KR20190009093A

KR20190009093A - Composition comprising citrale or as active ingredients for muscle strengthening, development, differentiation, regeneration or inhibiting muscle atrophy

Info

Publication number: KR20190009093A
Application number: KR1020170090871A
Authority: KR
Inventors: 박태선
Original assignee: 연세대학교 산학협력단
Priority date: 2017-07-18
Filing date: 2017-07-18
Publication date: 2019-01-28
Also published as: WO2019017677A2; KR101997335B1; WO2019017677A9; WO2019017677A3

Abstract

The present invention relates to a composition for the prevention or treatment of muscular diseases or a composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient, It is possible to increase the expression of the protein associated with the increase in muscle mass, and the expression of the enzyme involved in the muscle protein degradation can be suppressed from the mRNA level. Therefore, in muscle diseases caused by decreased muscle function, muscle wasting or muscle regeneration, The present invention relates to a method for preventing or treating muscle disorders, which comprises administering an effective amount of at least one compound selected from the group consisting of a compound of formula Can be used for improving the function.

Description

[TECHNICAL FIELD] The present invention relates to a composition containing citral as an active ingredient, which has an effect of strengthening muscle strength, muscle augmentation, muscle differentiation, muscle regeneration or reduction of muscle senility,

The present invention relates to a pharmaceutical composition for preventing and treating muscle diseases containing citral or a pharmaceutically acceptable salt thereof as an active ingredient.

In Korea, the elderly population accounted for 7.2% of the total population in 2000 and entered the aging society. By 2050, it is expected to enter the aging society (more than 20%). The muscle mass of a person decreases with age (10-15% at 50-70 years of age, and 30% at 70-80 years of age), resulting in a weakening of muscle strength and myofunction. This is followed by sarcopenia, Quot; Elderly myopenia leads to dysfunctional and gait disturbances and is a major cause of restricting the independent life of the elderly. In addition, myopenia reduces basal metabolic rate, increases insulin resistance, promotes the development of type 2 diabetes, and increases the risk of hypertension and cardiovascular disease by 3-5 times. Currently, there are no approved drugs for the treatment of myopinia. Drug repositioning techniques are being developed to apply myostatin inhibitors or other existing FDA-approved drugs to myopenia.

Muscles are divided into skeletal muscle, cardiac muscle, and visceral muscle, of which skeletal muscle is the most abundant in the human body, accounting for 40-45% of body weight. The skeletal muscle attaches to the bone through the tendon and acts to create movement or force of the bone. One muscle is made up of a number of muscle fibers, and the muscle fibers are made of numerous myofibers composed of actin and myosin. When actin and myosin overlap each other, muscle length is shortened or lengthened, causing overall muscle contraction and relaxation. An increase in myofibrillar size means an increase in muscle fiber thickness, resulting in an increase in muscle mass.

The types of muscle fibers constituting the muscles are mainly classified into Type I, Type IIA and Type IIB depending on the metabolic process that causes ATP and the rate of contraction. Type I muscle fibers are slow to contract and contain a large number of myoglobin and mitochondria, making them suitable for sustained, low-intensity aerobic activity. Type I muscle fibers are reddish, so they are also called red muscles, and the soleus is a typical example. On the other hand, 'Type IIB muscle fiber' has a very short contraction rate and is used for anaerobic exercise with a very short intensity but it has a low content of myoglobin and is white. 'Type IIA muscle fiber' has the intermediate characteristics of the two muscle fibers mentioned above. As you get older, not only does the composition of type I and II muscle fibers of your muscle vary, but also all types of muscle fibers are reduced.

The skeletal muscle has characteristics that are regenerated and maintained according to the environment, but these characteristics disappear with aging, and as a result, as the aging progresses, the muscular volume decreases and the muscular strength is also lost. The signaling pathway involved in muscle growth and regeneration is signaling to regulate protein synthesis mediated by insulin like growth factor 1 (IGF-1) / AKT. Activation of IGF-1 receptor (IGF-1R) in muscle cell membranes increases AKT phosphorylation through IRS1 and PI3K phosphorylation and activates mTORC phosphorylation. Activation of mTORC increases phosphorylation of ribosomal protein S6 kinase beta-1 (p70S6K1), thereby increasing mRNA translation, increasing eukaryotic translation initiation factor 4 (eIF4G) activity, and inducing eukaryotic translation initiation factor 4E binding protein 1 < / RTI > (4E-BP1) protein. eIF4G and 4E-BP1 are involved in the formation of an eIF4F complex, that is, eIF4G binds eIF4A and eIF4E to form an eIF4F complex, while 4E-BP1 is phosphorylated to inhibit eIF4E binding and increase free eIF4E . The latter combines with other translation initiation factors (eIF4G and eIF4A) to form an eIF4F complex and the resulting eIF4F complex stabilizes the ribosome structure, facilitating translation initiation and ultimately increasing protein synthesis (Bodine et al., Akt / mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy in vivo, Nature cell biology, 3, 1014-1019, 2001).

In addition, AKT phosphorylation enhances eIF2B expression through glycogen synthase kinase 3 (GSK3), which promotes muscle fiber growth and suppresses muscle loss by suppressing expression of forkhead box O (FOXO), a proteolytic transcription factor. Muscle relaxation is regulated by signaling mediated by TGF-β family receptors including myostatin, transforming growth factor beta (TGF-β), and activin. The binding of the ligand to the TGF-β type II receptor phosphorylates the type I receptor, while the latter phosphorylates the smad 2/3 complex and ultimately activates FOXO. The latter increases gene expression of the muscle-specific ubiquitin-ligase, muscle RING-finger protein-1 (MURF1) and Muscle Atrophy F-Box (MAFbx) / atrogin-1, which attaches ubiquitin to the lysine site of the target protein Promotes protein degradation, and ultimately leads to muscle loss. (Gumucio et al., Atrogin-1, MuRF-1, and sarcopenia, Endocrine, 43, 12-21, 2013).

