KR20180083706A - Apparatus and method constructing consensus reference genome map - Google Patents

Abstract

Disclosed are a device and a method for constructing a reference genome map including a common sequence. The present invention can construct a reference genome map by using a sequencing and mapping technology such as next generation sequencing (NGS) short sequence decode, PacBio long sequence decode, and Illumnina TSLR long sequence decode; and can integrate information of common mutations (SNP and indel) in the constructed reference genome map. The present invention is provided to construct the reference genome map by using three or more sequencing and mapping technologies such as the NGS short sequence decode, the PacBio long sequence decode, and the Illumnina TSLR long sequence decode, thereby constructing the reference genome map for a short time with low costs. The present invention is provided to integrate the information of the common mutations (SNP and indel) in the constructed reference genome map, thereby applying a sequence of consensus to each position on a genome.

Description

[0001] APPARATUS AND METHOD FOR GENERATING A REFERENCE STANDARDS WITH A COMMON SEQUENCE [0002]

The present invention relates to an apparatus and method for constructing a reference standard genome map including a common sequence, and more particularly, to sequencing and mapping techniques such as next generation sequencing (NGS) single sequence decoding, PacBio long sequence decoding, and Illumnina TSLR long sequence decoding To a reference genome map and to integrate information of common mutations (SNPs, indels) into a constructed reference standard genome map.

A genome is the sum of the genetic information of an individual. Reference standard genome maps refer to all nucleotide sequences and their positional information on the genome of one species or one species. Different species have evolutionarily different genomes, and even among different individuals of the same species, they have different genomic sequences with high similarities. For example, humans and chimpanzees share evolutionarily ancestors in common and are known to have diverged about 6 million years ago, as well as genome sequences and genomic structures (human chromosome 2 has two chromosomes in an ape-like ape 2A, 2B). There are also different genomic structures in humans, such as structural variation and copy number variation. In December 2009, the BGI-Shenzen Institute in China released a reference standard genome map draft (scaffold sequence) for one Asian and one black person using NGS (next generation sequencing). As a result, we present the different parts of the Asian genome as opposed to the white genome, which implies the need for genetic mapping of each race.

Reference standard genomic maps serve as criteria / standards in performing other genomic sequence analysis, mapping short DNA fragment sequences generated by the whole genome re-sequencing method to reference standard genomic maps ), Mutations can be discovered. Single nucleotide variation (SNV) refers to a mutation in which one base is different from the reference standard genome map, and indel (insertion or deletion) means a mutation in which a difference in length of a short (~ 50 bp) nucleotide sequence occurs. These SNVs and indels are the cause of individual / individual differences, and they are related to the characteristics of the group and disease outbreaks, which is very important for disease prediction and disease marker discovery.

The reference standard genomic maps generated by all the de novo genome assemblies published to date have been assembled mainly using samples extracted from one or one individuals, which have individual / individual specific genomic structures and sequences have. In other words, when constructing a genome map using one DNA sequence, not only a reference standard genome map having representative of the group can be made, but also a person-specific sequence is present on the genome map, In analyzing whole genome re-sequencing data, a large number of unnecessary mutations are found.

In the case of human reference standard genome maps, about 10 genome maps have been published so far. In the case of the human genome map (human reference (current version GRCh38), which has the best quality and serves as a standard for the analysis of human genome, BAC (bacterial artificial chromosome) clones were prepared for samples of about 50 participants, In fact, RPCI-11 (or RP11) individual BAC clones were mainly used (74.3%) and were decoded and assembled (see [Table 1] below). Also, the human genome map was not assembled into several representative sequences, and only one BAC clone was used in each genome position.

Library Fraction Ethnicity CTB 0.016 Caucasian CTC 0.021 Caucasian CTD 0.043 East Asian RP1 0.028 Caucasian RP3 0.016 Caucasian RP4 0.022 Caucasian RP5 0.027 Caucasian RP11 0.743 Caucasian / African total 0.916

All other human genome maps were assembled using a single DNA sample. Table 2 below shows the major human reference standard genomic maps published to date. In addition, several genome maps that have been published so far are characterized mainly by using one or two major genome experiment methods.

