KR20180127837A - Pharmaceutical composition for cancer treatment or suppression of metastasis comprising inhibitor of AP1S1 as an active ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition or the like for treating cancer or inhibiting cancer metastasis comprising an adaptor related protein complex 1 sigma 1 subunit (AP1S1) gene expression inhibitor or a protein activation inhibitor coded by the gene as an active ingredient. According to the present invention, it can be seen that the AP1S1 controlling activity of matrix metalloproteinase is remarkably over-expressed in cancer tissues accompanied by desmoplasia, and mobility and penetrability of a malignant tumor cell line are hindered by inhibiting expression of AP1S1. Therefore, the AP1S1 gene expression inhibitor or the protein activation inhibitor coded by the gene is expected to be developed as drugs for treatment or metastasis inhibition of cancer cells. Further, the present invention is expected to be used as a method of screening candidate drugs for a cancer therapeutic agent or a cancer metastasis inhibitor.

Description

[0001] The present invention relates to a pharmaceutical composition for inhibiting cancer therapy or cancer metastasis comprising an AP1S1 inhibitor as an active ingredient,

The present invention relates to a pharmaceutical composition for cancer treatment or cancer metastasis inhibition comprising an AP1S1 (Adaptive Related Protein Complex 1 Sigma 1 Subunit) gene expression inhibitor or a protein activity inhibitor encoded by the gene as an active ingredient.

AP1S1 (Adaptive Protein Complex 1 Sigma 1 Subunit) is a protein-coding gene, and the protein encoded by this gene is part of a clathrin coat assembly complex that links the clathrin to the receptor of the coated vesicle . Medicular syndrome (Mednik syndrome) and congenital diarrhea (Chirsta diarrhea) are known to be associated with AP1S1, and the disease is known to be related to the immune system and vesicle mediated transport.

Matrix metalloproteinase (MMP) is a kind of zinc (Zn) dependent endopeptidase family of enzymes that can degrade whole components of the extracellular membrane. The substrate metalloproteinase was first known to degrade the tadpole tail. Subsequent studies have shown that substrate metalloproteinases synthesized by connective tissue cells play an important role in the reconstruction of the extracellular membrane during physiological changes . Disease mediated by substrate metalloproteinases includes but is not limited to arteriosclerosis, restenosis, matrix metalloproteinase-mediated osteopenia, central nervous system inflammatory disease, Alzheimer's disease, skin aging, rheumatoid arthritis, osteoarthritis, Degenerative cartilage loss due to traumatic joint injury, cranial nervous system degeneration, cirrhosis, glioma disease, immature rupture of an embryonic membrane, inflammatory bowel disease, macular degeneration, macular degeneration associated with aging, diabetic It is known that retinopathy, proliferative vitreoretinopathy, immature retinopathy, ocular inflammation, keratoconus, Sjogren's syndrome, myopia, ocular neoplasia, corneal transplant rejection, angiogenesis, cancer invasion and metastasis (Wossener Jr., Annals NY Acad. Sci., 732, 11-21 (1994); Warner et al., Am. J. Pathol., 158, 2139-44 (2001); Stetler-Stevenson, Surg. Oncol. , 10, 383-92 (2001)).

On the other hand, it is already known that the protein encoded by AP1S1 is involved in the endocytosis and golgi formation process, but the AP1S1 gene and the protein encoded by the gene control the activity of the substrate metalloproteinase And so on.

The inventors of the present invention found AP1S1 gene expression inhibitor and protein-inhibiting agent encoded by the gene during the study of cancer treatment and cancer metastasis inhibition by AP1S1 inhibition, and they down-regulated expression of AP1S1, The activity of the enzyme can be inhibited and the proliferation and penetration of cancer cells can be inhibited, thereby completing the present invention.

It is an object of the present invention to provide a pharmaceutical composition for inhibiting cancer treatment or cancer metastasis comprising an AP1S1 gene expression inhibitor or an AP1S1 protein activity inhibitor as an active ingredient.

Another object of the present invention is to provide a method for screening candidate substances for cancer treatment or cancer metastasis using the AP1S1 gene or a protein encoded by the gene.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems and other problems not mentioned can be clearly understood by those skilled in the art from the following description will be.

In order to achieve the object of the present invention, the present invention provides a pharmaceutical composition for inhibiting cancer treatment or cancer metastasis comprising, as an active ingredient, an AP1S1 gene expression inhibitor or an AP1S1 protein activity inhibitor.

