KR20190019032A - A composition comprising mesenchymal stem cell for treating thyroid associated ophthalmopathy - Google Patents

Abstract

Provided is a composition for preventing, alleviating or treating thyroid-associated ophthalmopathy which contains mesenchymal stem cells as an active component. A pharmaceutical composition for treating thyroid-associated ophthalmopathy which contains mesenchymal stem cells as the active component recovers from increase in abnormal hyaluronic acid production, lipocyte differentiation, and lipid accumulation of orbital fibroblasts in patients having thyroid-associated ophthalmopathy, thereby being usefully used for treating thyroid-associated ophthalmopathy.

Description

[0001] The present invention relates to a composition for treating a thyroid eye disease comprising mesenchymal stem cells for treating thyroid associated ophthalmopathy,

To a composition for preventing, ameliorating, or treating a thyroid eye disease.

Thyroid associated ophthalmopathy (TAO) is a chronic orbital inflammation associated with thyroid abnormalities and is present in about 60% of patients with thyroid dysfunction. In patients with thyroid eye disease, an increase in the differentiation of orbital fibroblasts into adipocytes and an increase in hyaluronic acid are observed, resulting in enlargement of the adipocyte fat cells, or inflammation. If missed treatment time, proper treatment is required because it can lead to severe sequelae such as eyelid retraction, proptosis, restrictive strabismus, decreased vision, diplopia, or decreased visual acuity. To date, high-dose steroids, radiation therapy, and orbital decompression have been used for the treatment of thyroid eye disease, but its effect is limited and there are side effects or risks associated with treatment.

Therefore, it is necessary to develop a new therapeutic agent in the thyroid ophthalmopathy, which is a refractory orbital inflammation disease.

There is provided a composition for preventing, ameliorating, or treating a thyroid eye disease comprising mesenchymal stem cells as an active ingredient.

One aspect provides mesenchymal stem cells expressing one or more selected from the group consisting of FOXP3 (forkhead box P3), HLA-G (human leukocyte antigen G) and TLR4 (Toll-like receptor 4).

 The mesenchymal stem cells may have the following characteristics of a) or b):

a) expressing at least one selected from the group consisting of CXCL-1 (chemokine (C-X-C motif) ligand 1), MCP-1 (monocyte chemotactic protein 1) and TIMP-1 (tissue inhibitors of metalloproteinases);

b) one or more surface antigen characteristics selected from the group consisting of CD90, CD146, CD105 and CD72.

As used herein, the term " Mesenchymal Stem Cell (MSC) " may refer to a cell capable of maintaining self-renewal and stemness maintenance and differentiating into various mesenchymal tissues , Mesenchymal stem cells of an animal including a mammal such as a human, etc. The mesenchymal stem cells may be derived from umbilical cord, umbilical cord blood, bone marrow, placenta, or adipose derived mesenchymal stem cells The placenta-derived mesenchymal stem cells may be derived from various tissues constituting the placenta, such as amniotic epithelial cells, amniotic membrane, trophoblast, chorion, etc. Preferably, the placenta-derived mesenchymal stem cells are derived from the placenta- The stem cells may be mesenchymal stem cells derived from the chorionic plate of the placenta, more preferably those derived from chorionic plate membranes (Science 284: 143, 1997) and van et al. (J. Clin. Invest. ≪ RTI ID = 0.0 & , ≪ / RTI > 58: 699, 1976).

The mesenchymal stem cells may express or secrete an immunocytokine. The mesenchymal stem cells may be more expressed or secreted than fibroblasts or other cell-mediated immunocytokines compared to the control group. Examples of such immunocytokines may include CXCL-I, MCP-I, or TIMP-I.

