KR20190003868A - Evaluation of specificity of oligonucleotides - Google Patents

Abstract

The present invention relates to a method for evaluating the specificity of an oligonucleotide represented by 5'-X-Y-Z-3 '. The present invention relates to a method for determining the presence or absence of a nucleotide sequence comprising at least one nucleotide sequence database comprising at least one nucleotide sequence database comprising at least one sequence of oligonucleotides of formula (I) Extracting a sequence; And analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether a match or mismatch between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence (Ii) the number or percentage of mismatched or matched bases between each reference nucleotide sequence and the site Z of the oligonucleotide of formula (I) above.

Description

Evaluation of specificity of oligonucleotides

The present invention relates to the evaluation of specificity of oligonucleotides.

Nucleic acid amplification is an essential process in various methods of molecular biology, and various amplification methods have been proposed. For example, Miller, HI et al. (WO 89/06700) discloses a method of hybridizing a promoter / primer sequence to a target single stranded DNA ("ssDNA") and then transcribing many RNA copies of the sequence To amplify the nucleic acid sequence. Other known nucleic acid amplification procedures include transcription based amplification systems (Kwoh, D. et al., Proc. Natl. Acad Sci USA, 86: 1173 (1989) and Gingeras TR et al. 10315).

The most widely used nucleic acid amplification method known as polymerase chain reaction (hereinafter referred to as " PCR ") is a method for amplifying double stranded DNA, annealing an oligonucleotide primer to a DNA template, and repeating primer extension by a DNA polymerase (Mullis et al., U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159; Saiki et al., (1985) Science 230, 1350-1354).

In recent years, real-time PCR techniques for detecting amplification of a target nucleic acid sequence in a real-time manner have been widely used. Real-time PCR generally utilizes oligonucleotides such as primers and / or probes which hybridize specifically with the target nucleic acid sequence. Examples of methods of utilizing hybridization between a labeled probe and a target nucleic acid sequence include the Molecular beacon method using a double labeled probe capable of forming a hairpin structure (Tyagi et al., Nature Biotechnology v. 14 MARCH 1996), the HyBeacon method DJ et al., Mol. Cell Probes, 15 (6): 363-374 (2001)), a hybridization probe method using two probes labeled with a donor and a receptor, respectively (Bernad et al, 147-148 Clin Chem 2000; 46) and the Lux method using a single-labeled oligonucleotide (U.S. Patent No. 7,537,886). In addition, the TaqMan method (US Pat. Nos. 5,210,015 and 5,538,848) using hybridization of double-labeled probes as well as cleavage of double-labeled probes by the 5'-nuclease activity of DNA polymerases has been widely used .

PCR and real-time PCR generally utilize primers and / or probes to amplify or detect a desired target nucleic acid sequence from a mixture of various nucleic acids. Thus, for accurate amplification or detection results, primers and / or probes are required to have high specificity for the target nucleic acid sequence.

In this regard, the inventors have developed a dual specificity oligonucleotide (DSO) (also referred to as a dual priming oligonucleotide (DPO)) that performs a template-dependent reaction with higher specificity International Publication No. WO 2006/095981). The DSO has three different sites in the oligonucleotide molecule, a 5'-high Tm specificity site, a 3'-low Tm specificity site and a cleavage site, which are composed of universal bases The hybridization specificity is doubly determined by the two sites separated by the splitting site (5'-high Tm specific site and 3'-low Tm specific site).

In addition, the present inventors have developed a target discriminative probe (referred to as a TD probe) capable of distinguishing a target nucleic acid sequence from a non-target nucleic acid sequence (see International Publication No. WO 2011/028041). The TD probe comprises three unique sites in the oligonucleotide molecule: a 5'-second hybridization site, a 3'-first hybridization site and a cleavage site, and the 5'- The hybridization specificity of the TD probe is doubly determined by the second hybridization site and the 3'-first hybridization site.

Generally, the oligonucleotides used in PCR and real-time PCR are designed and manufactured to hybridize or match the target nucleic acid sequence. However, even finely engineered oligonucleotides can hybridize to non-target nucleic acid sequences that are not identified in the design. Therefore, it is necessary to confirm that the designed oligonucleotide is hybridized only to the intended target and not hybridized to any unintended non-target. This is commonly referred to as the specificity assessment process.

The specificity evaluation process includes a step of searching for a homologous sequence (homology search) by searching the known nucleotide sequence database (for example, GenBank) using the arbitrary sequence alignment algorithm or program (for example, BLAST) , And analyzing the generated homologous sequence to confirm that the designed oligonucleotide is only hybridized to the desired target nucleic acid sequence. This specificity assessment process has become a very useful tool for evaluating the suitability or operability of primers and probes.

Various sequence alignment algorithms or programs have been used to evaluate the specificity of oligonucleotides. Among them, BLAST is one of the most widely used sequence similarity search tools to compare a nucleotide query sequence with a nucleotide sequence database to find a sequence similar to the query in the database. This program is provided free of charge by the National Center for Biotechnology Information (NCBI) at http://www.ncbi.nih.gov.

The BLAST program is basically a string-matching program. Biological string matching finds similarity as proof of homology. The similarity between a query and a sequence in the database can be measured by the percent identity or number of bases in the query that exactly match the corresponding region of the sequence from the database.

The output of the BLAST search reports a set of scores and statistics for the matches found based on the raw score S, various parameters of the scoring algorithm, and the characteristics of the query and the database. The raw score S is a measure of similarity and size of match. The BLAST output lists the hits that are ordered by the E value. The E (expected) value of the match roughly measures the probability of string matching (gap allowance) occurring in a randomly generated database of the same size and configuration. The closer the E value is to zero, the lower the likelihood that it occurs by chance. That is, the lower the E value, the better the match is. This can be used as a measure of the primer match to the target nucleic acid sequence.

Although BLAST provides relatively good results for typical oligonucleotides, it is not suitable for non-typical oligonucleotides containing several consecutive universal bases, non-natural bases, etc. within the sequence.

In particular, in the case of oligonucleotides containing a plurality of consecutive universal bases such as the bispecific oligonucleotides developed by the present inventors, the BLAST was designed so that, even though the entire sequence was input as a query, Only results are generated. In addition, BLAST does not provide individual mismatch results for the 5 'and 3' sites, which are important considerations in the design of oligonucleotides containing multiple consecutive universal bases within a sequence.

In addition, BLAST treats universal bases or degenerative bases mismatched regardless of their particular type.

Thus, in view of the fact that conventional sequence alignment algorithms or programs are not suitable for evaluating the specificity of atypical oligonucleotides, there is a need to develop new methods for more accurately assessing the specificity of atypical oligonucleotides.

Numerous cited documents and patent documents are referred to and cited throughout this specification. The disclosures of the cited documents and patents are incorporated herein by reference in their entirety to more clearly describe the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a method for evaluating the specificity of oligonucleotides, especially atypical oligonucleotides containing contiguous bases not involved in the Watson-Crick base pair within the sequence. As a result, the present inventors have found that the present invention provides a method for identifying a nucleotide sequence, comprising the steps of: comparing an oligonucleotide sequence with a nucleotide sequence database; extracting a reference nucleotide sequence including a region homologous to the oligonucleotide; / Mismatches to provide individual match results at two sites separated by consecutive bases that do not participate in Watson-Crick base pairs.

Accordingly, it is an object of the present invention to provide a method for evaluating the specificity of oligonucleotides.

It is another object of the present invention to provide a computer-readable recording medium that includes instructions for implementing a processor to perform a method of assessing the specificity of an oligonucleotide.

It is another object of the present invention to provide an apparatus for evaluating the specificity of oligonucleotides.

It is yet another object of the present invention to provide a computer program stored on a computer readable recording medium embodying a processor for performing a method of evaluating the specificity of an oligonucleotide.

Other objects and advantages of the present invention will become apparent from the following detailed description together with the appended claims and drawings.

I. Oligonucleotide  Evaluation of specificity

According to one aspect of the present invention, the present invention provides a method of assessing the specificity of an oligonucleotide, comprising the steps of:

(a) providing an oligonucleotide represented by the following formula (I):

5'-X-Y-Z-3 '(I)

Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 > a < / RTI > hybridization nucleotide sequence;

(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database and comparing the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, Extracting a reference nucleotide sequence; And

(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.

The present inventors have sought to develop a method for evaluating the specificity of oligonucleotides, especially atypical oligonucleotides containing contiguous bases not involved in the Watson-Crick base pair within the sequence. As a result, the present inventors have found that the present invention provides a method for identifying a nucleotide sequence, comprising the steps of: comparing an oligonucleotide sequence with a nucleotide sequence database; extracting a reference nucleotide sequence including a region homologous to the oligonucleotide; / Mismatches to provide individual match results at two sites separated by consecutive bases that do not participate in Watson-Crick base pairs.

As used herein, the term " specificity " includes " annealing or hybridization specificity " and " target specificity.

The term " annealing or hybridization specificity " means the fidelity of hybridization between completely complementary bases. The term is used to describe the relationship between two nucleic acid sequences. According to the definition above, oligonucleotides with high specificity can hybridize to another oligonucleotide or polynucleotide under certain conditions, while oligonucleotides with low specificity are not.

 The term " target specificity " refers to the ability to match, hybridize, amplify, or detect a target nucleic acid sequence of interest, match, hybridize, amplify, or detect any other nucleic acid sequence , Which may be used interchangeably with the terms " target specificity ", " specificity for target nucleic acid " or " specific for target nucleic acid sequence ". According to the definition above, oligonucleotides with high specificity can only amplify or detect a desired target nucleic acid sequence from a sample containing a mixture of various nucleic acids by PCR or real-time PCR method, while oligonucleotides with low target specificity Amplifying or detecting non-target as well as target can reduce target amplification efficiency and cause false-positive results.

As used herein, the term specificity may refer to one or both of annealing specificity and target specificity.

Specificity may vary depending on several factors such as hybridization conditions (e.g., temperature), but specificity may be determined primarily by homology between the oligonucleotide sequence and the reference nucleotide sequence. That is, the specificity may depend on the match / mismatch result between the oligonucleotide and the reference nucleotide sequence. One of ordinary skill in the art will be able to ascertain, based on the match / mismatch between the designed oligonucleotide and the nucleotide sequence, that the designed oligonucleotide can hybridize to the nucleic acid sequence under specific conditions to selectively amplify or detect it.

Also, as used herein, the term " information about specificity " means any information that helps to assess the specificity of the oligonucleotide. As noted above, the information about the specificity used herein refers to the information obtained by analyzing the similarity between the oligonucleotide sequence and the reference nucleotide sequence, i.e., the match / mismatch between the oligonucleotide sequence and the reference nucleotide sequence. Information on specificity will be described in detail below.

The term " assessing specificity " or " assessing specificity " as used herein also includes determining the specificity of oligonucleotides based on the provided information, i.e., the match / mismatch between the oligonucleotide sequence and the reference nucleotide sequence do.

Skilled artisans will be able to ascertain whether oligonucleotides designed based on the match / mismatch can hybridize to a particular target nucleic acid sequence under certain conditions.

The skilled artisan will also be able to ascertain whether the oligonucleotide designed based on the match / mismatch between the designed oligonucleotide and the reference nucleotide sequence can hybridize only to the target nucleic acid sequence and amplify or detect it, under certain conditions.

The present invention relates to a method for evaluating the specificity of atypical oligonucleotides containing two or more consecutive bases not involved in the Watson-Crick base pair within a sequence. The present invention provides individual match / mismatch results at two sites (sites X and Z) that are separated by successive bases that do not participate in Watson-Crick base pairs.

