KR20190041362A - Fc gamma receptor variant, MG2A45 - Google Patents

Abstract

The present invention relates to a polypeptide comprising an Fc-gamma receptor mutant. The Fc-gamma receptor mutant of the present invention is optimized by replacing a part of an amino acid sequence of an Fc-gamma receptor with a different amino acid sequence, so as to have an excellent selective binding ability to immunoglobulins, thereby being effectively useful for uses of increasing the in vivo half-life of drugs, detecting and purifying immunoglobulins, and inhibiting organ transplantation rejection or preventing or treating autoimmune diseases.

Description

Fc gamma receptor variant MG2A45 {Fc gamma receptor variant, MG2A45}

The present invention relates to Fc gamma receptor variants with enhanced binding to IgG antibodies.

Fc gamma receptors (FcγRI, FcγRIIa, FcγRIIb, and FcγRIIIa) expressed in human immune cells bind to the IgG antibody Fc region (lower hinge region and upper CH2 region), and among these Fc gamma receptors, It has the highest affinity, but its thermostability is not very good and its expression rate is low, making it difficult to develop for medical use or for industrial application.

On the other hand, FcγRIIa is a membrane protein expressed on various immune cells such as macrophages, monocytes, and neutrophils, and has a low affinity for IgG (K _D = ~ 10 ^{- 6} ). FcγRIIa binds to the upper part of the IgG antibody Fc region (lower hinge region and upper CH2 region) and activates the corresponding immune cells through an intracellular signaling mechanism.

If the Fc gamma receptor present in the extracellular region, which has a much higher affinity for IgG than the wild-type Fc gamma receptor present in the body, can be produced and injected, the autoantibody recognizing the autologous cell as the antigen can be injected into the immune cell surface (Fc gamma receptor), which is an autoantibody that accumulates in organs and recognizes autologous cells as external antigens and causes inflammation. have.

In addition, most protein drugs, except antibodies, generally have a short duration in the body and a half-life of more than 24 hours. Antibody IgG is characterized by the fact that it enters the cells randomly by pinocytosis and then is retained in the body for about 3 weeks by binding to FcRn in a weakly acidic pH condition, , And Fc gamma receptor can be developed as a fusion partner that increases the half-life of the protein drug by using the process of binding to the antibody IgG.

There is a steady increase in the demand for protein drugs with high specificity and low side effects in target diseases, and studies are being actively conducted worldwide to improve the efficacy and stability of protein drugs. In particular, the serum half-life of protein drugs plays a decisive role in the mechanism of action, side effects, therapeutic efficacy, production cost, and administration frequency of the protein. Therefore, the leading pharmaceutical companies and protein engineering leading research groups Studies to increase the half-life of protein drugs have been actively conducted.

Typically, technologies for modifying protein using polyethylene glycol (PEG) polymer or increasing the half-life of blood by fusing a target protein to antibody Fc or albumin are being used.

It is a biocompatible polymer, such as PEG, which reduces the degradation by proteolytic enzymes when it is conjugated to a specific site of a protein of interest or nonspecifically binding to various sites, decreases excretion in the kidney by increasing molecular weight, Can be increased. Since 1990, PEG-modified adenosine deaminase, developed by Enzon, was marketed with permission from the US FDA, more than 10 products have been commercially available for clinical use. Roche has commercialized Pegylated Interferon-α as a drug for the treatment of hepatitis C and PEGASYS. In Amgen, Filgrastim (Neupogen) was developed to treat leukopenia. kDa PEG-modified sustained-release formulation of Neulasta. However, when large amounts of protein are injected, the removal of PEG moiety is delayed in the body, and it is reported that long-term injection of PEG having a large molecular weight causes a side effect problem. The stability of blood is closely related to the molecular weight of PEG. It is not easy to produce PEG having a molecular weight of 40,000 Da or more. As the molecular weight increases, the reactivity with the protein is lowered and the yield is lowered. In addition, because PEG polymers are a mixture of polymers with various molecular weight distributions, PEG-conjugated protein therapeutics become heterogeneous and cause difficulties in production and quality control. Therefore, it is urgently required to develop new protein engineering technology which differentiates from polymer formula such as PEG in order to increase blood half-life of protein drug.

A variety of Fc-fusion protein drugs fused with antibody Fc have been developed to improve the half-life of protein drugs with pharmacological effects. The Fc fusion protein is fused to a therapeutic protein and expressed by binding to the FcRn receptor Mechanisms can be used. In 1998, a technique to link interferon-α and Fc fragments to peptide linkers was developed. In 2003, a fusion protein was developed that links human erythropoietin to Fc as a peptide linker. As a representative example, etanercept (Enbrel ^® ) is a TNF-α inhibitor, a major cytokine that causes arthritis. It is a protein drug that is fused with an immunoglobulin Fc fragment in the outer part of the TNF-α receptor. Currently, 10 Fc fusion proteins are licensed to the US FDA and used clinically. However, protein therapeutic agents with Fc intercept fused have a problem to overcome the cytotoxicity problem due to the immune cell activation function, which is an inherent function of Fc, and there is a disadvantage that the half-life is not remarkably increased by receptor-mediated clearance. In addition, since it has to be fused with an Fc fragment as a homodimer, it is always expressed in a dimer form, thereby changing the pharmacological activity of a target protein.

Studies have also been conducted to increase the serum half-life of a therapeutic protein of interest using albumin as a fusion partner as well as antibody Fc fragments at high concentrations in human serum. Human genome science, which has albumin fusion technology, is currently in clinical trials by fusing albumin to protein drugs such as human growth hormone and interferon. Because albumin is a large protein with a large molecular weight (molecular weight: 66.5 kDa), it has the potential to inhibit the activity of the target protein during fusion protein formation.

It is expected that the technique using the FcγR variant can greatly improve the half-life of blood by applying the FcγR variant discovered as a new approach which has not been attempted so far to various protein therapeutics and candidate drug candidates used in clinical practice. The FcγR mutant fusion, which has pharmacological efficacy but has a low half-life and short duration in the body, has also been found in the development of numerous peptide drugs that are difficult to be clinically applied. Therefore, by enabling long-term efficacy in drug target tissues, dosage and frequency can be drastically reduced, and the cost of drug development and the development of new drugs are expected to be greatly improved.

In addition, autoimmune disease is an autoimmune disease in which an antibody produced in the body recognizes an autologous cell and attacks an autologous cell that causes an immune response. The immune cells have an FcγRs capable of binding to the antibody, An immune response such as ADCC or ADCP occurs. Therefore, the soluble FcγRIIa binds to an antibody recognizing an autologous cell. Even if the autologous cell is recognized, it can be prevented from binding to the immune cell. Therefore, it can be developed as an autoimmune disease therapeutic agent. For this purpose, a drug that inhibits autoimmune disease using wild-type soluble FcγRIIb, which does not have high IgG affinity, is currently undergoing clinical phase 2 clinical trials in humans (Sondermann et al., Curr Opin Immunol , 2016).

It should be understood that the foregoing description of the background art is merely for the purpose of promoting an understanding of the background of the present invention and is not to be construed as adhering to the prior art already known to those skilled in the art.

The present inventors have sought to find an Fc gamma receptor variant capable of prolonging the blood half-life of a number of peptide drug treatments which are difficult to be clinically applied due to their low half-life and short duration in the body. As a result, the present invention has been completed by confirming an Fc gamma receptor whose IgG binding ability is remarkably extended as compared with the wild type by optimizing substitution of some amino acid sequences with other amino acid sequences.

It is therefore an object of the present invention to provide a polypeptide comprising an Fc gamma receptor variant.

It is another object of the present invention to provide a nucleic acid molecule encoding the polypeptide.

It is still another object of the present invention to provide a vector comprising the nucleic acid molecule.

It is still another object of the present invention to provide a host cell comprising the vector.

It is another object of the present invention to provide a composition comprising the polypeptide, nucleic acid molecule or vector.

It is another object of the present invention to provide a composition comprising the polypeptide or the nucleic acid molecule.

It is still another object of the present invention to provide a kit for detecting an Fc region of an IgG antibody or IgG antibody comprising the polypeptide.

It is still another object of the present invention to provide a protein or a peptide fused body in which the polypeptide is bound to a physiologically active protein or a physiologically active peptide.

It is another object of the present invention to provide a method for producing a polypeptide comprising an Fc gamma receptor mutant.

It is another object of the present invention to provide a method for confirming the presence of an IgG antibody or an Fc region of an IgG antibody contained in a sample.

It is yet another object of the present invention to provide a method for purifying an IgG antibody contained in a sample or an Fc region of an IgG antibody.

It is still another object of the present invention to provide a method for screening human Fc gamma receptor mutants having improved binding ability to an Fc region of an IgG antibody or an IgG antibody.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a polypeptide comprising an Fc gamma receptor variant.

The present inventors have sought to find an Fc gamma receptor variant capable of prolonging the blood half-life of a number of peptide drug treatments which are difficult to be clinically applied due to their low half-life and short duration in the body. As a result, an Fc gamma receptor having an IgG binding capacity remarkably extended as compared with the wild type was identified by optimizing substitution of some amino acid sequences with other amino acid sequences.

As used herein, the term " Fc gamma receptor variant " means that the polypeptide of the Fc gamma receptor is different from the wild type Fc gamma receptor. These differences include immunoglobulin binding capacity, differences in therapeutic potential, amino acid composition or solubility, and the like. Refers to a modification of one or more amino acid sequences in an Fc gamma receptor, preferably consisting of a natural or synthetic amino acid capable of binding to an immunoglobulin or its Fc region, Deleted or inserted.

 The immunoglobulin may be any one of IgG, IgE, IgA, IgM or IgD, preferably IgG. The immunoglobulin may be derived from any animal, including human, rat, mouse, cattle, sheep, goat and chicken, ostrich or camel, preferably human.

According to a preferred embodiment of the present invention, the Fc gamma receptor variants of the present invention have improved properties compared to the wild type Fc gamma receptor.

As used herein, the term " enhanced properties " means that desirable characteristics can be obtained over gamma Fc receptors of the wild type. This property may be achieved by increasing or enhancing the binding capacity to immunoglobulin or Fc, by binding to the Fc of an immunoglobulin to modulate or inhibit immune function, to increase the half-life in the serum of a polypeptide or protein used as a therapeutic agent, May be to detect or enhance the detection accuracy of the desired polypeptide or protein (e. G., Immunoglobulin).

