KR20180131859A - Composition comprising Atractylenolide-Ⅰas an effective ingredient for preventing or treating of neurological disease - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing or treating neurological diseases, and a functional health food composition for alleviating neurological diseases, all of which comprise atractylenolide-I as an active ingredient. According to the present invention, the atractylenolide-I, due to having an inhibitory activity on activities of microglia cells, may prevent or treat neurological inflammation mediated by microglia cells, and thus may be used in the prevention or treatment of neurological diseases.

Description

[0001] The present invention relates to a composition for preventing or treating neuroinflammation comprising atoractanolol-I and a salt thereof as an active ingredient.

The present invention relates to a pharmaceutical composition for preventing or treating neuroinflammation comprising atactactilolide-I and a salt thereof as an active ingredient.

(Nat Rev Neurosci, 8 (1)). In this study, we investigated the effects of neuroinflammatory responses on brain injury caused by Parkinson's disease, Alzheimer's disease, trauma, paralysis and seizures in the central nervous system Griffin, WS et al., J Neuroinflammation, 3, 5, 2006). The inflammatory response is characterized by acute brain injury, which is caused by neutrophil, monocyte, and phagocytic cell infiltration due to the activation of astrocytes in the dormant brain tissue, and the proinflammatory cytokines, Inflammatory mediators exhibit activity. Neuroinflammation is mainly mediated by the activation of glial cells, which constitute about 20% of the brain.

The activity of microglia usually results from the signaling pathways of three pathways. (IL-1β), which is known as inflammatory cytokines, and TNF-α, which are known as inflammatory cytokines, and IL-1β, (IL-6), and transcription factor nuclear factor-κB (Mc Geer et al., Neurology, 38, 1285-91, 1988; Minghetti, L. et al. Pro, Neurobiol, 54, 99-125, 1998; Le, W. et al., J Neurosci, 21, 8447-55, 2001).

The induction of inflammation in the glial cells is accompanied by the production of nitrite (NO) by lipopolysaccharide (LPS) and the increase of nitrite (NO) is a pathological process that is very important for cytotoxicity during brain injury. (Chen et al., J Biol Chem, 273, 19424-30, 1998).

Atractylenolide-I is a major active ingredient of Atractylodes macrocephala. It is known that Zhang Yao Cai 1999, 22, 636-640 by Zhang Y. et al., Antioxidant (Wang, CC et al. Toxicol 2006, 44, 1308-1315) and anticancer (Huang, HL et al. J Ethnopharmacol 2005, 97, 21-29). However, there have been few studies on the protection of neurological diseases and the suppression of neuroinflammation.

The present invention is intended to provide a pharmaceutical composition for preventing or treating cranial nerve diseases containing atractylenolide-I as an active ingredient.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a pharmaceutical composition for the prophylaxis or treatment of cranial nerve diseases containing atractylenolide-I as an active ingredient.

The composition can prevent the inflammatory reaction of LPS or MPTP-induced microglia.

The composition may inhibit the release of nitrite (NO) or reduce the expression of iNOS.

The composition may inhibit the expression of TNF- [alpha], IL-1 [beta] or IL-6.

The composition may enhance the antioxidant activity.

The composition may inhibit damage to the midbrain dopaminergic neurons.

The cranial nerve disease may be selected from the group consisting of dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Lou Gehrig's disease, Creutzfeldt Jakob disease, stroke, multiple sclerosis, learning disorder, cognitive disorder and memory impairment.

An embodiment of the present invention provides a health functional food composition for preventing or ameliorating a brain disease containing atractylenolide-I as an active ingredient.

The present invention relates to a composition for preventing or treating cranial nerve diseases using atactylenolide-I as an active ingredient. The atactylenolide-I has an effect of inhibiting the activity of microglia, Which can prevent or treat neuroinflammation, can be used for preventing or treating neurological diseases.