In particular, in the case of oligonucleotides containing two sites that have different effects on specificity, the user can accurately assess the specificity of the oligonucleotide through the mismatch results at each site provided by the present invention. Therefore, the method of the present invention is particularly useful for evaluating the specificity of such atypical oligonucleotides.

1 is a flow diagram illustrating a process for evaluating the specificity of an oligonucleotide according to an exemplary embodiment of the present invention. The method 100 of the present invention will now be described with reference to Figure 1:

Step (a): Providing Oligonucleotides ( 110 )

First, in this step, an oligonucleotide to be evaluated for specificity is provided ( 110 ). The oligonucleotide is a primer or a probe used for amplifying or detecting a target nucleic acid sequence.

The term " target nucleic acid sequence ", " target sequence ", or " target " as used herein means a nucleic acid sequence which is to be amplified or detected using the oligonucleotides of the present invention. The target nucleic acid sequence may be double-stranded or single-stranded. The target nucleic acid sequence may be any one or two strands of double stranded nucleic acid, i.e., (+) strand (coding strand, sense strand, non-strand strand) or (-) strand (noncoding strand, antisense strand, template strand) . The target nucleic acid sequence may be one polynucleotide sequence comprising a region capable of hybridizing with an oligonucleotide of the present invention. Alternatively, the target nucleic acid sequence may be at least two polynucleotide sequences comprising a common region that can be hybridized with an oligonucleotide of the invention. The target nucleic acid sequence may be a nucleotide sequence having a genetic diversity. The target nucleic acid sequence may be a genetically identical gene family, i. E., A gene and a variant thereof. The target nucleic acid sequence may be a gene and a group of subtypes belonging to the gene according to conventionally known classification standards. For example, if the oligonucleotide is to amplify or detect human papillomavirus (HPV) type 16, the target nucleic acid sequence may comprise a plurality of genes belonging to HPV type 16.

As used herein, the term "non-target nucleic acid sequence", "non-target sequence", or "non-target" as used herein means a nucleic acid sequence other than the target nucleic acid sequence amplified or detected using the oligonucleotide of the present invention . The non-target nucleic acid sequence is also not intended to be amplified or detected using the oligonucleotides of the present invention, but also includes nucleic acid sequences that can be amplified or detected by chance.

As used herein, the term " oligonucleotide " refers to a short polynucleotide that is intended to assess its specificity. The oligonucleotide may be referred to as a " query " or " query sequence ".

The oligonucleotides may be natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, which can be naturally hybridized or artificially synthesized, and which can specifically hybridize to a target nucleic acid sequence. Linear oligomer. The oligonucleotide is preferably a single strand for maximum efficiency in hybridization. Preferably, the oligonucleotide is an oligodeoxyribonucleotide. The oligonucleotides of the present invention may comprise naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides, or non-natural nucleotides. Oligonucleotides can also include ribonucleotides. For example, the oligonucleotides of the present invention can be synthesized by using skeleton modified nucleotides such as peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides, 2'-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'- Pyranosyl RNA and anhydrohexitol DNA and nucleotides with base modifications such as C-5 substituted pyrimidines (fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, , Substituted or unsubstituted aryl groups, substituted or unsubstituted aryl groups, substituted or unsubstituted heteroaryl groups, substituted or unsubstituted aryl groups, substituted or unsubstituted aryl groups, substituted or unsubstituted aryl groups, However, Alkyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazolyl-, pyridyl- containing substituents), inosine and diaminopurine .

For example, the oligonucleotide of the present invention may comprise a base other than a natural base (A, T, C or G).

Oligonucleotides to be evaluated for specificity in the method of the present invention are primers or probes.

As used herein, the term " primer " refers to a nucleic acid that hybridizes under conditions that induce the synthesis of a primer extension product complementary to the target nucleic acid strand (template), that is, the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, Lt; RTI ID = 0.0 > oligonucleotides < / RTI > The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The exact length of the primer will depend on many factors, including the temperature, the application, and the source of the primer.

As used herein, the term " probe " refers to a single-stranded nucleic acid molecule comprising a site or regions substantially complementary to a target nucleic acid sequence. The probe may contain a label capable of generating a signal for detection of the target nucleic acid sequence. The 3'-end of the probe can be " blocked " to prevent its extension. The blocking can be accomplished according to conventional methods. For example, blocking can be performed by adding a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate or an alkane-diol to the 3'-hydroxyl group of the last nucleotide . Alternatively, the blocking can be performed using a 3'-hydroxyl group of the last nucleotide or a nucleotide without a 3'-hydroxyl group such as dideoxynucleotide.

The term " annealing " or " priming ", as used herein, means that oligodeoxynucleotides or nucleic acids are apposited to a template nucleic acid, which polymerase is capable of polymerizing the nucleotide to form a template nucleic acid or a portion thereof To form complementary nucleic acid molecules. The term " hybridization " as used herein means to form a double-stranded nucleic acid from a complementary single-stranded nucleic acid. The terms " annealing " and " hybridization " are no different and are used interchangeably herein.

An oligonucleotide to be evaluated for specificity in the present invention is an oligonucleotide represented by the following formula (I): < EMI ID =

5'-X-Y-Z-3 '(I)

Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 > nucleotide < / RTI >

The oligonucleotides of formula (I) have three different sites with distinctive characteristics, and their annealing specificity for the target nucleic acid sequence is doubly determined by its two discrete sites, namely site X and site Z.

Generally, the annealing specificity of a conventional (typical) primer or probe is governed by its entire sequence. In contrast, the annealing specificity of the oligonucleotide of formula (I) is doubly determined by two sites separated by site Y, namely site X and site Z.

In the oligonucleotides of formula (I), site Y comprises two or more consecutive bases, each of which is not involved in the Watson-Crick base pair.

As used herein, the Watson-Crick base pair means that the adenine (A) binds to thymine (T) or uracil (U) while guanine (G) binds to cytosine (C).

Thus, a base that does not participate in the Watson-Crick base pair refers to any base that does not form a Watson-Crick base pair with the opposite base in the target nucleic acid sequence. In particular, a base that does not participate in the Watson-Crick base pair can have any base that exhibits a lower intensity (lower melting temperature) base pairing between the base and the opposite base in the target nucleic acid sequence than the intensity of the base pairing between the natural base .

In one embodiment, site Y is designed to have the lowest Tm value among the three sites when the oligonucleotide is annealed to the target nucleic acid sequence.

These bases that do not participate in the Watson-Crick base pair are particularly useful for generating a bubble structure during annealing (hybridization) or amplification under conditions such that site X and / or Y specifically anneals (hybridizes) to the target nucleic acid sequence, Site Z, thereby improving the annealing specificity of the primer or probe to the target nucleic acid sequence.

Examples of bases which are not involved in the Watson-Crick base pairs are: (i) non-natural bases; (ii) a universal base; And (iii) a mismatched base. In one embodiment, the base contained in the cleavage site Y is an unnatural base; Universal base; Mismatched bases and combinations thereof.

As used herein, the term " unnatural base " includes adenine (A), guanyl (G), thymine (T), cytosine (C), and uracil (U), which can form hydrogen- Refers to derivatives of the same natural base (see U.S. Patent No. 8,440,406). As used herein, the term " unnatural base " refers to a base that is different from a natural base as the parent compound, for example, as described in U.S. Patent Nos. 5,432,272, 5,965,364, 6,001,983, 6,037,120, and 8,440,406 And a base having a base pairing pattern. Base pairing between unnatural bases involves two or three hydrogen bonds like natural bases. Base pairing between unnatural bases is also formed in a particular way.

The unnatural base contained in the oligonucleotide of formula (I) does not participate in the Watson-Crick base pair when the opposite base in the target nucleic acid sequence is a natural base. Base pairing between an unnatural base and an opposite base in the target nucleic acid sequence has a lower intensity (lower melting temperature) than base pairing between natural bases. Thus, this base pairing serves to create a bubble structure and separate sites X and Z.

Specific examples of unnatural bases include the following bases combined in base pairs: iso-C / iso-G, iso-dC / iso-dG, K / X, H / J, and M / N (US Patent No. 7,422,850 And 8,440,406).

As used herein, the term " universal base " refers to a base capable of forming a base pair without distinguishing between natural DNA / RNA bases, and the base pair is not involved in the Watson-Crick base pair.

The base pairing between the universal base contained in the oligonucleotide of formula (I) and the opposite base contained in the target nucleic acid sequence has a lower intensity (lower melting temperature) than the base pairing between natural bases.

Examples of the universal base include deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, 2'-F inosine, -Nitropyrrol, 3-nitropyrrol, 2'-OMe 3-nitropyrrol, 2'-F 3-nitropyrrol, 1- (2'- deoxy-beta-D- ribofuranosyl) -3 Nitroindole, 2'-OMe 5-nitroindole, 2'-F 5-nitroindole, deoxy 4-nitrobenzimidazole, 4-nitrobenzimidazole, , 4'-aminobenzimidazole, 4-aminobenzimidazole, deoxyne bululain, 2'-F nebularine, 2'-F 4-nitrobenzimidazole, PNA-5-introindole, PNA -Nonboline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrol, morpholino-5-nitroindole, morpholino-nebularine, morpholino-inosine, Mo 4-nitrobenzimidazole, mofolino-3-nitropropol, phosphoramidate-5-nitroindole, phosphoramidate Phospholamidate-3-nitroprolyl, 2'-O-methoxyethylinosine, 2'-O-isobutyrate, Methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitro-benzimidazole, 2'-O-methoxyethyl 3-nitropyrrole And combinations thereof. Particularly, the universal base is deoxyinosine, inosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrol or 5-nitroindole, more particularly deoxyinosine or inosine to be.

As used herein, the term " mismatched base " means a base that is incapable of forming a hydrogen bonding base pair with the opposite base in the target nucleic acid sequence (see WO 2013/123552 and WO 2014/124290). The mismatched base may vary depending on the type of opposite base in the target nucleic acid.

Since the mismatched base contained in the oligonucleotide of formula (I) can not form a base pair with the opposite base contained in the target nucleic acid, the site Y containing the mismatched base produces a bubble structure and the sites X and Z It separates.

Region Y is a continuous base that does not participate in the Watson-Crick base pair, preferably three, four, five, six, seven, or more consecutive bases that do not participate in the Watson- Lt; / RTI > According to a particular embodiment, the site Y is 2-10, 2-9, 2-8, 2-7, 2-6 or 2-5, 2- 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, < RTI ID = 0.0 > Or 3-4 consecutive bases, most particularly 4-10, 4-9, 4-8, 4-7, 4-6 or 4-5 consecutive consecutive bases not involved in the Watson- Base.

In one embodiment, site Y has two consecutive non-natural bases, preferably three, four, five, six, seven, eight or more consecutive unnatural bases. In another embodiment, site Y has two consecutive universal bases, preferably three, four, five, six, seven, eight or more consecutive universal bases. In another embodiment, site Y has two consecutive mismatched bases, preferably three, four, five, six, seven, eight or more consecutive mismatched bases. In another embodiment, the site Y has two, preferably three, four, five, six, seven, eight or more consecutive bases, each base independently being a non-natural base, Universal bases and mismatched bases.

In the oligonucleotides of formula (I), the sites X and Z are sites with hybridization nucleotides to the target nucleic acid sequence, respectively, i.e. sites with hybridization nucleotide sequences complementary to the positions on the template nucleic acid to be hybridized, respectively.