As used herein, the term " change in binding ability to immunoglobulin " means that the Fc gamma receptor mutant of the present invention has an activity different from the immunoglobulin binding activity of the wild-type Fc gamma receptor. These include the ability of the receptor to bind to the immunoglobulin, that is, the ability of the receptor to bind to the immune complex, aggregate, dimer, or monomeric immunoglobulin when compared to the wild type Fc gamma receptor.

As used herein, the term " modification of one or more amino acids that affect binding ability to immunoglobulin " means that the region of the amino acid residue or amino acid residue involved in the binding of the immunoglobulin to the wild type Fc gamma receptor is altered in the Fc gamma receptor . The amino acid involved in the binding of immunoglobulin may function directly as a binding of immunoglobulin or may be generated indirectly by maintaining structural integrity of the receptor so that binding occurs. Such a change may be a result of substitution, deletion or insertion.

According to one embodiment of the present invention, the Fc gamma receptor mutant of the present invention has enhanced binding capacity to the Fc region of the IgG antibody or IgG antibody as compared to the wild type Fc gamma receptor. The mutated Fc gamma receptor mutant is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% More than 2 times, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times as much as wild type Fc gamma receptor , 20 times, or 30 times or more (Examples 2, 8, 10, 11, 13, 15 to 17, and 19).

According to a preferred embodiment of the present invention, the mutant has three times or more of the binding ability of the IgG antibody or the IgG antibody to the Fc region as compared with the wild-type Fc gamma receptor.

According to a preferred embodiment of the invention, the Fc receptor of the invention has the form of an isolated preparation, meaning that it is purified to the extent that other proteins and / or non-proteinaceous molecules have been removed.

The purity of the preparation is at least 40% or more, preferably 60% or more, more preferably 60% or more, more preferably 60% or more, and most preferably 60% or more, 75% or more, and even more preferably 85% or more.

The polypeptide comprising an Fc receptor of the invention may be attached to a cell membrane or support means, or may have a soluble form. When it is intended to be used as a pharmaceutical composition, the polypeptide is preferably soluble.

The polypeptide may be labeled with a reporter molecule that forms a detectable signal under appropriate conditions. Such reporter molecules include radio-nucleotides, chemiluminescent molecules, bioluminescent molecules, fluorescent molecules or enzymes. Among the commonly used enzymes, peroxidase, glucose oxidase,? -Galactosidase, and alkaline phosphatase, such as horseradish peroxidase, are among others.

Preferably, the Fc receptor variants of the invention include natural or artificial mutants, variants or derivatives of the amino acids of the wild-type Fc receptor. The wild-type Fc receptor that forms the basis of the mutant, variant or derivative may be of human or animal origin. Such animal species are preferably mammalian species such as mouse, rat, rabbit, cattle, sheep, camel or chlorine species.

Amino acid modifications, i.e., deletion, insertion or substitution, to produce the Fc receptor variants of the present invention are carried out by conventional means. When the Fc receptor variant is derived from a recombinant, the nucleic acid encoding the molecule may be introduced into the sequence of appropriate codes for insertion or substitution of one or more amino acids, or may be appropriately deleted in the coding sequence. When preparing a receptor molecule by de novo peptide synthesis, the desired amino acid sequence may be introduced.

According to a preferred embodiment of the present invention, the mutant is a modification of the 117th amino acid and the 159th amino acid in the sequence of wild-type Fc gamma receptor of SEQ ID NO: 43 or SEQ ID NO: 49.

According to a preferred embodiment of the present invention, the mutant is a variant of the 117th amino acid, the 119th amino acid and the 159th amino acid in the sequence of wild type Fc gamma receptor of SEQ ID NO: 43 or SEQ ID NO: 49 sequence; And additionally one or more amino acid modifications selected from the group consisting of 86th amino acid, 127th amino acid and 171th amino acid.

According to a preferred embodiment of the present invention, the mutant comprises a sequence in which the 117th amino acid in SEQ ID NO: 43 or SEQ ID NO: 49 is substituted with asparagine (N) and the 159th amino acid is replaced with glutamine (Q) Fc gamma receptor mutants.

According to a preferred embodiment of the present invention, the mutant further comprises, in addition to the 117th amino acid and the 159th amino acid substitution, the 55th amino acid, the 86th amino acid, the 119th amino acid, 127th amino acid, and 171th amino acid.

According to a preferred embodiment of the present invention, the mutant is selected from the group consisting of SEQ ID NO: 43 or SEQ ID NO: 49 in which the 86th amino acid is aspartic acid (D), the 117th amino acid is asparagine (N), the 119th amino acid is methionine (E) in which the 127th amino acid is substituted with leucine (L), the 159th amino acid is replaced with glutamine (Q), and the 171st amino acid is replaced with glutamic acid (E) will be.

According to a preferred embodiment of the present invention, in addition to the 117th amino acid and the 159th amino acid substitution in the 43th sequence or the 49th sequence of the sequence listing, the mutant further comprises an amino acid at position 55 in which histidine (H) (D), wherein the 119th amino acid is replaced by methionine (M) or valine (V), the 127th amino acid is leucine (L), and the 171th amino acid is replaced by glutamic acid (E) Or more amino acids are substituted.

According to a preferred embodiment of the present invention, the mutant comprises the sequence of SEQ ID NO: 44.

According to a preferred embodiment of the present invention, the mutant comprises the sequence of SEQ ID NO: 45.

According to a preferred embodiment of the present invention, the mutant comprises the sequence of SEQ ID NO: 46.

According to a preferred embodiment of the present invention, said variant comprises the sequence of SEQ ID NO: 47.

According to a preferred embodiment of the present invention, the mutant comprises the sequence of SEQ ID NO: 48.

According to a preferred embodiment of the present invention, said variant comprises the sequence of SEQ ID NO: 50.

The Fc gamma receptor mutants encompassed by the present invention include mutants of various kinds of Fc gamma receptors (Fc? RI, Fc? RIIa, Fc? RIIb, Fc? RIIa, etc.), preferably Fc gamma receptor IIa mutants or Fc gamma receptor IIb mutants.

According to another aspect of the present invention, there is provided a nucleic acid molecule encoding the polypeptide, a vector comprising the nucleic acid molecule, or a host cell comprising the vector.

According to another aspect of the present invention, the present invention provides a method for producing a polypeptide comprising an Fc gamma receptor variant comprising the steps of:

a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding said polypeptide; And

b) recovering the polypeptide expressed by said host cell.

The nucleic acid molecules of the present invention may be isolated or recombinant, and include DNA and RNA in single and double stranded form as well as corresponding complementary sequences. &Quot; Isolated nucleic acid " is a nucleic acid isolated from a peripheral genetic sequence present in the genome of an isolated nucleic acid, in the case of a nucleic acid isolated from a naturally occurring source. In the case of a nucleic acid that is enzymatically or chemically synthesized from a template, such as a PCR product, a cDNA molecule, or an oligonucleotide, the nucleic acid generated from such a procedure can be understood as an isolated nucleic acid molecule. The isolated nucleic acid molecule represents a nucleic acid molecule as a separate fragment or as a component of a larger nucleic acid construct. A nucleic acid is " operably linked " when placed in a functional relationship with another nucleic acid sequence. For example, the DNA of a full-length or secretory leader is operably linked to the DNA of the polypeptide when expressed as a preprotein in the form before secretion of the polypeptide, and the promoter or enhancer comprises a polypeptide sequence Or the ribosome binding site is operably linked to a coding sequence when it is placed to facilitate translation. Generally, " operably linked " means that the DNA sequences to be ligated are located adjacent to each other, and in the case of a secretory leader, it means that the DNA sequences are adjacent to each other in the same reading frame. However, the enhancer need not be located contiguously. Linking is accomplished by ligation at convenient restriction sites. If such sites are not present, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

As used herein, the term " vector " means a carrier capable of inserting a nucleic acid sequence for introduction into a cell capable of replicating a nucleic acid sequence. The nucleic acid sequence may be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids, and viruses (e.g., bacteriophage). Those skilled in the art can establish a vector by standard recombinant techniques (Maniatis, et al, Molecular Cloning , A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY, 1988; and Ausubel et al, In:.. Current Protocols in Molecular Biology , John, Wiley & Sons, Inc, NY, 1994).

As used herein, the term " expression vector " means a vector comprising a nucleic acid sequence encoding at least a portion of the gene product to be transcribed. In some cases, the RNA molecules are then translated into proteins, polypeptides, or peptides. The expression vector may contain various regulatory sequences. Vectors and expression vectors may also include nucleic acid sequences that provide another function, as well as regulatory sequences that regulate transcription and translation.

As used herein, the term " host cell " refers to any transgenic organism that includes eukaryotes and prokaryotes and is capable of replicating the vector or expressing the gene encoded by the vector. The host cell may be transfected or transformed by the vector, which means that the exogenous nucleic acid molecule is transferred or introduced into the host cell.

According to another aspect of the present invention, the present invention provides a method for identifying the presence of an IgG antibody or an Fc region of an IgG antibody contained in a sample comprising the steps of:

a) preparing a sample to be tested for the presence or absence of an Fc region of an IgG antibody or an IgG antibody;

b) mixing the polypeptides of claim 1 with each other and binding them to each other; And

c) confirming the presence of the Fc region of the IgG antibody or IgG antibody bound to the polypeptide.

According to another aspect of the present invention, the present invention provides a method of purifying an Fc region of an IgG antibody or an IgG antibody contained in a sample comprising the steps of:

a) mixing the polypeptides of claim 1 with a sample comprising an Fc region of an IgG antibody or an IgG antibody to bind to each other; And

b) purifying the Fc region of the IgG antibody or IgG antibody bound to the polypeptide.

As described above, since the Fc gamma receptor mutant of the present invention has an enhanced binding ability to the Fc region of the IgG antibody or the IgG antibody as compared with the wild-type Fc gamma receptor, the IgG antibody or the IgG antibody And can be usefully used for detecting the presence, detecting it, or refining it.