1 is a graph showing (a) nitrite-inhibiting activity and (b) cytotoxicity of atactylenolide-I in LPS-stimulated BV-2 glial cells.
FIG. 2 shows the expression of MMP-1 and MMP-9 genes of TNF-α, IL-6, IL1-β and IL-6 genes in inflammatory mediator iNOS gene and proinflammatory mediators in BV-2 glial cells stimulated by LPS Inhibitory activity against the artactylrenolide-I.
FIG. 3 shows the inhibitory effect of atactylenolide-I on the inflammation-producing activator iNOS protein in BV-2 glial cells stimulated with LPS.
Fig. 4 shows the phosphorylation inhibitory effect of MAPK of atactyllainolide-I, a single compound, in BV-2 glial cells stimulated by LPS.
FIG. 5 shows the results of inhibition of the activity of NF-κB nuclear transcription factor dependent on concentration of atlactylenolide-I, a single compound, in the LPS-stimulated BV-2 gliotropic cells, and inhibition of IκB-α and inhibition of phosphorylation will be.
FIG. 6 is a graph showing the expression profiles of the iNOS gene, the proinflammatory mediator TNF-?, The microglial inflammation marker GFAP, the Mac-1 gene and the antioxidant enzyme HO-1 gene in the neurodegenerative animal disease model induced by MPTP Lt; RTI ID = 0.0 > of < / RTI >
FIG. 7 shows the inhibitory effect of atactylenolide-I on GFAP and Mac-1 protein, which are inflammation markers of microglial cells, in a neurodegenerative animal disease model induced by MPTP.
Fig. 8 shows the effect of atactylenolide-I on neuronal cell protection in a neurodegenerative animal disease model induced by MPTP.
FIG. 9 shows the antioxidant activity of atactylenolide-I and the increase of HO-1 activity, which is an antioxidant enzyme, in a neurodegenerative animal disease model induced by MPTP.

We conducted an efficacy analysis of atactylenolide-I through a mechanism study involved in the expression of products, genes and proteins of inflammatory-related factors induced by lipopolysaccharide (LPS) and found that MPTP induced The present inventors completed the present invention by confirming the action force and the protection of nerve cells in a neurodegenerative animal model and confirming the protective effect of atactylenolide-I on neurons.

Hereinafter, the present invention will be described in detail.

A pharmaceutical composition for the prevention or treatment of neurological diseases

The present invention provides a pharmaceutical composition for the prophylaxis or treatment of cranial nerve diseases containing atractylenolide-I as an active ingredient. Specifically, the atactylenolide-I may be represented by the following general formula (1), and may be an active ingredient of Atractylodes macrocephala, extracted or purified from the above extract, but is not limited thereto.

[Chemical Formula 1]

The composition according to the present invention inhibits the inflammatory response of glial cells in LPS or MPTP-induced microglia, inhibits the release of nitrite (NO), decreases the expression of iNOS, and inhibits TNF-α, IL-1β Or inhibiting the expression of an inflammatory cytokine such as IL-6, brain diseases can be prevented or treated.

In addition, the composition inhibits the degradation of IkB-a, inhibits the activity of NF-κB, inhibits it through the ERK pathway, one of the typical MAPKs pathways by LPS, and inhibits MPTP-mediated dopaminergic neuronal tissue By inhibiting the damage, the brain disease can be prevented or treated.

Cranial nerve diseases that can be prevented or treated by the compositions of the present invention are selected from the group consisting of dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Lou Gehrig's disease, Creutzfeldt Jakob disease, stroke, multiple sclerosis, learning disorders, cognitive disorders, And is preferably, but not limited to, Parkinson's disease.

The dose of atactylenolide-I that may be contained in the composition of the present invention is preferably from 0.1 mM to 100 mM, but is not limited thereto. At this time, when the concentration of atactylenolide-I is less than the above range, there is a problem that cell death is not prevented and it is difficult to exert the effect of preventing or treating brain diseases. When the concentration exceeds the above range, There may be concerns about toxicity, including

The pharmaceutical compositions for the prevention or treatment of cerebral diseases according to the present invention may be administered orally or parenterally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, external preparations, suppositories, And may contain suitable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions for formulation.

The carrier or the excipient or diluent includes lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, mineral oil, and the like.

In the case of formulation, a diluent or excipient such as a commonly used filler, a weight agent, a binder, a wetting agent, a disintegrant or a surfactant may be used.

The solid preparation for oral administration can be prepared by mixing at least one excipient such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. in the above-mentioned atactylenolide-I. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Examples of the liquid preparation for oral administration include suspensions, solutions, emulsions, syrups and the like. In addition to water and liquid paraffin which are commonly used diluents, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous agents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. As a base for suppositories, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol gelatin and the like can be used.

The preferred dosage of the pharmaceutical composition for preventing or treating a neurological disease according to the present invention varies depending on the condition of the patient, the body weight, the degree of disease, the drug form, the administration route and the period, but can be appropriately selected by those skilled in the art. However, for a desired effect, the dose may be 0.0001 to 2,000 mg / kg, preferably 0.001 to 2,000 mg / kg per day. The administration may be carried out once a day or divided into several doses. However, the scope of the present invention is not limited by the dosage.