The term " complementary " is used herein to mean sufficiently complementary to selectively hybridize to a target nucleic acid sequence under specified annealing or stringent conditions, and the terms " substantially complementary " and " Includes a completely complementary.

The site X and / or site Z in the oligonucleotide of formula (I) may have one or more mismatches to the template (target nucleic acid sequence) within a range that it can serve as a primer or probe. For example, site X and / or site Z in the oligonucleotide of formula (I) may have 1-2, 1-3 or 1-4 non-conformal nucleotides.

Most particularly, site X and / or site Z in the oligonucleotide of formula (I) has a nucleotide sequence that is completely complementary, i.e. mismatched, at one position on the template.

The length of site X and site Z may each range from 3 to 50 nucleotide residues.

In one embodiment, site X is longer than site Z. Specifically, the length of site X is 15 to 50, 15 to 40, 15 to 30 or 15 to 25 nucleotide residues, more particularly 17 to 50, 17 to 40, 17 to 30 or 17 to 25 nucleotide residues, To 50, 20 to 40, 20 to 30 or 20 to 25 nucleotide residues. The length of the Z region is 3 to 15, 3 to 12 or 3 to 10 nucleotide residues, more particularly 5 to 15, 5 to 12 or 5 to 10 nucleotide residues, most particularly 6 to 12 nucleotide residues.

In another embodiment, site Z is longer than site X. In particular, the length of site Z is from 15 to 50, 15 to 40, 15 to 30 or 15 to 25 nucleotide residues, more particularly from 17 to 50, 17 to 40, 17 to 30 or 17 to 25 nucleotide residues, 20 to 50, 20 to 40, 20 to 30 or 20 to 25 nucleotide residues. The length of site X is 3 to 15, 3 to 12 or 3 to 10 nucleotide residues, more particularly 5 to 15, 5 to 12 or 5 to 10 nucleotide residues, most particularly 6 to 12 nucleotide residues.

In one embodiment, the Tm of each of the moieties X and Z is in the range of 6 占 폚 to 80 占 폚, 6 占 폚 to 70 占 폚, 6 占 폚 to 50 占 폚, 6 占 폚 to 40 占 폚, 10 占 폚 to 80 占 폚, 20 deg. C to 60 deg. C, 10 deg. C to 50 deg. C, 10 deg. C to 40 deg. C, 80 占 폚, 30 占 폚 to 70 占 폚, 30 占 폚 to 60 占 폚, 30 占 폚 to 50 占 폚, or 30 占 폚 to 40 占 폚. In one embodiment, the Tm of site Y is from 1 ° C to 15 ° C, from 1 ° C to 20 ° C, from 1 ° C to 5 ° C, from 2 ° C to 15 ° C, from 2 ° C to 10 ° C, Deg.] C, 3 [deg.] C to 10 [deg.] C, or 3 [ In one embodiment, the Tm of site Y is lower than the Tm of sites X and Z, respectively.

In one embodiment, the Tm of site X is higher than the Tm of site Z. In certain embodiments, the Tm of site X is 5 ° C, 10 ° C, 15 ° C, 20 ° C, or 25 ° C higher than the Tm of site Z. In another embodiment, the Tm of site Z is higher than the Tm of site X. In certain embodiments, the Tm of site Z is 5 ° C, 10 ° C, 15 ° C, 20 ° C, or 25 ° C higher than the Tm of site Z.

In the oligonucleotides of formula (I), either or both of the X and Z sites may comprise at least one universal base or a degenerate base.

In one embodiment, when either or both of the site X and site Z in the oligonucleotide of formula (I) comprises two or more universal bases, the universal base is not contiguous to the oligonucleotide sequence, It exists separately. In the case where the Y site also contains two or more consecutive universal bases, the two or more universal bases contained in either or both of the X and Z sites are separated from the sequence in the presence of two Lt; RTI ID = 0.0 > universal < / RTI >

In another embodiment, when either or both of the site X and site Z in the oligonucleotide of formula (I) comprises two or more universal bases, the universal base is contiguous to the sequence of the oligonucleotide . When the Y site also contains two or more consecutive universal bases, two or more universal bases contained in either or both of the X site and the Z site are not distinguished from two or more consecutive universal bases at the Y site . In this case, any one of them may be treated or considered as a Y-site. As an example, the universal base closer to the 5 'end can be treated with the Y site, the site at the 5' end of the Y site is treated as X site, the site at the 3 'end around the Y site is treated as Z Treatment. As another example, a region remote from the 5 'end may be treated as a Y site, and a site at the 5' end and a site at the 3 'end of the Y site may be treated as the Z site. As another example, a region having more universal bases is treated as a Y site, and a site at the 5 'end around the Y site is referred to as an X site, and a site at the 3' end around the Y site is referred to as a Z site Can be processed.

As used herein, the term " degenerate base " means that at any given nucleotide position there may be a specific subset (two or three bases) of any of the four bases (A, C, G or T) . The term also refers to the possibility of more than one base at a particular position. One oligonucleotide can be synthesized to have multiple bases at the same position, which is often referred to as a " wobble " position or a degenerate base, also referred to as a " mixed base. &Quot;

The decocted base may have a different degree of degeneracy. The term " extent of degeneracy " refers to the number of bases that can occupy a given nucleotide position. "Full degeneracy" occurs when all four bases (A, C, G, or T) can occupy a given degenerative position. In this case, an oligonucleotide having a base A at a given axial displacement position, four oligonucleotides consisting of an oligonucleotide having a base C at a given axial displacement position, an oligonucleotide having a base G at a given axial displacement position, Oligonucleotides with base T can be used together. On the other hand, "partial degeneracy" means that a specific subset (2-3) of four bases such as A / G, C / T, A / C / G, Occurs when the position can be occupied.

Regarding the indication of degenerate bases, an IUB degenerate code for the nucleotide base is used herein. In these codes, R means any of the purine bases A or G; Y means any of the pyrimidine bases C or T; M means any of amino base A or C; K means either keto base G or T; S means any strong hydrogen bonding partner C or G; W means any of the weak hydrogen bonding partners A or T; H means A, C or T; B means G, T or C; V means G, C or A; D means G, A or T; N means G, A, C or T.

According to a particular embodiment of the invention, the oligonucleotide of formula (I) is a bispecific oligonucleotide (referred to as DSO or DPO) as described in WO 2006/095981. Details regarding the bispecific oligonucleotides are available in the above references.

According to another specific embodiment of the present invention, the oligonucleotides represented by formula (I) are target specificity (TD) probes as disclosed in WO 2011/028041. Details of the target differentiability probe are described in the above document.

The oligonucleotides of formula (I) provided in this step may be pre-existing oligonucleotides (primers or probes).

Alternatively, the oligonucleotide of formula (I) provided in this step may be an oligonucleotide designed based on the target nucleic acid sequence to be amplified or detected.

The oligonucleotides may be designed by hand or by design programs well known in the art. Examples of conventional primer / probe design programs include Primer3 (http://frodo.wi.mit.edu/), Visual OMP ™ software (DNA Software, Inc., Ann Arbor, Mich.), Integrated DNA Technology (IDT) OligoAnalyzer 3.0 program (http://scitools.idtdna.com/Analvzer/oligocalc.asp), DINAmelt ™ program (http://dinamelt.bioinfo.rpi.edu/), OLIGO 7 (Wojciech Rychlik (2007). "OLIGO 7 Primer Analysis Software ", Methods MoI. Biol. 402: 35-60), Primer Express 3.0 software (Applied Biosystems USA), and the like.

The oligonucleotides of formula (I) are designed such that their X and Y sites have sequences that can be substantially hybridized to the target nucleic acid sequence. To this end, the X and Y sites in the oligonucleotide of formula (I) are designed to match (with significant sequence similarity) to a specific region of the target nucleic acid sequence.

The oligonucleotides of formula (I) are amplified by a plurality of target nucleic acid sequences (for example, a nucleotide sequence having genetic diversity; a group consisting of genetically identical gene families, i.e. genes and variants thereof; genes and groups of subtypes thereof) The oligonucleotides can be prepared by aligning the plurality of target nucleic acid sequences and locating a common sequence such as a conserved region and designing the oligonucleotide to match the conserved region . The oligonucleotides of formula (I) may be designed to have 100% identity with a plurality of target nucleic acid sequences. Alternatively, oligonucleotides of formula (I) can be designed to have several mismatches for a plurality of target nucleic acid sequences, as long as they can be hybridized to the target nucleic acid sequence under controlled hybridization conditions (e.g., temperature).

The oligonucleotide of formula (I) may be one of a plurality of candidate oligonucleotides designed based on the target nucleic acid sequence (s). One skilled in the art can design a plurality of candidate oligonucleotides of formula (I) based on the known target nucleic acid sequence (s), and the oligonucleotide of formula (I) used in the method of the present invention may be one of the candidate oligonucleotides Lt; / RTI >

The oligonucleotide of formula (I) may be one of the oligonucleotides used in multiplex amplification or detection. The oligonucleotide of formula (I) may be one of a plurality of oligonucleotides (or candidate oligonucleotides) for amplifying or detecting a plurality of target nucleic acid sequences.

In addition, the oligonucleotide of formula (I) may be one of a pair of primers (i.e., forward primer and reverse primer) to amplify the target nucleic acid sequence.

Oligonucleotides of formula (I) are oligonucleotides that can be used for PCR or real-time PCR. The oligonucleotides of formula (I) may be used in a variety of fields, such as (i) Miller, HI method (WO 89/06700) and Davey, C. et al (EP 329,822), ligase chain reaction (LCR, Wu, DY et PCR (Methods and Applications, 1: 5-16 (1991)), Gap-LCR (WO 90/01069), Restriction Chain Reaction (EP 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238), such as primer-related nucleic acid amplification methods, (1994) Cycle sequencing PCR Methods Appl. 3: S107-S112) and Pyrosequencing (Ronaghi et al., (1996) Anal. Biochem., 242: 84-89; : 363-365), such as primer extension-related techniques, and (iii) oligonucleotides useful in detection of target nucleotide sequences using oligonucleotide microarrays, such as hybridization-related techniques. The oligonucleotides of the present invention are oligonucleotides that can be applied to various nucleic acid amplification, sequencing and hybridization-related techniques.

Step (b): Extraction ( 120 ) of a reference nucleotide sequence comprising a comparison with a nucleotide sequence database and a homologous region,

In this step, all or a portion of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database, and the sequence comprising a region homologous to all or part of the sequence of the oligonucleotide of formula (I) The reference nucleotide sequence is extracted ( 120 ).

As used herein, the term "database of nucleotide sequences", "nucleotide sequence database", "nucleotide database", or "database" refers to a sequence of two or more nucleotide sequences derived from various sources ≪ / RTI > The nucleotide sequence database may contain information related to the nucleotide sequence, e.g., their specific sequence and identity. The database may be publicly available, commercially available, or may be generated by the inventor. The database is an ordered set for convenience and speed of search by a computer.

Examples of databases known in the art include, but are not limited to, the GenBank database, the EST database, the EMBL nucleotide sequence database, the Entrez nucleotide database, and the LIFESEQ ™ database. The nucleotide sequence database herein may also be referred to as a " reference database ".

The database compared to the oligonucleotides of formula (I) herein may be any of the databases described above or a combination thereof.