In addition, the mesenchymal stem cells may express or secrete FOXP3, HLA-G, or TLR4. The mesenchymal stem cells may be more likely to express or secrete FOXP3, HLA-G, or TLR4 as compared to the control, fibroblasts, or other cells. The mesenchymal stem cells may express or secrete FOXP3, HLA-G, or TLR4 more than bone marrow-derived or adipose-derived mesenchymal stem cells. The difference in the expression levels may be, for example, a comparison of the expression levels of genes and proteins at the mRNA or protein level. Also, the difference in the expression level may be, for example, by microarray and proteomic analysis.

In addition, the mesenchymal stem cells may be genetically engineered to increase expression of any one of the factors. The term " genetic engineering " or " genetically engineered " as used herein refers to the act of introducing one or more genetic modifications to a cell or cells made thereby. For example, the mesenchymal stem cells or host cells are genetically engineered to increase the expression or activity of CXCL-1, MCP-1, or TIMP-1 or an active fragment thereof, such as CXCL-1, MCP-1, or an exogenous gene encoding TIMP-1 or an active fragment thereof. This increase in activity may mean that the activity of the same type of protein or enzyme has a higher activity than the activity of an endogenous protein or enzyme that does not or does not have a given genetically engineered parental cell (e. G., Wild type) . The exogenous gene may be expressed in the mesenchymal stem cell or the host cell in an amount sufficient to increase the activity of the protein mentioned relative to the parent cell. The exogenous gene may be introduced into the parent cell through an expression vector. In addition, the exogenous gene may be introduced into the parent cell in the form of a linear polynucleotide. In addition, the exogenous gene may be expressed from an expression vector (e.g., a plasmid) in a cell. In addition, the exogenous gene may be inserted into a genetic material (e.g., a chromosome) in a cell for stable expression.

The mesenchymal stem cells may be those expressing CD90, CD146, CD105 or CD72. In detail, the mesenchymal stem cells provided herein have at least about 20%, 25%, 30%, 35%, 40% or more of CD90, CD146, CD105 or CD72 positive surface markers on the cell surface expressed on the cell surface, , 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or about 99%. In addition, the mesenchymal stem cells provided herein have at least about 70%, at least about 60%, at least about 50% or less of CD45, CD31, CD34, or HLA-DR negative markers for the cell markers expressed on the cell surface , At least 40%, at least 30%, at least 20%, at least 10%, at least 5%, or at least 1%. The term " positive " as used herein in the context of stem cell markers may mean that the markers are present at higher or higher concentrations when compared to other non-stem cells on which the markers are based. In other words, a cell is positive for the label if it can be distinguished from one or more other cell types using the label because any label is present inside or on the cell. It may also mean that the cell has a label at a value greater than the background value, for example, as much as a signal from a cell-measuring device. For example, a cell may be detectably labeled with an antibody specific for CD90, and the cell is " CD90 + " if the signal from the antibody is detectably greater than the control (e.g., background value). As used herein, the term " negative " means that even when an antibody specific to a particular cell surface marker is used, the label can not be detected in comparison to the background value. For example, if a cell can not be detectably labeled with an antibody specific for CD45, the cell is " CD45- ".

Another aspect provides a pharmaceutical composition for treating a thyroid eye disease comprising mesenchymal stem cells as an active ingredient.

Refers to or includes the reduction, progression, or prevention of a disease, disorder or condition, or one or more symptoms thereof, wherein the " active ingredient " or " pharmaceutically effective amount " refers to a disease, disorder or condition, May refer to any amount of composition used in the practice of the invention provided herein to ameliorate, inhibit or prevent progression of one or more symptoms.

The term " thyroid associated ophthalmopathy " (TAO) refers to orbital inflammatory disease caused by hyperthyroidism due to excessive secretion of thyroid hormone. Retraction of the eyelid, protrusion of the eye, restricted morale, decreased vision, diplopia, decreased visual acuity, and the like.

The mesenchymal stem cells may alternatively be used as a culture, a lysate or an extract thereof. The culture, lysate or extract may be a useful alternative when it is difficult to use the cell as it is, and it may exhibit biological activity similar to or equivalent to that of the original cell since it contains components of cells including proteins and the like. The lysate or extract may be obtained using a commercially available cell lysis kit or an extraction kit.