The isolation and purification of the polypeptides can be performed by any of several known techniques. But are not limited to, for example, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high performance liquid chromatography (HPLC), reverse phase high performance liquid chromatography, and production disk gel electrophoresis. Techniques for the isolation and purification of the polypeptides may require modification of the polypeptide by conventional methods. For example, a histidine tag can be added to a protein when a nickel column is purified. Other variations may result in higher or lower activity, permit higher protein production, or simplify purification of the protein. Other tags may also include flag-tags. These tags are preferably used in eukaryotic hosts.

As a method for purifying a polypeptide, ammonium sulfate precipitation method is included in a protein purification method through a change in solubility. This method is more specific than a general technique such as salting out. Ammonium sulfate is generally used because it has a high solubility and can accept a salt solution of high ionic strength. The solubility of the polypeptide depends on the ionic strength of the solution, and therefore varies with the salt concentration.

Since the solubility of the polypeptide is distinctly different at high ionic strengths, the salting out method is a very useful method to aid in the purification of certain polypeptides. The addition of cosmotropic ammonium sulfate precipitates impurities and polypeptides such as cell wall components from host cells as well as folding byproducts such as loose and abnormal folding types. The precipitation effect increases with increasing precipitation concentration, so that a high purity Fc receptor variant preparation material can be obtained while the Fc receptor variant is resistant to the same precipitation as in ammonium sulfate at high concentration.

The precipitated polypeptide is removed by centrifugation, and while the maximum amount of polypeptide contaminants still remains in the solution, the ammonium sulfate concentration increases to the value at which most of the polypeptide of interest precipitates. For the next purification step, the precipitated polypeptide of interest is recovered by centrifugation and dissolved in a fresh buffer.

According to another aspect of the present invention, the present invention provides a method of screening for an Fc gamma receptor variant having enhanced binding to the Fc region of an IgG antibody or an IgG antibody comprising the steps of:

a) constructing an Fc gamma receptor mutant library comprising the sequence of SEQ ID NO: 43 or SEQ ID NO: 49 in which the 117th amino acid is substituted with asparagine (N) and the 159th amino acid is replaced with glutamine (Q); And

b) selecting an Fc gamma receptor variant having enhanced binding capacity to the Fc region of the IgG antibody or IgG antibody compared to an Fc gamma receptor variant comprising only the substitution of the two amino acid sequences in the library.

According to another aspect of the present invention, the present invention provides a method of screening for an Fc gamma receptor variant having enhanced binding to the Fc region of an IgG antibody or an IgG antibody comprising the steps of:

a) the amino acid sequence of SEQ ID NO: 43 or SEQ ID NO: 49, wherein the 117th amino acid is substituted with asparagine (N) and the 159th amino acid is replaced with glutamine (Q) Constructing a Fc gamma receptor variant library comprising a substitution of one or more amino acids selected from the group consisting of the 171th amino acid; And

b) comparing Fc gamma receptor mutants having improved binding ability to the Fc region of the IgG antibody or IgG antibody compared to the Fc gamma receptor mutant containing only substitutions of the two amino acid sequences of the 117th and 159th in the library step.

In accordance with another aspect of the present invention, the present invention provides a method of screening Fc gamma receptor variants with enhanced binding capacity to the Fc region of an IgG antibody or IgG antibody comprising the steps of:

a) an Fc comprising a sequence in which the 117th amino acid in SEQ ID NO: 49 or SEQ ID NO: 49 is substituted with asparagine (N), the 119th amino acid is valine (V) and the 159th amino acid is replaced with glutamine (Q) Constructing a gamma receptor mutant library; And

b) a Fc gamma receptor variant having an improved binding capacity to the Fc region of the IgG antibody or IgG antibody as compared to the Fc gamma receptor mutant containing only substitutions of the three amino acid sequences of the 117th, 119th and 159th in the library ≪ / RTI >

By using the screening method of the present invention, an Fc gamma receptor mutant having an improved binding capacity to an Fc region of an IgG antibody or an IgG antibody can be advantageously selected as compared with an Fc gamma receptor mutant.

Variants selected by the screening method of the present invention may additionally comprise the following amino acid modifications: sequence 55 or amino acid 55, amino acid 86, amino acid 119, amino acid 127, And one or more amino acids selected from the group consisting of 171th amino acid.

 According to a preferred embodiment of the present invention, the 55th amino acid further comprises histidine (H), the 86th amino acid is aspartic acid (D), the 119th amino acid is methionine (M) or valine (V) Leucine (L), and one or more amino acids selected from the group in which the 171st amino acid is replaced with glutamic acid (E).

According to one embodiment of the present invention, the Fc gamma receptor mutants having improved binding capacity to the Fc region of the IgG antibody or IgG antibody were selected through the screening method (Examples 7 and 8).

The screening method of the present invention can use fluorescence labeled cell separation (FACS) screening or other automated flow cell analysis techniques. Devices for conducting flow cytometry analyzers are well known to those skilled in the art. Examples of such devices include FACSAria, FACS Star Plus, FACScan and FACSort instruments (Becton Dickinson, Foster City, CA), Epics C (Coulter Epics Division, Hialeah, FL), MOFLO (Cytomation, Colorado Springs, Colo. XDP (Beckman Coulter, Indianapolis, IN), and Bio-Rad S3 (Bio-Rad, Hercules, Calif.). Flow cytometry techniques generally involve the separation of cells or other particles in a liquid sample. Typically, the purpose of a flow cytometer is to analyze the discrete particles for one or more of their properties (e.g., the presence of a labeled ligand or other molecule). Particles are passed one by one by the sensor and are classified based on size, refraction, light scattering, opacity, roughness, shape, fluorescence and the like.

According to another aspect of the present invention, there is provided a composition comprising said polypeptide, nucleic acid molecule or vector.

According to a preferred embodiment of the present invention, the composition of the present invention is for detecting an IgG antibody contained in a sample or an Fc region of an IgG antibody.

As used herein, the term " sample " refers to a substance that is likely to comprise an IgG antibody or an Fc region of an IgG antibody. In addition, feces, cells, blood, plasma, serum, hair or urine which are separated naturally or artificially from the subject and separated from the body can be used.

As used herein, the term " subject " includes mammals such as humans, primates including chimpanzees, pets such as dogs and cats, livestock such as cows, horses, sheep, goats, It is interpreted as meaning.

The composition can also be included in a kit and can be used to detect IgG antibodies or IgG antibody Fc sites contained in a sample, quantify the amount of a subject's IgG antibody, or quantify the amount of IgG antibody in a patient (for example, an immunosuppressive, Or a change in immune status due to organ transplantation).

According to another aspect of the present invention, there is provided a protein or a peptide fused body in which the polypeptide is conjugated with a physiologically active protein or a physiologically active peptide.

The protein or peptide fused product according to the present invention is characterized in that a physiologically active protein or a physiologically active peptide is bound to the Fc gamma receptor mutant to increase the half-life of the body by maintaining persistence in the body.

As used herein, the term " fusion protein / fusion polypeptide " refers to a protein fusion having a novel molecular structure in which a protein having one or more physiological activities is bound to the N-terminal or C-terminal of an Fc gamma receptor mutant . &Quot; Peptide fusion " means a peptide fusion having a novel molecular structure in which a low molecular weight peptide having at least one physiological activity is bound to the N-terminal or C-terminal of an Fc gamma receptor mutant.

The physiologically active protein or physiologically active peptide may be directly or indirectly bound to an Fc gamma receptor mutant using a linker composed of an amino acid.

Preferably, the physiologically active protein or the physiologically active peptide and the Fc gamma receptor mutant are bound using a gene recombination technique. However, it is possible to use a cross-linking agent known in the art to bind the Fc gamma receptor mutant at the N-terminal, C- .

The physiologically active proteins may include hormones and their receptors, biological response modifiers and their receptors, cytokines and their receptors, enzymes, antisera, antibody fragments, and the like. Specifically, the physiologically active protein may be selected from the group consisting of human growth hormone (hGH), insulin, follicle-stimulating hormone (FSH), human chorionic gonadotropin, parathyroid hormone (PTH) (GPO), granulocyte macrophage colony stimulating factor (GM-CSF), interferon alpha, interferon beta, interferon gamma, interleukin (TNF), hBMP2 (human bone morphogenic protein 2), KGF (hematopoietic factor), vascular endothelial growth factor (VEGF), vascular endothelial growth factor keratinocyte growth factor, platelet-derived growth factor (PDGF), glucocerebrosidase,? -galactosidase A,? -L-iduronidase, The iduronate e-2-sulfatase, lactase, adenosine deaminase, butyrylcholinesterase, chitinase, glutamate decarboxylase, A lipase, a uricase, a platelet-activating factor acetylhydrolase, a neutral endopeptidase, an urokinase, a streptokinase, a myeloperase A myeloperoxidase, a superoxide dismutase, a botulinum toxin, a collagenase, hyaluronidase, L-asparaginase, a monoclonal antibody, a polyclonal antibody, scFv, Fab, Fab ', F (ab') 2 and Fd, and the like.

The physiologically active peptides include glucagon-like peptide-1 (GLP-1) and analogs thereof, exendins and analogs thereof, somatostatin and analogs thereof, luteinizing hormone-releasing hormone (LHRH) And antagonist, adrenocorticotropic hormone, growth hormone-releasing hormone, oxytocin, thymosin alpha-1, corticotropin-releasing factor but are not limited to, corticotropin-releasing factor, calcitonin, bivalirudin, vasopressin analogues, and fragments of bioactive proteins.

The peptide of the present invention can be usefully used to increase the half-life of other physiologically active proteins or peptides, and the half-life of the protein or peptide fused body can be increased by maintaining persistence in the body.

According to a preferred embodiment of the present invention, the composition of the present invention is a pharmaceutical composition for immunosuppression.

The pharmaceutical composition of the present invention comprises (a) a nucleic acid molecule encoding the polypeptide, or a vector comprising the nucleic acid molecule; And (b) a pharmaceutically acceptable carrier.

According to a preferred embodiment of the present invention, the composition of the present invention is a pharmaceutical composition for preventing or treating an organ transplantation reaction inhibition or an autoimmune disease.

