7e는 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 유비퀴틴-프로테아좀 시스템에 관여하는 분자의 발현을 분석한 그래프이다.
도 7f는 ER 스트레스 네트워크에서 Huh7 세포주에 소라페닙 처리에 따른 콜레스테롤 대사 조절에 관여하는 분자의 발현을 분석한 그래프이다.
도 8은 오리지널 ER 스트레스 네트워크를 나타내는 그림이다.
도 9는 커널 네트워크 분석으로 동정한 감소된 네트워크를 나타내는 그림이다.
도 10a는 ER 스트레스 네트워크 및 그 억제제의 논리 다이어그램을 나타내고 있는 개요도이다.
도 10b는 ODE의 논리적 근사에 기초한 모델의 시뮬레이션 결과를 나타낸 그래프이다.
도 11a는 w₉ = 0.9, w₁₀ = 0.2 계수 값에 따른 시뮬레이션을 분석한 그래프이다.
도 11b는 w₉ = 0.6, w₁₀ = 0.8 계수 값에 따른 시뮬레이션을 분석한 그래프이다.
도 12a는 SNU761 세포에 4 μM 소라페닙 단독, 0.1 μM 보르테조밉 단독 또는 24시간 동안 병용투여한 후 세포 생존력을 분석한 그래프이다.
도 12b는 SNU761 세포에 4 μM 소라페닙 단독, 0.2 μM 보르테조밉 단독 또는 24시간 동안 병용투여 후 세포 생존력을 분석한 그래프이다.
도 13a는 HCC 세포에 PACMA 31 및 소라페닙을 단독 또는 병용처리하여 세포 생존력 및 세포사멸을 분석한 그래프이다.
도 13b는 HCC 세포에 PACMA 31 및 소라페닙을 단독 또는 병용처리한 후 세포를 PI 용액으로 염색하여 세포사멸을 나타낸 사진이다.
도 14a는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 UPR 신호 변환기 관련 유전자의 발현을 분석한 그래프이다.
도 14b는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 세포 사멸에 관여하는 분자의 발현을 분석한 그래프이다.
도 14c는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 ER 단백질 폴딩 및 품질 조절에 관여하는 분자의 발현을 분석한 그래프이다.
도 14d는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 당단백질 처리 관련 유전자의 발현을 분석한 그래프이다.
도 14e는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 유비퀴틴-프로테아좀 시스템 관련 유전자의 발현을 분석한 그래프이다.
도 14f는 ER 스트레스 네트워크에서 소라페닙 단독, 병용치료 및 PACMA 31 단독처리에 따른 레트로 전이(retrotranslocation)에 관여하는 분자의 발현을 분석한 그래프이다.
도 15는 SNU761 세포에서 소라페닙 단독 또는 PACMA 31 병용치료 시 분자의 발현 변화를 갖는 ER 스트레스 경로를 나타내는 그림이다.
도 16a는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 UPR 신호 변환기 관련 유전자의 발현을 분석한 그래프이다.
도 16b는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 세포 사멸에 관여하는 분자의 발현을 분석한 그래프이다.
도 16c는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 ER 단백질 폴딩 및 품질 조절에 관여하는 분자의 발현을 분석한 그래프이다.
도 16d는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 콜레스테롤 대사 조절 관련 유전자의 발현을 분석한 그래프이다.
도 16e는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 유비퀴틴-프로테아좀 시스템 관련 유전자의 발현을 분석한 그래프이다.
도 16f는 ER 스트레스 네트워크에서 소라페닙 단독 또는 PACMA 31 병용처리에 따른 레트로 전이(retrotranslocation)에 관여하는 분자의 발현을 분석한 그래프이다.
도 17a는 PACMA 31 및 소라페닙의 병용치료가 생체 내에서 Hep3B 이종 이식 마우스의 종양 성장 억제 여부를 관찰한 것으로 종양 부피의 변화를 나타내는 사진이다.
도 17b는 PACMA 31 및 소라페닙의 병용치료가 생체 내에서 Hep3B 이종 이식 마우스의 종양 성장 억제 여부를 관찰한 것으로 절개한 종양의 모습을 나타내는 사진이다.
도 18a는 진행시간에 따른 PDI 발현에 의한 생존을 분석한 그래프이다.
도 18b는 PDI 발현에 의한 전체 생존을 분석한 그래프이다. FIG. 1 is a graph showing the cell viability of HCC cell lines (HepG2, Hep3B, Huh7, SNU475 and SNU761) treated with Sorapanib.
2A is a gel photograph of phospho-elF2a (p-elF2a) isolated from sorafenib-treated SNU761 cells by Western blotting.
FIG. 2B is a gel photograph of RT-PCR analysis of CHOP mRNA expression of SNU761 cells treated with sorapenib and topicalgarin.
FIG. 2C is a gel photograph of phospho-elF2a isolated from sorafenib-treated Huh7 cells by Western blotting. FIG.
FIG. 2d is a gel photograph of RT-PCR analysis of CHOP mRNA expression in sorapenib-treated Huh7 cells.
Figure 2E is a graph quantifying CHOP mRNA expression by real-time PCR.
FIG. 3 is a graph showing the cell viability according to the concentration of sorapenib by preparing a cell line expressing scrambled shRNA or CHOP shRNA in Hep3B cells.
Figure 4 is a schematic representation of an ER pathway network with up-regulated molecules upon treatment with sorapenib in SNU761 cells.
5A is a graph showing gene expression of UPR signal transducer according to sorafenib treatment in an ER stress network.
FIG. 5B is a graph showing molecular expression involved in apoptosis induced by sorafenib treatment in an ER stress network. FIG.
FIG. 5c is a graph showing molecular expression involved in ER protein folding and quality control according to sorafenib treatment in an ER stress network. FIG.
FIG. 5D is a graph showing the expression of genes related to ubiquitin-proteasome system according to sorafenib treatment in an ER stress network. FIG.
FIG. 5E is a graph showing the expression of molecules involved in retrotranslocation by sorapenib treatment in an ER stress network. FIG.
FIG. 6A is a graph showing the expression of UPR signal transducer-related gene according to sorapenib treatment in HepG2 cell line in an ER stress network. FIG.
6B is a graph showing the expression of molecules involved in apoptosis by treatment with sorapenib in the HepG2 cell line in an ER stress network.
6C is a graph showing the expression of molecules involved in ER protein folding and quality control by treatment with sorapenib in HepG2 cell line in an ER stress network.
FIG. 6D is a graph showing the expression of the ubiquitin-proteasome system-related gene upon treatment with sorapenib in the HepG2 cell line in the ER stress network. FIG.
FIG. 6E is a graph showing the expression of molecules involved in retrotranslocation by treatment with sorapenib in HepG2 cell line in an ER stress network. FIG.
FIG. 7A is a graph showing the expression of UPR signal transducer-related genes according to Soraphenib treatment in Huh7 cell line in an ER stress network. FIG.
7B is a graph showing the expression of molecules involved in apoptosis by treatment with sorafenib in the Huh7 cell line in an ER stress network.
FIG. 7c is a graph showing the expression of molecules involved in ER protein folding and quality control by Soraphenyl treatment on Huh7 cell line in the ER stress network. FIG.
FIG. 7D is a graph showing the expression of a gene related to glycoprotein treatment upon treatment with sorafenib in the Huh7 cell line in an ER stress network. FIG.
7E is a graph showing the expression of molecules involved in the ubiquitin-proteasome system following treatment with sorafenib in the Huh7 cell line in an ER stress network.
FIG. 7f is a graph showing the expression of molecules involved in the regulation of cholesterol metabolism by treatment with sorafenib in the Huh7 cell line in the ER stress network. FIG.
8 is a diagram showing an original ER stress network.
Figure 9 is a diagram illustrating a reduced network identified by kernel network analysis.
10A is a schematic diagram illustrating a logic diagram of an ER stress network and its inhibitors.
10B is a graph showing a simulation result of a model based on a logical approximation of the ODE.
FIG. 11A is a graph of simulation analysis according to w ₉ = 0.9 and w ₁₀ = 0.2 coefficient values.
FIG. 11B is a graph of simulation analysis according to w ₉ = 0.6 and w ₁₀ = 0.8 coefficient values.
FIG. 12A is a graph showing cell viability after administration of 4 μM sorapenib alone, 0.1 μM bortezomib alone or in combination for 24 hours to SNU761 cells.
FIG. 12B is a graph showing cell viability after administration of 4 μM sorapenib alone, 0.2 μM bortezomib alone or in combination for 24 hours to SNU761 cells.
FIG. 13A is a graph showing cell viability and apoptosis of HCC cells treated with PACMA 31 and sorapenib alone or in combination. FIG.
13B is a photograph showing cell death by staining cells with PI solution after treating PACMA 31 and sorapenib alone or in combination with HCC cells.
14A is a graph showing the expression of gene related to UPR signal transducer according to sorafenib alone, combination therapy, and PACMA 31 alone treatment in an ER stress network.
14B is a graph showing the expression of molecules involved in apoptosis according to sorafenib alone, combination therapy and PACMA 31 alone treatment in an ER stress network.
14C is a graph showing the expression of molecules involved in ER protein folding and quality control by sorafenib alone, combination therapy, and PACMA 31 alone treatment in an ER stress network.
FIG. 14D is a graph showing the expression of genes related to glycoprotein treatment by sorafenib alone, combination therapy, and PACMA 31 alone treatment in an ER stress network.
14E is a graph showing the expression of genes related to ubiquitin-proteasome system according to sorafenib alone, combination treatment and PACMA 31 alone treatment in an ER stress network.
FIG. 14f is a graph showing the expression of molecules involved in retrotranslocation according to sorafenib alone, combination therapy, and PACMA 31 alone treatment in an ER stress network. FIG.
FIG. 15 is a graph showing the ER stress pathway with changes in the expression of molecules when treated with sorafenib alone or in combination with PACMA 31 in SNU761 cells. FIG.
16A is a graph showing the expression of gene related to UPR signal transducer according to Sorapenib alone or PACMA 31 combination treatment in an ER stress network.
16B is a graph showing the expression of molecules involved in apoptosis according to treatment with sorafenib alone or PACMA 31 in ER stress network.
16C is a graph showing the expression of molecules involved in the ER protein folding and quality control according to treatment with sorafenib alone or in combination with PACMA 31 in an ER stress network.
16 (d) is a graph showing the expression of genes related to cholesterol metabolism control by sorafenib alone or PACMA 31 combination treatment in the ER stress network.
FIG. 16E is a graph showing the expression of genes related to ubiquitin-proteasome system according to treatment with sorafenib alone or PACMA 31 in an ER stress network. FIG.
FIG. 16f is a graph showing the expression of molecules involved in retrotranslocation according to treatment with sorafenib alone or PACMA 31 in ER stress network. FIG.
FIG. 17A is a photograph showing the tumor growth inhibition of Hep3B xenografted mice in vivo in combination with PACMA 31 and sorafenib, which shows the change in tumor volume.
FIG. 17B is a photograph showing a tumor incision in which the combination treatment of PACMA 31 and sorapenib was observed to inhibit tumor growth of Hep3B xenografted mice in vivo.
18A is a graph showing survival by PDI expression according to progress time.
FIG. 18B is a graph showing the overall survival by PDI expression. FIG.