The pharmaceutical composition may be for administration to the eye. The terms " administering ", " introducing " and " transplanting " are used interchangeably and refer to a method of delivering a composition according to one embodiment ≪ / RTI > may refer to the arrangement of the composition according to the invention. May be administered by any suitable route that delivers at least a portion of the cells or cellular components of the composition according to one embodiment to the desired location within the living individual. The survival period of the cells after administration of the individual may be several hours, for example, from several hours to several days, for example, and may be several years or longer.

According to one embodiment, the composition may comprise 0.001% to 80% by weight of mesenchymal stem cells relative to the total weight of the composition. The dose of the composition may be 0.01 mg to 10,000 mg, 0.1 mg to 1000 mg, 1 mg to 100 mg, 0.01 mg to 1000 mg, 0.01 mg to 100 mg, 0.01 mg to 10 mg, or 0.01 mg to 1 mg. In addition, the dose of mesenchymal stem cells may be 1.0 x 10 ⁵ to 1.0 x 10 ⁸ cells / kg (body weight). However, the dose may be variously prescribed depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, route of administration, excretion rate and responsiveness of the patient, These factors can be taken into account to appropriately adjust the dosage. The number of administrations may be one or two or more times within the range of clinically acceptable side effects, and the administration site may be administered at one site or two or more sites. For an animal other than a human, the dosage may be the same as that of a human per kg, or the dosage may be converted into a dose in terms of a volume ratio (for example, an average value) One dose may be administered. Possible routes of administration include oral, sublingual, parenteral (e.g. subcutaneous, intramuscular, intraarterial, intraperitoneal, intrathecal, or intravenous), rectal, topical (including transdermal), inhalation, Device or material. Examples of animals to be treated in accordance with one embodiment include humans and other mammals for the purpose of administration. Specifically, humans, monkeys, mice, rats, rabbits, sheep, cows, dogs, horses, .

The pharmaceutical compositions according to one embodiment may comprise pharmaceutically acceptable carriers and / or additives. Examples thereof include sterilized water, physiological saline, buffering agents (phosphoric acid, citric acid, other organic acids, etc.), stabilizers, salts, antioxidants (such as ascorbic acid), surfactants, suspending agents, isotonic agents, can do. For the topical administration, organic substances such as biopolymers, and inorganic substances such as hydroxyapatite, specifically, collagen matrix, polylactic acid polymer or copolymer, polyethylene glycol polymer or copolymer, and chemical derivatives thereof . When the pharmaceutical composition according to one embodiment is prepared into a formulation suitable for injection, the mesenchymal stem cells may be frozen in a solution state in which the mesenchymal stem cells are dissolved or dissolved in a pharmaceutically acceptable carrier.

The pharmaceutical composition according to one embodiment of the present invention may be formulated into various forms such as suspensions, solubilizers, stabilizers, isotonizing agents, preservatives, adsorption inhibitors, surfactants, diluents, excipients, pH adjusters, Buffers, reducing agents, antioxidants, and the like. Pharmaceutically acceptable carriers and formulations suitable for the present invention, including those exemplified above, are described in detail in Remington ' s Pharmaceutical Sciences, 19th ed., 1995, and the like. The pharmaceutical composition according to one embodiment of the present invention may be formulated into pharmaceutically acceptable carriers and / or excipients in accordance with a method which can be easily carried out by those skilled in the art, Or may be manufactured by penetration into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oil or aqueous media, or in the form of powders, granules, tablets or capsules.

Another aspect provides a composition for a health functional food for preventing or ameliorating thyroid eye diseases, including mesenchymal stem cells, or cultures, lysates, or extracts thereof.

The health food composition may be used together with other food or food ingredients other than the mesenchymal stem cells, and may be appropriately used according to a conventional method. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, the composition of the present specification may be added in an amount of 15 parts by weight or less based on the raw material when the health functional food is prepared. There is no particular limitation on the kind of the health food.