In this step (b), the comparison of all or some of the oligonucleotides of formula (I) with at least one nucleotide sequence database involves searching the database using a sequence alignment algorithm or program. Also, in this step (b), the comparison of all or a part of the oligonucleotide of formula (I) with at least one nucleotide sequence database can be performed by using a sequence alignment algorithm or a program to determine all or a part of the sequence of the oligonucleotide And alignment with the nucleotide sequence in the database. In addition, in this step (b), the comparison of all or some of the oligonucleotides of formula (I) with at least one nucleotide sequence database may be made by comparing all or part of the oligonucleotide sequence with the respective nucleotide sequence in the database And analyzing the alignment. In addition, in this step (b), the comparison of all or some of the oligonucleotides of formula (I) with at least one nucleotide sequence database may be made by comparing all or part of the oligonucleotide sequence with the respective nucleotide sequence in the database , And determining the homology or similarity between them.

In this step, a comparison between the two or more sequences, i.e. the whole or partial sequence of the oligonucleotide of formula (I), and the nucleotide sequence in the database can be performed using a sequence alignment algorithm or a program.

Sequence alignment algorithms or programs are known in the art. An example of a sequence alignment algorithm or program is the homology algorithm of Smith and Waterman (1981, Adv. Appl. Math. 2: 482), the homology sorting algorithm of Needleman and Wunsch (1970, J. Mol. Biol. ), Computerized Implementations of These Algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics, 1988, Proc. Nat'l Acad Sci USA 85: 2444) Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), And manual alignment and visual inspection.

Other examples of algorithms or programs for determining homology include BLAST programs (Basic Local Alignment Search Tool at the National Center for Biological Information), ALIGN, Analysis of Multiply Aligned Sequences (AMAS), Protein Multiple Sequence Alignment (AMPS) ASSET (Aligned Segment Statistical Evaluation Tool), BANDS, BESTSCOR, BIOSCAN (Biological Sequence Comparative Analysis Node), BLIMPS (BLocks IMPROVED SEARCHER), FASTA, Intervals & Points, BMB, CLUSTAL V, CLUSTAL W, CONSENSUS, LCONSENSUS, WCONSENSUS, Smith Generic, GIBBS, GenQuest, ISSC (Global Alignment Program), GAP (Global Alignment Program), FSM (FAP), Framerign, Framesearch, DYNAMIC, FILTER, FSAP Sequence Comparison), LALIGN (Local Sequence Alignment), LCP (Local Content Program), MACAW (Multiple Alignment Construction & Analysis Workbench), MAP (Multiple Alignment Program), MBLKP, MBLKN, PIMA ulti-sequence Alignment), Sequence Alignment by Genetic Algorithm (SAGA), and WHAT-IF. In particular, the sequence alignment algorithm or program is selected from the group consisting of Smith & Waterman, Needleman-Wunsch, BLAST, and FASTA algorithms or programs.

The sequence alignment algorithm or program uses appropriate parameters to find regions that are homologous to the oligonucleotide (query sequence). The sequence alignment algorithm or program used in the method of the present invention may use parameters set to default or use parameters adjusted appropriately by those skilled in the art. For example, BLAST algorithm, which is a typical sequence sorting algorithm or a program, uses parameters such as E-value, Reward / penalty, Gap penalty, Gap creation, Word size, Scoring matrix, PSSM and Filter. The parameters in the sequence alignment algorithm or program can be determined by adjusting the homology cutoff between the entire or partial sequence of the oligonucleotide of formula (I) and the respective reference nucleotide sequence in the database and the amount of reference nucleotide sequence (Number), as will be appreciated by those skilled in the art. In particular, in consideration of the short length of oligonucleotides of formula (I), it is desirable to lower the word size and increase the E value by comparing with the default values in order to increase the match probability.

In one embodiment of the invention, the sequence alignment algorithm or program used in the present invention may be an algorithm or program developed by the present inventors. The algorithm or program was developed to evaluate the specificity of oligonucleotides containing two or more consecutive bases that do not participate in the Watson-Crick base pair within their sequence or, optionally, a non-contiguous universal base or degenerate base Algorithm or program. The algorithm or program may not consider the sequence of the Y site in the oligonucleotide of formula (I). For example, the algorithm or program does not consider the homology between the sequence of the Y site in the oligonucleotide of formula (I) and the corresponding reference nucleotide sequence in the database. That is, the comparison using the algorithm or the program may include determination of homology at sites X and Z except site Y. [

After comparison as described above, a reference nucleotide sequence comprising a region homologous to all or some of the oligonucleotides of Formula (I) is extracted from the database.

As used herein, the term " reference nucleotide sequence " refers to a sequence in the database, including regions that are homologous to all or part of the sequence of the oligonucleotide of formula (I). The number of reference nucleotides to be extracted may be at least one.

Each reference nucleotide sequence comprises a homologous region and optionally a flanking region thereof.

As used herein, the term "homologous region", "homologous region" or "homologous region" in relation to all or part of the sequence of the oligonucleotide of Formula (I) refers to the entire Refers to a specific region within a reference nucleotide sequence from a database that is the same as or similar to some sequence. Expressed again, the homologous region refers to a specific region within the reference nucleotide sequence that matches all or part of the sequence of the oligonucleotide of Formula (I).

The extracted reference nucleotide sequence may have homologous sequences of different sizes.

In one embodiment, the homology region is the same length as the oligonucleotide provided in step (a). For example, if the oligonucleotide provided in step (a) comprises a relatively small number of contiguous bases (e.g., two or three universal bases) that do not participate in Watson-Crick base pairs, the BLAST algorithm The reference nucleotide sequence extracted by step (a) may comprise a homology region of the same length as the oligonucleotide provided in step (a). In this case, the homologous region is the same length as the entire sequence of the oligonucleotide provided in step (a) and has homology with the sequence.

In another embodiment, the homologous region is shorter than the oligonucleotide provided in step (a). For example, if the oligonucleotide provided in step (a) comprises a relatively large number of consecutive bases (e.g., four, five, or six or more universal bases) that do not participate in the Watson- The nucleic acid sequence extracted by the BLAST algorithm may comprise a region of homology that is shorter than the oligonucleotide provided in step (a). Specifically, when the oligonucleotides represented by 5'-XYZ-3 '(especially those having a relatively large number of consecutive bases not involved in the Watson-Crick base pair within the Y site) are compared to a database using BLAST, (A homology region having the same length as the site X) can be obtained. In this case, the homologous region is shorter than the entire sequence of the oligonucleotide provided in step (a), and has homology with a part of the sequence of the oligonucleotide, i.e., the X region.

The phrase " region homologous to all or part of the sequence of an oligonucleotide " refers to a region within a reference nucleotide sequence that has substantial homology (similarity) to all or part of the sequence of the oligonucleotide. The substantial homology indicates that the homology between the region within the reference nucleotide sequence and all or a portion of the sequence of the oligonucleotide is higher than the defined or selected degree of homology (specific threshold). The degree of homology defined above means a criterion or threshold for extracting a reference nucleotide sequence with high similarity or homology with a designed oligonucleotide from a database. For example, the defined degree of homology may be at least 50%, at least 60%, at least 70%, at least 80%, at least 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% In one embodiment of the invention, the defined degree of homology between the sequence in any one of the sites X and Z of the oligonucleotide and the corresponding reference nucleotide sequence is the total base in any one of the two aligned nucleotide sequences May be 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more or 99% or more. In another embodiment of the invention, the defined degree of homology between the sequence at the site X of the oligonucleotide and the corresponding reference nucleotide sequence is determined based on the total number of bases in the nucleotide sequence of any of the two aligned nucleotide sequences, , At least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% oligonucleotides The degree of homology between the sequence of the reference nucleotide sequence and the homologous region in the corresponding reference nucleotide sequence is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96% Or more, or 99% or more.

In one embodiment, the entire sequence of the oligonucleotide of formula (I) is used in the comparison of step (b).

In certain embodiments, when the entire sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database, a reference comprising a region homologous to the entire sequence of the oligonucleotide of formula (I) in step (b) The nucleotide sequence can be extracted from the database. For example, the entire sequence of oligonucleotides composed of 30 nucleotide residues can be compared to the GenBank database, and in step (b) reference nucleotide sequences each containing 30 nucleotides in length of homology region can be extracted from the database.

In another specific embodiment, when the entire sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database, some of the oligonucleotides of formula (I) in step (b) A reference nucleotide sequence comprising a region homologous to a region Y or a portion thereof) can be extracted from the database. For example, the entire sequence of an oligonucleotide of 30 nucleotides in length can be compared to a GenBank database, and a reference sequence containing a homology region less than 30 nucleotides in length in step (b) can be extracted from the database.

In another embodiment, a partial sequence of the oligonucleotide of formula (I) is used in the comparison of step (b).

Some sequences of the oligonucleotides of formula (I) used in the comparison of step (b) of the present invention may be site X, site Z, or a portion thereof.

In certain embodiments, when a portion of the sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database, a reference comprising a region homologous to a portion of the sequence of the oligonucleotide of formula (I) in step (b) The nucleotide sequence can be extracted from the database. For example, only a site X composed of 15 nucleotide residues is compared to the GenBank database, and in step (b), a reference nucleotide sequence containing a homology region 15 nucleotides in length can be extracted from the database

In another particular embodiment, when a portion of the sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database, the homologous region (s) in the portion of the sequence of the oligonucleotide of formula (I) May be extracted from the database. For example, only a site X composed of 15 nucleotide residues is compared to the GenBank database, and a reference nucleotide sequence containing a homology region less than 15 nucleotides in length in step (b) can be extracted from the database

In one embodiment of the present invention, only the sequence of the X site in the oligonucleotide is compared with at least one nucleotide sequence database, and then the reference nucleotide sequence including the region homologous to the X site in step (b) is extracted from the database .

 In another embodiment of the invention, only the sequence of the Z site in the oligonucleotide is compared to at least one nucleotide sequence database, and then the reference nucleotide sequence comprising the region homologous to the Z site in step (b) Can be extracted.

In another embodiment of the invention, only the sequence of the portion of the X site in the oligonucleotide is compared to the at least one nucleotide sequence database and then the reference nucleotide sequence comprising the homologous region in the portion of the X site in step (b) Can be extracted from the database.

In another embodiment of the invention, only the sequence of the portion of the Z site in the oligonucleotide is compared to the at least one nucleotide sequence database and then the reference nucleotide sequence comprising the homologous region in the portion of the Z site in step (b) Can be extracted from the database.

According to embodiments using a partial sequence of the oligonucleotide of formula (I), the comparison (i. E., The determination of homology) between the oligonucleotide and the nucleotide sequence database is based on the sequence of the X or Z site, RTI ID = 0.0 > nucleotide < / RTI > Namely, the homology determination is characterized by using a part of the sequences, particularly the partial sequences excluding the Y part.

The use of some sequences other than the entire sequence of the oligonucleotide prevents the Y site from adversely affecting homology determinations, so that a reference nucleotide sequence having more accurate homology can be extracted. That is, the use of a partial sequence of the oligonucleotide avoids the problem of erroneous determination of the homology region due to the base not involved in the Watson-Crick base pair included in the Y site.

The reference nucleotide sequence extracted according to any of the above embodiments is a nucleotide sequence comprising a region that is homologous to a sequence at an X or Z site, or a portion thereof.

An exemplary procedure for comparing only the sequence of the X region in the oligonucleotide with the nucleotide sequence database and then extracting the reference nucleotide sequence containing the homologous region in the sequence of the X region from the database is shown in FIG.

Step (c): Match / mismatch analysis 130 :

Thereafter, a site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence is analyzed, and (i) a match or miss between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence The number or percentage of matched bases and (ii) the number or percentage of matched or mismatched bases between each reference nucleotide sequence and region Z of the oligonucleotide of Formula (I) above is provided ( 130 ).