용어의 정의:Definition of Terms:

본 문서에서 사용되는 용어 "소라페닙(sorafenib)"은 표적치료제로 VEGFR, PDGFR, Raf 같은 키나아제(kinase) 단백질의 활성을 막는 키나아제 저해제를 말한다. 바이엘(Bayer)과 오닉스(Onyx Pharmaceuticals)가 개발한 신장암과 간암 치료제로 미국 FDA의 승인을 받은 항암제다(일반명 Sorafenib; 상품명 Nexavar, 넥사바). As used herein, the term " sorafenib " refers to a kinase inhibitor that inhibits the activity of kinase proteins such as VEGFR, PDGFR, and Raf as target therapeutics. Bayer and Onyx Pharmaceuticals have developed the FDA-approved anticancer drug (generic name Sorafenib; Nexavar, Nexavar) for the treatment of kidney cancer and liver cancer.

본 문서에서 사용되는 용어 "단백질 이황화물 이성질화효소(PDI)"는 티올-2황화물 교환반응을 촉매하는 효소로 단백질분자내의 이황화물 결합(disulfide bond)의 재형성을 촉진한다. 소포체(ER)에 존재하며 분비단백질의 이황화물 결합의 형성으로 단백질 폴딩에 관여하는 것으로 알려져 있다. As used herein, the term " protein disulfide isomerase (PDI) " is an enzyme that catalyzes the thiol-2 sulphide exchange reaction and promotes the reshaping of disulfide bonds in protein molecules. It is known to be involved in protein folding by the formation of disulfide bonds of secretory proteins present in the endoplasmic reticulum (ER).

발명의 상세한 설명:DETAILED DESCRIPTION OF THE INVENTION [

본 발명의 일 관점에 따르면, 소라페닙 및 단백질 이황화 이성질화 효소(PDI) 억제제를 포함하는, 소라페닙 저항성 암 치료제가 제공된다.According to one aspect of the present invention, there is provided a therapeutic agent for sorafenib resistant cancer, which comprises sorapenib and a protein disulfide isomerase (PDI) inhibitor.

상기 소라페닙 저항성 암 치료제에 있어서, 상기 단백질 이황화 이성질화 효소(PDI) 억제제는 PACMA 31, RB-11-ca, P1(phenyl vinyl sulfonate), 아데난틴(adenanthin), Juniferdin, NEM, Acrolein, Thiomuscimol, cystamine, 35G8, CCF642, LOC14, 16F16, 아오도아세트아마이드(iodoacetamide), 하이퍼로사이드, 이소퀘르세틴, 퀘르세틴-3-글루쿠로나이드, 다티신, 퀘르세틴-3-루티노사이드, 시큐리닌(securinine), 항-PDI 항체 또는 그의 기능성 단편일 수 있다(Flaumenhaft et al., Arterioscler Thromb Vasc Biol 35(1): 16-23, 2015(RB-11-ca, P1, adenanthin, Juniferdin); Xu et al., Drug Discov Today 19(1): 222-240, 2014 (NEM, Acrolein, Thiomuscimol, cystamine); Vatolin et al., Cancer Res. 76(11): 3340-3350, 2016 (CCF642); Jasuja et al., J. Clin. Invest. 122(6): 2104-2113, 2012 (하이퍼로사이드 내지 quersetin-3-rutinoside); Kaplan and Stockwell, ACS Med. Chem. Lett., 6: 966-971, 2015 (securinine)). (PDI) inhibitor is selected from the group consisting of PACMA 31, RB-11-ca, P1 (phenyl vinyl sulfonate), adenanthin, Juniferdin, NEM, Acrolein, Thiomuscimol, cystamine, 35G8, CCF642, LOC14, 16F16, iodoacetamide, hypercholesterol, isoquercetin, quercetin-3-glucuronide, dacytin, quercetin-3-rutinoside, securinine, , Anti-PDI antibodies or functional fragments thereof (Flaumenhaft et al., Arterioscler Thromb Vasc Biol 35 (1): 16-23, 2015 (RB-11-ca, P1, adenanthin, Juniferdin); Xu et al. , Drug Discov Today 19 (1): 222-240, 2014 (NEM, Acrolein, Thiomuscimol, cystamine); Vatolin et al ., Cancer Res. 76 (11): 3340-3350, 2016 (CCF642); Jasuja et al. , J. Clin. Invest. 122 (6): 2104-2113, 2012 (quercetin-3-rutinoside); Kaplan and Stockwell, ACS Med. Chem. Lett., 6: 966-971, 2015 )).

상기 소라페닙 저항성 암 치료제에 있어서, 상기 암은 간세포암(HCC)일 수 있고 진행성 갑상선암(thyroid cancer) 또는 신장암(RCC)일 수 있으며 상기 간세포 암종은 진행성 간암 또는 원발성 간암일 수 있다. In the case of the treatment with sorafenib resistant cancer, the cancer may be hepatocellular carcinoma (HCC), progressive thyroid cancer or renal cancer (RCC), and the hepatocellular carcinoma may be advanced liver cancer or primary liver cancer.

상기 암의 치료방법에 있어서, 상기 투여는 경구 투여 또는 정맥내 주입, 경동맥 색전술(transarterial chemoembolization), 피하주입, 근육내 주입, 뇌실내 주입(intracerebroventricular injection), 뇌척수액내 주입(intracerebrospinal fluid injection), 근육내 주입 및 경피흡수로 구성되는 군으로부터 선택되는 비경구 투여일 수 있다. In the method of treating cancer, the administration may be orally or intravenously, transarterial chemoembolization, subcutaneous injection, intracerebroventricular injection, intracerebrospinal fluid injection, muscle Intraperitoneal injection, transdermal absorption, and transdermal absorption.

상기 소라페닙 저항성 암 치료제의 스크리닝 방법에 있어서, 대조군과 비교하여 상기 기질의 환원 정도를 억제한 피검 화합물 또는 피검 천연물을 선별하는 단계를 추가로 포함할 수 있고 상기 피검 천연물은 미생물, 식물 또는 동물의 추출물일 수 있다.The method of screening for a therapeutic agent for sorafenib resistant cancer may further comprise the step of screening a test compound or a test natural substance suppressed in the degree of reduction of the substrate as compared with the control group and the test natural substance is a microorganism, Lt; / RTI >

본 발명의 다른 일 관점에 따르면, 피검 화합물 또는 피검 천연물을 PDI(protein disulfide isomerase) 및 상기 PDI의 기질과 반응시키는 단계; 상기 기질의 환원 정도를 측정하는 단계; 대조군과 비교하여 상기 기질의 환원 정도를 억제한 피검 화합물 또는 피검 천연물을 1차 선별하는 단계; 선별된 피검 화합물 또는 피검 천연물을 소라페닙 저항성을 나타내는 암세포에 소라페닙과 함께 처리하는 단계; 및 소라페닙 저항성을 감소시키는 피검 화합물 또는 피검 천연물을 2차 선별하는 단계를 포함하는 소라페닙 저항성 암 치료제의 스크리닝 방법이 제공된다.According to another aspect of the present invention, there is provided a method for screening a test compound, comprising: reacting a test compound or a test substance with a substrate of PDI (protein disulfide isomerase) and the PDI; Measuring the degree of reduction of the substrate; A step of firstly screening the test compound or the test natural substance inhibiting the degree of reduction of the substrate as compared with the control group; Treating the selected test compound or the tested natural substance with sorapenib in a cancer cell showing resistance to sorapenib; And a second step of screening a test compound or a natural product to be tested for reducing the resistance to sorafenib.

상기 소라페닙 저항성 암 치료제의 스크리닝을 위해 하기와 같은 상용 스크리닝 키트를 사용할 수 있다: PDI Inhibitor Screening Assay Kit(ab139480, Abcam), Protein Disulfide Isomerases(PDI) Inhibitor Screening Kit(Fluorometric, BioVision), PDI Inhibitor Screening Assay Kit(AssKit-0671, Creative BioMart), Protein Disulfide Isomerases(PDI) Inhibitor Screening Kit (K840-100-BV, BioCat). PDI Inhibitor Screening Assay Kit (ab139480, Abcam), Protein Disulfide Isomerases (PDI) Inhibitor Screening Kit (Fluorometric, BioVision), PDI Inhibitor Screening Kit Assay Kit (AssKit-0671, Creative BioMart), Protein Disulfide Isomerases (PDI) Inhibitor Screening Kit (K840-100-BV, BioCat).

본 발명의 약학적 조성물에서 상기 화합물의 유효량은 환자의 환부의 종류,적용부위, 처리회수, 처리시간, 제형, 환자의 상태, 보조제의 종류 등에 따라 변할수 있다. 사용량은 특별히 한정되지 않지만, 0.01 μg/kg/day 내지 10 mg/kg/day일일 수 있다. 상기 1일량은 1일에 1회, 또는 적당한 간격을 두고 하루에 2~3회에 나눠 투여해도 되고, 수일(數日) 간격으로 간헐(間歇)투여해도 된다.The effective amount of the compound in the pharmaceutical composition of the present invention may vary depending on the kind of the affected part of the patient, the application site, the number of treatment, the treatment time, the formulation, the condition of the patient, The amount to be used is not particularly limited, but may be 0.01 μg / kg / day to 10 mg / kg / day. The above-mentioned daily dose may be administered once a day or two or three times a day at appropriate intervals, or intermittently administered at intervals of several days.