Genome map Genome decoding method Reference paper
GRCh38 Human genome map. Build BAC Live, decode and assemble genome by Sanger decoding method Lander, ES et al . Initial sequencing and analysis of the human genome. Nature 409, 860921 (2001).
AK1
Assembled with PacBio long sequence and BioNano map Seo, JS et al . De novo assembly and phasing of a Korean human genome. Nature 538, 243247 (2016).
HX1
Assembled with PacBio long sequence and BioNano map Shi, L. et al . Long-read sequencing and de novo assembly of a Chinese genome. Nat. Commun. 7, 12065 (2016).
ASM101398v1
Assembled with PacBio long sequence and BioNano map Pendleton, M. et al . Assembly and diploid architecture of an individual human genome via single-molecule technologies. Nat. Methods 12, 780786 (2015).
CHM1_PacBio_r2
PacBio assembled into a long sequence Chaisson, MJ et al . Resolving the complexity of the human genome using single-molecule sequencing. Nature 517, 608611 (2015).
HsapALLPATHS1
NGS method detox assembly Gnerre, S. et al . High-quality draft assemblies of mammalian genomes from massively parallel sequence data. Proc. Natl Acad. Sci. USA 108,15131518 (2011).
HuRef
Assembled in a decoy method Levy, S. et al . The diploid genome sequence of an individual human. PLoS Biol. 5, e254 (2007).
Mongolian
NGS method detox assembly Bai, H. et al . The genomes of Mongolian individual reveals the genetic imprints of Mongolians on modern human populations. Genome Biol. Evol. 6, 31223136 (2014). YH / YH_2.0 NGS method detox assembly Li, R. et al . De novo assembly of human genomes with massively parallel short read sequencing. Genome Res. 20, 265272 (2010). African NGS method detox assembly

Dewey et al. (Genome, 7, e1002280 (2011)), the genomic map of the human genome was published, and the Genome Project (Genome Project) (White, black, and East Asian) to create a consensus sequence by integrating the SNV identified from several hundreds or hundreds of whole genome re-sequencing data produced in the human genome map. Respectively. However, Dewey et al. In the case of the paper, data with low sequencing depth (depth) of the whole genome re-sequencing data was used, and consensus sequences were applied only to the SNV. Also, Dewey et al. The content of the paper is not about de novo assembly, but about methods that apply common sequences to existing published genomic maps. On the other hand, the present invention differs in that a common sequence of a population is applied to indel as well as SNV using high-depth whole genome re-sequencing data on a de novo assembled genome map .

The present invention applies a high-quality reference standard genome map by applying various genome experiment methods (NGS single sequence decoding, PacBio long sequence decoding, Illumina TSLR long sequence decoding, OpGen whole genome maps, BioNano maps) And how to build it. The present invention also incorporates a mutation (SNV, indel) extracted from a large number of high-depth whole genome re-sequencing data to construct a reference standard genomic map with a common sequence of populations It is about how to build a common reference genome map of the population.

Korean Patent Laid-Open No. 2006-0052710 (The Regents of the University of California) 2006. 5. 19. Patent Literature 1 discloses genome mapping of functional DNA elements and cellular proteins, and Patent Document 1 discloses an entire genome (for example, Discloses a method for examining the binding of a protein to DNA in an entire genome or a partial region such as a chromosome or a chromosome region.

SUMMARY OF THE INVENTION The present invention provides a reference genome map using sequencing and mapping techniques such as next generation sequencing (NGS) single sequence decoding, PacBio long sequence decoding, and Illumnina TSLR long sequence decoding , And a common sequence that incorporates information of common mutations (SNPs, indels) into a constructed reference standard genome map.

According to an aspect of the present invention, there is provided an apparatus for constructing a reference standard genome map including a common sequence, the apparatus comprising: a clustering unit for generating a clustering sequence having an insert size smaller than a preset value using next generation sequencing (NGS) A sequence generator for producing a tight sequence having an insert size greater than a set value; A sequence filtering unit for filtering a predetermined read in the clue sequence and the clue sequence; A contig assembly for assembling a contig based on the single sequence using a De Bruijn graph; A scaffold assembly for assembling a scaffold based on the contig and the gap sequence; A super-scaffold was assembled through comparison of a single molecule map and a restriction enzyme based on the scaffold, and the PacBio long sequence sequencing method and the Illumina TSLR synthetic long A super-scaffold assembly for inserting a gap on the super-scaffold using a sequence decoding method and verifying an erroneous region of the super-scaffold; And a chromosome sequence assembling unit for assembling a chromosome sequence based on the position and strand information of the super-scaffold.

The K-mer analysis unit performs K-mer analysis on the basis of the single sequence to obtain a K-mer frequency table, and the K-mer frequency table is used to calculate an error error can be corrected and the contig can be assembled based on the error-corrected single sequence using the K-mer frequency table and the DeBruijn graph.

Wherein the sequence filtering unit filters a read that overlaps the read sequence with the read sequence and filters a read including an adapter sequence in the read sequence and the read sequence, The method comprising the steps of: filtering a sequence having a quality score smaller than a predetermined value in a sequence; filtering a read containing a junction adapter in the sequence; It may be trimming to have a length.