The pharmaceutical composition of the present invention can be administered for human or animal use.

According to still another aspect of the present invention, there is provided a method of preventing or treating immune or organ transplantation inhibition or autoimmune disease comprising administering the pharmaceutical composition.

As used herein, the term " autoimmune disease " is used interchangeably with the term " autoimmune disorder " and refers to a cell, tissue, organ or organ Means the state of the object specified by the user. The term " inflammatory disease " is used interchangeably with the term " inflammatory disorder " and refers to conditions characterized by inflammation, preferably chronic inflammation. Autoimmune diseases may or may not be associated with inflammation. In addition, inflammation may or may not cause autoimmune disease.

Examples of autoimmune diseases that can be prevented or treated by the pharmaceutical compositions of the present invention include, but are not limited to, alopecia greata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal glands, Celiac sprue-dermatitis, atopic dermatitis, asthma, rhinitis, chronic sinusitis, autoimmune thrombocytopenia, autoimmune thrombocytopenia, schizophrenia, hemolytic anemia, autoimmune hepatitis, Chronic inflammatory dyslipidemic neuropathy, Churg-Strauss syndrome, scarring pheochromocytoma, CREST syndrome, cold agglutinin disease, Crohn's disease, dyspepsia, metachromatic complex cold globulinemia, fibromyalgia-fibrosis, glomerulonephritis, Graves disease, Guillain-Barré syndrome, Hashimoto thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, IgA neuritis, burning Wherein the disease is selected from the group consisting of chronic arthritis, rheumatoid arthritis, squamous cell carcinoma, squamous cell lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, Type I or immune-mediated diabetes mellitus, myasthenia gravis, Psoriatic arthritis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, lighter syndrome, rheumatoid arthritis, sarcoidosis, encephalopathy, rigidity, dysmenorrhea, hypertrophic scarring, But are not limited to, human syndrome, systemic lupus erythematosus, lupus erythematosus, polyarteritis nodosa, transient arteritis, giant cell arteritis, ulcerative colitis, uveitis, vitiligo and Wegener's granulomatosis.

The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and can be administered, for example, by intravenous injection, local injection, and intraperitoneal injection.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can readily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg / kg.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

The pharmaceutical composition of the present invention may be used alone, but may be used in combination with other conventional chemotherapy or biological therapies, and when such concurrent therapy is performed, the immune related disease can be more effectively treated .

The features and advantages of the present invention are summarized as follows:

(I) The present invention provides a polypeptide comprising an Fc gamma receptor mutant.

(Ii) In addition, the present invention provides a method for producing the polypeptide.

(Iii) The Fc gamma receptor mutant of the present invention can be obtained by optimizing the substitution of some amino acid sequences of the Fc gamma receptor with other amino acid sequences, so that the selective binding ability to the immunoglobulin is excellent and the half-life in the body is increased, the immunoglobulin is detected and purified, Inhibitory use, or prevention or treatment of autoimmune diseases.

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1 shows a schematic diagram of the construction of the FcγRIIa mutant library of the present invention.
Figure 2 shows the screening process for SH2A40 variants showing high affinity for human serum IgG.
Fig. 3 shows the result of confirming that FcγRIIa protein (32 kDa) was purified with high purity on SDS-PAGE.
FIG. 4 is a graph comparing the binding ability of SH2A40 to Fc with N-linked canonical glycosylation motif added to the wild type.
5 is a schematic diagram showing the process for obtaining purified SH2A40.
FIG. 6 shows the results of ELISA for the activity of SH2A40 digested after expression purification.
FIG. 7 is a schematic diagram of a process for preparing an FcγRIIa mutant library so that an N-linked canonical glycosylation motif is not formed.
FIG. 8 is a graph comparing the binding capacities of Fc variants (MG2A28 and MG2A45) selected using the constructed library and flow cytometry analyzer to Fc.
Fig. 9 shows the results of purifying the mutants.
FIG. 10 shows ELISA results for analyzing the binding ability to Fc of excavated mutants.
Figure 11 shows the results of measuring the K _D value of Fc gamma receptor mutants and rituximab via Biolayer interferometry.
12 is a graph comparing the affinities of Fc of mutants (MG2A28.1 and MG2A45.1) screened using the constructed library and flow cytometry analyzer to Fc.
Fig. 13 shows the results of purifying the mutants.
FIG. 14 shows ELISA results for analyzing the binding force to Fc of excavated mutants.
FIG. 15 shows the results of measuring the K _D value of Fc gamma receptor mutants and rituximab through iolayer interferometry.
FIG. 16 shows the results of ELISA analysis of binding capacity of Fc gamma receptor mutants to mouse serum IgG.
FIG. 17 shows the affinity comparison results of wild-type FcγRIIb and MG2A45.1 mutant-introduced FcγRIIb to human serum IgG-FITC.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Example 1. Fabrication of FcγRIIa mutant library

Based on the pMopac12-NlpA-FcγRIIa-FLAG vector, random mutagenesis of the FcγRIIa gene was performed using primers MJ # 160 and MJ # 161 so that a random mutation of about 0.2% occurred in FcγRIIa. Also, a focused insert was prepared using primers MJ # 160, MJ # 161, p788, p789, p790, p791, p792 and p793 to introduce various amino acids by introducing degenerate codon NNK at the binding site of FcγRIIa with IgG Fc (Table 1). The two insert designed restriction enzyme treated with Sfi I (New England Biolab) were ligation with the vector. Then Escherichia coli Jude1 ((F '[Tn 10 (Tet r) proAB + lacI q Δ (lacZ) M15] mcrA Δ (mrr - hsdRMS - mcrBC) φ80d lac ZΔM15 Δ lacX74 deoR recA1 araD139 ? ( intermediate leu ) 7697 galU galKrpsLendA1nupG ) to construct a large FcγRIIa mutant library (library size: 2.2x10 ⁹ ) (FIG. 1).

primer # sequence (5 '- > 3') P788 (SEQ ID No. 1) GCGGGGTTTGCAGCACCAGMNNMNNMNNAAGCACGGTCAGATGCACCG P789 (SEQ ID No. 2) CGGTGCATCTGACCGTGCTTNNKNNKNNKCTGGTGCTGCAAACCCCGC P790 (SEQ ID No. 3) Gt P791 (Sequence Listing 4) CTGCGTTGCCATAGCTGGAAAGATNNKNNKCTGNNKAAAGTGACCTTTTTTCAGAATGGCAAAAGC P792 (Sequence Listing 5 sequence) Gt P793 (SEQ ID NO: 6) GGTGAAAGTGACCTTTTTTCAGAATGGCAAANNKCAGAAANNKTCTNNKCTGGATCCGACCTTTAGCATTCCGC IIa_Fw_NdeI (SEQ ID No. 7) GCGGAATTC CATATG CAGGCTGCCCCACCGAAAG IIa_Rv_HindIII (SEQ ID No. 8) TAAGGG AAGCTT AATCACGCCCATCGGTGAGC MJ # 1 (SEQ ID NO: 9) CCA GGC TTT ACA CTT TAT GC MJ # 2 (SEQ ID NO: 10) CTG CCC ATG TTG ACG ATT G MJ # 112 (SEQ ID NO: 11) CAGCGGTTTATCTTTCCAGCTATGGC MJ # 113 (SEQ ID NO: 12) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 114 (SEQ ID NO: 13) GCCATAGCTGGAAAGATAAACCGCTGNNKGATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 115 (SEQ ID NO: 14) GCCATAGCTGGAAAGATAAACCGCTGNNKTTTGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 116 (Sequence Listing 15 sequence) GCCATAGCTGGAAAGATAAACCGCTGNNKCATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 117 (Sequence Listing 16 sequence) GCCATAGCTGGAAAGATAAACCGCTGNNKATTGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 118 (SEQ ID NO: 17 sequence) GCCATAGCTGGAAAGATAAACCGCTGNNKTATGTGNNKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 119 (SEQ ID NO: 18) GCCATAGCTGGAAAGATAAACCGCTGNNKNNGGTGNWKTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 120 (SEQ ID NO: 19) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGGCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 121 (Sequence Listing 20 sequence) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGGGCTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 122 (Sequence Listing 21 sequence) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGCCGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 123 (SEQ ID NO: 22) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGCGTTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 124 (SEQ ID NO: 23) GCCATAGCTGGAAAGATAAACCGCTGNNKNNKGTGTGGTTTTTTCAGAATGGCAAAAGCCAGAAATTTTCTC MJ # 160 (SEQ ID NO: 24) CGCAGCGAGA GGCCCAGCCGGCC ATG MJ # 161 (SEQ ID NO: 25 sequence) CGCAATTC GGCCCCCGAGGCC CC MJ # 162 (SEQ ID NO: 26) CGCAGCGA GCGCGC ACTCCATGCAGGCTGCCCCACC MJ # 163 (SEQ ID NO: 27) CCCTAAAA TCTAGA AATCACGCCCATCGGTGAGC MJ # 197 (SEQ ID NO: 28) CGGGAAAATTTCTTGGATTTTCCATTCTGGAAGAA MJ # 198 (SEQ ID NO: 29) Gt MJ # 199 (SEQ ID NO: 30) CGCAATTC GGCCCCCGAGGCC CCGGGCTCTTGGACAGTGATGGTCACAGGCTTG MJ # 200 (SEQ ID NO: 31) CAGCCCAGCTACCATTTCAAGGCCAAC MJ # 201 (SEQ ID NO: 32) GTTGGCCTTGAAATGGTAGCTGGGCTG MJ # 202 (SEQ ID NO: 33) CATAGGCTACACGCAGTACTCATCCAAGC MJ # 203 (SEQ ID NO: 34) GCTTGGATGAGTACTGCGTGTAGCCTATG

Example  2. Bacterial culture and Flow cell  Separator cytometry ) FcγRIIa Mutant  Explore the library

1 ml of the constructed FcγRIIa mutant library was added to Terrific Broth (TB) medium containing chloramphenicol (40 μg / ml) in 2% (w / v) glucose at 37 ° C and shaking at 250 rpm for 4 hours . The cultured library cells were inoculated at 1: 100 in TB medium and cultured at 37 ° C and 250 rpm shaking until OD ₆₀₀ reached 0.6. After that, the cells were incubated at 25 ° C for 20 minutes for cooling, and the expression was induced by adding 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG). Cells were harvested by centrifugation at 14,000 rpm for 1 minute, followed by OD ₆₀₀ normalization. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was discarded and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. Then, 300 μl of the supernatant was collected and 700 μl of PBS and human serum IgG-FITC probe (Sigma aldrich) were added together and the fluorescent probe was labeled on the spheroplast by rotation at room temperature. After labeling, the cells were washed once with 1 ml of PBS, and the upper 3% cells showing high fluorescence were collected using flow cytometry (S3 cell sorter (Bio-rad)). We rearranged the sorting cells again. resorting amplifying a gene by PCR received using the primers MJ # 160, MJ # 161 and Taq polymerase (Biosesang) sample and through the Sfi I restriction enzyme treatment ligation, transformation process to prepare a gene of the sorting cells to amplify sublibrary . This process was repeated over a total of four rounds and then analyzed for each of the 40 individual clones to determine the SH2A40 variant (SEQ ID NO: < RTI ID = 0.0 > 36 and 44 sequences) were selected (Fig. 2).