The pharmaceutical composition for preventing or treating brain diseases according to the present invention can be administered to mammals such as rats, mice, livestock, and humans in various routes. All modes of administration can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intra-uterine or intracerebroventricular injections.

As described above, the atactylenolide-I according to the present invention inhibits the expression of iNOS gene and protein, the expression of inflammatory cytokine in a concentration-dependent manner, and prevents the degradation of IkB-a, thereby inhibiting the activity of NF- Inhibits the action of ERK signal transduction pathway and damages of dopaminergic neuronal tissue of the midbrain, thereby inhibiting the activity of microglial cells. Therefore, it is possible to prevent or treat neuroinflammation mediated by microglia, Can be used for prevention or treatment.

Health functional food for prevention or improvement of cerebral nerve disease

The present invention provides a health functional food for preventing or ameliorating a brain disease containing atractylenolide-I as an active ingredient. The specific contents of the above-mentioned atactylenolide-I are as described above.

In the health functional food for preventing or ameliorating cerebral nerves according to the present invention, when said atactylenolide-I is used as an additive for health functional food, it can be added as it is or used together with other food or food ingredients, It can be used appropriately according to the method. The amount of the active ingredient to be mixed may be suitably determined according to each use purpose such as prevention, health, or treatment.

Formulations of health functional foods may be in the form of powders, granules, pills, tablets, capsules, as well as in the form of ordinary foods or beverages.

There is no particular limitation on the type of the food, and examples of the food to which the above substance can be added include dairy products including meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, , Various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and may include foods in a conventional sense.

Generally, atactyllanilide-I may be added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on 100 parts by weight of the raw material when the food or beverage is produced. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range. Further, since the present invention uses fractions from natural products, there is no problem in terms of safety, Or more.

The beverage in the health functional food according to the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates may be monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate may be about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 mL of the beverage according to the present invention.

In addition to the above, the health functional food for preventing or ameliorating a brain disease according to the present invention may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, , Stabilizers, preservatives, glycerin, alcohols, and carbonating agents used in carbonated beverages. In addition, the composition for improving sleep of the present invention may contain flesh for the production of natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The ratio of such additives is not limited, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food of the present invention.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Preparation Example ]

LPS (E. coli 0111: B4), Tween-20, bovine serum albumin (BSA), dimethylsulfoxide (DMSO), p-nitrophenyl phosphate, 3- (4,5-dimethylthiazol- phenyltetrazolium bromide (MTT), pyrrolidine dithiocarbamate (PDTC) (Sigma Chemical Co, USA). 6-well, 12-well, 96-well tissue culture plates 100 mm culture plates. (NUNC Inc, IL, USA)

DMEM was used as a cell culture medium, and 5% FBS and 100 units / ml penicillin / streptomycin were used as antibiotics (Gibco / Invitrogen, USA). The antibodies used in the experiments were iNOS, ERK, p-ERK, Akt, p-Akt, PI3K, p-PI3K, inhibitor of kappa 1, manganese superoxide dismutase (MnSOD) (Enzo Life Sciences, USA), and macrophage-1 antigen (B-alpha, IκB-α, p-IκB-α and β-actin (GFAP) (Abcam, USA) and tyrosine hydroxylase (TH) (Calbiochem, USA) were used in this study.

[Experimental Method]

One. BV -2 cell culture

The BV-2 immortalized murine microglial cell line was obtained from Dr. Seok Kyung Ho of Kyungpook National University. BV-2 cells were grown and maintained in DMEM supplemented with 5% heat-inactivated FBS. Penicillin / streptomycin (100 U / mL) was added to the DMEM medium and the cells were maintained in a humidified incubator at 37 ° C, 5% CO ₂ . ART-I was dissolved in DMSO and the control / vehicle group treated with DMSO alone.