Meanwhile, Citral is registered in the Korean Food Additives Codex (KFAC) and the Food and Drug Association (FDA) Food Additives Database and is used for food flavor. It is also stated that citral can be used for the sweetener and fragrance blending of cosmetics in the cosmetics raw material listing of Korea Cosmetics Association. Until now, citral has been known to exhibit antifungal and antioxidative physiological activities (Non-Patent Document 1 and Non-Patent Document 2), and it has been found that when administered by a route such as oral administration or transdermal administration, Have been reported to exhibit significant physiological activity (Non-Patent Documents 3 to 5).

Accordingly, the present inventors have determined that the demand for a pharmaceutical composition, a health functional food, or a cosmetic composition showing an effect of preventing muscle weakness and improving muscle function in the modern society in which aging continues is continuously expected to increase, , Citral was found to be capable of reducing myofunctional activity and enhancing muscle synthesis in muscle cells.

Silva, et al. &Quot; Antifungal activity of the lemongrass oil and citral against Candida spp. &Quot; Brazilian Journal of Infectious Diseases 12: 63-66, 2008 Wang, et al. &Quot; Antioxidant activity, free radical scavenging potential and chemical composition of Litsea cubeba essential oil " Journal of Essential Oil Bearing Plants 15: 134-143, 2012). P.M. et al. "Food flavorings and compounds of related structure I. Acute oral toxicity" Food and Cosmetics Toxicology. 2: 327-343, 1964). Eric Boyland " Experiments on the chemotherapy of cancer " Biochemical Journal. 34: 1196-1201, 1940). G.M. Jackson et al. &Quot; Comparison of the short-term hepatic effects of orally administered citral in long-evans hooded and wistar albino rats " Food and Chemical Toxicology. 25: 505-513, 1987).

The present invention is intended to provide a pharmaceutical composition for preventing or treating muscle diseases comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to solve the above problems, the present invention provides a pharmaceutical composition for preventing or treating muscle diseases, which comprises citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a pharmaceutical composition for increasing muscle mass or promoting muscle formation comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for increasing muscle mass or promoting muscle formation comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a health functional food composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention also provides a cosmetic composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

In the composition of the present invention, the citral may be a compound having a structure represented by the following Chemical Formula 1:

[Chemical Formula 1]

.

In the composition of the present invention, the citral or a pharmaceutically acceptable salt thereof may increase the expression of p-4E-BP1 and p-p70S6K proteins.

In the composition of the present invention, the citral or a pharmaceutically acceptable salt thereof may reduce the expression of MuRF1 (Muscle Ring-Finger Protein), MaFbx (Muscle atrophy F-box) or Myostatin.

In the composition of the present invention, the muscle disorder may be a muscle disorder caused by muscle weakness, muscle weakness, muscle atrophy, muscle wasting or muscle degeneration, more specifically atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis, rigid spinsesyndrome, Charcot- Marie-Tooth disease) and sarcopenia (sarcopenia).

Figure 1 shows changes in the thickness of myotubes in mouse myoblasts.
Figure 2 shows confirmation of mRNA expression levels (Figure 2a) and protein expression levels (Figure 2b) changes in proteolytic and synthetic molecules in mouse myoblasts treated with citral.

Hereinafter, the terminology of the present invention will be described.

Of the present invention "citral (citral)" is a terpenoid or a mixture of one pairs of molecular formula C ₁₀ H ₁₆ O. The molecular weight is 152.24 and has the structure of the following formula (1)

[Chemical Formula 1]

.

Citral has a double bond isomer, of which the E-isomer is called Guaranyl or Citral A, and the Z-isomer is called Neral or Citral B. The Citrus IUPAC name is 3,7-dimethylocta-2,6-dienal, and geranialdehyde; 3,7-dimethyl-2,6-octadienal; Lemonal; It is also called tinnitus, such as geranial.

Citral exists as a transparent liquid at room temperature, is colorless or pale yellowish, and is soluble in alcohol. Citrall is known to have a fragrance component, citrus, in particular fresh, juicy, lemon peel, with a sweet tangy green nuance, lime, woody and herbal fragrance.

As used herein, the term " muscle " refers collectively to the tendons, muscles, and tendons, and " muscular function " refers to the ability to exert its force by contraction of muscles. In order to overcome resistance, Muscular endurance, which is the ability to show how long the muscle can repeat contraction and relaxation on a given weight, and the ability to exert strength in a short period of time. Such muscle function is proportional to muscle mass, and "muscle function improvement" means improving muscle function better.

Hereinafter, the present invention will be described in detail.

Pharmaceutical compositions for preventing or treating muscle disorders

The present invention provides a pharmaceutical composition for preventing or treating muscle diseases, which comprises citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

In the pharmaceutical composition of the present invention, the citral is preferably a compound having a structure represented by the following formula (1), but is not limited thereto, and can be understood by those skilled in the art to have the same or similar activity as citral All isomers, hydrates or derivatives of the range are applicable:

[Chemical Formula 1]

.

The method of obtaining the citral is not particularly limited, and it may be separated from the plant containing the citral, chemically synthesized using a known production method, or commercially available.