Example 3: Cloning and expression for expression of excised SH2A40 mutants in animal cells, purification

In order to express SH2A40 in HEK293F cells, the gene was amplified by PCR using Vent polymerase and primers MJ # 162 and MJ # 163, followed by restriction enzyme treatment with Bss HII and Xba I (New England Biolab) pMAZ-FcγRIIa (wild type) and pMAZ-FcγRIIa variant (SH2A40). Genes cloned in pMAZ, an expression vector for animal cells, were transfected into HEK293F cells and transiently expressed at a size of 300 ml. After the culture, the cells were centrifuged at 2,000 rpm for 10 minutes to remove the cells. The supernatant was removed and the equilibrium was adjusted with 25 × PBS. and filtered with a 0.2 μm filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific). pass-through solution, and then wash with 50 ml of 1 × PBS, 25 ml of 10 mM imidazole buffer, 25 ml of 20 mM imidazole buffer, and 200 μl of 250 mM imidazole buffer. . Elution was performed with 2.5 ml of 250 mM imidazole buffer. The proteins were analyzed by SDS-PAGE (BioRad) after the buffer was exchanged with Amicon Ultra4 (Merck Millipore) in PBS, followed by enrichment (FIG. 3). It was confirmed that FcγRIIa protein (32 kDa) was purified with high purity on SDS-PAGE.

Example  4: Produced through animal cell culture FcγRIIa  For protein activity and binding assay IgG1  ELISA performed using rituximab consisting of subclasses

0.05 M Na ₂ CO ₃ The rituximab diluted to 4 μg / ml at pH 9.6 was immobilized in a flat bottom polystyrene high-index 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 μl of 5% BSA (0.05% PBST) And then blocked at room temperature for 2 hours. After washing four times with 180 μl of 0.05% PBST, serially diluted FcγRIIa proteins were added to each well of 50 μl of blocking solution and reacted at room temperature for 1 hour. After washing, 50 μl of anti-HisHRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed. After adding 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific), color development was performed and 50 μl of 2 MH ₂ SO ₄ was added to terminate the reaction. The reaction was then analyzed using an Epoch Microplate Spectrophotometer (BioTek). All experiments were carried out in duplicate. ELISA was able to compare and analyze the binding ability of rituximab to Fc part and wild type FcγRIIa and SH2A40. As a result, SH2A40 showed similar binding force as WT Fc [gamma] RIIA due to the addition of a new N-linked canonical glycosylation motif (Fig. 4).

Example 5. Cloning for MBP-FcγRIIa protein expression and E. coli Expression, purification

In order to produce the selected SH2A40 in soluble form, the gene was subjected to PCR using IIa_Fw_NdeI and IIa_Rv_HindIII primers and Nde I and Hin dIII (New England Biolab). After ligation with pET22b-MBP-TEV site-His vector of Nde I and Hin dIII, BL21 (DE3) cells were transfected. The cells were cultured in TB medium containing ampicillin (100 μg / ml) in 2% (w / v) glucose at 37 ° C and shaking at 250 rpm. The cultured cells were inoculated at 1: 100 in TB medium and cultured at 37 ° C at 250 rpm shaking until an OD ₆₀₀ reached 0.6. After that, the cells were incubated at 18 ° C for 20 minutes for cooling, followed by incubation with 1 mM IPTG for 14 hours. After the incubation, the cells were harvested by centrifugation at 7,000 rpm for 10 minutes. The cells were sonicated (5 sec on / 10 sec off, 100 repetitions) and centrifuged at 15,000 rpm for 30 min. The supernatant was filtered with a 0.45 μm syringe filter. The filtered supernatant was bound to Ni-NTA resin, washed with 100 ml of 10 mM imidazole buffer, 100 ml of 20 mM imidazole buffer, and eluted with 4 ml of 50 mM imidazole buffer. MBP-SH2A40 was cleaved with MBP and SH2A40 using TEV-GST, and TEV-GST and MBP proteins were removed with GST resin and amylose resin to obtain pure SH2A40 (Fig. 5).

Example 6 Analysis of binding capacity of FcγRIIa variant expressed in Escherichia coli to IgG1 by ELISA

ELISA was performed to examine the activity of SH2A40 digested after expression purification. 0.05 M Na ₂ CO ₃ Rituximab diluted to 4 μg / ml in pH 9.6 was immobilized in a flat bottom polystyrene High Bind 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 μl of 4% skim milk GenomicBase) (0.05% PBST) for 2 hours at room temperature. After washing four times with 180 μl of 0.05% PBST (pH 5.8, pH 7.4), 50 μl of serially diluted WT FcγRIIa and SH2A40 in 1% skim milk (in 0.05% PBST) was added to each well. Lt; / RTI > After washing, 50 μl of anti-His-HRP conjugate (Sigma) was reacted at room temperature for 1 hour and washed. After adding 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific), color development was performed and 50 μl of 2 MH ₂ SO ₄ was added to terminate the reaction and analyzed using an Epoch Microplate Spectrophotometer (BioTek) ).

Example 7: Fabrication of FcγRIIa mutant library so that N-linked canonical glycosylation motif is not formed

A library was constructed to detect FcγRIIa variants with high affinity for IgG Fc while eliminating the N-linked canonical glycosylation motif (N-X-S / T) formed in FcγRIIa variants (SH2A40: K117N, L159Q). This library was constructed by focusing on the positions of V116, K117, and T119 where N-linked canonical glycosylation motifs were formed in SH2A40. The template of the library was prepared using SH2A40 as a template, and a reduced codon was used so as not to cause Cys to prevent unpaired Cyc (FIG. 7).

1. Sub-library-1: Produce Asn and Cys at position 117

NNK degenerate codon was used to encode 20 amino acids at positions 116 and 119, 13 amino acids were codonized using NNG reduced codon at position 117 and 5 amino acids were codonized using NNG reduced codon at positions 117 and 119, respectively, using pMopac12-NlpA-FcγRIIa (SH2A40) The primers coding for the remaining amino acids (Gln, Phe, His, Ile, and Tyr) were prepared and used in the same amounts. MJ # 113-MJ # 118 was used to amplify the fragment-1 upstream of FcγRIIa gene and the downstream fragment-2 using primers MJ # 160 and MJ # 112 and Vent polymerase (New England Biolab) Mixture and MJ # 161 mixed at the same amino acid ratio were used. Prepared two fragment were assemble with Vent polymerase, it was treated with Sfi I (New England Biolab) restriction enzymes.

2. Sub-library-2: Produce Ser, Thr, Cys at position 119

NNK degenerate codon was used to encode 20 amino acids at positions 116 and 117, and 12 amino acids were codonized at position 119 using the NWK reduced codon and pMOPac12-NlpA-FcγRIIa (SH2A40) -FLAG as a template. The primers coding for the remaining amino acids (Ala, Gly, Pro, Arg, and Trp) were prepared and used in the same amounts. MJ # 119-MJ # 124 was used to amplify the fragment-1 upstream of FcγRIIa gene and the downstream fragment-2 using primers MJ # 160 and MJ # 112 and Vent polymerase (New England Biolab) Mixture and MJ # 161 mixed at the same amino acid ratio were used. Prepared two fragment were assemble with Vent polymerase, it was treated with Sfi I (New England Biolab) restriction enzymes.

Two sub-library genes with restriction enzymes were ligated in the same amount and transformed into Jude1 to construct FcγRIIa library (theoretical library size: 4.3 × 10 ⁴ , experimental library size: 6.3 × 10 ⁸ ).

Example  8: With built libraries Flow cell  Screening and analyzer MG2A28 , MG2A45  Such as Mutant  Screening (affinity analysis for human serum IgG)

The constructed library was cultured at 37 ° C for 4 hours in a 250 ml flask with 1 vial (1 ml) in 25 ml of TB + 2% glucose medium. After incubation at 37 ° C for 4 hours, the cells were inoculated in a 500 ml flask containing 100 ml of TB medium ₆₀₀ = 0.6. Immediately after cooling at 25 ° C and 250 rpm for 20 minutes, 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were recovered by centrifugation at 14,000 rpm for 1 minute at the normalized amount. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. Then, 300 μl of the supernatant was taken and 700 μl of PBS and human serum IgG-FITC (Sigma aldrich) probe were added together and the fluorescent probe was labeled on the spheroplast by rotation at room temperature. After labeling, the cells were washed once with 1 ml of PBS, diluted 20-fold with PBS, and only the cells with the highest 3% fluorescence signal were isolated using S3 cell sorter (Bio-rad). For more efficient screening, sorted cells were resorted to sorting once more. Filtered out cells were prepared for the sub-library genes to amplify a MJ # 1, MJ # 2 primer and amplifying the gene by PCR using Taq polymerase (Biosesang) and a cell sorting via the Sfi I restriction enzyme treatment ligation, transformation process . After repeating this process for a total of 3 rounds, variants showing high affinity with the Fc portion of human serum IgG were selected through sequencing of 50 individual clones (Fig. 8).