본 발명의 약학적 조성물에서 상기 화합물은, 조성물 총 중량에 대하여 0.1-100 중량%로 함유될 수 있다. 본 발명의 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 또한, 약학적 조성물의 제조에는 고체 또는 액체의 제제용 첨가물을 사용할 수 있다. 제제용 첨가물은 유기 또는 무기 중 어느 것이어도 된다.In the pharmaceutical composition of the present invention, the compound may be contained in an amount of 0.1 to 100% by weight based on the total weight of the composition. The pharmaceutical compositions of the present invention may further comprise suitable carriers, excipients and diluents conventionally used in the manufacture of pharmaceutical compositions. In addition, solid pharmaceutical preparations or liquid pharmaceutical preparations can be used for the preparation of pharmaceutical compositions. The preparation additive may be either organic or inorganic.

부형제로서는 예를 들면 유당, 자당, 백당, 포도당, 옥수수 전분(cornstarch), 전분, 탈크, 소르비트, 결정 셀룰로오스, 덱스트린, 카올린, 탄산칼슘 및 이산화규소 등을 들 수 있다. 결합제로서는 예를 들면 폴리비닐알코올, 폴리비닐에테르, 에틸셀룰로오스, 메틸셀룰로오스, 아라비아고무, 트래거캔스(tragacanth),젤라틴, 셀락(shellac), 히드록시프로필셀룰로오스, 히드록시프로필메틸셀룰로오스, 구연산칼슘, 덱스트린 및 펙틴(pectin), 또는 나노입자 (nano-particle) 등을 들 수 있다. 활택제로서는 예를 들면 스테아린산마그네슘, 탈크, 폴리에틸렌글리콜, 실리카, 경화식물유 등을 들 수있다. 착색제로서는 통상 의약품에 첨가하는 것이 허가되어 있는 것이라면 모두 사용할 수 있다. 이들의 정제, 과립제에는 당의(糖衣), 젤라틴코팅, 기타 필요에 따라 적절히 코팅할 수 있다. 또한, 필요에 따라 방부제, 항산화제 등을 첨가할 수있다.Examples of excipients include lactose, sucrose, saccharose, glucose, cornstarch, starch, talc, sorbit, crystalline cellulose, dextrin, kaolin, calcium carbonate and silicon dioxide. Examples of the binder include polyvinyl alcohol, polyvinyl ether, ethylcellulose, methylcellulose, gum arabic, tragacanth, gelatin, shellac, hydroxypropylcellulose, hydroxypropylmethylcellulose, calcium citrate, Dextrin and pectin, or nano-particles. Examples of the lubricant include magnesium stearate, talc, polyethylene glycol, silica, and hydrogenated vegetable oil. Any coloring agent may be used as long as it is usually allowed to be added to pharmaceuticals. These tablets and granules can be suitably coated with sugar (sugar coating), gelatin coating, and others as required. If necessary, preservatives, antioxidants and the like may be added.

본 발명의 약학적 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며(예: 문헌 [Remington's Pharmaceutical Science, 최신판;Mack Publishing Company, Easton PA), 제제의 형태는 특별히 한정되는 것은 아니다. 이들 제형은 모든 제약 화학에 일반적으로 공지된 처방서인 문헌[Remington's Pharmaceutical Science, 15^th Edition, 1975, Mack Publishing Company, Easton, Pennsylvania 18042(Chapter 87: Blaug, Seymour)에 기술되어 있다. The pharmaceutical composition of the present invention can be prepared by any of the formulations conventionally produced in the art (for example, Remington's Pharmaceutical Science (latest edition; Mack Publishing Company, Easton PA), the form of the formulation is not particularly limited . These formulations are generally known prescription Seo literature ^{[Remington's Pharmaceutical Science, 15 th} Edition, 1975, Mack Publishing Company, Easton, Pennsylvania 18042 all Agency: is described in (Chapter 87 Blaug, Seymour).

본 발명의 약학적 조성물에서 상기 화합물은 경구 또는 비경구로 투여되는 것이 가능하며, 바람직하게는 비경구 투여로 정맥내 주입, 경동맥 색전술 (transarterial chemoembolization), 피하 주입, 뇌실내 주입(intracerebroventricular injection), 뇌척수액내 주입(intracerebrospinal fluid injection), 근육내 주입 및 복강 주입 등으로 투여할 수 있다. In the pharmaceutical composition of the present invention, the compound can be administered orally or parenterally. Preferably, the compound is administered parenterally by intravenous injection, transarterial chemoembolization, subcutaneous injection, intracerebroventricular injection, Intracerebrospinal fluid injection, intramuscular injection, and intraperitoneal injection.

본 발명자들은 소라페닙의 효능을 향상시킬 수 있는 새로운 치료 전략의 일환으로 소라페닙의 작용과 저항성 기작을 발견하기 위해 하기와 같은 시스템 접근법을 채택하였다. 첫째, 소라페닙에 반응하여 HCC 세포주의 mRNA 발현 변화를 분석하고 소포체(ER) 스트레스 경로가 소라페닙에 의해 유발된 세포사멸에 기여한다는 것을 추론하였다. 둘째, 상기 경로를 기반으로 네트워크 모델을 구축하고 소라페닙 치료시 항세포사멸 모듈(antiapoptotic modules) 및 세포사멸 촉진 모듈(apoptosis-promoting module)을 동정하였다. 그 후, 논리 다이어그램(logic diagram)과 계산모델을 기반으로 한 네트워크 커널 분석(network kernel analysis) 및 in silico 시뮬레이션을 사용하여, 단백질 이황화물 이성질화효소(PDI)가 소라페닙의 효능 향상을 위한 치료 표적이 될 수 있음을 발견하였다. 그 후, 소라페닙 및 PDI 억제제의 조합 치료(combinatorial treatment)가 시험 관내(in vitro) 및 생체 내(in vivo)에서 시너지 효과를 나타낸다는 것을 추가로 입증하였고 높은 PDI 발현은 소라페닙 치료에 대한 저조한 반응률 및 간세포 암종 환자군에서의 부정적 임상 결과와 관련이 있음을 확인함에 따라 본 발명을 완성하였다. We have adopted a system approach to discover the action and resistance mechanism of sorapenib as part of a new therapeutic strategy to improve the efficacy of sorapenib. First, we analyzed changes in mRNA expression of HCC cell lines in response to sorafenib and inferred that the ER stress pathway contributes to the apoptosis induced by sorafenib. Second, a network model was constructed based on the above pathway, and antiapoptotic modules and apoptosis-promoting modules were identified in the treatment of sorafenib. Then, using network kernel analysis and in silico simulation based on a logic diagram and a computational model, protein disulfide isomerase (PDI) was used for treatment of sorapenib efficacy improvement It can be a target. Thereafter, it was further demonstrated that combinatorial treatment of sorapenib and PDI inhibitor displayed synergistic effects both in vitro and in vivo , and high PDI expression was associated with poor efficacy for treatment with sorapenib Response rate and negative clinical outcome in patients with hepatocellular carcinoma.

이하, 실시예를 통하여 본 발명을 더 상세히 설명한다. 그러나 본 발명은 이하에서 개시되는 실시예에 한정되는 것이 아니라 서로 다른 다양한 형태로 구현될 수 있는 것으로, 이하의 실시예는 본 발명의 개시가 완전하도록 하며, 통상의 지식을 가진 자에게 발명의 범주를 완전하게 알려주기 위해 제공되는 것이다.Hereinafter, the present invention will be described in more detail by way of examples. It should be understood, however, that the invention is not limited to the disclosed embodiments, but may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, Is provided to fully inform the user.

실시예 1: HCC 세포주 및 시약Example 1: HCC cell line and reagent

본 발명에서 사용된 인간 간세포 암종(HCC) 세포주인 Hep3B, SNU475, SNU761, HepG2, 및 Huh7 세포는 10% 우태아 혈청 및 항생제(페니실린 100 units/mL, 스트렙토마이신 100 ㎍/mL, 및 0.25 μg/mL Fungizone; Life Technologies Corp., Carlsbad, CA)를 처리한 Dulbecco's modified Eagle's medium(WelGENE Inc., 경산시, 한국)에서 5% CO₂를 포함하는 37℃ 습기 대기환경 조건으로 배양하였다. 또한, 본 발명에 사용된 소라페닙 토실레이트(sorafenib tosylate)는 LC Laboratories(Woburn, MA)에서 구매하였고 DMSO, 탑시가르긴(thapsigargin) 및 propidium iodide(PI)은 Sigma-Aldrich (St Louis, MO), PACMA 31은 Tocris Bioscience(Bristol, UK) 및 보르테조밉(Bortezomib)은 Selleck Chemicals(MA)에서 구매하였다. The human hepatocellular carcinoma (HCC) cell lines Hep3B, SNU475, SNU761, HepG2 and Huh7 cells used in the present invention were cultured in RPMI 1640 supplemented with 10% fetal bovine serum and antibiotics (100 units / mL of penicillin, 100 μg / mL of streptomycin, were cultured in Dulbecco's modified Eagle's medium (WelGENE Inc., Gyeongsan-si, Korea) treated with 5% CO ₂ at 37 ° C in a humidified atmospheric environment. Sorapenib tosylate used in the present invention was purchased from LC Laboratories (Woburn, Mass.) And DMSO, thapsigargin and propidium iodide (PI) were purchased from Sigma-Aldrich (St Louis, MO) , PACMA 31 from Tocris Bioscience (Bristol, UK) and Bortezomib from Selleck Chemicals (MA).