In this step, the match / mismatch between the oligonucleotide of formula (I) provided in step (a) and the respective reference nucleotide sequence extracted in step (b) is analyzed by site.

As used herein, the term " site-to-site match / mismatch " means a match / mismatch at each site of the oligonucleotide of formula (I). The term is used interchangeably with " local match / mismatch ".

Also, as used herein, the phrase " analyzing a match / mismatch by site " refers to analyzing a match / mismatch at each site of the oligonucleotide of formula (I). Thus, " analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and each reference nucleotide sequence " means that the sequence of each of the sites X and Z in the oligonucleotide of formula (I) and the respective reference nucleotide sequence ≪ / RTI > between the sequences of corresponding sites within the < RTI ID = 0.0 >

The analysis of the site-specific match / mismatch comprises comparing the sequence of the site X in the oligonucleotide of formula (I) with the corresponding sequence in each reference nucleotide sequence, calculating the match / mismatch between them, Comparing the sequence of the region Z in the oligonucleotide of the reference nucleotide sequence with the corresponding sequence in each reference nucleotide sequence and calculating the match / mismatch between them.

(I) the number or percentage of mismatched or mismatched bases between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence, and (ii) the site of the oligonucleotide of formula (I) The number or ratio of matched or mismatched bases between Z and each reference nucleotide sequence is provided.

The number or ratio of matched or mismatched bases at sites X and Z helps to assess the specificity of the oligonucleotides of formula (I). Thus, they are collectively referred to herein as information about specificity.

In the case of oligonucleotides containing universal bases continuous in sequence, such as bispecific oligonucleotides, the specificity is doubly determined by the X and Z sites divided by the successive universal bases. Therefore, in order to evaluate the specificity of the oligonucleotide, it is very important to confirm the annealing specificity at each of the X and Z sites of the oligonucleotide.

However, conventional sequence alignment algorithms or programs do not provide individual mismatch information for each of the X and Z sites as described above. In addition, if the homology score between the reference nucleotide sequence and the entire sequence of the oligonucleotide is rather low, the conventional sequence alignment algorithm or program will only provide a match / mismatch result for some sequence of the oligonucleotide, rather than the entire sequence of the oligonucleotide can do. For example, if BLAST searches oligonucleotides of 20 nucleotide residues, the BLAST algorithm may provide a match / mismatch result for fewer than 20 nucleotide lengths. In such a case, a match / mismatch result may not be obtained in either or both of the regions X and Z.

 In contrast, the method of the present invention provides individual match / mismatch results at the X and Z sites. Thus, the user can more accurately evaluate the specificity of the oligonucleotide based on the result.

In accordance with the present invention, the number or percentage of matched or mismatched bases in each of the X and Z sites is provided for all extracted reference nucleotide sequences. Thus, based on the results, the user can check whether the designed oligonucleotide is only hybridized to the target nucleic acid sequence.

In the case of oligonucleotides in which the match at the Z site is more important than the match at the X site in terms of specificity, the presence of a mismatch between the Z site of the oligonucleotide and the target nucleic acid sequence results in a different oligonucleotide instead of the designed oligonucleotide Provide a strong basis for making choices. On the other hand, the oligonucleotide having a base mismatched to the X site can also be hybridized to the target nucleic acid sequence under certain conditions, so that the presence of a mismatch at the X site allows the user to determine whether to use oligonucleotides Provide hints for. As such, the match / mismatch results of the X and Z sites are very useful in assessing the specificity of oligonucleotides of formula (I).

The number or ratio of matched or mismatched bases provided in this step is determined by comparing the sequence of the X site in the oligonucleotide with the corresponding sequence in each reference nucleotide sequence and comparing the sequence of the Z site in the oligonucleotide with the respective reference nucleotide sequence ≪ / RTI >

In one embodiment, the entire oligonucleotide sequence of formula (I) above is aligned (aligned) with each extracted reference nucleotide sequence based on its homology region, and then the sequence of matched or mismatched bases at the X and Y sites Analyze the number or ratio. In one embodiment, such alignment information (or result) can be obtained when the reference nucleotide sequence is extracted.

In one embodiment of the invention, the entire sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database and the region homologous to the entire sequence of the oligonucleotide of formula (I) in step (b) Mismatches between the entire sequence of the oligonucleotide of the above formula (I) and the homology region in each reference nucleotide sequence are analyzed, and when the reference nucleotide sequence containing the match or miss in the regions X and Z is extracted, The number or percentage of matched bases is provided.

For example, the entire sequence of the oligonucleotide of formula (I) of 40 nucleotides in length is compared to at least one nucleotide sequence database and the region (s) homologous to the entire sequence of the oligonucleotide of formula (I) 40 nucleotides in length) is extracted, the homologous region already contains sequences corresponding to the sites X and Z in the oligonucleotide of formula (I), so that the matches in sites X and Z The number or percentage of mismatched bases can be calculated directly.

In another embodiment of the present invention, the entire sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database and in step (b) a region homologous to a partial sequence of the oligonucleotide of formula (I) , A site-specific match / mismatch between the entire sequence of the oligonucleotide of the formula (I) and the homologous region of each reference nucleotide sequence and its flanking region is analyzed, and the sites X and < RTI ID = The number or ratio of matched or mismatched bases in Z is provided.

For example, the entire sequence of the oligonucleotide of formula (I) of 40 nucleotides in length is compared to at least one nucleotide sequence database and the region (s) homologous to the partial sequence of the oligonucleotide of formula (I) (10-15, 10-20, 10-30, or 10-35 nucleotides in length), the homologous region comprises a nucleotide sequence corresponding to sites X and Z in the oligonucleotide of formula (I) The number or percentage of matched or mismatched bases in sites X and Z can not be calculated directly. In this case, besides the homology region, its flanking region is additionally used in the calculation of the number or proportion of matched or mismatched bases in regions X and Z. That is, by comparing the entire sequence of the oligonucleotide of formula (I) with the corresponding sequence in each reference nucleotide sequence comprising the homologous region and its flanking region, the number of matched or mismatched bases at sites X and Z, or Calculate the ratio.

The flanking region refers to the remaining region except the homologous region in the reference nucleotide sequence. For example, if the homologous region is homologous to a site X in the oligonucleotide of formula (I), the flanking region comprises a region corresponding to the Y region and a region corresponding to the Z region. When the homologous region is homologous to the site Z in the oligonucleotide of formula (I), the flanking region comprises a region corresponding to the Y region and a region corresponding to the X region.

In another embodiment of the invention, a partial sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database and a region homologous to a partial sequence of the oligonucleotide of formula (I) in step (b) Mismatches between the entire sequence of the oligonucleotide of the above formula (I) and the homologous region of each reference nucleotide sequence and its flanking region are analyzed, and when the reference X and Z The number or percentage of matched or mismatched bases in the sample is provided.

For example, a partial sequence (e.g., 10-15, 10-20, 10-30 or 10-35 nucleotides in length) of an oligonucleotide of formula (I) of 40 nucleotides in length is compared to at least one nucleotide sequence database , A reference nucleotide sequence comprising a region (e.g., 10-15, 10-20, 10-30 or 10-35 nucleotides in length) homologous to a portion of the sequence of the oligonucleotide of formula (I) in step (b) , The number or proportion of matched or mismatched bases in the sites X and Z is less than or equal to the number of mismatched bases in the homology region < RTI ID = 0.0 > Can not be directly computed using only. In this case, besides the homology region, its flanking region is additionally used in the calculation of the number or proportion of matched or mismatched bases in regions X and Z. That is, by comparing the entire sequence of the oligonucleotide of formula (I) with the corresponding sequence in each reference nucleotide sequence comprising the homologous region and its flanking region, the number of matched or mismatched bases at sites X and Z, or Calculate the ratio.

As described above, the homology region within each reference nucleotide sequence may be the same or shorter in length compared to the oligonucleotide of formula (I) provided in step (a). Specifically, when the entire sequence of the oligonucleotide of formula (I) is compared to the nucleotide sequence database and the number of bases not involved in the Watson-Crick base pair in the Y site is relatively small, the entire sequence of the oligonucleotide of formula (I) A reference nucleotide sequence including a homologous region can be extracted. On the other hand, when the number of bases not involved in the Watson-Crick base pair in the Y site is relatively large, a reference nucleotide sequence including a region homologous to a partial sequence of the oligonucleotide of Formula (I) may be extracted. Further, when a part of the sequence of the oligonucleotide of formula (I) is used for comparison, a reference nucleotide sequence including a region homologous to a partial sequence of the oligonucleotide of formula (I) may be extracted.

Such comparison or analysis may also be referred to as " expansion of comparison " in that the comparison in step (b) utilizes a partial sequence of the oligonucleotide while the comparison in step (c) utilizes the entire sequence of the oligonucleotide have.

If a reference nucleotide sequence comprising a region homologous to a portion of the sequence of the oligonucleotide of Formula (I) is extracted, then the homology region is extended and then the number or ratio of mismatched or matched bases in regions X and Z Can be calculated. Expanding the homologous region to calculate the number or percentage of mismatched or mismatched bases can be accomplished by extending the homologous region to a sequence corresponding to the entire sequence of the oligonucleotide and then calculating the number or percentage of matched or mismatched bases . That is, it means that the sequence of the flanking region is taken (or restored) from the extracted nucleic acid sequence or database to calculate the number or percentage of mismatched or matched bases in regions X and Z.

The process of obtaining the match / mismatch results of sites X and Z using some sequences of oligonucleotides of formula (I) is shown in FIG.

As shown in FIG. 2, when a reference nucleotide sequence including a homologous region is extracted at the X site of the oligonucleotide of formula (I), its flanking region on the opposite side of the Z site is deleted from the database or the extracted reference nucleotide sequence To calculate the number of mismatched bases in sites X and Z. Conversely, when a reference nucleotide sequence comprising a homologous region in the Z region of the oligonucleotide of Formula (I) is extracted, its flanking region on the opposite side of the X region is taken from the database or the extracted reference nucleotide sequence, Calculate the number of mismatched bases in Z.

In the case of the oligonucleotides of formula (I), the bases contained in the Y sites hybridize to the corresponding bases in the target nucleic acid sequence with a relatively low affinity as compared to bases forming the Watson-Crick base pairs. That is, when the oligonucleotide of formula (I) is hybridized to the target nucleic acid sequence, the Y site can form a loop structure. This loop formation of the Y site can reduce the distance between the region where the X region hybridizes and the region where the Z region hybridizes.

Thus, considering such hybridization variability, the flanking region on the opposite side of the site X or Y of interest for the calculation of the number or ratio of matched or mismatched bases is determined in view of the region of interest and its possible opposite region.

For example, supposing that a total of five bases are contained in the Y site, when a reference nucleotide sequence including a homologous region is extracted at the X site of the oligonucleotide of formula (I), the flanking site at the opposite side of the Z site The region is generally 5 nucleotides apart from the homology region in which the X region is hybridized, but it may be 4 nucleotides or 3 nucleotides apart from the homology region in which the X region is hybridized due to loop formation on the Y region.

For example, when a total of five bases are contained in the Y site, the calculation of the number of matched or mismatched bases is performed between the Z region and the X region and the 5 nucleotide spaced region from the hybridization region, May be made between the 4 nucleotide spaced regions from the hybridization region and the 3 nucleotide spaced apart regions from which the Z and X regions are hybridized.

In one embodiment, the number of bases matched in each of the sites X and Z is provided.

In one embodiment, a ratio of the number of mismatched bases to the number of matched bases in each of the sites X and Y is provided.