2. Animals and MPTP  administration

Male C57BL6 / J mice (25-28 g) (Samtako Bio Korea) at 8-9 weeks of age were adapted for 14 days before drug treatment. Animal testing was conducted ethically in accordance with the National Laboratory's Guide to Laboratory Animal Care and Use (NIH publication No. 85-23, 1985), and the experimental procedure was approved by Konkuk University's Animal Care and Use Committee. Experimental mice were allowed free access to food and water in a controlled environment (temperature 23 ° C ± 1 ° C and humidity 50% ± 5%). Indoor lighting was provided between 8 am and 8 pm. Twenty-six 126 mice were randomly assigned to seven groups of 18: vehicle group, MPTP group, ATR-I (30 mg / kg / 10 ml) group, Selegiline (10 mg / kg / (30 mg / kg / 10 ml) + MPTP group, ATR-I (10 mg / kg / 10 ml) + MPTP group and ATR-I (30 mg / kg / 10 ml) + MPTP group.

100 mg / kg / 10 ml MPTP was intraperitoneally administered to all groups except the vehicle group and the ATR-Ⅰ (30 mg / kg / 10 ml) group four times at 1 hour intervals. After 4 hours of MPTP injection, ATR-Ⅰ (ip) was administered 3 times a day for 3 days and 7 days after 12 hours. Selegiline (i.p) was also administered once every day for 3 days and 7 days after 4 injections of MPTP. Experimental mice were sacrificed at 3 and 7 days after ATR-I was last administered. MPTP was prepared by washing with saline prior to use. Prior to administration of ART-I, the cells were suspended in 0.5% methyl cellulose solution containing 1% Tween 80. [ The control / vehicle group was administered as a normal methylcellulose solution.

3. Pole test

To measure the degree of motility, a typical symptom of Parkinson's disease, a modified Paul test of the procedure was performed and performed three consecutive times for each mouse. The experimenter kept all groups dark during the experiment.

4. Nitrite measurement assay and cell viability assay

Release of nitric oxide (NO) was measured using the Griess reaction in cell supernatants. The 96-well plate was inoculated with 200 μL of BV-2 cells (2.5 × 10 ⁴ cells / mL) pretreated with ATR-Ⅰ at concentrations of 25 μM, 50 μM and 100 μM for 1 hour, Were stimulated in the presence or absence of LPS (100 ng / mL). Additional procedures were performed according to previously published data. Results represent three independent experiments.

The cytotoxicity of ART-Ⅰ was assessed using MTT-based colorimetric assay and MTT reduction was measured with formazan. BV-2 cells were pretreated with various doses of ART-I for 1 hour regardless of exposure to LPS (100 ng / mL) for 24 hours. Cell viability was measured by conventional methods and expressed as a percentage of control (untreated cells).

5. Immunohistochemistry

(1: 500; 131 AbD Serotec, Oxford, UK) and GFAP (1: 2000) were added to the free floating brain section of mouse striatum (STR) and SNpc sacrificed 3 days post- ; Abcam). The sections labeled Mac-1 were incubated with biotinylated anti-rat (1: 200) (Vector Laboratories, Burlingame, CA, USA) antibody for 2 hours. The avidin biotin-peroxidase complex of the Vectastain Elite ABC Kit (Vector Laboratories) was then incubated for 60 minutes at room temperature according to the supplier's recommendations. Finally, each section was developed by reacting with Vector DAB substrate kit (Vector Laboratories) for 80 seconds, and the stained sections were observed using a bright field microscope (Carl Zeiss Inc., Oberkochen, Germany) . GFAP sections were incubated with rabbit antigoat GFAP antibody (1: 200) (Alexa Flour, Invitrogen, Carlsbad, CA, USA) for 1 hour. The slices were dehydrated in ethanol (70%, 80% and 90%), treated with 100% xylene to prevent slippage, and the stained sections were analyzed with a fluorescent microscope (Carl Zeiss Inc., Oberkochen, Germany) . The STR and SNpc sections of mice sacrificed on day 7 were labeled with primary TH antibody (1: 1500; Calbiochem, Billerica, MA, USA) and stored at 4 ° C for one day. The sections were also treated with biotinylated anti-rabbit (1: 500) (Vector Laboratories, Burlingame, CA, USA) antibody and incubated for 2 hours. The avidin biotin-peroxidase complex of the Vectastain Elite ABC Kit (Vector Laboratories) was then incubated for 60 minutes at room temperature according to the supplier's recommendations. Finally, each section was developed with Vector DAB substrate kit (Vector Laboratories) for 80 seconds. The sections were dehydrated in ethanol (70%, 80% and 90%) and then mounted with 100% xylene treatment for 60 seconds and covered. The stained sections were observed using a bright field microscope (Carl Zeiss Inc., Oberkochen, Germany). Quantification of the effect on brain-tissue sections was performed by measuring the number of TH-immunopositive neurons in the SNpc using Image J software (Bethesda, MD, USA) and measuring the optical density of TH-positive fibers in the STR. Data were expressed as a ratio to the values of the control group.