In the pharmaceutical composition of the present invention, the citral or pharmaceutically acceptable salt thereof may increase the expression of the p-4E-BP1 and p-p70S6K proteins, and may be used for the expression of MuRF1 (Muscle Ring-Finger Protein), MaFbx Muscle atrophy F-box) or Myostatin. Specifically, p70S6K1, 4E-BP1, and eIF members are representative molecules involved in protein synthesis, and these three molecules are regulated by higher mTORCs. Activation of mTORc phosphorylates p70S6K1 and activated p70S6K1 phosphorylates the 40S ribosomal protein S6 to increase mRNA translation. Activation of mTORC also increases the activity of eIF4G and phosphorylates 4E-BP1, both of which are involved in the formation of the eIF4F complex. In other words, eIF4G binds eIF4A and eIF4E to form an eIF4F complex, while 4E-BP1 is phosphorylated, which inhibits binding to eIF4E and increases free eIF4E. The latter combines with other translation initiation factors (eIF4G and eIF4A) to form the eIF4F complex, which stabilizes the ribosome structure, thereby facilitating translation initiation and ultimately increasing protein synthesis. MAFbx / Atrogin-1 and MuRF1 are muscle-specific ubiquitin-ligase, which attaches ubiquitin to the lysine site of the target protein to promote protein degradation and muscle reduction. The pharmaceutical composition of the present invention is MuRF1 (Muscle Ring-Finger Protein) or MaFbx (Muscle atrophy F-box).

In the pharmaceutical composition of the present invention, the muscle disorder includes a range of diseases caused by muscle weakness, muscle weakness, muscle atrophy, muscle wasting or muscle degeneration. Specifically, the muscle disorder may be atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis (amyotrophic lateral sclerosis, rigid spinsesyndrome, Charcot-Marie-Tooth disease, and sarcopenia. However, the present invention is not limited thereto. In addition, the muscle wasting or degeneration is caused by total factors, acquired factors, aging, etc., and muscle wasting is characterized by gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal muscle or veterinary muscle and heart muscle.

In addition, from the viewpoint of using the pharmaceutical composition of the present invention for muscle differentiation promotion, muscle regeneration or muscle strengthening, the differentiation of muscle cells is a muscle developmental program that specifies components of muscle fiber such as a contractile organ (miopyril) program. A useful therapeutic agent for differentiation is an amount of at least about 10%, more preferably at least 50%, and most preferably at least 100%, of the amount of all muscle fiber components in the diseased tissue, as compared to an equivalent tissue in a similarly treated control animal .

In addition, from the viewpoint that the pharmaceutical composition of the present invention is used for promoting muscle differentiation, muscle regeneration or muscle strengthening use, or for use in increasing muscle mass, muscle growth is caused by an increase in the fiber size and / Can be caused by an increase in the number. The muscle growth can be measured by A) an increase in wet weight, B) an increase in protein content, C) an increase in the number of myofibers, and D) an increase in myofiber diameter. The increase in muscle fiber growth can be defined as the increase in diameter when the diameter is defined as the short axis of the section ellipsoid. A useful therapeutic agent is one that is at least 10% more muscle-degenerated than the previously similarly treated control animal (i. E., An animal having degenerated muscle tissue not treated with a muscle growth compound) The diameter is increased by 10% or more, more preferably by 50% or more, and most preferably by 100% or more. Compounds that increase growth by increasing the number of muscle fibers are useful as therapeutic agents when it increases the number of muscle fibers in the diseased tissue by at least 1%, more preferably by at least 20%, and most preferably by at least 50%. These percent values are determined relative to baseline levels in untreated, non-diseased, comparable mammals, or in non-adulterated muscles, when the compound is administered and locally acting.

In addition, from the viewpoint of using the pharmaceutical composition of the present invention for promoting muscle differentiation, muscle regeneration, or muscle strengthening, muscle regeneration refers to a process in which new muscle fibers are formed from muscle buds. Useful therapeutic agents for regeneration increase the number of new fibers by at least about 1%, more preferably at least 20%, and most preferably at least 50%, as described above.

In addition, from the viewpoint of using the pharmaceutical composition of the present invention for increasing the amount of muscle or promoting muscle growth, the term " increasing the amount of muscle " means improving the growth of muscle particularly among the body components. And the amount of muscle can be increased by administering a substance having an effect of increasing muscle, and the type of muscle is not limited.

In the pharmaceutical composition of the present invention, it is preferable that the capacity of the citral be included in a concentration of 0.1 μM to 1000 μM, but the present invention is not limited thereto. At this time, when the citral concentration is lower than the above-mentioned concentration range, there is a problem that the protein synthesis and degradation activity is lowered in the muscle cells and the effect of preventing or treating muscular diseases is difficult to be exhibited. When the citral concentration exceeds the above range, There may be concerns about toxicity, including

The citral of the present invention can be used in the form of a pharmaceutically acceptable salt, and as the salt, acid addition salt formed by a pharmaceutically acceptable free acid is useful. Acid addition salts include those derived from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid or phosphorous acid, and aliphatic mono- and dicarboxylates, phenyl-substituted alkanoates, hydroxyalkanoates, Dioleate, aromatic acid, aliphatic and aromatic sulfonic acids. Such pharmaceutically innocuous salts include, but are not limited to, sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, nitrate, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate chloride, bromide, Butyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, succinate, maleic anhydride, maleic anhydride, , Sebacate, fumarate, maleate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, Methoxybenzoate, phthalate, terephthalate, benzene sulfonate, toluene sulfonate, chlorobenzene sulfide Propyl sulphonate, naphthalene-1-yne, xylenesulfonate, phenylsulfate, phenylbutyrate, citrate, lactate,? -Hydroxybutyrate, glycolate, maleate, Sulfonate, naphthalene-2-sulfonate or mandelate.