In one embodiment, a ratio of the number of mismatched bases to the total number of nucleotide sequences in each of the sites X and Y is provided.

In one embodiment, the ratio of the number of mismatched bases to the number of mismatched bases in each of the sites X and Y is provided.

In one embodiment, a ratio of the number of bases matched in each of the sites X and Y to the total number of nucleotide sequences is provided.

When either or both of the sites X and Z comprises at least one universal base or dehydrating base, the method of the present invention may be used after changing the criteria for treating the universal base or dehydrating base as a match or mismatch , And provide the number of mismatched or mismatched bases based on the modified criterion in step (c).

In one embodiment of the present invention, when either or both of the sites X and Z in the oligonucleotide of formula (I) comprise at least one universal base, the universal base is selected from the group consisting of mismatched bases in step (c) Lt; / RTI > That is, when at least one universal base is present in any one or both of the sites X and Z in the oligonucleotide of formula (I), the universal base is capable of hybridizing to any of the reference nucleotide sequences, regardless of the type of corresponding nucleotide in each reference nucleotide sequence Treated with the matched bases. For example, if there are three mismatched bases and one additional universal base at the X site consisting of 15 nucleotides, then one embodiment of the invention can determine the total number of mismatched bases to be three.

In embodiments providing the number of matched bases at sites X and Z, the universal base may or may not be counted with the matched bases. For example, if there are three mismatched bases and one additional universal base at the X site of 15 nucleotides in length, the total number of matched bases at the X site can be determined to be twelve. Alternatively, the total number of matched bases at the X site can be determined to be 11.

In one embodiment of the invention, when either or both of the sites X and Z in the oligonucleotide of formula (I) comprise at least one deacidifying base, the method of the present invention is characterized in that the deactivation base and the reference nucleotide Consideration is given to matching between the corresponding bases in the sequence. That is, when a degenerate base is present in either or both of the sites X and Z of the oligonucleotide of formula (I), the degenerate base may be different depending on the type of degenerate base May be counted or not counted as mismatched bases in step (c).

 In certain embodiments, when either or both of the sites X and Z in the oligonucleotide of formula (I) comprise at least one degenerate base, the degenerate base may be any of the bases represented by the degenerate base If one matches the corresponding base in the reference nucleotide sequence, it is not counted as a mismatched base in step (c). Conventional sequence alignment algorithms or programs, such as BLAST, treat the dehydrated bases mismatched regardless of their type. On the other hand, the method of the present invention is characterized by determining a match / mismatch based on the type of dehydrating base. For example, when the degenerate base "R" (purine base A or G) is present in the oligonucleotide and the corresponding base in the reference nucleotide sequence to be compared is adenine (A) or guanine (G) The method of the invention treats the dehydrated bases as a match. On the other hand, when the corresponding base in the reference nucleotide sequence to be compared is cytosine (C) or thymine (T), the method of the present invention treats the degenerate base mismatch. Thus, the method of the present invention can produce a more accurate match / mismatch result even in the presence of degenerate bases within the oligonucleotide of formula (I) as compared to conventional sequence alignment algorithms.

In another embodiment of the present invention, when one or both of the sites X and Z in the oligonucleotide of formula (I) comprises at least one degenerate base, the degenerate base is introduced into the degenerate base (B) and (c), respectively.

For example, when the degenerate base "R" (purine base A or G) is present in the oligonucleotide of formula (I), the first oligonucleotide in which the degenerate base "R" is converted to adenine (A) A second oligonucleotide in which nucleotides and degenerate bases " R " are converted to guanine (G) is prepared and each method of the present invention is carried out. This method can prevent the degenerate base from being judged as a mismatch and affecting the extraction of the nucleotide sequence having the homologous region.

According to one embodiment, the number or ratio of matched or mismatched bases between each of the sites X and Z in the oligonucleotide of formula (I) and each reference nucleotide sequence can be expressed in a variety of ways.

For example, the number of mismatched bases at the X site and the number of mismatched bases at the Z site can be expressed as Xm | Zm, (Xm, Zm), Xm-Zm, Xm & , Where Xm represents the number of mismatched bases at the X site and Zm represents the number of mismatched bases at the Z site.

For example, the notation " 0 | 0 " indicates that the number of mismatched bases between the X site and the reference nucleotide sequence is zero, and the number of mismatched bases between the Z site and the reference nucleotide sequence is zero. That is, the above notation means that the oligonucleotide of formula (I) except for the Y site is perfectly matched to the reference nucleotide sequence. On the other hand, " 1 | 0 " indicates that the number of mismatched bases between the X site and the reference nucleotide sequence is one and that the number of mismatched bases between the Z site and the reference nucleotide sequence is zero. On the other hand, "0 | 1" indicates that the number of mismatched bases between the X site and the reference nucleotide sequence is zero, and the number of mismatched bases between the Z site and the reference nucleotide sequence is one.

In addition to the above notation, it will be understood by those skilled in the art that the number of mismatched bases at sites X and Z can be expressed in other ways.

In one embodiment, the total number of nucleotides in each of the sites X and Y, or the number of matched bases in each of the sites X and Y, may additionally be indicated.

The number of mismatched bases is highly related to the specificity of the oligonucleotide of formula (I).

The number of mismatched bases at the X and Z sites may affect the specificity of the oligonucleotides of formula (I), particularly the annealing specificity, while the Y site does not affect the evaluation of specificity. As discussed above, the number of mismatched bases at the X site and the number of mismatched bases at the Z site have a different negative impact on the specificity of the oligonucleotide. Taking into consideration the difference in the above effects, the method of the present invention is characterized in that, in order to more accurately evaluate the specificity of the oligonucleotide of formula (I), the number or ratio of mismatched bases at the X site and mismatches The two values, such as the number or percentage of bases, can be weighted differently.

According to one embodiment, in the determination of specificity, the match at the Z site is more important than the match at the X site (for example, the bispecific oligonucleotide disclosed in WO 2006/095981). In this case, oligonucleotides having one mismatch at the Z site can be evaluated as having poor specificity compared to oligonucleotides having one mismatch at the X site. In addition, oligonucleotides having one mismatch at the Z site can be evaluated as having poor specificity compared to oligonucleotides having two, three or four mismatches at the X site. Considering that the number of mismatched bases at the X site and the number of mismatched bases at the Z site differently affect the evaluation of the specificity as described above, the number of mismatched bases at the Z site The weight may be greater than the weight assigned to the number of mismatched bases at the X site. The weights may be given by a person skilled in the art in various ways.

According to another embodiment, the match at the X site is more important than the match at the Z site in determining the specificity (see, for example, the target differentiation (TD) probe disclosed in WO 2011/028041). In this case, the weight given to the number of mismatched bases at the X site may be greater than the weight given to the number of mismatched bases at the Z site.

Also, one embodiment of the present invention may assign a penalty score to the oligonucleotides of formula (I) based on the number of mismatched bases at the X and Z sites. The penalty score is a value reflecting the degradation of the specificity of the oligonucleotide of formula (I).

The penalty score may be given for every mismatched base. The penalty score per mismatched base at the X site and the penalty score per mismatched base at the Z site may be different from each other.

In one embodiment, if the match at the Z-site is more important than the match at the X-site in determining the specificity, the penalty score per mismatched base at the X-moiety is given per mismatched base at the Z- It is smaller than the penalty score. This difference in penalty score can be achieved by giving a weighted penalty score. For example, if the specificity of oligonucleotides of formula (I) (i.e., sites X and Z in oligonucleotides perfectly matched with the target nucleic acid sequence) in which no mismatched base is present in both the X and Z sites is set to " 100 & 20 "," 30 "," 40 "," 50 ", or" 60 "for mismatched bases at the Z site, &Quot; can be given. In this case, the specificity of the oligonucleotide having one mismatched base at the X site will be " 90 " (= 100-10), and the specificity of the oligonucleotide having one mismatched base at the Z site will be & , "70", "60", "50", or "40". As such, the present invention allows for accurate specificity evaluation by assigning different weighted penalty scores to site X and site Z, depending on the number of mismatched bases in sites X and Z. < RTI ID = 0.0 >

 In another embodiment, when the match at the X site is more important than the match at the Z site in determining the specificity, the penalty score per mismatched base at the Z site is given per mismatched base at the X site It is smaller than the penalty score.

On the other hand, unlike the X and Z sites described above, the Y site does not affect the evaluation of the specificity of the oligonucleotide, so the Y site is not considered in the evaluation of the specificity.

Since the present invention individually provides match / mismatch results at the X and Z sites of the oligonucleotide, the specificity of each of the X and Z sites can be individually assessed by the match / mismatch results for each site.

In one embodiment, the specificity of each of the X and Z sites may be determined by evaluating the match / mismatch results at each site based on different criteria (e.g., different match / mismatch thresholds).

For example, with respect to the specificity of the X site, it is determined whether there are two or fewer mismatches between the X site and the reference nucleotide sequence, and with respect to the specificity of the Z site, one between the Z site and the reference nucleotide sequence It is determined whether or not the following mismatch exists.

The specificity of the oligonucleotide can be assessed by combining the specificity evaluation at each site to determine the nucleotide sequence in which the oligonucleotide is annealed or hybridized.

In one embodiment, the number of matches / mismatches per region may be specified to assess specificity, then the coverage, inclusivity and exclusivity of the oligonucleotides may be assessed. In addition, the coverage, inclusiveness and exclusivity of the oligonucleotide can be adjusted, if necessary, by adjusting the hybridization conditions and the like.

In addition to the number or ratio of matched or mismatched bases at sites X and Z, the methods of the invention can additionally provide a match direction between the oligonucleotides of formula (I) and each of the reference nucleotide sequences. Specifically, the direction of the match is determined by comparing the oligonucleotide of formula (I) matched to the positive strand (coding strand, sense strand, non-template strand) of the reference nucleotide sequence and the negative strand of the reference nucleotide sequence , An antisense strand, a template strand) to distinguish oligonucleotides of formula (I). For example, if the oligonucleotide of formula (I) is matched to the (+) strand of the reference nucleotide sequence, it may provide an indication such as "F" or "+" &Quot; can be provided. The match direction may be provided with the number of mismatched bases at the X and Z sites described above. For example, notation such as "F Xm | Zm", "+ Xm | Zm", "R Xm | Zm", "-Xm | Zm" The above notation is illustrated in FIG. As shown in Figure 3, the notation " -1 | 0 " indicates that the oligonucleotide of formula (I) matches the (-) strand of the reference nucleotide sequence and that the oligonucleotide of formula (I) It has a simple and intuitive display that it has a mismatched base with zero base in the Z region with a matched base.

The method of the present invention can further provide a biological characteristic of the reference nucleotide.

The biological characteristics of the reference nucleotide sequence include the source, gene ID, or description of the extracted reference nucleotide sequence. In addition, the biological characteristics of the reference nucleotide sequence may include the position of the region corresponding to the oligonucleotide (e.g., the position number of the nucleotide at the 5 'end and the 3' end). In addition, the biological characteristics of the reference nucleotide sequence can include a list of reference nucleotide sequences that have substantial homology with the desired oligonucleotide. The biological characteristics of the reference nucleotide sequence may include one or more features provided in a sequence alignment algorithm or program, such as the conventional BLAST algorithm. The biological character of the reference nucleotide sequence may be useful in assessing the specificity of the oligonucleotide. The user can analyze the list of reference nucleotide sequences including the desired oligonucleotide and homologous regions and their specific sequence information to determine whether the designed oligonucleotide amplifies or detects (or hybridizes) only the target nucleic acid sequence that is not a non-target nucleic acid sequence . Furthermore, it is possible to control the degree of mismatch of the oligonucleotide, specifically the X and Z sites in relation to the target nucleic acid sequence. The presence of a target nucleic acid sequence in the list of reference nucleotide sequences and the absence of a non-target nucleic acid sequence indicates that the oligonucleotide is suitable for amplification or detection of the target nucleic acid sequence. On the other hand, the presence of a non-target nucleic acid sequence in the list of reference nucleotide sequences indicates that the oligonucleotide is not suitable for amplification or detection of the target nucleic acid sequence, which is a strong basis for selecting other oligonucleotides.