Example 9 Cloning and Expression Purification for Expression of Excavated Variants in Animal Cells

To express MG2A28 (SEQ ID NO: 37 and SEQ ID NO: 45) and MG2A45 (SEQ ID NO: 38 and SEQ ID NO: 46) in HEK293F cells, the gene was ligated with Vent polymerase and primers MJ # 162, MJ # 163 And then ligated with Bss HII and Xba I (New England Biolab) to obtain pMAZ-FcγRIIa variant (MG2A28) and pMAZ-FcγRIIa variant (MG2A45). Genes cloned in pMAZ, an expression vector for animal cells, were transfected into HEK293F cells and transiently expressed at a size of 300 ml. The cultured medium was centrifuged at 2000 rpm for 10 minutes to remove the cells, and the supernatant was taken and the equilibrium was adjusted with 25 × PBS. and filtered with a 0.2 μm filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific). pass-through solution, and then wash with 50 ml of 1 × PBS, 25 ml of 10 mM imidazole buffer, 25 ml of 20 mM imidazole buffer, and 200 μl of 250 mM imidazole buffer. . Elution was performed with 2.5 ml of 250 mM imidazole buffer. The received protein was analyzed by SDS-PAGE (BioRad) through a concentration process after replacing the buffer with PBS through Amicon Ultra4 (Merck Millipore) (FIG. 9). It was confirmed that FcγRIIa protein (32 kDa) was purified with high purity on SDS-PAGE.

Example  10: IgG1  subclass rituximab  Used Mutant On Fc  ELISA for analysis of binding force

0.05 M Na ₂ CO ₃ The rituximab diluted to 4 μg / ml at pH 9.6 was immobilized in a flat bottom polystyrene high-index 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 μl of 5% BSA (0.05% PBST) And then blocked at room temperature for 2 hours. After washing four times with 180 μl of 0.05% PBST, serially diluted FcγRIIa variants with blocking solution were dispensed in 50 μl of each well and reacted at room temperature for 1 hour. After washing, 50 μl of anti-HisHRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed. 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to each well to develop color, and 50 μl of 2 MH ₂ SO ₄ was added thereto to terminate the reaction and analyzed using an Epoch Microplate Spectrophotometer (BioTek) . All experiments were performed in duplicate. ELISA was able to compare and analyze the binding ability of rituximab to Fc part and FcγRIIa mutants (wild type, SH2A40, MG2A28, MG2A45).

Example 11: FcγRIIa variants via Biolayer interferometry and K of rituximab _D measure value

The affinity of FcγRIIa mutants was measured using rituximab to measure the binding capacity of IgG1, an IgG subclass mainly used in various antibody drugs, to Fc, which accounts for more than 70% of human serum. The binding of Fc [gamma] RIIA mutants was measured using Blitz (Fortebio). For reliable analysis Amine reactive 2 ^nd generation (AR2G) in sodium acetate pH 5.0 solution to the biosensor (Fortebio) immobilizing the rituximab antibody diluted to 40 ug / ml and, 1x kinetics buffer (fortebio) to serially dilution the FcγRIIa variants (wild type SH2A40, MG2A28, and MG2A45) were respectively reacted to analyze binding force (Fig. 11). Blitz Pro 1.2 software (Fortebio) was used to calculate the equilibrium binding constant (K _D ) (Table 3). As a result, it was confirmed that SH2A40, MG2A28, and MG2A45 were 3.57 times, 6.16 times, and 8.26 times higher than those of wild type, respectively.

Example  12: Affinity for maturation MG2A28 , MG2A45  Based FcγRIIa  error-prone PCR  Build a library

In order to construct the FcγRIIa mutant library based on MG2A28 and MG2A45, error prone PCR was performed using pMopac12-NlpA-FcγRIIa (MG2A28, MG2A45) -FLAG as a template. An error prone PCR technique using Taq polymerase (Takara) was used as a method for applying a random point mutation to the FcγRIIa region. PCR was performed to ensure that two mutants of MG2A28 and MG2A45 were present in the library at an equivalent ratio of 50%. Point mutations were introduced in 0.3% of nucleotides in the entire FcγRIIa gene using primers MJ # 160 and MJ # 161 Respectively. Then after the next Sfi I restriction enzyme treatment and ligation process to prepare a FcγRIIa Library transformation by the Jude1 (Library ^{size: 2.6 x 10 9, experimental error} rate: 0.32%). A library was constructed in which Fc [gamma] RIIa variants were displayed in the inner membrane of E. coli.

Example  13: With built libraries Flow cell  Screening and analyzer MG2A28 .One, MG2A45 .1 Mutant  Screening (affinity analysis for human serum IgG)

The constructed library was cultured at 37 ° C for 4 hours in a 250 ml flask with 1 vial (1 ml) in 25 ml of TB + 2% glucose medium. After incubation at 37 ° C for 4 hours, the cells were inoculated in a 500 ml flask containing 100 ml of TB medium ₆₀₀ = 0.6. Immediately after cooling at 25 ° C and 250 rpm for 20 minutes, 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were recovered by centrifugation at 14,000 rpm for 1 minute at the normalized amount. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. Then, 300 μl of the supernatant was collected and 700 μl of PBS and human serum IgG-FITC (Sigma aldrich) probe were added together and the fluorescent probe was labeled with spheroplast at room temperature -2 rounds: 20 nM, and 3 rounds: 5 nM). After labeling, the cells were washed once with 1 ml of PBS, diluted 20-fold with PBS, and only the cells with the highest 3% fluorescence signal were isolated using S3 cell sorter (Bio-rad). For more efficient screening, sorted cells were resorted to sorting once more. Filtered out cells were prepared for the sub-library genes to amplify a MJ # 1, MJ # 2 primer and amplifying the gene by PCR using Taq polymerase (Biosesang) and a cell sorting via the Sfi I restriction enzyme treatment ligation, transformation process . After repeating this process for a total of 5 rounds, fluorescence signal intensities due to the binding of 70 individual clones to IgG-FITC were analyzed. As a result, mutants exhibiting high affinity with the Fc portion of human serum IgG were screened, and it was confirmed through sequencing analysis that MG2A28-based mutants and MG2A45-based mutants were each isolated (FIG. 12).

Example 14 Cloning and Expression Purification for Expression of Excavated Variants in Animal Cells

To express MG2A28.1 (SEQ ID NO: 39 and SEQ ID NO: 47) and MG2A45.1 (SEQ ID NO: 40 and SEQ ID NO: 48) in the HEK293F cells, the gene was ligated with Vent polymerase and primer MJ # 162 , MJ # 163, and ligated with Bss HII and Xba I (New England Biolab) to prepare pMAZ-FcγRIIa variant (MG2A28.1) and pMAZ-FcγRIIa variant (MG2A45.1) . Genes cloned in pMAZ, an expression vector for animal cells, were transfected into HEK293F cells and transiently expressed at a size of 300 ml. The cultured medium was centrifuged at 2000 rpm for 10 minutes to remove the cells, and the supernatant was taken and the equilibrium was adjusted with 25 × PBS. and filtered with a 0.2 μm filter (Merck Millipore) using a bottle top filter. 1 ml slurry of Ni-NTA agarose (Qiagen) equilibrated with PBS was added, and the mixture was stirred at 4 ° C for 16 hours and then poured into a polypropylene column (Thermo Fisher Scientific). pass-through solution, and then wash with 50 ml of 1 × PBS, 25 ml of 10 mM imidazole buffer, 25 ml of 20 mM imidazole buffer, and 200 μl of 250 mM imidazole buffer. . Elution was performed with 2.5 ml of 250 mM imidazole buffer. The obtained protein was purified by using SDS-PAGE (BioRad) through a concentration process after replacing the buffer with PBS through Amicon Ultra4 (Merck Millipore) (FIG. 13). It was confirmed that FcγRIIa protein (32 kDa) was purified with high purity on SDS-PAGE.

Example  15: IgG1  subclass rituximab  Used Mutant On Fc  ELISA for analysis of binding force

0.05 M Na ₂ CO ₃ The rituximab diluted to 4 μg / ml at pH 9.6 was immobilized in a flat bottom polystyrene high-index 96-well microplate (Costar) at 4 ° C for 16 hours, and then 100 μl of 5% BSA (0.05% PBST) And then blocked at room temperature for 2 hours. After washing four times with 180 μl of 0.05% PBST, serially diluted FcγRIIa variants with blocking solution were dispensed in 50 μl of each well and reacted at room temperature for 1 hour. After washing, 50 μl of anti-HisHRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed. 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) was added to each well and developed. The reaction was terminated by adding 50 μl of 2 MH ₂ SO ₄ , and analyzed using an Epoch Microplate Spectrophotometer (BioTek) ). All experiments were performed in duplicate. ELISA showed that the binding ability of rituximab to Fc part and FcγRIIa mutants (wild type, MG2A28, MG2A45, MG2A28.1, MG2A45.1) could be compared and analyzed.

Example 16: FcγRIIa variants via Biolayer interferometry and K of rituximab _D measure value

The affinity of FcγRIIa mutants was measured using rituximab to measure the binding capacity of IgG1, an IgG subclass mainly used in various antibody drugs, to Fc, which accounts for more than 70% of human serum. The binding of Fc [gamma] RIIA mutants was measured using Blitz (Fortebio). For stable analysis, rituximab antibody diluted to 40 ug / ml was immobilized in sodium acetate pH 5.0 solution to an Amine reactive 2 ^nd generation (AR2G) biosensor (Fortebio) and FcγRIIa variants serially diluted with 1x kinetics buffer (fortebio) .1, MG2A45.1) were respectively reacted to analyze binding force (Fig. 15). Blitz Pro 1.2 software (Fortebio) was used to calculate the equilibrium binding constant (K _D ) (Table 4). As a result, it was confirmed that MG2A28.1 and MG2A45.1 were increased by 5.39 times and 32.09 times, respectively, compared with the wild type.