실시예 2: 웨스턴 블랏 분석 Example 2: Western blot analysis

HCC 세포주인 SNU761 및 Huh7 세포에 소라페닙(0 내지 16 μM) 을 농도별로 24시간 동안 처리한 후 용해 완충액(20 mM HEPES[pH 7.2], 150 mM NaCl, 0.5% Triton X-100, 10% 글리세롤, 1 ㎍/mL aprotinin, 1 ㎍ leupeptin, 1 mM of Na₃VO₄, 및 1 mM NaF)에서 용해하였다. 이어서, 상기 세포 용해물(cell lysates)을 4℃에서 15분간 13,000 rpm의 조건으로 원심분리하였고 상기 생성된 상층액을 이용하여 SDS-PAGE 전기영동 및 웨스턴 블랏 분석을 수행하였으며 분석에 필요한 항체는 항-phospho-elF2a(eukaryotic initiation factor 2 alpha; Cell Signaling Technology, Danvers, MA), 항-PDI(Invitrogen, Carlsbad, CA), 및 항-actinin(Santa Cruz Biotechnology, Inc., Dallas, TX)를 사용하였고 토끼 다클론성 항-GAPDH(glyceraldehyde 3-phosphate dehydrogenase) 항체는 권기선 박사(한국생명공학연구원)로 부터 수득하였다. (20 mM HEPES [pH 7.2], 150 mM NaCl, 0.5% Triton X-100, 10% glycerol (10 mM), and the like) was treated with Sorapanib (0-16 μM) for 24 hours in HCC cell lines SNU761 and Huh7 cells , 1 μg / mL aprotinin, 1 μg leupeptin, 1 mM of Na ₃ VO ₄ , and 1 mM NaF). Then, the cell lysates were centrifuged at 13,000 rpm for 15 minutes at 4 ° C. SDS-PAGE electrophoresis and Western blot analysis were performed using the supernatant obtained above. (Invitrogen, Carlsbad, Calif.), and anti-actinin (Santa Cruz Biotechnology, Inc., Dallas, Tex.) were used Rabbit polyclonal anti-GAPDH (glyceraldehyde 3-phosphate dehydrogenase) antibodies were obtained from Dr. Kwon, Ki-Sun (Korea Research Institute of Bioscience and Biotechnology).

실시예 3: RT-PCR 및 qRT-PCR Example 3: RT-PCR and qRT-PCR

PCR 증폭을 위한 총 RNA는 RNA-spin(iNtRON, 대한민국)을 첨가한 배양 세포로 부터 추출하였고 RT kit(Solgent, 대한민국), 2X Taq Premix(Solgent) 및 프라이머(서열번호 1 내지 5)를 사용하여 RT-PCR을 수행하였다. 또한 qPCR 분석은 cDNA, 프라이머(서열번호 6 및 7) 및 SYBR Master Mix(Applied Biosystems)를 포함하는 20 μL 반응 볼륨으로 StepOnePlus(Applied Biosystems, Waltham, MA)를 이용하여 수행하였고 각 반응에서 GAPDH mRNA에 대한 데이터를 표준화하였다. 상기 프라이머를 포함하여 본 발명에서 사용한 프라이머 정보를 하기 표 1에 나타내었다. Total RNA for PCR amplification was extracted from cultured cells supplemented with RNA-spin (iNtRON, Korea) and analyzed using RT kit (Solgent, Korea), 2X Taq Premix (Solgent) and primers (SEQ ID NOS: 1 to 5) RT-PCR was performed. QPCR analysis was also performed using a StepOnePlus (Applied Biosystems, Waltham, MA) with a 20 μL reaction volume containing cDNA, primers (SEQ ID NOS: 6 and 7) and SYBR Master Mix (Applied Biosystems) and GAPDH mRNA . The primer information used in the present invention including the above primers is shown in Table 1 below.

프라이머primer 염기서열(5' --> 3')The base sequence (5 '-> 3') 서열번호SEQ ID NO: CHOP F-1CHOP F-1 TGT CAG CTG GGA GCT GGA AGCTGT CAG CTG GGA GCT GGA AGC 1One CHOP F-2CHOP F-2 ACT CTT GAC CCT GCTTCT CTGACT CTT GAC CCT GCTTCT CTG 22 CHOP RCHOP R ATT CGG TCA ATC AGA GCT CGGATT CGG TCA ATC AGA GCT CGG 33 b-actin Fb-actin F AGA GCT ACG AGC TGC CTG ACAGA GCT ACG AGC TGC CTG AC 44 b-actin Rb-actin R AGC ACT GTG TTG GCG TAC AGAGC ACT GTG TTG GCG TAC AG 55 GAPDH FGAPDH F CGC TCT CTG CTC CTC CTG TTCGC TCT CTG CTC CTC CTG TT 66 GAPDH RGAPDH R CCA TGG TGT CTG AGC GAT GTCCA TGG TGT CTG AGC GAT GT 77 XbaI FXbaI F TCCGTGTCTAGAATGCTGCGCCGCGCTCTGTCCGTGTCTAGAATGCTGCGCCGCGCTCTG 88 EcoRI REcoRI R TGGCTTGAATTCTTACAGTTCATCTTTCACAGTGGCTTGAATTCTTACAGTTCATCTTTCACAG 99

실시예 4: 플라스미드 구축, 바이러스 생산 및 감염 Example 4: Plasmid construction, virus production and infection

렌티바이러스(lentivirus) 생산을 위해, 제조사의 지침에 따라 Lipofectamine(Invitrogen)을 이용하여 HEK 293T 세포를 관련 렌티바이러스 플라스미 및 패키징 믹스(pLP1, pLP2, 및 pLP/VSVG)로 형질감염시켰고 과발현 실험을 위해, XbaI 사이트를 포함하는 정방향 프라이머(서열번호 8) 및 EcoRI 사이트를 포함하는 역방향 프라이머(서열번호 9)로 PCR 증폭하여 SNU761 세포부터 분리한 총 RNA로부터 PDI 총-길이 cDNA를 증폭하였다. 또한 PCR 단편은 XbaI 및 EcoRI로 절단한 후 pLentiM1.4 렌티바이러스 벡터로 결찰하여 시퀀싱으로 확인하였고 CHOP 넉다운을 위해 pLKO.1의 CHOP 표적 short hairpin RNA(shRNA)를 암호화하는 플라스미드(Sigma-Aldrich)를 사용하였다.For lentivirus production, HEK 293T cells were transfected with related lentiviral plasmids and packaging mixes (pLP1, pLP2, and pLP / VSVG) using Lipofectamine (Invitrogen) according to the manufacturer's instructions and overexpression experiments Length cDNA was amplified from total RNA isolated from SNU761 cells by PCR amplification with a forward primer (SEQ ID NO: 8) containing the Xba I site (SEQ ID NO: 8) and a reverse primer containing the Eco RI site (SEQ ID NO: 9). The PCR fragment was digested with Xba I and Eco RI, ligated with pLentiM1. 4 lentiviral vector and confirmed by sequencing. A plasmid (Sigma-Aldrich) encoding CHOP target short hairpin RNA (shRNA) of pLKO.1 for CHOP knockdown ) Was used.

실시예 5: mRNA 마이크로어레이 실험 및 분석Example 5: mRNA microarray experiment and analysis

본 발명의 소라페닙의 작용기전과 저항기전을 규명하기 위하여 소라페닙 처리 전과 후의 HCC 세포주(SNU475, SNU761, Huh7, Hep3B, 및 HepG2)의 전사 변이 분석을 수행하였다. Transcriptional mutation analysis of HCC cell lines (SNU475, SNU761, Huh7, Hep3B, and HepG2) before and after sorafenib treatment was performed to investigate the mechanism of action and resistance mechanism of sorafenib of the present invention.

구체적으로, 상기 HCC 세포주에 소라페닙(3 μM)을 24시간 동안 처리하고 대조군은 DMSO로 처리한 후, 하기와 같이 3회 반복하여 수행하였다. 총 RNA는 제조사의 지침에 따라 Trizol(Invitrogen Life Technologies, Carlsbad, CA)을 이용하여 추출하였고 RNeasy columns(Qiagen, Valencia, CA)를 이용하여 정제하였다. 또한 바오틴화 cRNA를 생산하기 위해 Ambion Illumina RNA amplification kit(Ambion, Austin, TX)를 사용하여 총 RNA를 증폭하여 정제하였고 표지된 cRNA 샘플(750 ng)도 제조사의 지침(Illumina, Inc., San Diego, CA)에 따라 58℃에서 16-18시간 동안 각 인간 HT-12 발현 v.4 비드 어레이에 혼성화하였다. 상기 어레이 신호의 검출은 비드 어레이 매뉴얼에 따라 Amersham fluorolink streptavidin-Cy3(GE Healthcare Bio-Sciences, Little Chalfont, UK)을 이용하여 수행하였고 Illumina 비드 어레이 판독기 공촛점 스캐너로 스캔하였다. 미가공 데이터(raw data)는 제조사(Illumina GenomeStudio v2011.1, Gene Expression Module v1.9.0)에서 제공한 소프트웨어를 사용하여 추출하였고 어레이 프로브(array probes)는 대수(logarithm)로 변환되고 변위치(quantile) 방법으로 정규화하였다. 한편, 발현 데이터의 통계적 유의성은 귀무가설(null hypothesis)이 두 그룹간에 차이가 없었던 배수 변화(fold change)와 LPE(local pooled error) 테스트를 사용하여 결정하였고 Benjamini-Hochberg 알고리즘을 사용하여 P 값을 조정 후 FDR(false discovery rate)을 제어하였다. 기본적으로, 선택적으로 발현된 유전자는 SNU761을 제외하고 조정된 P 값 < 0.05 및 절대 배수 변화 ≥ 1.5의 기준을 사용하여 수득하였다. 테스트한 첫 번째 세포주인 SNU761의 경우 각각 다른 날에 3회의 실험이 수행되었으므로 3가지 P 값의 기준을 충족시키는 유전자는 없었고 본 발명에서 후보 유전자를 선택하기 위해 배수 변화 기준 ≥ 1.7 만 적용하였다. 아울러 크게 변화하는 생물학적으로 관련된 유전자 세트를 확인하기 위해 MSigDB의 홀마크(hallmark) 유전자 세트를 이용한 유전자 목록 기능 강화 분석(gene list functional enrichment analysis) 및 유전자-세트 강화 분석(gene set enrichment analysis)은 ToppGene Suite(//toppgene.cchmc.org/) 및 GSEA 소프트웨어를 이용하여 수행하였고 선택적인 발현 유전자의 데이터 분석 및 시각화는 R 3.1.2(www.r-project.org)을 이용하였다. Specifically, the HCC cell line was treated with sorafenib (3 μM) for 24 hours, the control group treated with DMSO, and then repeated three times as follows. Total RNA was extracted using Trizol (Invitrogen Life Technologies, Carlsbad, Calif.) According to the manufacturer's instructions and purified using RNeasy columns (Qiagen, Valencia, Calif.). Total RNA was amplified and purified using Ambion Illumina RNA amplification kit (Ambion, Austin, Tex.) To produce baitinized cRNA. A labeled cRNA sample (750 ng) was also prepared by manufacturer's instructions (Illumina, Inc., San Diego , &Lt; / RTI > CA) at 58 占 폚 for 16-18 hours to each human HT-12 expressing v.4 bead array. Detection of the array signals was performed using Amersham fluorolink streptavidin-Cy3 (GE Healthcare Bio-Sciences, Little Chalfont, UK) according to the bead array manual and scanned with Illumina bead array reader confocal scanner. The raw data was extracted using software provided by the manufacturer (Illumina GenomeStudio v2011.1, Gene Expression Module v1.9.0) and the array probes were converted to logarithm and quantile, . On the other hand, the statistical significance of the expression data was determined using the null change (fold change) and local pooled error (LPE) tests, in which the null hypothesis was not different between the two groups. Using the Benjamini-Hochberg algorithm, After adjustment, the FDR (false discovery rate) was controlled. Basically, the selectively expressed gene was obtained using the standard of adjusted P value < 0.05 and absolute multiple variation > 1.5 except for SNU761. In the case of SNU761, which was the first cell line tested, three experiments were carried out on different days. Therefore, no gene satisfying the three P-value criteria was applied. Gene list functional enrichment analysis and gene set enrichment analysis using the hallmark gene set of MSigDB in order to identify a large set of biologically related genes were performed using ToppGene Suite (// toppgene.cchmc.org/) and GSEA software, and R 3.1.2 (www.r-project.org) was used for data analysis and visualization of selective expression genes.