The scaffold assembly may be configured to align the contiguous sequence with the contig to measure an actual insert size and to insert the contig and the contiguous sequence using an actual insert size To assemble the scaffold and to cover the gap on the scaffold.

The super-scaffold assembly may be configured to select the restriction enzyme and to select the restriction enzyme based on the single molecule map generated by optical mapping and the scaffold based on the scaffold. The super-scaffold can be assembled through comparison of restriction enzyme patterns.

The super-scaffold constructor may verify the super-scaffold misassembly region using nanochannel-based genome mapping data.

The chromosome sequence assembling unit can assemble the chromosome sequence based on the position and strand information of the super-scaffold aligned to the human genome map (GRCh38).

And may further include a sequence substitution unit that substitutes the chromosome sequence using whole genome re-sequencing data.

According to another aspect of the present invention, there is provided a method of constructing a reference standard genome map including a common sequence, the method comprising the steps of: Producing a cloning sequence having a smaller insert size and an insert size greater than the predetermined value; Filtering a predetermined read in the clue sequence and the clue sequence; Assembling a contig based on the single sequence using a de Bruijn graph; Assembling a scaffold based on the contig and the gating sequence; Assembling a super-scaffold by comparing a single molecule map with a restriction enzyme based on the scaffold; Interposing a gap on the super-scaffold using a PacBio long sequence detoxification method and an Illumina TSLR synthetic long sequence detoxification method; Verifying the misassembly region of the super-scaffold; And assembling a chromosome sequence based on the position and strand information of the super-scaffold.

The contig assembly step may include: performing a K-mer analysis based on the single sequence to obtain a K-mer frequency table; Correcting an error of the clue line using the K-mer frequency table; And assembling the contig based on the error-corrected single sequence using the K-mer frequency table and the DeBruijn graph.

The read filtering step may include filtering the read line overlapped with the lead line and the overlapping sequence; Filtering a read containing an adapter sequence in the cue sequence and the cyan sequence; Filtering a sequence having a quality score value smaller than a predetermined value in the clue sequence and the clue sequence; Filtering a read containing a junction adapter in the jitter sequence; And trimming the clue sequence so that the clue sequence and the clue sequence have a predetermined length.

The step of assembling a scaffold may include aligning the contiguous sequence to the contig to measure an actual insert size; Assembling the scaffold based on the contig and the gap sequence using the actual insert size; And etching a gap on the scaffold.

The super-scaffold assembly step comprises: selecting the restriction enzyme; And comparing the restriction enzyme pattern selected based on the scaffold with the single molecule map generated by the optical mapping to determine the super-scaffold super- -scaffold). < / RTI >

The super-scaffold verification step verifies the super-scaffold erroneous region using nanochannel-based genome mapping data. Lt; / RTI >

The step of assembling the chromosome sequence is a step of assembling the chromosome sequence based on the position and strand information of the super-scaffold aligned to the human genome map (GRCh38) And assembling them.

The method may further comprise replacing the chromosome sequence with whole genome re-sequencing data.

According to an aspect of the present invention, there is provided a computer program for use in a computer readable recording medium, the computer program causing the computer to execute any one of the methods.

According to the apparatus and method for constructing a reference standard genome map including a common sequence according to the present invention, three or more sequencing and mapping techniques such as NGS (next generation sequencing) single sequence decoding, PacBio long sequence decoding, and Illumnina TSLR long sequence decoding are utilized By constructing a reference genome map, you can assemble a reference standard genome map in a fraction of the time. In addition, by incorporating information on common mutations (SNPs) into the constructed reference standard genome map, it can be applied to retain a consensus sequence at each position on the genome.

1 is a block diagram illustrating a reference standard genome map building apparatus including a common sequence according to a preferred embodiment of the present invention.
FIG. 2 is a view for explaining an example of a reference standard genome map building process according to a preferred embodiment of the present invention.
3 is a diagram for explaining an example of a verification result of a super-scaffold according to a preferred embodiment of the present invention.
FIG. 4 is a view for explaining an example of a result of assembling a chromosome sequence according to a preferred embodiment of the present invention.
5 is a graph illustrating the effect of a reference standard genome map according to a preferred embodiment of the present invention.
FIG. 6 is a flowchart illustrating a method of constructing a reference standard genome map including a common sequence according to a preferred embodiment of the present invention.
FIG. 7 is a flow chart illustrating the sequence filtering step shown in FIG. 6 in more detail.
8 is a flowchart showing the concrete construction step shown in Fig. 6 in more detail.
FIG. 9 is a flowchart showing the scaffold assembly step shown in FIG. 6 in more detail.
FIG. 10 is a flowchart showing the super-scaffold assembly step shown in FIG. 6 in more detail.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Reference will now be made in detail to the present embodiments of the present invention, examples of which are illustrated in the accompanying drawings.