The biological character of the reference nucleotide sequence includes information that helps determine the target coverage of the oligonucleotide.

The method of the present invention may further provide a result of classification of the reference nucleotide sequence according to the number of mismatched bases at the X site and the number of mismatched bases at the Z site.

The user needs to identify the reference nucleotide sequence homologous to the designed oligonucleotide, and thus the provision of this sorting result is very useful in determining the specificity of the designed oligonucleotide.

The result of classification of the reference nucleotide sequence is the result obtained by grouping (classifying) the reference nucleotide sequence based on the number of mismatched bases at the X site and the number of mismatched bases at the Z site, The list and number of reference nucleotides belonging to each group, and the biological characteristics of each of the reference nucleotide sequences.

A primer or probe can also hybridize to a reference nucleotide sequence with several mismatches under certain hybridization conditions. Therefore, in order to evaluate the suitability or operability of a designed primer or probe, it is necessary to identify the reference nucleotide sequence that is matched as well as the partially matched reference nucleotide sequence. To this end, the method of the present invention provides the list and number of reference nucleotide sequences belonging to each group, and the biological characteristics of each of the reference nucleotide sequences in a simple and intuitive manner.

Specifically, a mismatch of " 0 | 0 " with respect to the oligonucleotide of formula (I) (the number of mismatched bases at the X site is zero and the number of mismatched bases at the Z site is zero) The number of reference nucleotide sequences having the nucleotide sequence of SEQ ID NO. In addition, in relation to the oligonucleotide of formula (I), a mismatch of " 1 | 0 ", wherein the number of mismatched bases at the X site is 1 and the number of mismatched bases at the Z site is 0, The number of reference nucleotide sequences having "0 | 1", "1 | 2", "2 | 2", "3 | 0", "3 | 1", "3 | 2"

For example, if the number of reference nucleotide sequences belonging to the mismatch type " 0 | 0 " is given as " 30 ", this means that the reference nucleotide sequence which is 100% identical to the X and Z sites of the oligonucleotide of formula (I) It means that 30 exist. Those skilled in the art will appreciate that for the accurate evaluation of the specificity of the oligonucleotide of formula (I), " 1 | 0 ", & 2 ", " 3 | 0 ", " 3 | 1 ", " 3 | 2 ", and the like.

When the match at the Z site is more important than the X site in the evaluation of the specificity, the reference nucleotide sequence corresponding to the mismatch type " 1 | 0 " is highly likely to be amplified or detected using the oligonucleotide of formula (I). Therefore, when there is a non-target nucleic acid sequence in the reference nucleotide sequence belonging to the mismatch type " 1 | 0 ", the user designes another oligonucleotide to avoid amplification or detection of the non-target nucleic acid sequence, The amplification or detection of the non-target nucleic acid sequence can be ignored if the number of target nucleic acid sequences is small or the importance is low. When the target nucleic acid sequence is present in the mismatch type " 0 | 1 ", the target nucleic acid sequence may not be amplified or detected using the oligonucleotide of formula (I). Thus, the user can modify (e.g., by incorporating a degenerate base) the sequence of the oligonucleotide of formula (I), or with another oligonucleotide, to cover the target nucleic acid sequence belonging to the mismatch type " 0 | Can be designed. Also, in the case where a non-target nucleic acid sequence exists in a reference target nucleotide sequence corresponding to the mismatch type " 0 | 1 ", it is preferable to determine whether the non-target nucleic acid sequence is amplified or detected and then use of the oligonucleotide is determined . The result of the classification of the reference nucleotide sequence based on the number of mismatched bases at the X site and the number of mismatched bases at the Z site is useful for evaluating the specificity of the designed oligonucleotide in a simple and intuitive manner.

The classification result may further include information about each reference nucleotide sequence.

The information provided may also be used to determine whether the oligonucleotide represents the same match result as the match result reviewed at the time of the initial design. For example, if the oligonucleotide of formula (I) has five target nucleic acid sequences with a mismatch type " 0 | 0 ", where the number of mismatched bases at the X site is zero and the number of mismatched bases at the Z site is zero. Match the three target nucleic acid sequences with the mismatch type "1 | 0" and match the two target nucleic acid sequences with the mismatch type "1 | 1", the designed oligonucleotide is used as the target Is compared with a database containing only a nucleic acid sequence, and the number of target nucleic acid sequences belonging to mismatch types "0 | 0", "1 | 0" and "1 | 1" It can be determined whether a result is obtained.

In addition, further classification results can be used to confirm the coverage of the oligonucleotides of formula (I). The classification result can be used to confirm the coverage of the oligonucleotide of formula (I), since the user can analyze the classification results and identify the target nucleic acid sequence amplified or detected using the designed oligonucleotide.

The method of the present invention, on the other hand, can additionally provide information about the sequence similarity between the oligonucleotide and the respective reference nucleotide sequence.

The information about the similarity can be displayed in various ways. In one embodiment, the information about the similarity may be expressed as the number of nucleotides matched against the total number of nucleotides of the designed oligonucleotide, or a percent-identity score thereof.

In particular, the information about the similarity can be calculated by excluding the similarity between the site Y of the oligonucleotide and the corresponding site of the reference nucleotide sequence. For example, if the X site is a p nucleotide length, the Y site is a q nucleotide length, and Z is a r nucleotide length, then the similarity (%) is the sum of nucleotides matched at [ Number / (p + r)] * 100.

Alternatively, the similarity information may be calculated assuming that the site Y of the oligonucleotide and the corresponding site of the reference nucleotide sequence match each other. For example, if the X site is a p nucleotide length, the Y site is a q nucleotide length, and Z is a r nucleotide length, then the similarity (%) is the sum of nucleotides matched at [ Number + q) / (p + q + r)] * 100.

As another alternative, the similarity between the X site of the oligonucleotide and the corresponding site of the reference nucleotide sequence and the similarity between the Z site of the oligonucleotide and the corresponding site of the reference nucleotide sequence are provided separately.

On the other hand, when there is at least one universal base or degenerate base in any one or both of the sites X and Z of the oligonucleotide of formula (I), the sequence similarity is determined by calculating the number of mismatched bases in the universal base Or by treating universal bases or dehydrating bases in the same manner as the treatment of dehydrating bases.

As described above, the method of the present invention provides information on the specificity of oligonucleotides in various ways, allowing a user to easily, quickly and intuitively analyze the homology of oligonucleotides with target and non-target nucleic acid sequences .

Since the method of the present invention is characterized by providing information on the specificity of the oligonucleotide, the method of the present invention may be referred to as a method of providing information on the specificity of the oligonucleotide.

One of ordinary skill in the art can assess the specificity of oligonucleotides designed using the information provided by the methods of the present invention. Thus, the method of the present invention may further comprise the step of evaluating the specificity of the oligonucleotide of formula (I) using the information provided in step (c) above.

Estimating the specificity of the oligonucleotide of formula (I) using the information provided in step (c) can be accomplished by determining the inclusion and exclusivity of the oligonucleotide of formula (I).

The method of the present invention can be used to evaluate the operability of oligonucleotides as primers or probes, particularly the oligonucleotides represented by formula (I).

The match / mismatch results at sites X and Z provided in step (c) confirm whether the oligonucleotides hybridize to a particular target nucleic acid sequence. Thus, the methods of the present invention can be used to determine whether oligonucleotides will act as primers or probes for a particular target nucleic acid sequence.

The above-described method may be embodied on a computer by software, including instructions for implementing a process for implementing the method.

II. Recording medium, computer program and apparatus

The recording medium, the apparatus and the computer program of the present invention described below enable the method of the present invention to be carried out in a computer, and the common content therebetween is omitted in order to avoid excessive redundancy causing the complexity of the present specification.

According to another aspect of the present invention, there is provided a computer-readable recording medium comprising instructions for implementing a processor for performing a method of evaluating the specificity of an oligonucleotide, said method comprising the steps of: :

(a) providing an oligonucleotide represented by the following formula (I):

5'-X-Y-Z-3 '(I)

Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 > a < / RTI > hybridization nucleotide sequence;

(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, and comparing the at least one sequence of the oligonucleotide of formula (I) Extracting a reference nucleotide sequence; And

(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.

According to another aspect of the present invention, there is provided a computer program stored on a computer readable recording medium embodying a processor for performing a method of assessing the specificity of an oligonucleotide, said method comprising the steps of: Includes:

(a) providing an oligonucleotide represented by the following formula (I):

5'-X-Y-Z-3 '(I)

Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 > a < / RTI > hybridization nucleotide sequence;

(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, and comparing the at least one sequence of the oligonucleotide of formula (I) Extracting a reference nucleotide sequence; And

(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.

Program instructions, when executed by a processor, cause the processor to perform the method of the invention described above. Program instructions for carrying out the methods of the present invention may include the following instructions: (i) instructions to compare all or part of the oligonucleotide of formula (I) with at least one nucleotide sequence database; (ii) extracting from the database a reference nucleotide sequence comprising a region homologous to all or some of the oligonucleotides of formula (I); (iii) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and each reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence The number or percentage of mismatched bases and (ii) the number or percentage of matched or mismatched bases between each reference nucleotide sequence and the site Z of the oligonucleotide of formula (I) above.

The method of the present invention is implemented in a processor, which may be a stand alone computer, a network attached computer, or a processor in a data acquisition device such as a real-time PCR device.

The computer-readable recording medium may be any of various storage media known in the art such as CD-R, CD-ROM, DVD, flash memory, floppy disk, hard drive, portable HDD, USB, magnetic tape, MINIDISC, , EEPROM, optical disk, optical storage medium, RAM, ROM, system memory and web server.

The oligonucleotide of formula (I) for amplifying or detecting the target nucleic acid sequence may be provided in various ways. For example, the sequence of oligonucleotides of formula (I) may be introduced into a host computer system by a network connection (e.g., LAN, VPN, Internet and intranet) or a direct connection (e.g., USB or other direct wired connection or wireless connection) May be provided in a separate system, or may be provided on a portable medium such as a CD, a DVD, a floppy disk, and a portable HDD.

Instructions implementing the processor implementing the invention may be included in the logic system. Although the instructions may be provided on a software recording medium (e.g., a portable HDD, a USB, a floppy disk, a CD and a DVD) ). ≪ / RTI > Computer code for implementing the invention can be implemented in a variety of coding languages such as C, C ++, Java, Visual Basic, VBScript, JavaScript, Perl, and XML. In addition, various languages and protocols may be used for external and internal storage and delivery of signals and instructions in accordance with the present invention.

According to another aspect of the present invention, the present invention provides a device for evaluating the specificity of oligonucleotides, comprising: (a) a computer processor; and (b) said computer readable recording medium of the present invention coupled to said computer processor Lt; / RTI >

A processor may be constructed such that one processor may perform all of the above-described performance. Alternatively, the processor unit may be constructed such that multiple processors execute their respective performance.