6. Isolation of total RNA and reverse transcription-polymerase chain reaction (RT- PCR )

After preincubation for 1 hour with 25 μM, 50 μM and 100 μM of ART-Ⅰ with BV-2 cells (5.0 × 10 ⁵ cells / mL), the presence of LPS (100 ng / ≪ / RTI > for 6 hours, respectively. The animal tissues were washed with 0.1 M cold PBS (pH 7.4), homogenized using a tuberculin syringe, and stored at -80 ° C until RNA was extracted. Total RNA was extracted with TRIzol (Invitrogen). For RT-PCR, 2.5 μg of the total RNA of each of the above-mentioned Example 2 was reverse transcribed using First Strand cDNA Synthesis Kit (Invitrogen). Then, the cDNA was amplified using the specific primers shown in Table 1. PCR products were analyzed on 1% agarose gels stained with ethidium bromide and bands were visualized by UV light.

Target gene Primer sequences of BV-2 microglia and C57BL6 / J mice SEQ ID NO: iNOS F-5'-CTTGCAAGTCCAAGTCTTGC-3 '' One R-5'-GTATGTGTCTGCAGATGTGCTG-3 '' 2 TNF-a F-5'-TTCGAGTGACAAGCCTGTAGC-3 '' 3 R-5'-AGATTGACCTCAGCGCTGAGT-3 '' 4 IL-6 F-5'-GGAGGCTTAATTACACATGTT-3 '' 5 R-5'-TGATTTCAAAGATGAATTGGAT-3 ' 6 IL-1? F-5'-CATATGAGCTGAAAGCTCTCCA-3 '' 7 R-5'-GACACAGATTCCATGGTGAAGTC-3 '' 8 MCP-1 F-5'-AGATGCAGTTAACGCCCCAC-3 '' 9 R-5'-GACCCATTCCTTCTTGGGGT-3 '' 10 MMP-9 F-5'-CGCTCATGTACCCGCTGTAT-3 '' 11 R-5'-TGTCTGCCGGACTCAAAGAC-3 '' 12 HO-1 F-5'-GGATTTGGGGCTGCTGGTTTC-3 '' 13 R-5'-GCAGTGGCAAAGTGGAGATTG-3 '' 14 Mae-1 F-5'-TCAAGCGGCAGTACAAGGAC-3 '' 15 R-5'-GCCACACACAGAGCTTGCTT -3 '' 16 GFAP R-5'- CCCTTCAGGACTGCCTTAGT -3 '' 17 R-5'- CCCTTCAGGACTGCCTTAGT -3 '' 18 GAPDH F-5'-GCAGTGGCAAAGTGGAGATTG-3 '' 19 R-5'-TGCAGGATGCATTGCTGACA-3 '' 20

7. SDS-PAGE and Western blot  Western blot analysis

BV-2 cells (5.0 × 10 ⁵ cells / mL) were cultured in 6-well plates and pretreated with 25 μM, 50 μM, and 100 μM concentrations of ART-I for 1 hour and then treated with LPS (100 ng / Each for 18 hours. Preparation of cell lysates (whole cell and nucleus), electrophoresis and immunoblotting procedures were performed by known methods. For animal experiments, STR and ventral midbrain (VM) tissues were treated according to known methods. (1: 1000), anti-IκB-α (1: 1000), anti-p-IκB-α (1: 1000), anti-Akt (1: 1000), anti-p-Akt (1: 1000), anti-PI3K (1: 1000), anti-β-actin (1: 2000), anti-MnSOD (1: 1000), anti-NF-κB / p65 (1: 500) and anti-nucleolin (1: 500). Horseradish peroxidase-conjugated secondary antibodies (1: 1000-5000) (Cell Signaling Technology and Santa Cruz Biotechnology) were then incubated for 1 hour and incubated. The optical density of antibody-specific bands was analyzed by Luminescent Image Analyzer, LAS-3000 (Fuji, Tokyo, Japan).