First, referring to FIGS. 1 to 4, a reference standard genome map building apparatus including a common sequence according to a preferred embodiment of the present invention will be described.

FIG. 1 is a block diagram for explaining a reference standard genome map building apparatus including a common sequence according to a preferred embodiment of the present invention. FIG. 2 illustrates an example of a reference standard genome map building process according to a preferred embodiment of the present invention FIG. 3 is a view for explaining an example of a verification result of a super-scaffold according to a preferred embodiment of the present invention, and FIG. 4 is a diagram showing an example of the result of assembling a chromosome sequence according to a preferred embodiment of the present invention Fig.

Referring to FIG. 1, a reference standard genome map construction apparatus 100 (hereinafter, referred to as a genome map construction apparatus) including a common sequence according to a preferred embodiment of the present invention includes a next generation sequencing (NGS) The reference genome map is constructed using three or more sequencing and mapping techniques, such as long sequence decode and Illumnina TSLR long sequence decode. The genome map construction apparatus 100 may then integrate information of common mutations (SNPs) into a constructed reference standard genome map.

For this purpose, the genome map building apparatus 100 includes a sequence generator 110, a sequence filtering unit 120, a congestion generating unit 130, a scaffolding assembling unit 140, a super-scaffolding assembling unit 150, A chromosome sequence assembling unit 160 and a sequence substitution unit 170.

The sequence generator 110 generates a sequence having a short insert (short paired-end) having an insert size smaller than a predetermined value by using next generation sequencing (NGS) size [long-mate pair]). Here, the predetermined value may be 1 Kb (fragment size). That is, the sequence generator 110 can produce a sequence having a small insert size of less than 1 Kb and a small insert size larger than 1 Kb.

2 (a), the sequence generator 110 generates a short sequence (short paired-end) sequence to construct a scaffold of the genome map using the NGS scheme, insert size of less than 1 Kb) and long insert (long-mate pair, insert size of more than 1 Kb). At this time, the DNA library is produced by Illumina TruSeq DNA Sample Preparation Guide for clues. July 2012, for gigantic sequences Illumina Nextera® Mate Pair The method described in the Sample Preparation Guide, January 2013 is available. In the present invention, a library of 170 bp, 500 bp, and 700 bp based on the insert size in the cue sequence, and 2 Kb, 5 Kb, 10 Kb, 15 Kb, and 20 Kb based on the insert size were constructed and decoded. The result of NGS sequencing is shown in [Table 3] below.

Type Insert size Read length (bp) Number of read pairs Total data (Gb) Sequence depth (X)

Short-insert size libraries
170bp
101 254,562,947 51.42 16.59
48.69 246,624,330 49.82 16.07 246,007,078 49.70 16.03
500bp
101 246,418,836 49.78 16.06
46.71 230,109,465 46.48 14.99 240,361,539 48.55 15.66
700bp
101 207,193,678 41.85 13.50
39.17 188,159,956 38.01 12.26 205,873,335 41.59 13.41



Long-mate pair libraries
2Kb
101 196, 290, 337 39.65 12.79
38.22 232,858,099 47.04 15.17 157,507,662 31.82 10.26
5Kb
101 152,201,289 30.74 9.92
32.81 177,874,430 35.93 11.59 173,383,733 35.02 11.30
10Kb
101 205,215,277 41.45 13.37
40.05 209,859,354 42.39 13.67 199,617,521 40.32 13.01
15Kb
101 156,336,183 31.58 10.19
30.65 166,036,249 33.54 10.82 147,927,209 29.88 9.64
20Kb
101 181,506,276 36.66 11.83
34.72 177,434,679 35.84 11.56 173,929,946 35.13 11.33 Total 4,773,289,408 964.19 311.02 311.02

The sequence filtering unit 120 filters the predetermined read in the sequence of the clues and the sequence of the clues. Here, the predetermined read may include a redundant read, a read including an adapter sequence, a sequence having a quality score value smaller than a preset value, a junction adapter, And the like.

In order to obtain an accurate standard genomic map from clues and gaps generated in the Illumina decoding machine, the sequence filtering unit 120 uses a redundant read and adapter a read including an adapter, a read with a low quality, and the like can be eliminated. For this process, PrinSeq, SOAPfilter, and cutadapt programs were used in the present invention, respectively.