The present inventors have confirmed that the mesenchymal stem cell regenerates the abnormal activity (excessive hyaluronic acid production, adipocyte differentiation, and lipid accumulation) of the fibroblasts in the thyroid eye disease patients, Prevention, or amelioration of a disease or condition.

The pharmaceutical composition for treating the thyroid eye disease containing the mesenchymal stem cell as an active ingredient can restore the abnormal activity of the orbital fibroblast, and thus can be usefully used for the treatment of the thyroid eye disease.

Figure 1A shows the levels of neuroprotective cytokines of hPMSC measured from cell culture medium.
Fig. 1B shows that the markers which can be confirmed as MSC are confirmed on the surface of the hPMSC.
FIG. 2 shows the results of immunoassay for HAS, HA and HAdase contained in normal and TAO patients' tears.
Fig. 3A shows the co-culture of orbital fibroblasts and hPMSC, wherein the change in HAS2 expression was measured by Western blotting.
FIG. 3B shows the co-culture of orbital fibroblasts and hPMSC, wherein the change in HAS2 expression is quantified.
FIGS. 4A and 4B are the results of observing changes in the surface markers of co-cultured fibroblasts after co-culturing normal organs and patient's orbital fibroblasts with hPMSC.
FIG. 5 shows the results of real-time PCR analysis of mRNA expression of PPARγ, ADIPONECTIN and C / EBPα after co-culture of normal organs and patient's fibroblasts with hPMSC.
FIG. 6 shows the result of observing changes in lipid accumulation of fibroblasts after co-culturing normal organs and patient's orbital fibroblasts with hPMSC.
FIG. 7 is a graph showing the effects of mesenchymal stem cells according to one embodiment on the immune response modulators of inflammation-induced cells: AD: adipose derived mesenchymal stem cells, BM: bone marrow derived mesenchymal stem cells, PD: Placenta-derived mesenchymal stem cells, WI-38: fibroblast; a: FOXP3, b: HLA-G, c: hTRL4; * Control vs. Other: Decrease, # Control vs. Other: increase, ** 1ng vs. 10ng: Decrease, ## 1ng vs. 10ng: increased.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Reference example

References 1. Isolation of placenta-derived mesenchymal stem cells

The umbilical cord was separated from the placenta tissue collected during normal placental delivery, receiving informed consent from healthy normal pregnant women in advance. The chorioamniotic membranes were placed in a 50-ml tube, and DPBS was added to remove excess blood. After 20 ml of enzyme solution I (1 mg / ml collagenase type I, 2 mg / ml trypsin, 20 mg / U / ml Dispase, x1 PS in HBSS) was used to scrape the upper part of the chorioamniotic membranes with a sterile slide glass and collect the collected suspensions. 10 ml of Enzyme Solution I was added and mixed evenly. Stem cells were separated from the tissues while repeating the enzyme reaction at 37 ° C for 15 minutes twice. The isolated cell suspension was centrifuged and the separated cells were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin, 1 ug / ml heparin, and 25 ng / ml Fibroblast Growth Factor- 4, FGF-4) supplemented with DMEM / F12. After that, the culture medium was changed every 4 to 5 days. In the first passage, TrypLE of Invitrogen was treated in a 37 ° C incubator for a short time Subcultured

Reference example 2. Orbital  Fibroblast Orbital fibroblast ) Culture and processing

Orbital fibroblasts (4 normal, 4 patients) were taken from a human and cultured in DMEMF12 (Gibco) (10% FBS, and 1% penicillin-streptomycin). The fibroblasts grew in the medium and 2 days later, 5 μg / ml insulin, 1 mM dexamethasone, and 0.5 mM IBMX were added in DMEM (10% FBS) to initiate differentiation into adipocytes (day 0). After 72 hours (day 3), the medium was replaced with DMEM medium supplemented with 10% FBS and 5 μg / ml insulin, followed by DMEM medium supplemented with 10% FBS every other day.