8. Detection of intracellular ROS  generation using a flow cytometer

Production of intracellular reactive oxygen species (ROS) was measured using the non-fluorescent compound H ₂ DCFDA as described above. H ₂ DCFDA is a stable, nonpolar compound that readily diffuses into cells to produce DCFH. In the presence of peroxidase, intracellular ROS transforms DCFH into DCF, a highly fluorescent compound. Therefore, the amount of ROS is proportional to the fluorescence sensitivity of the cells. Briefly, DMSO or ART-I (25 μM, 50 μM and 100 μM) was treated with BV-2 cells (5.0 × 10 ⁵ cells / 6-well plate) stimulated with LPS for 4 hours and cultured at 37 ° C. for 1 hour Respectively. Cells were also treated with 10 [mu] M H ₂ DCFDA (dissolved in DMSO) at 37 [deg.] C for 45 min. Then, the cells were treated with trypsin and fluorescent intensity was measured with a FACS Calibur flow-cytometry system.

9. Immunofluorescence ( Immunofluorescence  assay)

BV-2 cells ( ⁵ × 10 ⁵ cells / well) were cultured in sterilized coverslips of 24-well plates and treated with ATR-Ⅰ (100 μM) for 1 hour. LPS (100 ng / mL) was then treated for 0.5 h to detect the p65 subunit in NF-kB cells. Thereafter, additional procedures were performed for immunofluorescence analysis according to known methods.

[ Example ]

Example  One. Microglia BV At -2 cells Atactylenolide -I Toxicity test

To determine the effect of LPS and a single compound, atactylenolide-I, on cell viability in LPS-stimulated Microglia BV-2 cells, MTT assay was performed.

As a result, as shown in FIG. 1B, MTT measurement showed that the cell survival rate did not change in all experimental groups treated with LPS and a single compound, atactylenolide-I alone or in the same way, compared with the control group. This indicates that LPS, a neuroinflammatory inducer, and atactyllainolide-I, a single compound, do not affect cell survival.

Example  2. By LPS  Stimulated Microglia BV -2 cells. Atactylenolide -I concentration-dependent NO release, iNOS  Inhibition of gene and protein expression

2-1) NO release inhibitory action

In order to analyze the anti-inflammatory activity of a single compound, atactylenolide-I, a concentration-dependent inhibitory effect of nitrite (NO) produced in Microglia BV-2 cells stimulated with LPS (100 ng / Respectively. Nitrite (NO) was measured by NO assay using Griess reagent.

As a result, the amount of nitrite (NO) induced by LPS in BV-2 cells was about 40-fold higher than that of the control, and atroxylenolide-I, a single compound, And 100 [mu] M). As a result, it was confirmed that the amount of nitrite (NO) emission decreased as shown in Fig. 1A, depending on the concentration of atactylenolide-I.

2-2) iNOS  Gene expression inhibition

The expression of iNOS gene was analyzed by BV-2 treatment with LPS and a single compound atactylenolide-I (25 μM, 50 μM, and 100 μM) for 6 hours, RNA was identified and analyzed by RT-PCR And the expression pattern of the gene was analyzed quantitatively.

As a result, as shown in Fig. 2 and Fig. 3, it was confirmed that atactinyl-I, a single compound in the gene and protein level of iNOS, which is an enzyme inducing nitrite (NO) synthesis, there was. That is, as shown in FIG. 2, it was confirmed that the expression level of iNOS gene was almost not observed in the control group not treated with LPS, whereas the expression level of iNOS gene was significantly increased in the experimental group treated with LPS, The expression pattern of Ride-I decreased in a concentration-dependent manner was confirmed.

2-2) iNOS  Inhibition of protein expression

In order to analyze the expression pattern of iNOS protein, the same concentration of LPS and a single compound, atlactylenolide-I, was treated with iNOS gene analysis. After the same incubation time, proteins were identified and Western blot was performed to determine the iNOS protein The expression changes were quantitatively analyzed.

As a result, as shown in FIG. 3, it was confirmed that the amount of iNOS protein expression was almost zero in the control group not treated with LPS. In the experimental group treated with LPS, the expression level of iNOS protein was significantly increased, and in the case of a single compound, atactylenolide-I, the concentration-dependent decrease in expression was observed.

Example  3. By LPS  Stimulated Microglia BV -2 cells in the production of inflammatory agonistic cytokines, a single compound Atactylenolide I  Concentration-dependent inhibitory effect

In order to elucidate the expression pattern of the inflammatory mediators cytokines TNF-α, IL-1β and IL-6 gene, expression pattern of inflammatory markers cytokine gene was determined by LPS in BV-2 cell and atactyl- I was treated with concentration (25 μM, 50 μM, and 100 μM) for 6 hours, RNA was identified, and RT-PCR was performed. The expression patterns of the genes were analyzed quantitatively A common expression change was identified. GAPDH was used as a control for gene quantitative analysis.