In one embodiment of the present invention, the AP1S1 gene expression inhibitor or the AP1S1 protein activity inhibitor is characterized by inhibiting the activity of a substrate metalloproteinase.

In another embodiment of the present invention, the AP1S1 gene expression inhibitor is an antisense nucleotide complementary to the mRNA of the AP1S1 gene, a small hairpin RNA (shRNA), a small interfering RNA , siRNA), ribozyme, and gene scissors (CRISPR / Cas-9).

In another embodiment of the present invention, the activity inhibitor of the AP1S1 protein is any one selected from the group consisting of a compound that binds complementarily to the AP1S1 protein, a peptide, a peptide mimetic, an aptamer, and an antibody .

The present invention also provides a method for screening candidate substances for cancer treatment or cancer metastasis inhibiting, which comprises the following steps.

(1) treating the test substance with an AP1S1 gene expressing cell line;

(2) measuring the expression level of the AP1S1 gene or the expression level of the AP1S1 protein in the cell line; And

(3) a step of selecting the test substance whose expression level of the AP1S1 gene or the expression level of the AP1S1 protein is decreased as compared with the control group not treated with the test substance.

In one embodiment of the present invention, in step (2), the AP1S1 gene expression level is determined by immunoprecipitation, reverse transcription-polymerase chain reaction (RT-PCR), enzyme immunoassay (ELISA), Immunocytochemistry, Western Blot, and Flow cytometry (FACS).

In another embodiment of the present invention, in step (2), the AP1S1 protein expression level is determined by Western blotting, radioimmunoassay (RIA), radioimmunodiffusion, enzyme immunoassay, A method selected from the group consisting of immunofluorescence, ouchterlony, complement fixation assay, reverse transcription polymerase chain reaction (PCR), and protein chip .

In another embodiment of the present invention, the cancer is characterized by arsenic lung cancer or breast cancer.

The present invention provides a method of inhibiting cancer treatment or cancer metastasis, comprising the step of administering to said subject a pharmaceutical composition for inhibiting cancer therapy or cancer metastasis.

The present invention provides a use of a composition comprising an inhibitor of the expression of the AP1S1 gene as an active ingredient for cancer treatment or inhibition of cancer metastasis.

According to the present invention, AP1S1, which controls the activity of matrix metalloproteinases, is overexpressed in cancer tissues accompanied by desmoplasia and inhibits the mobility and permeability of malignant tumor cell lines by inhibiting the expression of AP1S1 have. Therefore, it is expected that an inhibitor of AP1S1 gene expression or a protein activity inhibitor encoded by the gene can be developed as a drug for the treatment or metastasis of cancer cells, and the present invention also provides a method for screening a cancer drug or cancer metastasis inhibitor candidate drug It is expected that it can be used as.

FIG. 1A is a graph showing gene expression of AP1S1 according to an increase in hardness of an extracellular matrix in various cancer cell lines. FIG.
FIG. 1B shows the expression level of AP1S1 protein in arsenic lung cancer and breast cancer cells.
FIG. 2A is a graph showing the degree of inhibition of AP1S1 gene expression by the AP1S1 expression-inhibiting cell line. FIG.
FIG. 2B is a graph showing the cell migration and penetration degree of the AP1S1 expression-inhibiting cell line.
FIG. 3A is a graph showing the degree of substrate metalloproteinase activity in cells (cell lysate) of the AP1S1 expression-inhibiting cell line.
Fig. 3B is a graph showing the degree of substrate metalloproteinase activity in the extracellular (conditioned medium) of the AP1S1 expression-inhibiting cell line.

The present inventors have found that the expression of the AP1S1 gene and the inhibition of the activity of the protein encoded by the gene inhibit the mobility and permeability of the cell by controlling the activity of the substrate metalloproteinase. The present invention provides a pharmaceutical composition for inhibiting cancer therapy or cancer metastasis, which comprises an inhibitor or a protein activity inhibitor encoded by the gene as an active ingredient, and a method for screening candidate substances for cancer treatment and cancer metastasis inhibition.

In one embodiment of the present invention, AP1S1 of the present invention was found to have an increased expression at the hardness of cancer tissues compared to the hardness of normal tissues (see Example 2).

In another embodiment of the present invention, it was confirmed that the migration and penetration of cancer cells were reduced according to the inhibition of gene expression of AP1S1 of the present invention (see Example 3).