Referential Example 3. orbit  Fibroblast Orbital fibroblast ) Lipid accumulation analysis

The cells were cultured for 10 days in DMEM supplemented with 10% FBS, 33 uM biotin, and 10 ng / ml DMEM supplemented with hPMSC (placenta derived mesenchymal stem cell) 1 μM dexamethasone, 5 μg / ml insulin / w / o IBMX, Dexamethaxone, Insulin for 5 to 10 days, and 1 μM pantothenic acid, 0.2 nM T3, 10 μg / mL transferrin, 0.2 μM prostaglandin I2, 0.1 mM isobutylmethylxanthine ). After 10 days, lipid accumulation of fibroblasts was observed through Oil-Red-O staining.

Reference Example 4. Tear Sampling

Tears were collected from Schirmer strips from normal (n = 13) and thyroid associated ophthalmopathy (TAO) patients (n = 13). The skimmer strips were then transferred to a 0.5 ml tube with a cannula on the bottom, and 30 [mu] L PBS was added. The contents of the tube were transferred to a larger tube (1.5 ml) and centrifuged for 5 minutes (13,000 rpm). The collected tears were stored at -20 ° C.

Reference Example 5. Real-time PCR

On day 8 of culture, hPMSC (2 x 10 ⁵ ) was co-cultured with orbital fibroblasts for 48 hours. Cell lysates were homogenized in TRIzol (Invitrogen, Carlbad, CA, USA) and RNA was extracted. 1 μg of total RNA from each sample was reverse transcribed to synthesize cDNA. cDNA synthesis conditions were as follows: RNA fusion (65 ° C for 1 minute), annealing (25 ° C for 5 minutes), amplification (42 ° C for 60 minutes) and enzyme inactivation (85 ° C for 1 minute).

MRNA expression of each gene was amplified and normalized according to the following PCR conditions: initial fusion (95 ° C., 2 minutes), amplification (95 ° C., 10 seconds; 55 ° C., 20 seconds; ) 40 cycles. PPAR gamma, ADIPONECTIN and C / EBP alpha, primer sets are as follows:

PPAR? FP: 5'-TTGACCCAGAAAGCGATTCC (SEQ ID NO: 1) -3 ', RP: 5'-AAAGTTGGTGGGCCAGAATG (SEQ ID NO: 2) -3'; 3 ', RP: 5'-TTTCACCGATGTCTCCCTTAGG (SEQ ID NO: 4) -3'C / EBPα FP: 5'- TGTATACCCCTGGTGGGAGA (SEQ ID NO: 5) -3', RP: 5'-GGCCGTGATGATGGCAGAGAT 5'-TCATAACTCCGGTCCCTCTG (SEQ ID NO: 6) -3 '. Expression of mRNA of each gene was normalized to 18s rRNA. Data were expressed as folds (mean ± SEM) of lipoprotein-related factors as compared to normal population.

Reference Example 6. Western Blot

Lysates were prepared using RIPA buffer. Equal amounts of total protein were separated by SDS-PAGE and transferred to a membrane. The membranes were immunoblotted at 1: 1000 dilution with anti-HAS1 and HAS2 (Santa Cruz Biotechnology, SA, USA) and the same membrane was incubated with GAPDH (SantaCruz). After washing, the cells were incubated with Horseradish peroxidase-conjugated anti-goat IgG secondary antibody for 3 hours at 1: 10000 dilution. Immunoreactive bands were imaged with an enhanced chemiluminescence solution (Animal Genetics, Suwon, Korea) and detected with ChemiDoc ^™ XRS + System Imager (Bio-Rad Laboratories, Hercules, CA, USA). Protein expression level was normalized to GAPDH. Data were expressed as a fold (mean ± SEM) of HAS2 compared to the normal population.

Reference Example 7 Enzyme-Linked Immunosorbent Assay (ELISA)

Tears from normal and TAO patients were prepared and their levels of hyaluronic acid (Ha) and hyaluronidase (Hyal) were determined by ELISA. This analysis was performed according to the manual of the manufacturer.