그 결과, 소라페닙에 대한 민감도는 대체적으로 유사하게 나타났지만 SNU761과 Huh7 세포는 Hep3B와 HepG2 세포에 비해 소라페닙에 상대적인 내성을 나타내었다(도 1). 또한, 크게 변화하는 생물학적으로 관련된 유전자 세트를 확인하기 위해 유전자 목록 기능 강화 분석 및 유전자 세트 강화 분석을 수행한 결과, SNU761, Huh7 및 Hep3B 세포에서 UPR 유전자 세트가 유의하게 변화하였으나 HepG2에서는 그 정도가 낮게 나타났다. As a result, sensitivity to sorafenib was generally similar, but SNU761 and Huh7 cells showed resistance to sorapenib relative to Hep3B and HepG2 cells (Fig. 1). In addition, to confirm the biologically relevant gene sets that are changing significantly, we carried out gene cluster function enhancement analysis and gene set enhancement analysis. As a result, the UPR gene set was significantly changed in SNU761, Huh7 and Hep3B cells, appear.

상기 결과는 소라페닙이 HCC 세포주의 일부 군에서 세포사멸 또는 저항을 유발하는 단백독성 스트레스(proteotoxic stress)의 발생 가능성을 높힌다는 것을 시사한다. These results suggest that sorafenib increases the likelihood of developing proteotoxic stress causing apoptosis or resistance in some groups of HCC cell lines.

상기 가설을 확인하기 위해 UPR에서 중요한 단백질 키나아제 RNA-유사 소포체 키나아제(PERK) 축 활성화의 마커인 phospho-elF2a에 대한 웨스턴 블랏 분석을 수행한 결과, 소라페닙이 UPR을 유도하는 것으로 나타났고 ER 스트레스-유도 세포사멸 마커로 알려져 있는 CHOP(DNA-damage-inducible transcript 3)의 RT-PCR 수행 결과, ER 스트레스에 의해 유발된 세포사멸이 소라페닙에 의해 유도될 수 있음을 확인하였다(도 2a 내지 2e). 아울러, 상기 가설(hypothesis)을 확인하기 위해, scrambled shRNA 또는 CHOP shRNA를 발현하는 Hep3B 세포의 세포 생존력 분석을 수행한 결과, 소라페닙-유도 세포사멸은 대조군 세포에 비해 CHOP 넉다운 세포에서 감소한 것으로 나타났다(도 3). Western blot analysis of phospho-elF2a, a marker of protein kinase RNA-like ER kinase (PERK) axis activation, important in UPR to confirm this hypothesis, showed that sorafenib induces UPR, ER stress- RT-PCR of CHOP (DNA-damage-inducible transcript 3), known as an inducible cell death marker, confirmed that ER apoptosis-induced cell death could be induced by sorapenib (Figs. . In addition, to confirm the above hypothesis, the cell viability analysis of Hep3B cells expressing scrambled shRNA or CHOP shRNA showed that sorapenib-induced cell death was reduced in CHOP knockdown cells compared to control cells 3).

실시예 6: 경로-집중 유전자 발현 프로파일 Example 6: Pathway-directed gene expression profile

ER 스트레스 경로에 대한 소라페닙의 영향을 명확히 하고 소라페닙의 효능을 완화시키며 세포사멸에 대해 저항할 수 있는 분자를 확인하기 위해 본 발명자들은 ER 스트레스의 신호 네트워크 모델을 구축하였다(도 4). 상기 네트워크 모델은 세 부분으로 구성되는데 하나는 접히지 않거나(unfolded) 잘못 접혀진(misfolded) 단백질의 축적에 의해 활성화되는 UPR 신호 변환인자(signal transducer)로 구성된 UPR 부분이고 나머지는 단백질 재접힘 부분(protein refolding part)과 ERAD(ER-associated degradation) 부분으로, 이들은 잘못 접혀진 단백질을 다시 접히도록 하거나 분해하여 단백질 독성 스트레스를 완화시켜 세포생존을 유도한다.In order to clarify the effects of sorapenib on the ER stress pathway and to identify molecules that can alleviate the efficacy of sorapanib and resist cell death, we constructed a signal network model of ER stress (Figure 4). The network model consists of three parts: an UPR part consisting of a UPR signal transducer activated by the accumulation of unfolded and misfolded proteins, and the other part being a protein refolding part) and ERAD (ER-associated degradation), which induce cell survival by re-folding or degrading the misfolded protein to relieve protein toxic stress.

본 발명의 경로-집중 유전자 발현 프로파일은 96-웰 인간 미접힘단백질반응(UPR) PCR 어레이, RT2 프로파일러 PCR 어레이(PAHS-089Z, 인간 UPR RT2 Profiler PCR 어레이; Qiagen, Hilden, 독일)를 사용하여 수행하였다. 상기 어레이의 84웰(well)은 각 웰에서 단일 유전자에 대한 프라이머 및 PCR 반응을 위한 필요한 모든 성분을 포함하고 있다. 상기 유전자는 미접힘 단백질 결합(unfolded protein binding), ER 단백질 접힘 품질 조절(ER protein folding quality control), 콜레스테롤 대사 조절, 번역의 조절, ER-연관 분해(RE-associated degradation), 유비퀴틴화(ubiquitination), 전사 인자, 단백질 접힘, 단백질 이황화 이성질화(protein disulfide isomerization), 열 충격 단백질(heat shock proteins), 및 세포 사멸에 관여한다. 한편, ER 스트레스 네트워크에서 모듈의 84개 핵심 분자 발현 변화에 따른 소라페닙의 효과를 확인하기 위하여 SNU761 세포주에 대한 qRT-PCR 기반 어레이 분석 실험은 2 μM의 소라페닙 처리시 2회, 4 μM의 소라페닙 처리시 2회 또는 4회 수행하였다. 상기 실험을 위해 희석된 cDNA 주형은 제조사의 지침에 따라 RT2 SYBR 그린 마스터 믹스(Qiagen)와 혼합하고 96-웰 어레이 플레이트 상에 로딩하였다. qPCR 분석은 QuantStudio 5(Applied Biosystems)를 이용하여 플레이트를 95℃에 10분 동안 가열하고 이어서 95℃에서 15초 및 60℃에서 1분의 조건으로 40 사이클로 수행하였고 모든 데이터는 모든 플레이트를 통해 하우스키핑 유전자(hypoxanthine phosphoribosyltransferase 1; beta-2-microglobulin, ribosomal protein, large, P0(RPLP0); GAPDH; 및 b-actin)에 대해 표준화하였다.The pathway-directed gene expression profiles of the present invention were generated using a 96-well human unfolded protein reaction (UPR) PCR array, an RT2 profiler PCR array (PAHS-089Z, human UPR RT2 Profiler PCR array; Qiagen, Hilden, Germany) Respectively. 84 wells of the array contain primers for a single gene and all necessary components for PCR reactions in each well. These genes are unfolded protein binding, ER protein folding quality control, cholesterol metabolism regulation, regulation of translation, RE-associated degradation, ubiquitination, , Transcription factors, protein folding, protein disulfide isomerization, heat shock proteins, and apoptosis. On the other hand, in order to confirm the effect of sorafenib on the 84 core expression changes of the module in the ER stress network, the qRT-PCR-based array assay for SNU761 cell line was performed twice with 2 μM sorapanib, Fenip treatment was performed twice or four times. For this experiment, the diluted cDNA template was mixed with RT2 SYBR Green Master Mix (Qiagen) according to the manufacturer's instructions and loaded onto a 96-well array plate. qPCR analysis was carried out using QuantStudio 5 (Applied Biosystems) for 10 minutes at 95 ° C for 10 minutes, followed by 40 cycles of 95 ° C for 15 seconds and 60 ° C for 1 minute, and all data were analyzed by Housekeeping (RAPPO), GAPDH (b-actin), and beta-2-microglobulin (ribosomal protein)

그 결과, 소라페닙을 처리했을 때 상기 84개의 핵심 분자 중 37개의 분자가 유의하게 상향조절 되었으나 어느 것도 하향조절 되지는 않았다(표 2). 상기 변경 사항이 네트워크 모델에 표시되면 UPR 및 ERAD 부분이 모두 활성화되는 것을 확인하였고(도 4). 또한, ER 단백질 폴딩 및 유비퀴틴-프로테아좀 경로에 대한 분자가 상향조절되어 소라페닙의 세포사멸 효과에 저항성을 나타내었다(도 5a 내지 5e). 또한, 상기 현상이 다른 세포주에서 발생하는지 시험하기 위해, 동일한 실험을 HepG2 및 Huh7 세포주에서 수행한 결과, UPR은 HepG2 세포주에서 분명하게 나타나지 않았으나(도 6a 내지 6e) Huh7 세포주는 qRT-PCR 분석에서 SNU761 세포주와 유사한 반응을 나타내었다(도 7a 내지 7f). 상기 결과는 세포 컨텍스트(cellular contexts)에 따라 ER 스트레스가 유도됨을 시사한다. 소라페닙 처리에 따른 상기 84개 핵심 분자의 qRT-PCR 실험 결과를 하기 표 2에 나타내었다. As a result, 37 of the 84 core molecules were significantly up-regulated when treated with sorapenib, but none were down-regulated (Table 2). When the change is displayed on the network model, the UPR and ERAD portions are all activated (FIG. 4). In addition, the ER protein folding and molecules for the ubiquitin-proteasome pathway were upregulated and resistant to the apoptotic effects of sorapenib (Figures 5a-5e). In order to test whether the above phenomenon occurred in other cell lines, the same experiment was carried out in HepG2 and Huh7 cell lines. As a result, UPR was not apparent in HepG2 cell line (Fig. 6a to 6e), but Huh7 cell line was SNU761 (Fig. 7 (a) to (f)). The results suggest that ER stress is induced according to cellular contexts. The results of qRT-PCR of the 84 core molecules following sorapenib treatment are shown in Table 2 below.