In another embodiment of the present invention, it was confirmed that the activity of the substrate metalloproteinase was reduced by inhibiting gene expression of AP1S1 of the present invention (see Example 4).

Hereinafter, the present invention will be described in detail.

The present invention provides a pharmaceutical composition for inhibiting cancer treatment or cancer metastasis, which comprises an AP1S1 gene expression inhibitor or a protein activity inhibitor encoded by the gene as an active ingredient.

The term " cancer ", as used herein, refers to an aggressive characteristic of a cell that disregards normal growth limits and divides and grows, invasive characteristics that penetrate surrounding tissues, It is a generic term for diseases caused by cells with metastatic characteristics.

The cancer used in the present invention can be used for the treatment of colorectal cancer, gastric cancer, colon cancer, breast cancer, lung cancer, arthritis cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, skin or intraocular melanoma, uterine cancer, ovarian cancer, Cancer, endometrioid carcinoma, thyroid cancer, papillary cancer, adenocarcinoma, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, uterine cancer, endometrial carcinoma, endometrial cancer, uterine cancer, vulvar carcinoma, vulvar carcinoma, vulvar carcinoma, , Chronic or acute leukemia, lymphocytic lymphoma, bladder cancer, renal or ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, central nervous system (CNS) tumor, primary CNS lymphoma, spinal cord tumor, brainstem glioma, and pituitary adenoma , Preferably arsenic lung cancer or breast cancer, but the present invention is not limited thereto.

The pharmaceutical composition of the present invention may contain at least one known active ingredient having an anticancer effect together with an AP1S1 gene expression inhibitor or an AP1S1 protein activity inhibitor.

The pharmaceutical composition containing the AP1S1 gene expression inhibitor or the AP1S1 protein activity inhibitor of the present invention as an active ingredient preferably includes 0.0001 to 50% by weight of the active ingredient based on the total weight of the composition, but is not limited thereto .

The compositions of the present invention may further comprise suitable carriers, excipients, and diluents conventionally used in the manufacture of pharmaceutical compositions. In addition, it can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, oral formulations such as syrups and aerosols, external preparations, suppositories, and sterilized injection solutions according to a conventional method.

Examples of carriers, excipients and diluents that can be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose , Microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When the composition is formulated, it is prepared using a diluent such as a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, or an excipient usually used.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, " pharmaceutically effective amount " means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dosage level will depend on the type of disease, severity, The sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and administer an amount capable of achieving the maximum effect in a minimal amount without adverse effect, and this can be easily determined by a person having ordinary skill in the art to which the present invention belongs.

The pharmaceutical composition of the present invention may be administered to a subject in various routes. All modes of administration may be expected, for example, by subcutaneous, intravenous, intramuscular, intra-uterine, or intracerebral injection. The pharmaceutical composition of the present invention is determined depending on the kind of the active ingredient, together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and disease severity of the patient.

In another aspect of the present invention, the present invention provides a method for treating cancer or a method for inhibiting cancer metastasis, comprising the step of administering a pharmaceutically effective amount of the above pharmaceutical composition to a subject suffering from cancer.

The term " individual " as used herein refers to a subject in need of treatment of a disease, and more particularly refers to a human or non-human primate, mouse, rat, dog, And mammals such as cows.

The composition may have activity of inhibiting the proliferation, migration, penetration or metastasis of cancer cells.

In the present invention, the expression inhibitor of the AP1S1 gene may be any one selected from the group consisting of an antisense nucleotide complementary to the mRNA of the? TAT1 gene, a small hairpin RNA, a small interference RNA, a ribozyme, and a gene scissors, Preferably small hairpin RNA, but is not limited thereto.

In the present invention, the activity inhibitor of the AP1S1 protein may be any one selected from the group consisting of a compound which binds complementarily to the AP1S1 protein, a peptide, a peptide mimetic, an aptamer, and an antibody, but is not limited thereto.

As used herein, the term " Peptide Mimetics " is a peptide or non-peptide that inhibits the binding domain of the AP1S1 protein and inhibits the activity of the AP1S1 protein. The major residues of the non-hydrolyzable peptide analogs can be produced using? -Turn dipeptide cores, keto-methylene pseudopeptides, azepine, benzodiazepines,? -Aminoalcohols, and substituted gamma lactam rings.

As used herein, the term " platamer " refers to a single-chain DNA or RNA molecule that can be identified by an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment) Can be obtained by separating an oligomer having a high affinity and a selectivity. Aptamers can specifically bind to a target and modulate the activity of the target, for example, by blocking the ability of the target to function through binding.