The acid addition salt according to the present invention may be prepared by a conventional method, for example, by dissolving the citral in an excess amount of an acid aqueous solution, and using the salt in a water-miscible organic solvent such as methanol, ethanol, acetone or acetonitrile Followed by precipitation. By heating the same amount of citric acid and an acid or alcohol in water, then evaporating the mixture and drying, or by suction filtration of the precipitated salt.

In addition, bases can be used to make pharmaceutically acceptable metal salts. The alkali metal or alkaline earth metal salt is obtained, for example, by dissolving the compound in an excess amount of an alkali metal hydroxide or an alkaline earth metal hydroxide solution, filtering the insoluble compound salt, and evaporating and drying the filtrate. At this time, it is preferable for the metal salt to produce sodium, potassium or calcium salt. The corresponding silver salt is also obtained by reacting an alkali metal or alkaline earth metal salt with a suitable salt (such as silver nitrate). In addition, the citral of the present invention includes not only pharmaceutically acceptable salts, but also all salts, hydrates and solvates which can be prepared by conventional methods.

The addition salt according to the present invention can be prepared by a conventional method, for example, by dissolving citral in a water-miscible organic solvent such as acetone, methanol, ethanol, or acetonitrile, adding an excessive amount of organic acid, Adding an aqueous solution, and precipitating or crystallizing it. Subsequently, in this mixture, a solvent or an excess acid is evaporated and dried to obtain an additional salt, or the precipitated salt may be produced by suction filtration.

The pharmaceutical composition of the present invention may be various oral or parenteral formulations. When formulating the composition, one or more buffers (e.g., saline or PBS), antioxidants, bacteriostats, chelating agents (e.g., EDTA or glutathione), fillers, extenders, binders, adjuvants Aluminum hydroxide), suspending agents, thickening agents, disintegrating agents or surfactants, diluents or excipients.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient, such as starch (cornstarch, wheat starch, rice starch, potatoes Starch and the like), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose - It is prepared by mixing cellulose or gelatin. For example, tablets or tablets may be obtained by combining the active ingredient with a solid excipient, then milling it, adding suitable auxiliaries, and processing the mixture into granules.

In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions or syrups. In addition to water and liquid paraffin which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances or preservatives are included . In addition, crosslinked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may optionally be added as a disintegrant, and may further include an anticoagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and an antiseptic agent .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations or suppositories. Examples of non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol, gelatin and the like can be used.

The pharmaceutical composition of the present invention may be administered orally or parenterally, and may be administered externally for parenteral administration; Intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine, or intracerebral injection; Percutaneous administration agents; Or in the form of a nasal inhaler, according to methods known in the art.

In the case of such injections, they must be sterilized and protected against contamination of microorganisms such as bacteria and fungi. Examples of suitable carriers for injectables include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and / or vegetable oils . More preferably, suitable carriers include isotonic solutions such as Hanks' solution, Ringer's solution, phosphate buffered saline (PBS) containing triethanolamine, or sterile water for injection, 10% ethanol, 40% propylene glycol and 5% dextrose Etc. may be used. In order to protect the injection from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal and the like may be further included. In addition, the injections may in most cases additionally include isotonic agents, such as sugars or sodium chloride.

Examples of transdermal dosage forms include ointments, creams, lotions, gels, solutions for external use, pastes, liniments, and air lozenges. In the above, transdermal administration means that the pharmaceutical composition is locally administered to the skin, so that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin.

In the case of an inhalation dosage form, the compounds used according to the invention can be formulated into a pressurized pack or a pressurized pack using a suitable propellant, for example dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gases. It can be conveniently delivered in the form of an aerosol spray from a nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve that delivers a metered amount. For example, gelatin capsules and cartridges for use in an inhaler or insufflator may be formulated to contain a compound, and a powder mixture of a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975. Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, commonly known in all pharmaceutical chemistries.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, " pharmaceutically effective amount " means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type of disease, severity, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts. The pharmaceutical composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. That is, the total effective amount of the pharmaceutical composition of the present invention can be administered to a patient in a single dose and administered by a fractionated treatment protocol administered over a long period in multiple doses . It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the pharmaceutical composition of the present invention varies depending on the patient's body weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and disease severity. The daily dose is preferably such that it is preferably administered in an amount of 0.01 to 50 mg, more preferably 0.1 to 30 mg per kg of body weight per day on a citral basis during parenteral administration, and when administered orally, It may be administered in one to several divided doses so as to be preferably administered in an amount of 0.01 to 100 mg, more preferably 0.01 to 10 mg per kg of body weight per day on the basis of citral. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

The pharmaceutical composition of the present invention can be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

The pharmaceutical composition of the present invention can also be provided as a formulation of a topical preparation containing citral as an active ingredient. When the pharmaceutical composition for the prevention and treatment of muscle diseases according to the present invention is used as an external preparation for skin, it may further contain a fatty substance, an organic solvent, a solubilizer, a thickening agent and a gelling agent, a softener, an antioxidant, a suspending agent, a stabilizer, Surfactants, water, ionic emulsifiers, nonionic emulsifiers, fillers, sequestering agents, chelating agents, preservatives, vitamins, blocking agents, wetting agents, essential oils, dyes, pigments, hydrophilic active agents, lipophilic active agents Or any other ingredient conventionally used in skin topical agents such as lipid vesicles. The components can also be introduced in amounts commonly used in the field of dermatology.