모듈
module
유전자 리스트
Gene list
선택적으로 발현하는 유전자Selectively expressing genes (대조군 vs 소라페닙)(Control vs sorafenib) 소라페닙 처리군에서 상향조절됨(P<0.05)Uptake in sorafenib treated group ( P < 0.05) 소라페닙 처리군에서 하향조절됨(P<0.05)Down regulated in sorafenib treated group ( P < 0.05) UPR 신호 변환기UPR signal converter ATF4, ATF6, ATF6B, ERN1 (IRE1a), ERN2 (IRE1b), EIF2A, EIF2AK3 (PERK),
XBP1, PPP1R15A (GADD34)ATF4, ATF6, ATF6B, ERN1 (IRE1a), ERN2 (IRE1b), EIF2A, EIF2AK3 (PERK)
XBP1, PPP1R15A (GADD34) ATF4, ATF6, ATF6B, ERN1(IRE1a), EIF2AK3 (PERK)ATF4, ATF6, ATF6B, ERN1 (IRE1a), EIF2AK3 (PERK) NoneNone 세포사멸Cell death BAX, MANF, DDIT3 (CHOP), HTRA2, HTRA4, CEBPB, CREB3, CREB3L3,
MAPK10, MAPK8, MAPK9BAX, MANF, DDIT3 (CHOP), HTRA2, HTRA4, CEBPB, CREB3, CREB3L3,
MAPK10, MAPK8, MAPK9 BAX, DDIT3 (CHOP), CREB3BAX, DDIT3 (CHOP), CREB3 NoneNone ER 단백질 폴딩 및 품질 조절ER protein folding and quality control CALR, CANX, CCT4, CCT7, DNAJB2, DNAJB9, DNAJC10, DNAJC3, DNAJC4, EDEM1, EDEM3, ERO1L, ERO1LB,
ERP44 (PDIA10), HSPA1B, HSPA1L, HSPA2, HSPA4, HSPA4L, HSPA5, HSPH1, NUCB1, PDIA3, PFDN2,
PFDN5, PPIA, RPN1, SERP1, SIL1, TCP1, TOR1ACALR, CANX, CCT4, CCT7, DNAJB2, DNAJB9, DNAJC10, DNAJC3, DNAJC4, EDEM1, EDEM3, ERO1L, ERO1LB,
HSPA1L, HSPA1B, HSPA1L, HSPA2, HSPA4, HSPA4L, HSPA5, HSPH1, NUCB1, PDIA3, PFDN2,
PFDN5, PPIA, RPN1, SERP1, SIL1, TCP1, TOR1A CANX, DNAJC10, DNAJC4,
ERP44 (PDIA10), EDEM1,
PFDN2, PFDN5, PPIA, SERP1,
TOR1ACANX, DNAJC10, DNAJC4,
ERP44 (PDIA10), EDEM1,
PFDN2, PFDN5, PPIA, SERP1,
TOR1A NoneNone 당단백질 처리 Glycoprotein treatment GANAB, GANC, PRKCSH, UGGT1, UGGT2GANAB, GANC, PRKCSH, UGGT1, UGGT2 GANAB, UGGT1GANAB, UGGT1 NoneNone UbiquitinationUbiquitination AMFR, ATXN3, FBXO6, HERPUD1, RNF139, RNF5, SEC62, SEL1L, SYVN1,
UBE2G2, UBE2J2, UBXN4, UFD1L, USP14, VCPAMFR, ATXN3, FBXO6, HERPUD1, RNF139, RNF5, SEC62, SEL1L, SYVN1,
UBE2G2, UBE2J2, UBXN4, UFD1L, USP14, VCP AMFR, FBXO6, HERPUD1,
RNF5, SEL1L, SYVN1,
UBE2J2, UBXN4, USP14AMFR, FBXO6, HERPUD1,
RNF5, SEL1L, SYVN1,
UBE2J2, UBXN4, USP14 NoneNone 콜레스테롤 대사 조절Cholesterol metabolism regulation INSIG1, INSIG2, MBTPS1, MBTPS2, SCAP, SREBF1, SREBF2INSIG1, INSIG2, MBTPS1, MBTPS2, SCAP, SREBF1, SREBF2 INSIG1, INSIG2, SREBF2INSIG1, INSIG2, SREBF2 NoneNone

실시예 7: 네트워크 커널 분석 Example 7: Network kernel analysis

소라페닙과 병용 요법의 후보 물질을 동정하기 위해 첫째로 네트워크의 입출력 동역학(input-output dynamics)과 위상학적 측면(topological aspects)을 보존하면서 네트워크 동역학(network dynamics)에 대한 필수 노드(essential nodes)를 명료화하고 생물학적 네트워크를 보다 작게 압축하는 커널 식별 알고리즘(kernel identification algorithm)을 채택하였다. 상기 알고리즘은 회귀적으로 추가 대체할 수 없을 때까지 오리지널 네트워크로 같은 동력으로 더 작은 네트워크를 가진 각 노드의 이웃 서브 네트워크를 대체하는데 필수 유전자, 질병-관련 유전자 및 약물 표적은 감소된 커널 네트워크에서 증가하는 것으로 알려져 있다.In order to identify candidates for combination therapy with sorapenib, we first need to maintain the input-output dynamics and topological aspects of the network and identify the essential nodes for network dynamics And adopted a kernel identification algorithm that clarifies and compresses the biological network to a smaller extent. The algorithm can be used to replace the neighboring subnetworks of each node with smaller networks with the same power to the original network until it can not be further regressively replicated. Essential genes, disease-related genes and drug targets increase in the reduced kernel network .

한편, 입력세트(input set)는 20개의 노드와 34개의 링크로 구성된 ER 스트레스 경로 네트워크로(도 8) 상기 커널 식별 알고리즘에 의해 6개의 노드와 10개의 링크가 있는 소규모 네트워크로 압축하였다(도 9). 상기 압축된 네트워크에서 열 충격 단백질(HSP) 및 PDI는 세포사멸에 대한 중요한 노드로 밝혀졌다. HSP는 하나의 억제제에 의해 완전히 차단될 수 없는 여러 분자의 계열이기 때문에 PDI 억제제는 광범위한 PDI 계열의 효소 활성을 저해할 수 있으므로 PDI는 표적 분자의 최우선 순위로 사용된다.On the other hand, the input set is compressed into an ER stress path network consisting of 20 nodes and 34 links (Fig. 8) into a small network with 6 nodes and 10 links by the kernel identification algorithm (Fig. 9 ). In the compressed network, heat shock protein (HSP) and PDI were found to be important nodes for apoptosis. Because HSP is a family of molecules that can not be completely blocked by an inhibitor, PDI inhibitors can inhibit the activity of a wide range of PDI enzymes, so PDI is used as a top priority for target molecules.

실시예 8: 논리도 및 ER 스트레스 경로의 컴퓨터 모델링 Example 8: Computer modeling of logic diagram and ER stress path

소라페닙과 억제제 조합 치료의 효과를 조사하기 위해 논리적 근사치(logical approximation)에 기반한 계산모델을 구축하였고 각 억제제(PDI 및 프로테오좀)의 효과를 시뮬레이션하였다(도 10a). ODE의 논리적 근사치에 의한 동적 활동(dynamic activities)을 설명하기 위해 단계 함수(h)를 적용하였으며 스텝 함수는 하기와 같이 정의하였다:To investigate the effectiveness of sorafenib and inhibitor combination therapies, a computational model based on logical approximation was constructed and the effect of each inhibitor (PDI and proteomic) was simulated (Fig. 10a). The step function (h) is applied to explain the dynamic activities by logical approximation of ODE and the step function is defined as follows:

상기 T는 노드 활성화에 대한 한계점(threshold)을 의미한다. T denotes a threshold for node activation.

상기 [MP], [RMP] 및 [UPS]는 잘못 접힌 단백질, 잘못 접힌 단백질의 재접힘 및 유비퀴틴-프로테아좀 시스템을 나타내며 각각 k₁, k₂, k₃, k₄, k₅, k₆, k₇, k₈, k₉, k₁₀, k₁₁, k₁₂, k₁₃, k₁₄, k₁₅ 및 k₁₆은 동역학 계수(kinetic parameters)를 나타내고, T₁ 및 T₂는 각 노드의 활성화 임계값을 나타내고 w₁, w₂, w₃, w₄, w₅, w₆, w₇, w₈, w₉, 및 w₁₀은 각 노드 활성화의 협력 가중치(cooperation weights)를 나타낸다. 또한, 시뮬레이션 결과를 위해, k₁ = 0.2, k₂ = 0.2, k₃ = 0.3, k₄ = 0.3, k₅ = 0.3, k₆ = 0.2, k₇ = 0.2, k₈ = 0.2, k₉ = 0.2, k₁₀ = 0.2, k₁₁ = 0.14, k₁₂ = 0.2, k₁₃ = 0.2, k₁₄ = 0.2, k₁₅ = 0.2, k₁₆ = 0.2, w₁ = 0.3, w₂ = 0.3, w₃ = 0.3, w₄ = 1.5, w₅ = 1, w₆ = 0.3, w₇ = 0.3, w₈ = 0.8, w₉ = 0.9, w₁₀ = 0.5, T₁ = 0, 및 T₂ = 0을 사용하였다. The [MP], [RMP] and [UPS] is incorrectly folded protein, incorrect refolding and ubiquitination of the folded protein-refers to proteasome system, k _1, k _2, k _3, respectively, k _4, k _5, k ₆ , activation of _{_{_{k 7, k 8, k 9}}} , k 10, k 11, k 12, k 13, k 14, k 15 and k ₁₆ represents a kinetic coefficient (kinetic parameters), T ₁ and T ₂ are each node And w ₁ , w ₂ , w ₃ , w ₄ , w ₅ , w ₆ , w ₇ , w ₈ , w ₉ , and w ₁₀ represent the cooperation weights of each node activation. Further, to the simulation _{_{results, k 1 = 0.2, k 2}} = 0.2, k 3 = 0.3, k 4 = 0.3, k 5 = 0.3, k 6 = 0.2, k 7 = 0.2, k 8 = 0.2, k 9 = _{0.2, k 10 = 0.2, k} 11 = 0.14, k 12 = 0.2, k 13 = 0.2, k 14 = 0.2, k 15 = 0.2, k 16 = 0.2, w 1 = 0.3, w 2 = 0.3, w 3 = 0.3, w ₄ = 1.5, w ₅ = 1, w ₆ = 0.3, w ₇ = 0.3, w ₈ = 0.8, w ₉ = 0.9, w ₁₀ = 0.5, T ₁ = 0 and T ₂ = 0 .