The term " antibody " as used herein includes immunoglobulin molecules that are immunologically reactive with specific antigens and include both polyclonal antibodies and monoclonal antibodies. The term also includes forms produced by genetic engineering such as chimeric antibodies (e. G., Humanized murine antibodies) and heterologous binding antibodies (e. G., Bispecific antibodies).

In addition, the present invention provides a screening method for a candidate compound for cancer treatment or cancer metastasis using the AP1S1 gene.

Specifically, the method comprises:

(1) treating the test substance with an AP1S1 gene expressing cell line;

(2) measuring the expression level of the AP1S1 gene or the expression level of the protein encoded by the gene in the cell line; And

(3) a step of selecting the test substance whose expression level of the AP1S1 gene or the expression level of the protein encoded by the gene is decreased as compared with the control group not treated with the test substance, but it is not limited thereto.

In the above method, in step (2), the AP1S1 gene expression level may be determined by any one selected from the group consisting of immunoprecipitation, reverse transcription polymerase chain reaction, enzyme immunoassay, immunocytochemistry, Western blot, and flow cytometry , But it is possible to use any method for measuring the amount of gene or transcript known to a person having ordinary skill in the art to which the present invention belongs.

In this method, in step (2), the AP1S1 protein expression level is determined by Western blotting, radioimmunoassay, radioimmunoassay, enzyme immunoassay, immunoprecipitation, flow cytometry, immunofluorescence staining, A method of measuring the amount of protein expression known to a person having ordinary skill in the art to which the present invention belongs, is preferably measured by a method selected from the group consisting of an immunoassay, a fixation assay, a reverse transcription polymerase chain reaction All methods are available.

Hereinafter, the present invention will be described in detail with reference to examples.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Experimental Preparation and Experimental Method

1-1. Cell culture

Human cancer cell lines H1299 (lung cancer cell line), MDA-MB-231 (breast cancer cell line), HCT116 (colorectal cancer cell line) and SKOV-3 (ovarian cancer cell line) were purchased from Korean cell line banks. Were grown in a Roswell Park Memorial Institute 1640 medium (RPMI 1640; Sigma) supplemented with 10% (v / v) Young in Frontier (FBS), 100 units / ml penicillin and 100 ug / ml streptomycin. Gibco-BRL, Grand Island, NY) in a humidified environment of 5% CO 2 at 37 ° C.

1-2. Production of polyacrylamide gel

An acrylamide-bisacrylamide mixed solution of 0.5 kPa, which is the hardness of the normal tissue and 40 kPa of the hardness of the cancer tissue, was prepared and the gel was hardened on a 25 mm cover slip coated with 2% 3-aminopropyltrimethoxysilane . The polyacrylamide gel was treated with 0.5 mg / mL sulfo-sulfosuccinimidyl-6- [4'-azido-2'-nitrophenylamino] hexanoate (Sigma, St. Louis, Mo., USA) Respectively. And then coated with 50 μg / ml Type I collagen (BD Bioscience, Bedford, MA, USA) at 4 ° C for 16 hours.

1-3. Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was obtained using RNAiso Plus (TaKaRa). CDNA synthesis was performed using reverse transcriptase from M-MLV (M. Biotech, Seoul, Korea) and RT-PCR using Ex-Taq DNA polymerase Using the primers listed in Table 1 below. Band densities were analyzed using a Quantity One system (Bio-Rad).

The RT-PCR primers used in this study Forward (5 'to 3') Reverse (5 'to 3') AP1S1 CCGATACGTGGAGCTCTTAG CTCCTCTTGCAGTAGGTCAG GAPDH GAGTCAACGGATTTGGTCGT TGTGGTCATGAGTCCTCCCA

1-4. Western blot analysis

Cells were lysed in lysis buffer [105 mM NaCl, 6 mM Na ₂ HPO ₄ , 4 mM NaH ₂ PO ₄ , 2 mM EDTA, 1% sodium deoxycholate, 1% NP-40, 50 mM NaF, 2% sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) and polyvinylidene difluoride (PVDF) membranes (Millipore, Inc.) were prepared by homogenization in a buffer solution of sodium chloride (SDS), 1 mM Na ₃ VO ₄ , and 10 mM phenylmethylsulfonyl fluoride Bedford, MA, USA) and incubated with anti-AP1S1, anti-GAPDH, or anti-pMLC antibody (primary antibody) and then incubated with anti-IgG antibody (secondary antibody) conjugated with HRP .