When the pharmaceutical composition for preventing or treating muscle disorders of the present invention is provided as an external preparation for skin, it may be a formulation such as ointments, patches, gels, creams or sprays.

Health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening

In the health functional food composition, the content of the citral is as described above.

In the health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening according to the present invention, when citral is used as an additive for a health functional food, it can be added as it is or used together with other food or food ingredients, And the like. The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, the citral may be added in an amount of not more than 15 parts by weight, preferably not more than 10 parts by weight based on 100 parts by weight of the raw material in the production of food or beverage. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. Further, since the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, A thickening agent, a pH adjusting agent, a stabilizer, a preservative, a glycerin, an alcohol, and a carbonating agent used in a carbonated drink. In addition, the health functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening of the present invention may contain flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Cosmetic composition for improving muscle function

The present invention also provides a cosmetic composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient. The cosmetic composition is not particularly limited, but it can be used for external use on the skin or can be ingested orally.

The composition for improving muscle function of the present invention may also be a cosmetic composition. The cosmetic composition of the present invention contains citral as an active ingredient and is combined with a skin-care-acceptable excipient in combination with a basic cosmetic composition (cleanser, pack, body oil such as lotion, cream, essence, cleansing foam and cleansing water) (Such as foundation, lipstick, mascara, make-up base), hair product composition (shampoo, rinse, hair conditioner, hair gel) and soap.

Such excipients include, but are not limited to, emollients, skin penetration enhancers, colorants, perfumes, emulsifiers, thickeners and solvents. In addition, it may further contain flavors, pigments, bactericides, antioxidants, preservatives, moisturizers and the like, and may include thickeners, inorganic salts and synthetic polymeric substances for the purpose of improving physical properties. For example, when the cleanser and the soap are prepared with the cosmetic composition of the present invention, the citral can be easily added to the common cleanser and soap base. In the case of producing a cream, it can be prepared by adding citral or a salt thereof to a cream base of a general underwater type (O / W). A synthetic or natural material such as a flavor, a chelating agent, a coloring matter, an antioxidant, an antiseptic, and a protein, a mineral, and a vitamin for the purpose of improving a physical property may be further added.

The content of citral contained in the cosmetic composition of the present invention is not limited thereto, but is preferably 0.001 to 10% by weight, more preferably 0.01 to 5% by weight, based on the total weight of the whole composition. If the content is less than 0.001% by weight, the desired anti-aging or wrinkle-reducing effect can not be expected. If the content is more than 10% by weight, safety or formability may be difficult.

Hereinafter, the present invention will be described in more detail with reference to examples and preparation examples. It should be apparent to those skilled in the art that these examples and preparations are only for illustrating the present invention and that the scope of the present invention is not construed as being limited by these examples and preparations .

Confirmation of inhibition effect of citral on muscle loss using mouse myoblast

In order to confirm the effect of inhibiting citrus muscle loss, muscle damage was induced in differentiated myotubes from mouse myoblasts, and citral treatment was performed to confirm the degree of injury of canalicular cells.

Cell culture

First, differentiation was induced from mouse myoblasts to canaliculus cells. Mouse myoblast cell line (C2C12 cell) was purchased from ATCC (Manassas, VA, USA). The purchased cells were inoculated into 10% fetal bovine serum media (Gibco-BRL) and cultured in a 5% CO ₂ incubator at 37 ° C. When the confluent of cells attached to the medium reached 80% or more, cells were transferred to 2% horse serum medium (Gibco-BRL) to differentiate myoblasts into canaliculus cells.

Causing muscle damage

Root reduction was induced by treatment with 50 μM dexamethasone (dexam; dexa; Sigma Aldrich, USA) for 2 days (48 hours) from the 4th day after induction of differentiation into canaliculus cells. In order to confirm the effect of inhibiting muscle loss, 100 μM citral (CAS No. 112-31-2, Sigma Aldrich, USA) was treated with dexamethasone and cultured.

As the untreated control group, cells treated with dexamethasone alone without citral treatment were used.

Measurement of canalicular cell thickness

After completion of the incubation, the cells were washed twice with phosphate buffered saline (PBS), and fixed with 100% methanol for 10 minutes. After the fixation was completed, the cells were naturally dried at room temperature for 10 minutes and stained with giemsa-wright staining solution (Asan Pharm, Seoul) for specifically staining myotube. The cells were stained for 30 minutes at room temperature.

Stained canaliculus cells were photographed using a fluorescence microscope (IX 71, Olympus) at × 10 magnification and analyzed using image J software (USA). Six sections were randomly selected in each well under a microscope and at least 100 canine cell thicknesses were analyzed from each well (3 replicates / group).

Experiment result

As a result of confirming the protective effect of citral in root canal cells differentiated from mouse myoblasts, the thickness of canalicular cells was significantly reduced in the non-treated control group (Dexa) treated with dexamethasone alone compared with normal cells (basal, dexamethasone treated group) It was confirmed that dexamethasone reduced the thickness of canaliculus cells when treated with citral (Fig. 1A). When quantitatively quantified, it showed an increase effect of + 41% level by citral treatment compared to dexamethasone-induced cancellous cell decrease (FIG. 1B). Thus, it was confirmed that citral increased root canal cell thickness derived from mouse myoblast, thereby suppressing muscle loss and promoting muscle growth.