As a result, as shown in FIG. 2, there was almost no expression amount of TNF-α, IL-1β and IL-6 gene in the control group not treated with LPS. In the experimental group treated with LPS (100 ng / The expression pattern of the atactyllainolide-I compound, which is a compound, decreased in a concentration-dependent manner.

Example  4. By LPS  Stimulated BV -2 in glial cells Atactylenolide - Of I  MAPKs pathway ERK  Inhibition of phosphorylation and inflammation-related protein PI3K / Akt  Concentration-dependent inhibitory effect of phosphorylation

It has been previously known that the inflammatory response through LPS treatment proceeds typically through the MAPKs (Mitogen-activated protein kinase) pathway. It was confirmed whether or not atactylleneolide-I inhibits the inflammatory response through the MAPK pathway.

As a result, as shown in FIG. 4, it was confirmed that the amount of phosphorylation in the ERK pathway in ERK, which is one of the components of MAPKs, was increased in the LPS treatment as compared with the control. However, it has been confirmed that the degree of phosphorylation of atroxylenolide-I decreases dependently on the concentration of atactylenolide-I, and in the case of PI3K / Akt phosphorylation increased during inflammation, I concentration-dependently.

Example  5. By LPS  Stimulated BV -2 In the glial cells, Art Rocktile Nora The inhibitory effect of id-I on NF-κB nuclear transfer factor

The effect of NF-κB, a transcription factor that expresses proinflammatory cytokines, on the induction of inflammation by LPS was confirmed for the efficacy analysis of atactyllanoride-I. The expression of NF-κB p65 in the nucleus was confirmed by Western blot. The expression of NF-κB p65 in the nucleus was confirmed by immunofluorescence staining.

BV-2 cells were treated with 100 μM of LPS (100 ng / ml) and atactylenolide-I at a concentration of 100 μM and incubated for 30 minutes. Immunofluorescence revealed that the p65 protein constituting NF- (Fig. 5B). In the absence of any treatment, it was confirmed that the protein p65 was contained in the nucleolus, and that the protein p65 was highly introduced into the nucleus during the LPS treatment, and when atactylenolide I was treated, Of the total amount of water.

FIG. 5A is a result of quantitatively confirming the expression pattern of nuclear protein through Western blotting by identifying nucleoprotein in order to more accurately confirm the fact confirmed by immunofluorescence. In the LPS-untreated control group, expression of NF-κB p65 was scarcely observed, but the expression of NF-κB p65 was increased in the LPS-treated experimental group, and the expression level of atactylenolide I was decreased Respectively. Nucleolin is a control protein for quantification of nuclear proteins.

5A and 5B show concentration-dependent inhibitory effects of atactylenolide I on NF-κB activity in BV-2 gliotropic cells stimulated with LPS.

Example  6. MPTP - Inflammatory response improvement effect on treated neurodegenerative mouse model

MPTP is widely known as a neurotoxin capable of inducing neuronal cell activation in the Central Nervous System (CNS) and inducing neuroinflammation and dopaminergic neurodegeneration. The neuroinflammatory and neuroprotective effects of atactyllanoride-I on MPTP-induced neuroinflammation in neurodegenerative mouse models were analyzed.

As a result, as shown in Fig. 6, in the gene step of iNOS, which is a nitrite (NO) synthesis inducing enzyme in the inflammatory reaction of MPTP-induced glial cells, and TNF-a which is an inflammation-mediated cytokine, atactyl- I in a dose-dependent manner, the inhibition of iNOS and TNF-α gene expression was inhibited.

In addition, as shown in FIG. 6 and FIG. 7, it was confirmed that the expression of GFAP and Mac-1, which are activation markers of glial cells, was inhibited in a gene-dependent and protein-dependent manner, respectively, by concentration of atactylenolide-I. It was confirmed by the tissue immuno-staining method that the gene level of Mac-1 and protein expression were inhibited in a concentration-dependent manner by atactylenolide-I.

Example  7. MPTP -Treated neurodegenerated mice Neuroprotective effect on model

The loss of MPTP-mediated dopaminergic neurons in the substantia nigra pars compacta (SNpc) was measured through tyrosine hydroxylase (TH) -positive neurons.

Injection of MPTP, as confirmed by Western blot and tissue immunostaining, decreased TH expression and TH-bearing nerve number. However, it was confirmed that in the group administered with atactyllanoride-I, the expression loss of TH induced by MPTP was reduced (FIG. 8).