1-5. Production of AP1S1 knock-down cell line using lentiviral system

A small hairpin RNA containing a 21 bp inducible sequence (# 1: 5'-GAGCTCTTAGACAAATACTTT-3 '# 2: 5'-GCCAAGACAATGAGCTCATCA-3') targeting an open reading frame (ORF) in mRNA of AP1S1 Two complementary oligo oligos were synthesized including a small hairpin RNA and a ligation adapter of EcoR1 or AGe1 (NEB, Beverly, Ma). Each oligo was amplified using T4 polynucleotide kinase (New England Biolabs , Ipswich, Mass., USA). The annealed oligonucleotides were ligated to EcoR1 or Age1-digested pLko.1 vector and the sequence of the vector was confirmed by DNA sequencing. To construct lentivirus, HEK293T cells were seeded onto 100 mm plates with 70-80% confluence and the pLko.1-ctl or pLko.1-shRNA constructs were seeded with the psPAX and pMD2.G vectors The cells were transfected with polyethylenimine (PEI) for 24 hours, replaced with 8 ml of serum-free medium, and cultured for 48 hours to harvest the virus-containing culture.

H1299 cells were seeded in a 6-well plate with 70-80% confluence. After culturing for 24 hours, 200 占 퐇 of the virus culture solution was added, followed by incubation for 48 hours to infect the virus. After infection, stable cell lines were selected by culturing in 250 ng / ml puromycin (Sigma-Aldrich) for 2 weeks.

1-6. Cell Mobility and Permeability Analysis

(8-μm pore size 24-well transfer plate; Costar, Corning, NY, USA) was used to confirm the cell migration effect. To confirm the penetration effect of cells, Transwell And coated with 25 / / ml Type Ⅰ collagen. Control H1299 cells and AP1S1 expression-inhibiting H1299 cells (2 × 10 ⁵ cells) were seeded in 200 μl of serum free medium in the upper chamber of Transwell, and RPMI supplemented with 10% FBS was injected into the lower chamber Respectively. After 24 hours, the cells were fixed with methanol and stained with 0.1% crystal violet. Noninvasive cells were removed with a cotton swab and counted in a random field of at least 5 infiltrating cells.

1-7. Analysis of matrix metalloproteinase (MMP) activity

Control H1299 cells and AP1S1 gene expression-inhibiting H1299 cells were seeded at 4 × 10 ⁵ cells on the different hardness gels prepared in Example 1-2, and then cultured for 24 hours. The conditioned medium was harvested by harvesting the culture medium, centrifuged at 13000 rpm for 5 min at 4 ° C, and then harvested by transferring the supernatant. Cells were lysed with 1 × diluted cell culture lysis 5x Reagent (Promega, Madison, WI) ≪ / RTI > After treatment with Mca-PLGL-Dpa-AR-NH2 Fluorogenic MMP Substrate (ES001; R & D systems, Minneapolis, MN) to 10 mu m in each conditioned medium and cell lysate, Were measured using a Bio-Tek Synergy Mx microplate reader (Bio-Tek Instruments, Inc, Winooski, VT, USA). The excited wavelength was 305 nm and the emission wavelength was 430 nm.

Example 2. Confirmation of increase in hardness-dependent AP1S1 gene and protein expression

A polyacrylamide gel having a hardness of 0.5 kPa and a hardness of 40 kPa according to Example 1-2 was prepared and various cancer cell lines cultured through the method of Example 1-1 were respectively seeded to prepare cancer cells The expression levels of the AP1S1 gene were analyzed through the above Examples 1-3.

As a result, as shown in FIG. 1A, gene expression of AP1S1 was increased at a cancer tissue hardness of 40 kPa compared to a normal tissue hardness of 0.5 kPa in human arsenic lung cancer cell line H1299 and breast cancer cell line MDA-MB-231 Respectively.

Further, in order to confirm whether the amount of the protein changes according to the gene expression, the amount of protein expressed by the gene in H1299 and MDA-MB-231 in which the gene expression was changed in FIG. Respectively.

As a result, as shown in Fig. 1B, the expression level of AP1S1 in cells cultured at a hardness of 40 kPa compared with 0.5 kPa was confirmed at the protein level. This means that the expression level of AP1S1 is increased in the hardness of cancer tissues compared with the hardness of normal tissues.