Example 17: Analysis of binding force with mouse serum IgG for ELISA using mouse model by ELISA

0.05 M Na ₂ CO ₃ After immobilization of the mouse serum IgG diluted to 4 μg / ml at pH 9.6 in a flat bottom polystyrene high-bind 96-well microplate (Costar) at 4 ° C for 16 hours, 100 μl of 5% BSA ) For 2 hours at room temperature. After washing four times with 0.05% PBST (180 μl), 50 μl of serially diluted FcγRIIa mutants (wild type, MG2A28, MG2A45, MG2A28.1, and MG2A45.1) were added to each well and incubated at room temperature for 1 hour Lt; / RTI > After washing, 50 μl of anti-HisHRP conjugate (Sigma-Aldrich) was reacted at room temperature for 1 hour and washed. The reaction was terminated by adding 50 μl of 1-Step Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific) to each well and adding 2 μl of 2 MH ₂ SO _{4 to} each well. The reaction was then terminated and analyzed using an Epoch Microplate Spectrophotometer (BioTek) . All of the experiments were performed in duplicate. ELISA was able to compare and analyze the binding ability of mouse serum IgG and FcγRIIa mutants (wild type, MG2A28, MG2A45, MG2A28.1, MG2A45.1), and all mutants except MG2A28 were wild type , And it was confirmed that MG2A45 and MG2A45.1 mutants bind to mouse serum IgG with the highest affinity.

Example  18: FcγRIIa and  About 96% of homology Of FcγRIIb On Fc  About Affinity  Introduction of point mutations to determine their effect

Experiments were performed to analyze the effect of the excised point mutations on Fc [gamma] RIb (SEQ ID NO: 41 and SEQ ID NO: 49). For this purpose, plasmid pMopac12-NlpA-FcγRIIb-FLAG was used as a template, and Quikchange site directed mutagenesis (Agilent) was performed to introduce R55H and L159Q among MG2A45.1 point mutations (R55H, K117N, T119V, L159Q, V171E) ) Technique. MJ # 200 and MJ # 201, MJ # 202 and MJ # 203 primers were used for the introduction of each point mutation, PCR was performed using Pfu turbo polymerase (Agilent), restriction enzyme treatment with Dpn I (New England Biolab) Lt; RTI ID = 0.0 > 37 C. < / RTI > After the transformation of the prepared gene, nucleotide sequence analysis confirmed that the point mutation was successfully inserted. In addition, assembly PCR technique was used to introduce three point mutations of K117N, T119V and V171E. Two fragments were amplified using MJ # 160 and MJ # 197, MJ # 198 and MJ # 199 primers and a vent polymerase (New England Biolab) as a template with a plasmid containing R55H and L159Q introduced by Quikchange site directed mutagenesis MJ # 160 and MJ # 199 were assemble. After completion of the Sfi I restriction enzyme treatment, ligation and transformation, the nucleotide sequence was analyzed to complete the production of the pMopac12-NlpA-FcγRIIb (MG2B45.1) -FLAG gene in which the 5 point mutations of MG2A45.1 were all inserted.

Example  19: wild type FcγRIIb and MG2A45 .1 mutation introduced Of FcγRIIb (MG2B45.1)  human serum IgG - At FITC  Comparison of affinity for

The FcγRIIb mutant (MG2B45.1) (SEQ ID No. 42 and 50 sequence) compared the affinity for human serum IgG-FITC with the wild type FcγRIIb. Inoculum preincubated in 5 ml of TB + 2% glucose medium was inoculated 1: 100 in 5 ml of TB medium and cultured to OD ₆₀₀ = 0.6. Immediately after cooling at 25 ° C and 250 rpm for 20 minutes, 1 mM IPTG was added and overexpressed at 25 ° C and 250 rpm for 5 hours. After overexpression, the OD ₆₀₀ value was measured and the cells were recovered by centrifugation at 14000 rpm for 1 minute. The cells were resuspended in 1 ml of 10 mM Tris-HCl (pH 8.0) and centrifuged for 1 min. The wash procedure was repeated twice. The cells were resuspensioned with 1 ml of STE [0.5 M sucrose, 10 mM Tris-HCl, 10 mM EDTA (pH 8.0)] and the extracellular membrane was removed by rotation at 37 ° C for 30 minutes. After centrifugation, the supernatant was removed and 1 ml of Solution A [0.5 M sucrose, 20 mM MgCl ₂ , 10 mM MOPS pH 6.8] was added and centrifuged with resuspension. 1 ml of Solution A and 20 μl of 50 mg / ml lysozyme solution was added to 1 ml of the solution. The solution was then resuspensioned and the peptidoglycan layer was removed by rotation at 37 ° C for 15 minutes. After centrifugation, the supernatant was removed and resuspension in 1 ml of PBS. Then, 300 μl of the sample was taken and 700 μl of PBS and human serum IgG-FITC (Sigma aldrich) probe were added together and the plate was rotated for 1 hour at room temperature. Respectively. After labeling, the cells were washed once with 1 ml of PBS, and fluorescence signals from human IgG-FITC bound to FcγRIIb were analyzed using Guava (Merck Millipore) equipment (FIG. 17).