The features and advantages of the present invention are summarized as follows:

(a) Conventional sequence alignment algorithms or programs can be used to identify a 5'-XYZ-3 ', wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson- But does not provide a match / mismatch result for non-typical oligonucleotides. In contrast, the method of the present invention provides individually match / mismatch results at the X and Z sites, allowing the user to evaluate the specificity, particularly the annealing specificities at the X and Z sites, to different weights.

(b) for non-typical oligonucleotides such as those represented by 5'-XYZ-3 ', wherein Y represents a cleavage site comprising two or more consecutive bases not involved in Watson-Crick base pairs, The sorting algorithm or program may only provide a match / mismatch result of either the X region or the Z region. In contrast, the method of the present invention provides a match / mismatch result for both the X and Z sites using the homology region and its flanking region within the extracted reference nucleotide sequence. Thus, the method of the present invention enables accurate evaluation of the specificity, particularly the annealing specificity of oligonucleotides having a non-typical structure, and helps to select an appropriate oligonucleotide in view of the importance of the X and Z sites.

(c) For oligonucleotides containing a continuous or discontinuous universal base within a sequence, conventional sequence alignment algorithms or programs determine the universal base as a mismatch. In contrast, the method according to one embodiment of the present invention makes it possible to accurately determine the specificity of the oligonucleotide by determining the universal base as a match.

(d) For oligonucleotides containing deacidifying base (s) within the sequence, conventional sequence alignment algorithms or programs will mismatch the degenerate base (s) regardless of the type of its corresponding nucleotide . In contrast, the method according to one embodiment of the present invention determines a match / mismatch according to the type of the base represented by the degenerate base so as to accurately evaluate the specificity of the oligonucleotide.

(e) The method of the present invention provides the biological characteristics of the reference nucleotide sequence as well as the result of classification of the reference nucleotide sequence according to the number of mismatched bases in the sites X and Z, so that the user can easily identify the specificity of the oligonucleotide, It allows intuitive evaluation.

1 is a flow chart illustrating a process for evaluating the specificity of an oligonucleotide according to an embodiment of the present invention.
Figure 2 is a schematic representation of a process for assessing the specificity of an oligonucleotide (DPO primer) according to one embodiment of the present invention. A sequence (query) of a site X in the DPO primer represented by 5'-XYZ-3 'is compared with a database using BLAST to extract a plurality of reference nucleotide sequences including a region homologous to the X site. Thereafter, the site-specific match / mismatch between the entire sequence of the DPO primer and the homologous region of each reference nucleotide sequence and its flanking region is analyzed and the number of mismatched bases in regions X and Z is provided .
Figure 3 shows a site-specific match / mismatch analysis between the entire sequence (top row) of an exemplary DPO primer represented by 5'-XYZ-3 'and the reference nucleotide sequence (bottom row) extracted according to one embodiment of the present invention (Sequence alignment). As shown in Figure 3, the DPO primer was found to have a (-) strand of the reference nucleotide sequence, one mass matched base at site X and zero mismatched bases at site Z. The above information is indicated as "-1 | 0 " in Fig.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

Example

Example  1: Work of the invention In an implementation example  Following Oligonucleotide  Specificity evaluation

<1-1> Double specificity Of the oligonucleotide (DPO)  design

A DPO primer (SEQ ID NO: 1) was designed to amplify 16S ribosomal RNA (Genbank ID No: HM352993.1) of Bacteroides fragilis as a target nucleic acid sequence with reference to the disclosure of WO 2006/095981. The nucleotide sequence of the designed DPO primer is shown below.

5'-GACTCTAGAGAGACTGCCGTCGTAA IIIII GAGGAAGGTG-3 '(SEQ ID NO: 1)

As indicated above, the DPO primer has three distinct sites: (i) site "X" at the 5 'end: GACTCTAGAGAGACTGCCGTCGTAA; (ii) a cleavage site " Y " consisting of 5 deoxyinosines (I) (expressed in bold) as universal bases; And (iii) a site &quot; Z " at the 3 'end: GAGGAAGGTG.

<1-2> Evaluation of specificity using BLAST

To assess the specificity of the DPO primers, site X (i.e., 5'-GACTCTAGAGAGACTGCCGTCGTAA-3 ') in the DPO primer was compared to the GenBank database using BLAST for homology analysis. The parameters used in the BLAST algorithm are as follows:

- query: Fasta-format primer sequence filename

- db: Nucleotide database file name

- out: the file name to be saved

- evalue: 1000

- word_size: 4

- perc_identity: 60

- num_alignments: 1000000

- num_descriptions: 1000000

As a result of the above comparison, a total of 2387 reference nucleotide sequences containing regions homologous to site X of the DPO primer were extracted. Each of the extracted reference nucleotide sequences contained a flanking region that could be used for comparison with the homologous region and optionally the Z region.

The extracted reference nucleotide sequence containing the homologous region and its flanking region is each compared with the entire sequence of the DPO primer to determine the number of mismatched bases between the site X of the DPO primer and each reference nucleotide sequence as well as the number of mismatched bases of the DPO primer The number of mismatched bases between Z and the respective reference nucleotide sequence was obtained (see FIG. 2).

The results of comparison between the DPO primer and one of the reference nucleotide sequences are shown in FIG.

From Figure 3 it can be seen that the DPO primer has one mismatched base at site X and zero mismatched base at Z site compared to the exemplary reference nucleotide sequence. In addition, the DPO primer appeared to match the (-) strand of the reference nucleotide sequence.

The information is represented by the notation " D Xm | Zm ". In the above notation, " D " means the match direction of the oligonucleotide of interest relative to the reference nucleotide sequence. Specifically, "+" means that the oligonucleotide of interest matches the (+) strand of the reference nucleotide sequence and "-" means that the oligonucleotide of interest matches the (-) strand of the reference nucleotide sequence. Also, " Xm " refers to the number of mismatched bases at site X, and " Zm " refers to the number of mismatched bases at site Z. The results are shown in FIG. 3 as "-1 | 0 ".

The reference nucleotide sequence was then sorted according to the number of mismatched bases at site X and the number of mismatched bases at site Z. [ The results are shown in Table 1 below.

Among the above mismatch types, mismatch types "0 | 0" (230 reference nucleotide sequences), "1 | 0" (422 reference nucleotide sequences) and "1 | 1" &Quot; (10 reference nucleotide sequences). As a result, all reference nucleotide sequences included in the mismatch type were found to be derived from Bacteroides fragilis. This shows that the designed DPO primer has specificity for the nucleic acid sequence of Bacteroides fragilis.

The results also provide information about the coverage of the target nucleic acid sequence amplified using the designed DPO primers, depending on the hybridization conditions. Specifically, from the above results, those skilled in the art will recognize that target nucleic acid sequences belonging to mismatch types "0 | 0", "1 | 0" and "1 | 1" can be amplified by modulating the hybridization conditions.

The results also provide information as to whether the DPO primer has an annealing specificity for each extracted reference nucleotide.

Thus, the specificity of the designed oligonucleotide can be evaluated in a simpler and more intuitive manner.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> SEEGENE, INC. <120> Method for evaluating target specific workability of          oligonucleotides <130> PI180020KR <150> KR 10-2016-0069487 <151> 2016-06-03 <160> 1 <170> KoPatentin 3.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Synthetic nucleotide <400> 1 gactctagag agactgccgt cgtaannnnn gaggaaggtg 40

Claims (17)

A method for evaluating the specificity of oligonucleotides, comprising the steps of:
(a) providing an oligonucleotide represented by the following formula (I):
5'-XYZ-3 '(I)
Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; hybridization nucleotide sequence;
(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database and comparing the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, Extracting a reference nucleotide sequence; And
(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.
3. The method of claim 1, wherein the entire sequence of the oligonucleotide of formula (I) is compared to at least one nucleotide sequence database and the step (b) comprises the step of (i) comprising a region homologous to a partial sequence of the oligonucleotide of formula When a reference nucleotide sequence is extracted, site-specific match / mismatch between the entire sequence of the oligonucleotide of the above formula (I) and the homologous region of each reference nucleotide sequence and its flanking region is analyzed, Characterized in that the number or percentage of matched or mismatched bases is provided.
2. The method according to claim 1, wherein a partial sequence of the oligonucleotide of the formula (I) is compared to at least one nucleotide sequence database and the step (b) comprises the step of introducing a sequence homologous to a partial sequence of the oligonucleotide of the formula When a reference nucleotide sequence is extracted, site-specific match / mismatch between the entire sequence of the oligonucleotide of the above formula (I) and the homologous region of each reference nucleotide sequence and its flanking region is analyzed, Characterized in that the number or percentage of matched or mismatched bases is provided.
4. The method of claim 3, wherein the partial sequence of the oligonucleotide of formula (I) used in the comparison of step (b) is site X, site Z, or a portion thereof.
4. The method of claim 3, wherein the partial sequence of the oligonucleotide of formula (I) used in the comparison of step (b) is site X, site Z, or a portion thereof.
6. The method of claim 5, wherein the sequence alignment algorithm or program is selected from the group consisting of Smith & Waterman, Needleman-Wunsch, BLAST, and FASTA.
3. The method of claim 1, wherein one or both of the X and Z sites comprise at least one universal base or a degenerate base.
8. The method of claim 7, wherein the universal base is not counted as a mismatched base in step (c).
8. The method of claim 7, wherein the degenerate base is not counted as a mismatched base in step (c) if any of the bases exhibited by the degenerate base match the corresponding base in the reference nucleotide sequence How to.
2. The method of claim 1, further providing a biological characteristic of each reference nucleotide sequence in step (c).
2. The method of claim 1, further comprising providing a result of classification of the reference nucleotide sequence according to the number of mismatched bases at site X and the number of mismatched bases at site Z.
The method according to claim 1, wherein the oligonucleotide of the formula (I) is a primer or a probe.
The method according to claim 1, wherein the oligonucleotide of the formula (I) is a primer or a probe.
The method according to claim 1, wherein the base included in the cleavage site Y is an unnatural base; Universal base; A mismatched base and a combination thereof.
A computer readable recording medium comprising instructions for implementing a processor to perform a method of assessing the specificity of an oligonucleotide, said method comprising the steps of:
(a) providing an oligonucleotide represented by the following formula (I):
5'-XYZ-3 '(I)
Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; hybridization nucleotide sequence;
(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database and comparing the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, Extracting a reference nucleotide sequence; And
(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.
15. An apparatus for evaluating the specificity of an oligonucleotide, comprising: (a) a computer processor; and (b) the computer-readable recording medium of claim 15 coupled to the computer processor.
A computer program stored on a computer readable recording medium embodying a processor for performing a method of assessing the specificity of an oligonucleotide, said method comprising the steps of:
(a) providing an oligonucleotide represented by the following formula (I):
5'-XYZ-3 '(I)
Wherein Y represents a cleavage site comprising two or more consecutive bases not involved in the Watson-Crick base pair, and Z represents a cleavage site of the target nucleic acid sequence Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; hybridization nucleotide sequence;
(b) comparing all or part of the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database and comparing the sequence of the oligonucleotide of formula (I) with at least one nucleotide sequence database, Extracting a reference nucleotide sequence; And
(c) analyzing the site-specific match / mismatch between the oligonucleotide of formula (I) and the respective reference nucleotide sequence to determine whether (i) a match between the site X of the oligonucleotide of formula (I) and the respective reference nucleotide sequence Providing the number or percentage of mismatched bases between the respective reference nucleotide sequence and the number or percentage of mismatched bases and (ii) site Z of the oligonucleotide of formula (I) above.

Images