Identification of mechanism of action of muscle protection by citral

It has been confirmed that citral protects root canal cells, suppresses muscle loss, and promotes muscle growth. Therefore, in order to determine what kind of intracellular process citral can exert to protect muscles, The expression levels of representative molecules in the cell were observed.

Determination of mRNA expression level by RNA extraction and RT-PCR

In the same manner as in [Example 1], root canal cells were induced to differentiate from myoblasts, and dexamethosone and / or citral were treated and cultured. After completion of the culture of all the experimental groups and the control group, each cell was obtained, and 334 쨉 l of 334 쨉 l trizol solution per 1 x 10 ⁷ cells of the root canal was added and changed. The mixture was centrifuged at 12,000 x g for 10 minutes Respectively. Then, the supernatant was transferred to a new tube, and 67 μl of chloroform was added and mixed by vortexing. In the mixed solution, the supernatant was transferred to a new tube, isopropanol was added at a ratio of 1: 1 (v: v) to the supernatant, and the mixture was vigorously shaken about 10 times and left at room temperature for 15 minutes. After centrifugation at 12,000 × g for 10 minutes at 4 ° C., the supernatant was removed. 1 ml of 70% ethanol was added to the precipitate, and the ethanol was removed by centrifugation at 7,500 × g for 5 minutes at 4 ° C., And dried for 15 minutes. Finally, the precipitated RNA was dissolved in nuclease free water to obtain RNA extracted from the cells. The RNA was measured for absorbance at wavelengths of 260 nm and 280 nm in a UV / VIS spectrophotometer to confirm the concentration and the integrity of the RNA samples was confirmed by electrophoresis.

Reverse transcription-polymerase chain reaction (RT-PCR) was performed using the prepared RNA samples. CDNA was synthesized by performing the reverse transcription step using oligo dT primer and superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) using the RNA sample as a template. The synthesized cDNA was used as a template again and PCR was performed using the primer pair (forward primer, reverse primer) shown in Table 1 below. Each primer was constructed based on the 5 'and 3' flanking sequences of the template gene cDNA to be amplified. After completion of the PCR, 1 μl of the amplified PCR product was electrophoresed on 1% agarose gel to confirm the DNA band generated.

The primer sequence used for RT-PCR Target gene primer
direction Sequence (5` → 3`) Tm (占 폚) PCR product
Length (bp) MaFbx
(synonym: atrogin-1) F GTCCAGAGAGAGGGCAAGTC 63 141 R GTCGGTGATCGTGAGACCTT MuRF1
(synonym: TRAM63) F ACATCTACTGTCTCACGTGT 58 106 R TGTCCTTGGAAGATGCTTTG Myostatin F TCACGCTACCACGGAAACAA 60 166 R AGGAGTCTTGACGGGTCTGA IGF F GGGGACTTTCGTGACTGAGC 60 165 R GGTAGGTCCGGGTCGTTTAC GAPDH F GTGATGGCATGGACTGTGGT 55 163 R GGAGCCAAAAGGGTCATCAT

Identification of changes in protein expression levels by Western blot

In the same manner as in [Example 1], root canal cells were induced to differentiate from myoblasts, and dexamethosone and / or citral were treated and cultured. After completion of the incubation of all experimental groups and control groups, the medium was removed and lysis buffer was added to each well to dissolve the cells. The dissolution buffer contained 5 mM EDTA, 50 mM sodium pyrophosphate, 50 mM NaF, 100 mM orthovanadate, 1% Triton X-100, 1 mM phenylmethanesulfonyl fluoride, PMSF), 2 g / mL aprotinin, 1 μg / mL pepstatin A and 1 μg / mL leupeptin was used. Respectively. Cells were lysed and centrifuged at 1,300 x g for 20 minutes at 4 DEG C, and then the middle layer was taken as a protein layer in the cell extract. Protein concentration was determined by the Bradford method.

40 ㎍ of the quantified protein was electrophoresed by SDS-PAGE, and proteins separated by a nitrocellulose membrane (Amersham, Buckinghamshire, UK) were transferred. Then, the membrane was washed three times for 10 minutes using a tris-buffered saline solution and a tween 20 solution (TBS-T), followed by washing with 10% skim milk The membrane was blocked for 60 minutes. The primary antibody diluted at a ratio of 1: 1,000 was added to the blocked membrane, and the antibody was bound to the protein by gently shaking at 4 ° C for 12 hours. Then, the antibody was washed with TBS-T, diluted with a ratio of 1: 2,000 The secondary antibody was added and the secondary antibody bound to the primary antibody for 60 minutes, followed by washing. The primary antibodies used were p70S6K1, phopho-p70S6K1 (p-p70S6K1), 4E-BP1, phospho-4E-BP1 (p-4E-BP1) and GAPDH (Cell Signaling Technology, Beverly, MA, USA) Respectively. Finally, the protein bound to the antibody was visualized on an X-ray film using an ECL Western blot detection kit (RPN2106, Amersham, Arlington Heights, IL, USA). Visualized bands were scanned on X-ray film and quantified with Quantity One analysis software (Bio-Rad).