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

<110> Kookmin University Industry Academy Cooperation Foundation <120> Fc gamma receptor variant MG2A45 <130> HP7568 <160> 50 <170> KoPatentin 3.0 <210> 1 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> P788 <400> 1 gcggggtttg cagcaccagm nnmnnmnnaa gcacggtcag atgcaccg 48 <210> 2 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> P789 <400> 2 cggtgcatct gaccgtgctt nnknnknnkc tggtgctgca aaccccgc 48 <210> 3 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> P790 <400> 3 gcttttgcca ttctgaaaaa aggtcacttt mnncagmnnm nnatctttcc agctatggca 60 acgcag 66 <210> 4 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> P791 <400> 4 ctgcgttgcc atagctggaa agatnnknnk ctgnnkaaag tgaccttttt tcagaatggc 60 aaaagc 66 <210> 5 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> P792 <400> 5 gcggaatgct aaaggtcgga tccagmnnag amnntttctg mnntttgcca ttctgaaaaa 60 aggtcacttt cacc 74 <210> 6 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> P793 <400> 6 ggtgaaagtg accttttttc agaatggcaa annkcagaaa nnktctnnkc tggatccgac 60 ctttagcatt ccgc 74 <210> 7 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> IIa_Fw_NdeI <400> 7 gcggaattcc atatgcaggc tgccccaccg aaag 34 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> IIa_Rv_HindIII <400> 8 taagggaagc ttaatcacgc ccatcggtga gc 32 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MJ # 1 <400> 9 ccaggcttta cactttatgc 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> MJ # 2 <400> 10 ctgcccatgt tgacgattg 19 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MJ # 112 <400> 11 cagcggttta tctttccagc tatggc 26 <210> 12 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 113 <400> 12 gccatagctg gaaagataaa ccgctgnnkn nggtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 13 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 114 <400> 13 gccatagctg gaaagataaa ccgctgnnkg atgtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 14 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 115 <400> 14 gccatagctg gaaagataaa ccgctgnnkt ttgtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 15 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 116 <400> 15 gccatagctg gaaagataaa ccgctgnnkc atgtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 16 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 117 <400> 16 gccatagctg gaaagataaa ccgctgnnka ttgtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 17 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 118 <400> 17 gccatagctg gaaagataaa ccgctgnnkt atgtgnnktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 18 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 119 <400> 18 gccatagctg gaaagataaa ccgctgnnkn nggtgnwktt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 19 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 120 <400> 19 gccatagctg gaaagataaa ccgctgnnkn nkgtggcgtt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 20 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 121 <400> 20 gccatagctg gaaagataaa ccgctgnnkn nkgtgggctt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 21 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 122 <400> 21 gccatagctg gaaagataaa ccgctgnnkn nkgtgccgtt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 22 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 123 <400> 22 gccatagctg gaaagataaa ccgctgnnkn nkgtgcgttt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 23 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> MJ # 124 <400> 23 gccatagctg gaaagataaa ccgctgnnkn nkgtgtggtt ttttcagaat ggcaaaagcc 60 agaaattttc tc 72 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> MJ # 160 <400> 24 cgcagcgaga ggcccagccg gccatg 26 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MJ # 161 <400> 25 cgcaattcgg cccccgaggc ccc 23 <210> 26 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> MJ # 162 <400> 26 cgcagcgagc gcgcactcca tgcaggctgc cccacc 36 <210> 27 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> MJ # 163 <400> 27 ccctaaaatc tagaaatcac gcccatcggt gagc 34 <210> 28 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> MJ # 197 <400> 28 cgggaaaatt tcttggattt tccattctgg aagaa 35 <210> 29 <211> 67 <212> DNA <213> Artificial Sequence <220> <223> MJ # 198 <400> 29 gctggaagga caagcctctg gtcaatgtcg tgttcttcca gaatggaaaa tccaagaaat 60 tttcccg 67 <210> 30 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> MJ # 199 <400> 30 cgcaattcgg cccccgaggc cccgggctct tggacagtga tggtcacagg cttg 54 <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MJ # 200 <400> 31 cagcccagct accatttcaa ggccaac 27 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> MJ # 201 <400> 32 gttggccttg aaatggtagc tgggctg 27 <210> 33 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MJ # 202 <400> 33 cataggctac acgcagtact catccaagc 29 <210> 34 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> MJ # 203 <400> 34 gcttggatga gtactgcgtg tagcctatg 29 <210> 35 <211> 549 <212> DNA <213> Homo sapiens <400> 35 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcgttttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgaatg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa agtgaccttt 360 tttcagaatg gcaaaagcca gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta taccctgttt 480 agcagcaaac cggtgacaat taccgtgcag gtgccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 36 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> SH2A40 <400> 36 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcgttttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgaatg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa tgtgaccttt 360 tttcagaacg gcaaaagcca gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta tacccagttt 480 agcagcaaac cggtgacaat taccgtgcag gtgccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 37 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> MG2A28 <400> 37 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcgttttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgaatg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa tgtgatgttt 360 tttcagaatg gcaaaagcca gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta tacccagttt 480 agcagcaaac cggtgacaat taccgtgcag gtgccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 38 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> MG2A45 <400> 38 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcgttttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgaatg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa tgtggtgttt 360 tttcagaatg gcaaaagcca gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta tacccagttt 480 agcagcaaac cggtgacaat taccgtgcag gtgccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 39 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> MG2A28.1 <400> 39 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcgttttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgattg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa tgtgatgttt 360 tttcagaatg gcaaaagcct gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta tacccagttt 480 agcagcaaac cggtgacaat taccgtgcag gagccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 40 <211> 549 <212> DNA <213> Artificial Sequence <220> <223> MG2A45.1 <400> 40 gccccaccga aagccgtgct gaaactggaa ccgccgtgga ttaatgtgtt gcaggaagat 60 agcgtgaccc tgacctgtca gggagcgcgt agccctgaaa gcgattctat tcagtggttt 120 cacaatggaa atctgattcc gacccatacc cagccgagct atcattttaa agcgaacaat 180 aatgatagcg gcgaatacac ctgccagacg ggccagacca gcctgagcga tccggtgcat 240 ctgaccgtgc ttagcgaatg gctggtgctg caaaccccgc atctggaatt tcaggaaggc 300 gaaaccatta tgctgcgttg ccatagctgg aaagataaac cgctggtgaa tgtggtgttt 360 tttcagaatg gcaaaagcca gaaattttct cacctggatc cgacctttag cattccgcag 420 gcgaatcatt ctcactccgg cgattaccat tgtaccggca atataggcta tacccagttt 480 agcagcaaac cggtgacaat taccgtgcag gagccgagca tgggcagcag ctcaccgatg 540 ggcgtgatt 549 <210> 41 <211> 516 <212> DNA <213> Homo sapiens <400> 41 gctcccccaa aggctgtgct gaaactcgag ccccagtgga tcaacgtgct ccaggaggac 60 tctgtgactc tgacatgccg ggggactcac agccctgaga gcgactccat tcagtggttc 120 cacaatggga atctcattcc cacccacacg cagcccagct acaggttcaa ggccaacaac 180 aatgacagcg gggagtacac gtgccagact ggccagacca gcctcagcga ccctgtgcat 240 ctgactgtgc tttccgaatg gctggtgctc cagacccctc acctggagtt ccaggaggga 300 gaaaccatcg tgctgaggtg ccacagctgg aaggacaagc ctctggtcaa ggtcacattc 360 ttccagaatg gaaaatccaa gaaattttcc cgttcggatc ccaacttctc catcccacaa 420 gcaaaccaca gtcacagtgg tgattaccac tgcacaggaa acataggcta cacgctgtac 480 tcatccaagc ctgtgaccat cactgtccaa gctccc 516 <210> 42 <211> 516 <212> DNA <213> Artificial Sequence <220> <223> MG2B45.1 <400> 42 gctcccccaa aggctgtgct gaaactcgag ccccagtgga tcaacgtgct ccaggaggac 60 tctgtgactc tgacatgccg ggggactcac agccctgaga gcgactccat tcagtggttc 120 cacaatggga atctcattcc cacccatacc cagccgagct atcattttaa agcgaacaat 180 aatgatagcg gcgaatacac gtgccagact ggccagacca gcctcagcga ccctgtgcat 240 ctgactgtgc tttccgaatg gctggtgctc cagacccctc acctggagtt ccaggaggga 300 gaaaccatcg tgctgaggtg ccacagctgg aaggacaagc ctctggtcaa tgtcgtgttc 360 ttccagaatg gaaaatccaa gaaattttcc cgttcggatc ccaacttctc catcccacaa 420 gcaaaccaca gtcacagtgg tgattaccac tgcacaggaa acataggcta cacgcagtac 480 tcatccaagc ctgtgaccat cactgtccaa gagccc 516 <210> 43 <211> 183 <212> PRT <213> Homo sapiens <400> 43 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Lys Val Thr Phe Phe Gln Asn Gly Lys Ser Gln Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Leu Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Val Ser Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 44 <211> 183 <212> PRT <213> Artificial Sequence <220> <223> SH2A40 <400> 44 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Thr Phe Phe Gln Asn Gly Lys Ser Gln Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Val Ser Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 45 <211> 183 <212> PRT <213> Artificial Sequence <220> <223> MG2A28 <400> 45 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Met Phe Phe Gln Asn Gly Lys Ser Gln Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Val Ser Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 46 <211> 183 <212> PRT <213> Artificial Sequence <220> <223> MG2A45 <400> 46 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Val Phe Phe Gln Asn Gly Lys Ser Gln Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Val Ser Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 47 <211> 183 <212> PRT <213> Artificial Sequence <220> <223> MG2A28.1 <400> 47 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Asp Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Met Phe Phe Gln Asn Gly Lys Ser Leu Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Glu Pro Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 48 <211> 183 <212> PRT <213> Artificial Sequence <220> <223> MG2A45.1 <400> 48 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Pro Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Gln Gly Ala Arg Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr His Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Met Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Val Phe Phe Gln Asn Gly Lys Ser Gln Lys         115 120 125 Phe Ser His Leu Asp Pro Thr Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Phe 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Glu Pro Ser Met Gly Ser                 165 170 175 Ser Ser Pro Met Gly Val Ile             180 <210> 49 <211> 172 <212> PRT <213> Homo sapiens <400> 49 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Gln Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Arg Gly Thr His Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr Arg Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Val Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Lys Val Thr Phe Phe Gln Asn Gly Lys Ser Lys Lys         115 120 125 Phe Ser Arg Ser Asp Pro Asn Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Leu Tyr 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Ala Pro                 165 170 <210> 50 <211> 172 <212> PRT <213> Artificial Sequence <220> <223> MG2B45.1 <400> 50 Ala Pro Pro Lys Ala Val Leu Lys Leu Glu Pro Gln Trp Ile Asn Val   1 5 10 15 Leu Gln Glu Asp Ser Val Thr Leu Thr Cys Arg Gly Thr His Ser Pro              20 25 30 Glu Ser Asp Ser Ile Gln Trp Phe His Asn Gly Asn Leu Ile Pro Thr          35 40 45 His Thr Gln Pro Ser Tyr His Phe Lys Ala Asn Asn Asn Asp Ser Gly      50 55 60 Glu Tyr Thr Cys Gln Thr Gly Gln Thr Ser Leu Ser Asp Pro Val His  65 70 75 80 Leu Thr Val Leu Ser Glu Trp Leu Val Leu Gln Thr Pro His Leu Glu                  85 90 95 Phe Gln Glu Gly Glu Thr Ile Val Leu Arg Cys His Ser Trp Lys Asp             100 105 110 Lys Pro Leu Val Asn Val Val Phe Phe Gln Asn Gly Lys Ser Lys Lys         115 120 125 Phe Ser Arg Ser Asp Pro Asn Phe Ser Ile Pro Gln Ala Asn His Ser     130 135 140 His Ser Gly Asp Tyr His Cys Thr Gly Asn Ile Gly Tyr Thr Gln Tyr 145 150 155 160 Ser Ser Lys Pro Val Thr Ile Thr Val Gln Glu Pro                 165 170

Claims (18)

As polypeptides comprising an Fc gamma receptor variant,
Wherein said variant comprises a modification of a 117th amino acid, a 119th amino acid and a 159th amino acid in the sequence of SEQ ID NO: 43 or SEQ ID NO: 49 wild-type Fc gamma receptor, Wherein the amino acid is asparagine (N), the 119th amino acid is valine (V), and the 159th amino acid is replaced by glutamine (Q).
2. The polypeptide of claim 1, wherein the variant comprises the sequence of SEQ ID NO: 46.
2. The polypeptide according to claim 1, wherein the mutant comprising the amino acid substitution has improved binding to the Fc region of the IgG antibody as compared to the wild-type Fc gamma receptor.
4. The polypeptide according to claim 3, wherein the mutant comprising the amino acid substitution has an improved binding ability of the IgG antibody against Fc three times or more as compared to the wild-type Fc gamma receptor.
A nucleic acid molecule encoding the polypeptide of claim 1.
A vector comprising the nucleic acid molecule of claim 5.
A host cell comprising the vector of claim 6.
A composition comprising the polypeptide of claim 1, the nucleic acid molecule of claim 5, or the vector of claim 6.
9. The composition of claim 8, wherein the composition is for detecting an IgG antibody or an Fc region of an IgG antibody contained in a sample.
A kit for detecting an Fc region of an IgG antibody or IgG antibody comprising the composition of Claim 9.
9. The composition of claim 8, wherein the composition is a pharmaceutical composition for immunosuppression.
9. The composition according to claim 8, wherein the composition is a pharmaceutical composition for inhibiting organ transplantation.
9. The composition of claim 8, wherein said composition is a pharmaceutical composition for the prevention or treatment of autoimmune diseases.
A protein or peptide fused product comprising the polypeptide of claim 1 and a physiologically active protein or a physiologically active peptide conjugated thereto, wherein the protein or peptide fused product maintains persistence in the body, thereby increasing the half-life of the protein or peptide.
A method for producing a polypeptide comprising an Fc gamma receptor variant comprising the steps of:
a) culturing a host cell comprising a vector comprising a nucleic acid molecule encoding the polypeptide of claim 1; And
b) recovering the polypeptide expressed by said host cell.
A method for identifying the presence of an Fc region of an IgG antibody or an IgG antibody contained in a sample comprising the steps of:
a) preparing a sample to be tested for the presence or absence of an Fc region of an IgG antibody or an IgG antibody;
b) mixing the polypeptides of claim 1 with each other and binding them to each other; And
c) confirming the presence of the Fc region of the IgG antibody or IgG antibody bound to the polypeptide.
A method for purifying an Fc region of an IgG antibody or IgG antibody contained in a sample comprising the steps of:
a) mixing the polypeptides of claim 1 with a sample comprising an Fc region of an IgG antibody or an IgG antibody to bind to each other; And
b) purifying the Fc region of the IgG antibody or IgG antibody bound to the polypeptide.
A method of screening for an Fc gamma receptor variant having enhanced binding to an Fc region of an IgG antibody or an IgG antibody comprising the steps of:
a) an Fc comprising a sequence in which the 117th amino acid in SEQ ID NO: 49 or SEQ ID NO: 49 is substituted with asparagine (N), the 119th amino acid is valine (V) and the 159th amino acid is replaced with glutamine (Q) Constructing a gamma receptor mutant library; And
b) a Fc gamma receptor variant having an improved binding capacity to the Fc region of the IgG antibody or IgG antibody as compared to the Fc gamma receptor mutant containing only substitutions of the three amino acid sequences of the 117th, 119th and 159th in the library &Lt; / RTI &gt;

Images