Reference Example 8. FACS  analysis

Human fibroblasts (3 x 10 ⁵ ) were dissociated with cell dissociation buffer (Life Technologies) and washed with PBS (2% (v / v) FBS). This was incubated with isotype control IgG or antigen-specific antibody (BD Biosciences, CA, USA) for 20 minutes and used to identify cells. FACS sorting was performed using a FACS vantage flow cytometer (BD Biosciences, CA, USA).

Example 1. Placenta Origin Stem Cells ( placenta derived stem cell )

In order to analyze the characteristics of the placenta-derived mesenchymal stem cells isolated in Reference Example 1, cytokine secretion characteristics and surface antigen characteristics were analyzed. Specifically, the concentration of neurotrophic cytokine was measured in the culture medium of the placenta-derived mesenchymal stem cells through ELISA analysis, and the surface antigen (CD34, CD45, CD90, CD31, HLA -DR, CD146, CD106, and CD73), and the results are shown in FIG.

Figure 1A shows the levels of neuroprotective cytokines of hPMSC measured from cell culture medium. As shown in FIG. 1A, ELISA analysis revealed that secretion of cytokines (CXCL-1, MCP-1, TIMP-1) associated with inflammation and wound healing was increased in cultured hPMSCs.

Figure 1B shows the surface pattern of hPMSC. As shown in FIG. 1B, FACS analysis showed that the mesenchymal cell markers CD90, CD146, CD105 and CD72 were positive.

Example 2. TAO  Identification of increased hyaluronic acid synthesis in patients

Western blots were performed using tears collected from normal subjects and TAO patients (total of 26 samples), and the amount of hyaluronic acid synthase (HAS) was measured. A total of 10 μg protein was loaded. Anti-HAS1 and HAS2 were incubated overnight at 4 < 0 > C. ELISA analysis of tears taken from patients with TAO was also performed.

As a result, it was confirmed that the protein expression of HAS1 and HAS2, which are the hyaluronic acid synthetases, is increased in the tears of the patients as compared with the normal individuals as shown in FIG. As shown in FIG. 2B, the level of Ha was also increased, but the level of HAdase was not significantly changed as shown in FIG. 2C.

As a result of ELISA analysis, the level of hyaluronic acid in the tear of TAO patients was increased, but the level of hyaluronic acid degrading enzyme was not different from that of normal patients. Therefore, it was confirmed that the production of hyaluronic acid is increased by increasing hyaluronic acid synthase in TAO patients.

Example 3. hPMSC  Hyaluronic acid production reduced

Fibroblast culture On the 15th day (day 15), orbital fibroblasts were incubated with IL-1β (20 ng / mL) as a stimulant during induction of lipogenesis. After co-incubation with hPMSC, protein expression of HAS2 was determined.

As shown in FIG. 3A, during the induction process, the expression of HAS2, a hyaluronic acid synthase, was increased in fibroblasts of TAO patients, and the expression of synthetic enzymes increased by co-culture with PMSC was reduced.

As shown in FIG. 3B, the amount of protein expressed by hyaluronic acid synthase HAS2 was quantified. As a result, fibroblasts of TAO patients cultured in fat-derived induction differentiation media showed protein expression of HAS2 about 2.3 times And it decreased by co - culture with PMSC.

Example 4. hPMSC orbit  Identification of effects on fibroblast surface antigen markers

Observations were made of co-culture of orbital fibroblasts from normal and TAO patients with hPMSC. Fibroblasts were analyzed by FACS.

Fibroblast Culture On day 15, fibroblasts were treated with IL-1β (20 ng / mL). After 24 hours of incubation, hPMSC was co-cultured. The co-cultured fibroblasts were classified as CD90 or CD105 as markers. Further, fibroblasts were observed under a microscope.