그 결과, PDI 억제는 프로테아좀 억제보다 훨씬 더 큰 상승 작용을 나타내었고(도 10b) 다양한 계수값으로 유사한 결과가 얻었다(도 11a 및 11b).As a result, the PDI inhibition showed much greater synergism than the proteasome inhibition (Fig. 10b) and similar results were obtained with various count values (Figs. 11a and 11b).

실시예 9: 세포 생존력 및 세포사멸 분석 Example 9: Cell viability and apoptosis assay

소라페닙과 병용 요법의 후보 물질을 동정하기 위한 두 번째 방법으로, 보르테조밉(bortezomib)과 같은 프로테아좀 억제제에 의한 프로테오좀(proteasome)의 억제가 단백독성 스트레스(proteotoxic stress)를 유발하고 소라페닙과의 상승효과를 나타내는 것으로 알려져 있으므로 프로테아좀 억제제의 효과 및 PDI 억제제의 효과 비교를 가상세포 시스템(in silico) 및 생체외(in vitro)에서 수행하였다. As a second method to identify candidates for combination therapy with sorapenib, inhibition of proteasomes by proteasome inhibitors such as bortezomib induces proteotoxic stress, Phenytoin, a comparison of the effects of proteasome inhibitors and PDI inhibitors was performed in a virtual cell system ( in silico ) and in vitro ( in vitro ).

구체적으로, 세포 생존력 분석(cell viability assay)을 위해 HCC 세포를 성장 배지에서 6×10³ 세포/웰의 농도로 96-웰 플레이트에 파종하였고 24시간 또는 48시간 동안 배양한 후 소라페닙(LC Laboratories, 4 μM), PACMA 31(Tocris Bioscience, 0.4 μM), 보르테조밉(0.1 - 0.2 μM)을 단독 또는 조합하여 표시된 농도를 첨가하였다. 그 후, 플레이트를 24시간 동안 배양한 후, 상대 세포 생존력을 측정하기 위해 WST-1 용액(Daeillab, 대한민국)을 세포에 30분 내지 2시간 동안 첨가한 후 xMark Microplate 흡광도 분광 광도계(Bio-Rad, Hercules, CA)를 사용하여 450 nm에서 흡광도를 측정하였다.Specifically, for cell viability assay, HCC cells were seeded in 96-well plates at a concentration of 6 × 10 ³ cells / well in growth medium and cultured for 24 hours or 48 hours. Then, the cells were treated with sorafenib , 4 μM), PACMA 31 (Tocris Bioscience, 0.4 μM), and bortezomib (0.1-0.2 μM) alone or in combination. Thereafter, the plate was incubated for 24 hours, and WST-1 solution (Daeillab, Korea) was added to the cells for 30 minutes to 2 hours to measure relative cell viability. The plate was incubated with a xMark Microplate absorbance spectrophotometer (Bio- Absorbance was measured at 450 nm using Hercules, CA.

또한 PI-기반의 세포사멸(apoptosis) 분석을 위해 제조사의 지침에 따라 IncuCyte Zoom(Essen Biosciences, Ann Arbor, MI)을 세포사멸 검출에 사용하였고 HCC 세포는 96-웰 플레이트에 파종한 후 24시간 동안 배양하였다. 그 후, 세포에 소라페닙(LC Laboratories, 4 μM) 및 PACMA 31(Tocris Bioscience, 0.4 μM) 단독또는 조합하여 24시간 동안 처리하였고 파종 후, 세포를 Incu-Cyte Zoom(Essen Bioscience)을 사용하여 영상화하였고 세포사멸 평가를 위해, IncuCyte ZOOM 분석 소프트웨어를 사용하여 각 시점에서 PI-표지된 세포의 평균 면적을 측정하였다. 또한, 이미지는 20× 대물렌즈로 웰당 3개 분리 영역으로부터 3시간 간격으로 캡처하였다. In addition, IncuCyte Zoom (Essen Biosciences, Ann Arbor, Mich.) Was used for cell death detection according to the manufacturer's instructions for PI-based apoptosis analysis. HCC cells were seeded in 96-well plates for 24 hours Lt; / RTI > Cells were then treated with sorafenib (LC Laboratories, 4 μM) and PACMA 31 (Tocris Bioscience, 0.4 μM) alone or in combination for 24 hours and after seeding cells were imaged using Incu-Cyte Zoom (Essen Bioscience) For the evaluation of apoptosis, the mean area of PI-labeled cells at each time point was measured using IncuCyte ZOOM analysis software. The images were also captured at 3 hour intervals from three separate areas per well with a 20x objective.

그 결과, 도 12a 및 12b와 같이, 생포 생존력에 있어서 보르테조밉이 소라페닙에 의한 약한 부가효과를 보인 반면에 PACMA 31는 상승효과(synergistic effects)를 나타내었다(도 13a 및 13b). As a result, as shown in FIGS. 12A and 12B, while bortezomib showed a weak additive effect by sorapenib in the viability of survival, PACMA 31 showed synergistic effects (FIGS. 13A and 13B).

실시예 10: ER 스트레스 네트워크의 병용처리 효과 Example 10: Effect of combined treatment of ER stress network

본 발명에서 구축한 ER 스트레스 네트워크에서의 PACMA 31 병용처리의 효과를 관찰하기 위하여 SNU761 세포의 ER 스트레스 네트워크에서 소라페닙 단독, 병용처리, 및 PACMA 31 단독 처리하고 84개의 핵심 분자에 대한 발현 변화를 나타내는qRT-PCR 기반 분석을 수행하였다.In order to observe the effect of PACMA 31 combination treatment in the ER stress network constructed in the present invention, sorafenib alone, combination treatment, and PACMA 31 alone treatment of 84 stress molecules in ER stress network of SNU761 cells qRT-PCR-based analysis was performed.

그 결과, 도 14에 나타난 바와 같이, 세포사멸을 증가시키는 분자는 병용처리군에서 상향조절된 반면에 X-box 결합 단백질(XBP1) 및 중뇌 성상 교세포-유래 신경 영양 인자(MANF)와 같은 항-세포사멸 분자는 대조군과 비교시에도 하향조절되었다(도 14a 및 14b). 또한, 단백질 폴딩과 ERAD에 관여하는 분자는 PDI의 활성화(ER degradation-enhancing alpha-mannosidase-like 1[EDEM1], endoplasmic oxidoreductin-1-like protein[ERO1L])에 관여하는 것을 제외하고는 소라페닙 실험군과 비교하여 병용처리군에서 하향조절되었으나 PACMA 31 단일처리군에서는 효과가 나타내지 않았다(도 14c 내지 14f). 상기 변화가 네트워크 모델에서 나타났을 때, ERAD 부분(오른쪽)과 단백질 리폴딩(중심)이 꺼져있는 반면 UPR 부분에서 세포사멸 경로가 활성화되었음을 발견하였다(도 15). 또한, HepG2의 경우, UPR은 소라페닙처리에 있어서 분명하지 않았지만(도 6), 다른 세포주와 마찬가지로 PACMA 31에서 상승적인 세포독성을 관찰하였다(도 13). 아울러, 소라페닙과 PACMA 31의 병용처리에 의해 c-Jun N 말단 키나아제(JNK) 및 CHOP가 유도되는 것으로 나타났다(도 16a 내지 16e). As a result, as shown in Fig. 14, the molecules that increase cell death were up-regulated in the combination treatment group, whereas the anti-angiogenic factors such as X-box binding protein (XBP1) and the midbrain astrocyte-derived neurotrophic factor (MANF) The apoptotic molecule was also down-regulated when compared to the control group (Figs. 14A and 14B). In addition, the molecules involved in protein folding and ERAD are involved in the activation of PDI (ER degradation-enhancing alpha-mannosidase-like 1 [EDEM1], endoplasmic oxidoreductin-1-like protein [ERO1L] , But the effect was not observed in the PACMA 31 monotherapy group (Figs. 14C to 14F). When the change appeared in the network model, we found that the ERAD part (right) and protein refolding (center) were turned off, whereas the apoptotic pathway was activated in the UPR part (Fig. 15). Also, in the case of HepG2, UPR was not evident in sorapenib treatment (Fig. 6), but synergistic cytotoxicity was observed in PACMA 31 as in other cell lines (Fig. 13). In addition, c-Jun N terminal kinase (JNK) and CHOP were induced by the combination treatment of sorapenib and PACMA 31 (Figs. 16A to 16E).

실시예 11: 실험동물 모델 Example 11: Experimental animal model

본 발명자들은 이종 이식 마우스 모델을 이용하여 소라페닙과 PDI 억제제의 병용처리 효과를 관찰하였다. 먼저, 실험동물 모델을 제조하기 위해, Hep3B 세포(1×10⁷/100 μL) 및 BD 매트리젤 100-μL 혼합물(총 200μL/머리)을 5주령 암컷 Balb/c 누드 마우스에 피하이식하였다. 그 후, 종양의 평균 부피가 200 mm³에 도달했을때 마우스를 무작위로 네 그룹으로 나누고(그룹당 n = 8), 비히클(0.5% carboxymethylcellulose sodium, 10 mL/kg) 또는 소라페닙(30 mg/kg, 경구) 및 PACMA 31(20 mg/kg, 복강 내)을 단독 또는 조합하여 1일 1회 4주간 투여하였다. 종양 부피는 2-3 일마다 L×W²/2(L, 길이; W, 너비)로 계산하였고 마우스는 12시간 명암 주기로 유지하였으며 표준 채식(standard chow)을 급이하였다. 본 발명의 모든 동물 실험은 서울대학교 병원의 기관 동물관리위원회(Institutional Animal Care and Committee)의 승인을 받아 수행하였다. The present inventors observed the effect of sorafenib and PDI inhibitor in combination treatment using a xenograft mouse model. First, experiments for the production of animal models, Hep3B cells ^{(1 × 10 7/100 μL} ) , and BD-mat rijel 100 μL mixture (a total of 200μL / head) was transplanted subcutaneously to 5-week-old female Balb / c nude mice. The mice were then randomly divided into four groups (n = 8 per group) when the average volume of the tumors reached 200 mm ³ and vehicle (0.5% carboxymethylcellulose sodium, 10 mL / kg) or sorafenib , Oral) and PACMA 31 (20 mg / kg, intraperitoneal) were administered alone or in combination for once a day for 4 weeks. Tumor volumes are each 2 to 3 L × W ^2/2; were calculated as (L, a length W, W) mouse was maintained 12 hours period was the contrast class a standard diet (standard chow). All animal experiments of the present invention were conducted with the approval of Institutional Animal Care and Committee of Seoul National University Hospital.