Experiment result

The expression of cytolytic protein synthesis and degradation related molecules in mouse myoblasts was examined. In the control cells (Dexa), the amounts of p-4E-BP1 and p-p70S6K1 proteins, which are involved in protein synthesis, were significantly decreased compared with that of normal cells, whereas the protein degradation genes MaFbx / atrogin1 and MuRF1 Respectively. Citral treatment significantly increased the amounts of p-4EBP1 and p-p70S6K1 proteins reduced by desamethasone, while significantly reducing the expression of MaFbx / atrogin1, MuRF1, Myostatin (FIG. 2). Thus, citral may increase the phosphorylation of 4E-BP1 and p70S6K1 protein in mouse myoblasts and inhibit the expression of MaFbx / atrogin1, MuRF1 and Myostatin genes and ultimately contribute to the increase of muscle mass.

Hereinafter, a production example of medicines, foods or cosmetics containing the citral according to the present invention as an active ingredient will be described, but the present invention is not intended to be limited thereto but is specifically described. The medicines, food or cosmetic compositions of Preparation Examples 1 to 4 were prepared according to the conventional methods according to the following composition components and composition ratios with the extracts excellent in the prevention and treatment of muscular diseases or the improvement of muscular function.

[Preparation Example 1] Preparation of pharmaceutical composition

<1-1> Preparation of powder

Citral 20 mg

Lactose baggage 100 mg

Talc 10 mg

The above ingredients were mixed and filled in an airtight container to prepare powders.

<1-2> Preparation of tablets

Citral 10 mg

Corn starch 100 mg

Lactose baggage 100 mg

Magnesium stearate 2 mg

After mixing the above components, tablets were prepared by tableting according to a conventional method for producing tablets.

&Lt; 1-3 > Preparation of capsules

Citral 10 mg

Microcrystalline cellulose 3 mg

Lactose baggage 14.8 mg

Magnesium stearate 0.2 mg

After mixing the above components, the capsules were filled in gelatin capsules in accordance with the usual methods for preparing capsules.

&Lt; 1-4 > Preparation of injection

Citral 10 mg

Mannitol 180 mg

Sterile sterilized water for injection 2974 mg

Sodium hydrogen phosphate 26 mg

After the above components were mixed, they were prepared with the above ingredient contents per 1 ampoule (2 mL) according to the usual injection preparation method.

<1-5> Preparation of liquid agent

Citral 10 mg

Isomer 10 mg

Mannitol 5 mg

Purified water Suitable amount

Lemon incense Suitable amount

The components are dissolved in purified water according to the usual preparation method, and the lemon flavor is added in an appropriate amount. Then, purified water is added to adjust the total volume to 100 mL, sterilized and filled in a brown bottle to prepare a liquid preparation.

[Preparation Example 2] Preparation of health food

<2-1> Production of health supplement foods

Citral 10 mg

Vitamin mixture Suitable amount

Vitamin A Acetate 70 [mu] g

Vitamin E 1.0 mg

Vitamin B_One 0.13 mg

Vitamin B₂ 0.15 mg

Vitamin B₆ 0.5 mg

Vitamin B₁₂ 0.2 [mu] g

Vitamin C 10 mg

Biotin 10 [mu] g

Nicotinic acid amide 1.7 mg

Folic acid 50 [mu] g

Calcium pantothenate 0.5 mg

Mineral mixture Suitable amount

Ferrous sulfate 1.75 mg

Zinc oxide 0.82 mg

Magnesium carbonate 25.3 mg

Potassium monophosphate 15 mg

Dicalcium phosphate 55 mg

Potassium citrate 30 mg

Calcium carbonate 100 mg

Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a composition suitable for health food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above ingredients are mixed according to a conventional method for producing healthy foods , Granules can be prepared and used in the manufacture of health food compositions according to conventional methods.

<2-2> Manufacture of health drinks

Citral 10 mg

Vitamin C 15 g

Vitamin E (powder) 100 g

Iron lactate 19.75 g

Zinc oxide 3.5 g

Nicotinic acid amide 3.5 g

Vitamin A 0.2 g

Vitamin B_One 0.25 g

Vitamin B₂ 0.3 g

Purified water dose

The above components were mixed according to a conventional health drink manufacturing method, and the mixture was stirred and heated at 85 for about 1 hour. The resulting solution was filtered and sterilized in a sterilized 2 l vessel. The resulting solution was refrigerated, Used in the manufacture of health beverage compositions.

Although the compositional ratio is relatively mixed with a component suitable for a favorite drink, it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as the demand class, the demanding country, and the use purpose.

[Preparation Example 3] Preparation of cosmetic composition

Hereinafter, a preparation example of a cosmetic composition containing the extract of the present invention will be described, but the present invention is not intended to be limited thereto but is specifically explained.

<3-1> Nourishing lotion (milk lotion)

Citral 2.0 wt%

Squalane 5.0 wt%

Wax 4.0 wt%

Polysorbate 60 1.5 wt%

Sorbitan sesquioleate 1.5 wt%

Liquid paraffin 0.5 wt%

Caprylic / capric triglyceride 5.0 wt%

glycerin 3.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Carboxyvinyl polymer 0.1 wt%

Triethanolamine 0.2 wt%

Preservative, coloring, fragrance Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional lotion, the compounding ratio thereof may be arbitrarily varied, and the preparation may be carried out according to a conventional method in the field of cosmetics.

<3-2> Flexible longevity (skin lotion)

Citral 2.0 wt%

glycerin 3.0 wt%

Butylene glycol 2.0 wt%

Propylene glycol 2.0 wt%

Carboxyvinyl polymer 0.1 wt%

PEG 12 nonyl phenyl ether 0.2 wt%

Polysorbate 80 0.4 wt%

ethanol 10.0 wt%

Triethanolamine 0.1 wt%

Preservative, coloring, fragrance Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above-described components is a mixture of the components suitable for the relatively long softening time, it may be arbitrarily varied in its blending ratio, and it can be produced according to a conventional production method in the field of cosmetics.