Thus, it can be seen that atactylenolide-I protects neurons from MPTP-induced neuroinflammation.

Example  8. MPTP - Antioxidant activity against treated neurodegenerative mouse model

In the MPTP-treated neurodegenerative mouse model, flow cytometry and decrease of expression of antioxidant enzymes HO-1, Mn-SOD were confirmed to increase ROS in the brain.

As a result, as shown in FIG. 9A, there was almost no increase in ROS in the control group not treated with MPTP. In the MPTP-treated experimental group, the expression level of ROS in the concentration-dependent manner in the atactylenolide- In the case of the present invention.

9B and C, it was confirmed that the expression of HO-1 and Mn-SOD, which are antioxidant enzymes, was increased in a concentration-dependent manner upon treatment with atactylenolide-I.

Example  9. Statistical analysis

Statistical analysis was performed using GraphPad software version 5 (GraphPad, La Jolla, 199 CA, USA). Data mean the mean ± standard error (SEM) of at least 3 independent experiments. Significant differences between groups were determined by one-way analysis (ANOVA) and Tukey's post-hoc analysis. P <0.05 is considered to be statistically significant.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Konkuk University Glocal Industry-Academic Collaboration Foundation <120> Composition comprising Atractylenolide-1 as an effective          preventing or treating neurological disease <130> 1062241 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of iNOS <400> 1 cttgcaagtc caagtcttgc 20 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of iNOS <400> 2 gtatgtgtct gcagatgtgc tg 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of TNF-alpha <400> 3 ttcgagtgac aagcctgtag c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of TNF-alpha <400> 4 agattgacct cagcgctgag t 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of IL-6 <400> 5 ggaggcttaa ttacacatgt t 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of IL-6 <400> 6 tgatttcaaa gatgaattgg at 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer of IL-6 beta <400> 7 catatgagct gaaagctctc ca 22 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of IL-6 beta <400> 8 gacacagatt ccatggtgaa gtc 23 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of MCP-1 <400> 9 agatgcagtt aacgccccac 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of MCP-1 <400> 10 gacccattcc ttcttggggt 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of MMP-9 <400> 11 cgctcatgta cccgctgtat 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of MMP-9 <400> 12 tgtctgccgg actcaaagac 20 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of HO-1 <400> 13 ggatttgggg ctgctggttt c 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of HO-1 <400> 14 gcagtggcaa agtggagatt g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of Mae-1 <400> 15 tcaagcggca gtacaaggac 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of Mae-1 <400> 16 gccacacaca gagcttgctt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer of GFAP <400> 17 cccttcagga ctgccttagt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of GFAP <400> 18 cccttcagga ctgccttagt 20 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer of GAPDH <400> 19 gcagtggcaa agtggagatt g 21 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer of GAPDH <400> 20 tgcaggatgc attgctgaca 20

Claims (8)

A pharmaceutical composition for the prophylaxis or treatment of cranial nerve diseases containing atractylenolide-I as an active ingredient.
The method according to claim 1,
The composition is characterized by inhibiting the inflammatory response of microglia induced by LPS (Lipopolysaccharide) or MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine)
A pharmaceutical composition for the prevention or treatment of neurological diseases.
The method according to claim 1,
Characterized in that the composition inhibits the release of nitrite (NO) or reduces the expression of iNOS
A pharmaceutical composition for the prevention or treatment of neurological diseases.
The method according to claim 1,
Wherein said composition inhibits the expression of TNF- [alpha], IL-1 [beta] or IL-6
A pharmaceutical composition for the prevention or treatment of neurological diseases.
The method according to claim 1,
Wherein said composition is characterized by enhancing antioxidant activity
A pharmaceutical composition for the prevention or treatment of neurological diseases.
The method according to claim 1,
Wherein said composition inhibits damage to the midbrain dopaminergic neurons
A pharmaceutical composition for the prevention or treatment of neurological diseases.
The method according to claim 1,
Wherein the neurodegenerative disease is selected from the group consisting of dementia, Alzheimer's disease, Parkinson's disease, Huntington's disease, Lou Gehrig's disease, Creutzfeldt Jakob disease, stroke, multiple sclerosis, learning disorders, cognitive disorders and memory impairment
A pharmaceutical composition for the prevention or treatment of neurological diseases.
A health-functional food composition for preventing or ameliorating a brain disease containing atractylenolide-I as an active ingredient.

Images