Example 3. Confirmation of the Effect of Cancer Cell Movement and Penetration Change by Inhibition of AP1S1 Expression

In order to confirm the role of AP1S1 in the cancer cells in which the expression level increases in a hardness-dependent manner, a cell line inhibiting the expression of AP1S1 was prepared in Example 1-5. The degree of inhibition of expression of the AP1S1 gene was confirmed according to the above-described Example 1-3.

As a result, as shown in FIG. 2A, the two AP1S1 gene expression inhibitory cell lines produced by the lentiviral system inhibited AP1S1 gene expression by 60% and 35%, respectively, 1 cell line, the following experiments were carried out.

In addition, the inhibition of expression of the AP1S1 gene affects the mobility and permeability of cancer cells, as confirmed in Examples 1-5.

As a result, as shown in FIG. 2B, it was confirmed that the mobility (left panel) and permeability (right panel) of the AP1S1 gene expression inhibitory cell line were decreased as compared with the control cell line.

Example 4. Confirmation of Effect of Inhibition of AP1S1 Expression on Substrate Metal Protease Activity

 In order to confirm whether the expression of AP1S1 affects the activity and secretion of the substrate metalloproteinase, the control cells and the AP1S1 gene in the different hardness gels prepared in Example 1-2, (Cell lysate) and extracellular (conditioned media) of the substrate metalloproteinases in the expression inhibitory cell lines of the present invention.

As a result, as shown in Fig. 3A, it was confirmed that the activity of the substrate metalloproteinase in the cells was not significantly different from that of the cell hardness and inhibition of AP1S1 expression. However, as shown in FIG. 3B, the activity of the substrate metalloproteinase is increased as the hardness of the control cells increases in the extracellular medium. However, in the cell line inhibiting the AP1S1 gene expression, the substrate metalloproteinase It was confirmed that the increase of the activity did not occur. This implies that AP1S1 is involved in an increase in substrate metalloproteinase activity depending on the hardness of the cells.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention. There will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

Claims (10)

A pharmaceutical composition for inhibiting cancer treatment or cancer metastasis, comprising an AP1S1 (Adaptive Related Protein Complex 1 Sigma 1 Subunit) gene expression inhibitor or an AP1S1 protein activity inhibitor as an active ingredient.
The method according to claim 1,
Wherein said AP1S1 gene expression inhibitor inhibits the activity of a substrate metalloproteinase.
The method according to claim 1,
Wherein the AP1S1 protein activity inhibitor inhibits the activity of the substrate metalloproteinase.
The method according to claim 1,
Wherein said cancer is arsenic lung cancer or breast cancer.
The method according to claim 1,
The AP1S1 gene expression inhibitor is an antisense nucleotide complementary to the mRNA of the AP1S1 gene, a small hairpin RNA, a small interfering RNA, a ribozyme, (CRISPR / Cas-9). ≪ / RTI >
The method according to claim 1,
Wherein the activity inhibitor of the AP1S1 protein is any one selected from the group consisting of a compound which binds complementarily to the AP1S1 protein, a peptide, a peptide mimetic, an aptamer, and an antibody. A pharmaceutical composition.
A screening method for cancer treatment or cancer metastasis suppressing candidate substance, comprising the steps of:
(1) treating the test substance with an AP1S1 gene expressing cell line;
(2) measuring the expression level of the AP1S1 gene or the AP1S1 protein expression in the cell line; And
(3) a step of selecting the test substance whose expression level of the AP1S1 gene or the expression level of the AP1S1 protein is decreased as compared with the control group not treated with the test substance.
8. The method of claim 7,
Wherein the cancer is arsenic lung cancer or breast cancer.
8. The method of claim 7,
In step (2), the AP1S1 gene expression level may be determined by immunoprecipitation, reverse transcription-polymerase chain reaction, ELISA, immunocytochemistry, (Western blot), and flow cytometry (FACS). The method according to claim 1, A method for screening candidate substances for cancer therapy or cancer metastasis inhibition.
8. The method of claim 7,
In step (2), the AP1S1 protein expression level may be determined by Western blotting, radioimmunoassay, radioimmunodiffusion, enzyme immunoassay, immunoprecipitation, flow cytometry, immunofluorescence, Characterized in that it is measured by any one method selected from the group consisting of ouchterlony, complement fixation assay, reverse transcription polymerase chain reaction, and protein chip. A method for screening candidate substances for cancer therapy or cancer metastasis inhibition.

Images