<3-3> Nourishing cream

Citral 2.0 wt%

Polysorbate 60 1.5 wt%

Sorbitan sesquioleate 0.5 wt%

PEG60 hardened castor oil 2.0 wt%

Liquid paraffin 10 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 5.0 wt%

glycerin 5.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Triethanolamine 0.2 wt%

antiseptic Suitable amount

Pigment Suitable amount

Spices Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the nutritional cream, the compounding ratio of the ingredient may be arbitrarily varied, and can be manufactured according to a conventional method in the field of cosmetics.

<3-4> Massage Cream

Citral 1.0 wt%

Wax 10.0 wt%

Polysorbate 60 1.5 wt%

PEG 60 hardened castor oil 2.0 wt%

Sorbitan sesquioleate 0.8 wt%

Liquid paraffin 40.0 wt%

Squalane 5.0 wt%

Caprylic / capric triglyceride 4.0 wt%

glycerin 5.0 wt%

Butylene glycol 3.0 wt%

Propylene glycol 3.0 wt%

Triethanolamine 0.2 wt%

Preservative, coloring, fragrance Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparatively suitable for the massage cream, the compounding ratio thereof may be arbitrarily modified, and can be manufactured according to a conventional manufacturing method in the field of cosmetics.

<3-5> Pack

Citral 1.0 wt%

Polyvinyl alcohol 13.0 wt%

Sodium carboxymethylcellulose 0.2 wt%

glycerin 5.0 wt%

Allantoin 0.1 wt%

ethanol 6.0 wt%

PEG 12 nonyl phenyl ether 0.3 wt%

Polysorbate 60 0.3 wt%

Preservative, coloring, fragrance Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above components is comparatively comparatively compatible with the pack, the compounding ratio thereof may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

<3-6> Gel

Citral 0.5 wt%

Ethylenediamine sodium acetate 0.05 wt%

glycerin 5.0 wt%

Carboxyvinyl polymer 0.3 wt%

ethanol 5.0 wt%

PEG 60 hardened castor oil 0.5 wt%

Triethanolamine 0.3 wt%

Preservative, coloring, fragrance Suitable amount

Purified water to 100 wt%

Although the compounding ratio of the above-mentioned ingredients is comparatively comparable to that of the gel, the blending ratio may be arbitrarily varied and can be produced by a conventional method in the field of cosmetics.

Although the compounding ratio is comparatively comparatively suitable for the cosmetic composition, it can be applied to cosmetics for various uses including other color cosmetics. Depending on its effectiveness, it can be applied to a human body thinly, It can be used for manufacturing in ointment, and it is also possible to arbitrarily modify the compounding ratio according to the regional or national preference such as demand level, demand country, use purpose, and the like.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Industry-Academic Cooperation Foundation. Yonsei University <120> Composition containing citral or active ingredients for muscle strengthening, development, differentiation, regeneration or inhibiting muscle atrophy <130> 1061724 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > forward primer of MaFbx (synonym: atrogin-1) <400> 1 gtccagagag tcggcaagtc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of MaFbx (synonym: atrogin-1) <400> 2 gtcggtgatc gtgagacctt 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer of MuRF1 (synonym: TRAM63) <400> 3 tcggtgatcg tgagacctt 19 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of MuRF1 (synonym: TRAM63) <400> 4 tgtccttgga agatgctttg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Myostatin <400> 5 tcacgctacc acggaaacaa 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Myostatin <400> 6 aggagtcttg acgggtctga 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of IGF <400> 7 ggggactttc gtgactgagc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of IGF <400> 8 ggtaggtccg ggtcgtttac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) <400> 9 gtgatggcat ggactgtggt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) <400> 10 ggagccaaaa gggtcatcat 20

Claims

A pharmaceutical composition for preventing or treating a muscle disorder, which comprises citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

The pharmaceutical composition according to claim 1, wherein the citral is a compound having a structure of the following formula 1:
[Chemical Formula 1]

.

The pharmaceutical composition according to claim 1, wherein the citral or a pharmaceutically acceptable salt thereof increases the expression of p-4E-BP1 and p-p70S6K protein.

The method according to claim 1, wherein the citral or pharmaceutically acceptable salt thereof reduces the expression of MuRF1 (Muscle Ring-Finger Protein), MaFbx (Muscle atrophy F-box) Or a pharmaceutically acceptable salt thereof.

The pharmaceutical composition for preventing or treating a muscle disorder according to claim 1, wherein the muscle disorder is a muscle disorder caused by muscle weakness, muscle weakness, muscle atrophy, muscle wasting or muscle degeneration.

6. The method of claim 5, wherein the muscle disorder is selected from the group consisting of atony, muscular atrophy, muscular dystrophy, myasthenia gravis, cachexia, rigid spinesyndrome, amyotrophic lateral sclerosis Characterized in that it is at least one selected from the group consisting of amyotrophic lateral sclerosis, rigid spinsesyndrome, Charcot-Marie-Tooth disease and sarcopenia. A pharmaceutical composition for preventing or treating disease.

A pharmaceutical composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

A health-functional food composition for promoting muscle differentiation, muscle regeneration or muscle strengthening comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

A pharmaceutical composition for increasing muscle mass or promoting muscle formation comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

A health functional food composition for increasing muscle mass or promoting muscle formation comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

A health functional food composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.

A cosmetic composition for improving muscle function comprising citrale or a pharmaceutically acceptable salt thereof as an active ingredient.