As shown in FIGS. 4A and 4B, the changes of CD105 and CD90, which are normal and patient fibroblast markers, were found to be changed by co-culture with hPMSC.

Example 5. hPMSC  Adipocyte differentiation ( adipogenesis ) Check the effect on

Orbital fibroblasts from normal and TAO patients were treated with lipid differentiation induction media 1 (33 μM biotin, 17 μM pantothenic acid, 0.2 nM T3, 10 μg / mL transferrin, 0.2 μM prostaglandin I2, 0.1 mM isobutylmethylxanthine (IBMX) , 1 μM dexamethasone, 5 μg / ml insulin) and 5 days to 10 days after induction of lipid differentiation induction media 2 (33 μM biotin, 17 μM pantothenic acid, 0.2 nM T3, 10 μg / mL transferrin, 0.2 μM prostaglandin I 2 , 0.1 mM). On day 8 of culture, hPMSC (2 x 10 ⁵ ) and orbital fibroblasts cultured in fat-differentiated media were co-cultured for 48 hours. Hereinafter, mRNA expression of PPARγ, ADIPONECTIN and C / EBPα, which are representative adipocyte differentiation-related factors, was confirmed as described in Reference Example 5, and the results are shown in FIG.

As a result, as shown in Fig. 5, mRNA expression of PPARγ, ADIPONECTIN and C / EBPα in the fibroblasts of the patient cultured in the differentiation induction medium was increased by 21.5 times, about 80 times, and 33 times, respectively. In contrast, it was confirmed that the expression of PPARγ, mRNA of ADIPONECTIN, and mRNA of C / EBPα were increased to about 8-fold, 33-fold and 12.4-fold, respectively, by co-culture with PMSC. These results suggest that mesenchymal stem cells inhibit the expression of PPARγ, ADIPONECTIN and C / EBPα in orbital fibroblasts. This suggests that mesenchymal stem cells inhibit the adipocyte differentiation of orbital fibroblasts.

Example 6. orbit  Confirmation of lipid accumulation in fibroblasts

The effects of human placenta - derived mesenchymal stem cells on the lipid accumulation of orbital fibroblasts were examined. Specifically, orbital fibroblasts collected from normal and TAO patients were subjected to co-culture with PMSC along with fat-inducing medium. Seven days later, lipid accumulation in the orbital fibroblasts was confirmed as in Reference Example 3 using Oil-Red O staining, and the results are shown in Fig.

As a result, it was confirmed that the lipid accumulation of the fibroblasts of the TAO patients induced in the differentiation medium was decreased by co-culturing with PMSC as shown in Fig.

From the above results, it was confirmed that human placenta-derived stem cells (hPMSC) restore the abnormal activity of fibroblasts in TAO patients.

Example 7. Confirmation of immunoregulatory ability of mesenchymal stem cells

In order to confirm the immunoregulatory ability of the placenta-derived mesenchymal stem cells, adipose-derived mesenchymal stem cells and bone marrow-derived mesenchymal stem cells isolated from Reference Example 1 described above in orbital fibroblasts, naive mesenchymal stem cells were infected with inflammation By treating the factors, the expression of each factor expressed in each mesenchymal stem cell was compared and analyzed by the inflammatory reaction. The adipose-derived mesenchymal stem cells and bone marrow-derived mesenchymal stem cells were supplied from the American Type Culture Collection (ATCC).

Specifically, the mesenchymal stem cells were treated with 1 or 10 ng of inflammatory inducers LPS and IL-1β, respectively. Subsequently, the expression levels of hFOXP3, hHLA-G, and hTRL4, which are immunomodulators, were confirmed by qRT-PCR. Specifically, qRT-PCR is a method of recovering cells that have been treated with an inflammation-inducing factor and using lysing with TRIZOL, cDNA synthesis using reverse transcriptase, gene specific base sequence and Tag. PCR amplification using a DNA polymerase, and electrophoresis of the amplified PCR product on an agarose gel to confirm the presence of the amplified gene. The results of the qRT-PCR analysis are shown in Fig.