그 결과, 도 17a 및 17b와 같이, 병용처리군의 종양 부피가 대조군과 비교하여 현저하게 감소한 것으로 나타났다(분산의 양방향 반복 측정 분석, P <0.05).As a result, as shown in Figs. 17A and 17B, the tumor volume of the combination treatment group was significantly decreased (bi-directional repeated measurement analysis of dispersion, P < 0.05).

실시예 12: 면역조직화학검사 및 통계분석 Example 12: Immunohistochemical examination and statistical analysis

면역조직화학검사(IHC)를 위한 항-PDI 항체(clone RL90)는 Abcam (Cambridge, UK)로 부터 구매하였고 면역염색은 Ventana Optiview system(Roche Diagnositics, Mannheim, Germany)을 이용하여 수행하였다. 고 Aperio Scan-Scope CS2(Leica Biosystems, Nussloch, Germany)에 의해 슬라이드를 스캐닝하고 각 코어의 이미지 파일을 수득하였고 PDI 면역 반응은 Aperio Image Scope(Leica Biosystems)의 Positive Pixel Count 알고리즘으로 계산하였다. 또한, 케이스 당 2개 이상의 코어를 검사하였고 가장 높은 값은 대푯값(representative value)으로 사용하였다. 아울러 통계분석은 Mann-Whitney U 테스트 및 Kruskal-Wallis 테스트는 다른 그룹간의 차이점을 분석하기 위해 사용하였고 chi-square 테스트 및 Fisher's 정확성 테스트는 범주형 데이터를 위해 사용하였다. 또한, 예측 결과에 대한 최적의 차단값(cutoff value)을 정의하기 위해 검열된 생존 데이터에 대한 시간 의존 수신기-동작 특성(ROC) 곡선을 구축하였다. 최적의 컷오프 값은 감수성과 특이성의 최대 합이 있을 때 채택하였고 진행까지의 시간(TTP)은 소라페닙의 처리 첫날부터 PD까지 계산하였고 전체 생존율(OS)은 소라페닙의 시작일부터 사망 또는 마지막 접촉일까지 계산하였다. PDI에 대한 연구 및 면역양성(immunopositivity)에 참여할 당시의 전통적인 임상 인자(Conventional clinical factors)는 Kaplan-Meier 방법으로 결정된 생존에 영향을 미치는 변수를 분석하였고 log-rank test로 비교하였다. 아울러, 생존에 영향을 미치는 독립 변수를 확인하기 위하여 콕스 비례 위험(Cox proportional hazards) 모델을 사용하여 단계별로 다변량 분석(multivariate analysis)을 수행하였고 단변량 분석(univariate analysis)에 의한 결과와 유의한 관련이 있는 인자들이 상기 다변량 분석에 포함되었으며 모든 통계 분석은 SPSS 소프트웨어를 사용하여 수행하였고 0.05 미만의 P 값은 유의한 것으로 간주하였다. Anti-PDI antibody (clone RL90) for immunohistochemistry (IHC) was purchased from Abcam (Cambridge, UK) and immunostaining was performed using the Ventana Optiview system (Roche Diagnostics, Mannheim, Germany). The slides were scanned by Aperio Scan-Scope CS2 (Leica Biosystems, Nussloch, Germany) and image files of each core were obtained. PDI immune response was calculated by the Positive Pixel Count algorithm of Aperio Image Scope (Leica Biosystems). In addition, more than two cores per case were examined and the highest value was used as the representative value. The Mann-Whitney U test and the Kruskal-Wallis test were used to analyze the differences between the different groups, and the chi-square test and the Fisher's accuracy test were used for the categorical data. In addition, a time-dependent receiver-operation characteristic (ROC) curve for the censored survival data was constructed to define the optimal cutoff value for the prediction results. The optimal cut-off value was adopted when there was a maximum sum of susceptibility and specificity, and the time to progression (TTP) was calculated from the first day of treatment with sorapenib to PD. Overall survival (OS) Respectively. Conventional clinical factors at the time of participation in the study and immunopositivity of PDI were analyzed by log-rank test and the variables affecting survival determined by the Kaplan-Meier method were analyzed. In addition, multivariate analysis was performed using the Cox proportional hazards model to identify independent variables affecting survival, and significant correlations with results from univariate analysis Were included in the multivariate analysis and all statistical analyzes were performed using SPSS software. P values less than 0.05 were considered significant.

결론적으로, PDI가 소라페닙에 대한 유용한 예측 바이오 마커가 될 뿐만 아니라 소라페닙에 대한 내성을 극복하기 위한 복합 요법의 유망한 표적이 될 수 있음을 시사하므로 본 발명의 소라페닙 및 PDI 억제제의 병용 치료는 시험 관내 및 생체 내에서 시너지 효과를 나타내어 소라페닙의 효능을 향상시킬 수 있는 새로운 치료 전략으로 활용 가능하다.In conclusion, the combination therapy of sorafenib and PDI inhibitor of the present invention may be useful as a prospective biomarker for sorapenib as well as a promising candidate for combination therapies to overcome resistance to sorafenib Can be used as a new therapeutic strategy to enhance the efficacy of sorafenib by showing synergy in vitro and in vivo.

본 발명은 상술한 실시예 및 실험예를 참고로 설명되었으나 이는 예시적인 것에 불과하며, 당해 기술분야에서 통상의 지식을 가진 자라면 이로부터 다양한 변형 및 균등한 다른 실시예 및 실험예가 가능하다는 점을 이해할 것이다. 따라서 본 발명의 진정한 기술적 보호 범위는 첨부된 특허청구범위의 기술적 사상에 의하여 정해져야 할 것이다.While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. I will understand. Accordingly, the true scope of the present invention should be determined by the technical idea of the appended claims.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Sorafenib resistance cancer therapeutic agent <130> PD17-5552 <160> 9 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP F-1 <400> 1 tgtcagctgg gagctggaag c 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP F-2 <400> 2 actcttgacc ctgcttctct g 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP R <400> 3 attcggtcaa tcagagctcg g 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin F <400> 4 agagctacga gctgcctgac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin R <400> 5 agcactgtgt tggcgtacag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F <400> 6 cgctctctgc tcctcctgtt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R <400> 7 ccatggtgtc tgagcgatgt 20 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> XbaI F <400> 8 tccgtgtcta gaatgctgcg ccgcgctctg 30 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> EcoRI R <400> 9 tggcttgaat tcttacagtt catctttcac ag 32 <110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> Sorafenib resistance cancer therapeutic agent <130> PD17-5552 <160> 9 <170> Kopatentin 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP F-1 <400> 1 tgtcagctgg gagctggaag c 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP F-2 <400> 2 actcttgacc ctgcttctct g 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CHOP R <400> 3 attcggtcaa tcagagctcg g 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> B-actin F <400> 4 agagctacga gctgcctgac 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> b-actin R <400> 5 agcactgtgt tggcgtacag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH F <400> 6 cgctctctgc tcctcctgtt 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH R <400> 7 ccatggtgtc tgagcgatgt 20 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> XbaI F <400> 8 tccgtgtcta gaatgctgcg ccgcgctctg 30 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> EcoRI R <400> 9 tggcttgaat tcttacagtt catctttcac ag 32

Claims

A therapeutic agent for sorafenib resistant cancer comprising sorafenib and a protein disulfide isomerase (PDI) inhibitor.

The method according to claim 1,
The protein disulfide isomerase (PDI) inhibitor may be selected from the group consisting of PACMA 31, RB-11-ca, Phenyl phenyl sulfonate, adenanthin, Juniferdin, NEM, Acrolein, Thiomuscimol, cystamine, 35G8, CCF642, LOC14, 16F16 Quercetin-3-rutinoside, securinine or an anti-PDI antibody or a functional fragment thereof, for example, In, sorafenib resistant cancer treatment.

The method according to claim 1,
Wherein the cancer is hepatocellular carcinoma (HCC), advanced thyroid cancer, or renal cancer (RCC).

The method according to claim 1,
Wherein said hepatocellular carcinoma is advanced liver cancer or primary liver cancer.

A method of treating cancer, comprising administering to a subject suffering from cancer a therapeutically effective amount of a therapeutic agent for sorapenib resistant cancer according to any one of claims 1 to 4.

5. The method of claim 4,
The administration may be by oral or intravenous infusion, transarterial chemoembolization, subcutaneous infusion, intramuscular injection, intracerebroventricular injection, intracerebrospinal fluid injection, intramuscular injection and transdermal absorption Lt; RTI ID = 0.0 > parenteral < / RTI >

Reacting the test compound or the natural product with a substrate of PDI (protein disulfide isomerase) and the PDI; And
And measuring the degree of reduction of the substrate. &Lt; RTI ID = 0.0 > 11. < / RTI >

8. The method of claim 7,
Further comprising the step of selecting a test compound or a natural product to be tested in which the degree of reduction of the substrate is suppressed as compared with the control group.

9. The method according to claim 7 or 8,
Wherein the natural product to be tested is an extract of a microorganism, a plant or an animal.

Reacting the test compound or the natural product with a substrate of PDI (protein disulfide isomerase) and the PDI;
Measuring the degree of reduction of the substrate;
A step of firstly screening the test compound or the test natural substance inhibiting the degree of reduction of the substrate as compared with the control group;
Treating the selected plant compound or the natural product with sorapenib in a cancer cell exhibiting resistance to sorapenib; And
A second step of screening a test compound or a natural product to be tested for reducing the resistance to sorafenib.