FIG. 7 is a graph showing the effects of mesenchymal stem cells according to one embodiment on the immune response modulators of inflammation-induced cells: AD: adipose derived mesenchymal stem cells, BM: bone marrow derived mesenchymal stem cells, PD: Placenta-derived mesenchymal stem cells, WI-38: fibroblast; a: FOXP3, b: HLA-G, c: hTRL4; * Control vs. Other: Decrease, # Control vs. Other: increase, ** 1ng vs. 10ng: Decrease, ## 1ng vs. 10ng: increased.

As shown in FIG. 7, it was found that the mesenchymal stem cells according to one embodiment express more HLA-G, FOXP3, and TLR4 than fibroblasts. In particular, placenta-derived mesenchymal stem cells express not only HLA-G, FOXP3, and TLR4, which are involved in the regulation of the immune response and protect cells from T cell attack, , And the expression level was high even after treatment with the inflammation inducer. By analyzing the expression patterns of the immunological-related factors in a naive state according to the treatment of the inflammation-inducing factor, the expression of the mesenchymal stem cells (in particular, the placenta-derived mesenchymal stem cells showing overexpression of the immunoregulatory factor such as HLA- Cells) could be useful as a therapeutic agent for thyroid eye diseases.

<110> Sungkwang medical foundation <120> A composition comprising mesenchymal stem cell treating          thyroid associated ophthalmopathy <130> PN123453 <150> KR 10-2017-0103723 <151> 2017-08-16 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> fprimer for PPAR <400> 1 ttgacccaga aagcgattc 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for PPAR <400> 2 aaagttggtg ggccagaatg 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for ADIPONECTIN <400> 3 ggccgtgatg atggcagaga t 21 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for ADIPONECTIN <400> 4 tttcaccgat gtctccctta gg 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for C / EBP <400> 5 tgtatacccc tggtgggaga 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for C / EBP <400> 6 tcataactcc ggtccctctg 20

Claims (14)

A mesenchymal stem cell expressing at least one selected from the group consisting of FOXP3 (forkhead box P3), HLA-G (human leukocyte antigen G) and TLR4 (toll-like receptor 4). The mesenchymal stem cell according to claim 1, having the following characteristics a) or b):
a) expressing one or more selected from the group consisting of CXCL-1 (chemokine (CXC motif) ligand 1), MCP-1 (monocyte chemotactic protein 1) and TIMP-1 (tissue inhibitors of metalloproteinases);
b) one or more surface antigen characteristics selected from the group consisting of CD90, CD146, CD105 and CD72. A pharmaceutical composition for treating a thyroid eye disease comprising mesenchymal stem cells as an active ingredient. 4. The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cell comprises a culture, a lysate, or an extract thereof. [Claim 4] The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cells are umbilical cord-derived, umbilical cord blood-derived, bone marrow-derived, placenta-derived or adipose derived mesenchymal stem cells. [Claim 4] The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cells are placenta chorion-derived mesenchymal stem cells. The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cell secretes or expresses at least one of CXCL-1, MCP-1, or TIMP-1. 4. The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cell secretes or expresses at least one of FOXP3, HLA-G, or TLR4. 4. The pharmaceutical composition according to claim 3, wherein said mesenchymal stem cells express at least one of CD90, CD146, CD105 or CD72. [Claim 4] The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cells inhibit differentiation of orbital fibroblasts into adipocytes or hyaluronic acid production. The pharmaceutical composition according to claim 3, wherein the thyroid eye disease is caused by hyperthyroidism. 4. The pharmaceutical composition according to claim 3, wherein the mesenchymal stem cells are for ocular administration. A composition for a health functional food for preventing or ameliorating ocular diseases of the thyroid containing mesenchymal stem cells as an active ingredient. 14. The composition for a health functional food according to claim 13, wherein the mesenchymal stem cell comprises a culture, a lysate, or an extract thereof.

Images