That is, the sequence filtering unit 120 may filter the redundant read in the sequence of the clue. In other words, there is a process of amplifying DNA fragments using PCR to facilitate sequencing in the process of producing a library of clues and gaps. In this process, the same sequence is redundantly sequenced in the library, which becomes an unnecessary element for producing an accurate reference standard genome map. The sequence filtering unit 120 performs filtering to remove the redundant read. At this time, the program used in the present invention is PrinSeq (lite-0.20.4).

The sequence filtering unit 120 may filter the read including the adapter sequence in the cue sequence and the cyan sequence. In other words, there is a read containing the adapter sequence (GATCGGAAGAGCACACGTCTGAACTCCAGTCAC, Reverse adapter: GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT) in the reading of the sequence of the clue sequence and the gapped sequence, The sequence filtering unit 120 removes such readings. At this time, the program used in the present invention is a SOAPfilter.

In addition, the sequence filtering unit 120 may filter a sequence having a quality score value smaller than a predetermined value in the clue sequence and the clue sequence. In other words, the decoded cue sequence and the cyan sequence have a quality score value corresponding to each sequence. In order to obtain a sequence having an accuracy of 99% or more, when the Quality Score value is less than 20 on average per read based on a Quality Score 20, the sequence filtering unit 120 filters the corresponding sequence. Also, when the ratio of the number of N base (ambiguous base) included in each read is equal to or larger than 5% of the read length, the sequence filtering unit 120 filters the corresponding sequence. At this time, the program used in the present invention is PrinSeq (lite-0.20.4).

Then, the sequence filtering unit 120 may filter a read containing a junction adapter in a gigantic sequence. Again, in the case of a deciphered sequence, a junction adapter may be randomly included in the sequence in the course of the experiment. The sequence filtering unit 120 trims the read containing the junction adapter to remove elements that may affect the assembly of the reference standard genome map. At this time, the program used in the present invention is cutadapt (v1.1).

In addition, the sequence filtering unit 120 may trimming the clue sequence and the clue sequence to have a predetermined length. In other words, the sequence filtering unit 120 may extract a sequence having the same sequence as that of the Poly-A tail at both ends of the sequence and at a position where the decoding quality of the sequence at the 5 'end and the 3' Cut all the parts that can affect the assembly. For example, the 3base and 3base portions of the 5'end and 8base of the 5'end are trimmed to 90bp so that the read length is 49bp based on the 3'end of the short sequence, (trimming). At this time, the program used in the present invention uses a script developed by itself.

The results of the sequence filtering are shown in Table 4 below.

Type Insert size Read length (bp) Number of read pairs Total data (Gb) Sequence Depth (X)

Short-insert size libraries
170bp
90 238,901,578 43.00 13.87
40 225,934,916 40.67 13.12 224,145,725 40.35 13.01
500bp
90 220,100,704 39.62 12.78
37.57 207,716,033 37.39 12.06 219,165,329 39.45 12.73
700bp
90 189,043,000 34.03 10.98
32.24 173,545,699 31.24 10.08 192, 535, 557 34.66 11.18



Long-mate pair libraries
2Kb
49 102,368,796 10.03 3.24
9.64 118,485,351 11.61 3.75 83,704,400 8.20 2.65
5Kb
49 74,199,538 7.27 2.35
8.08 93,060,115 9.12 2.94 88,156,446 8.64 2.79
10Kb
49 52,521,514 5.15 1.66
5.03 54,759,429 5.37 1.73 51,874,811 5.08 1.64
15Kb
49 60,904,413 5.97 1.93
5.3 55,631,632 5.45 1.76 51,042,581 5.00 1.61
20Kb
49 20,374,949 2.00 0.64
2.08 26,561,512 2.60 0.84 19,032,195 1.87 0.60 Total 2,843,766,223 433.77 139.94 139.94

The congestion assembly 130 assembles a contig based on a single sequence using a De Bruijn graph.

That is, the congestion building unit 130 performs a K-mer analysis based on a single sequence to obtain a K-mer frequency table. Again, the size of the genome is determined using a single-stranded sequence that has been translated for accurate reference standard genomic mapping. In order to measure the genome size, K-mer analysis should be performed. The K-mer frequency table is divided into the clusters by the length of the K value according to the determined K value, And measure the size of the genome. In the case of K-mer = 17, the genome size of 4 ^ 17, about 16 Gb, which is the probability that A, T, G and C exist by chance is analyzed. When the sequencing repeat number is sufficient, It goes up. In the reference standard genome mapping process according to the present invention, K-mer = 23 was used to obtain more accurate results. At this time, the program used in the present invention is SOAPec.

Then, the congestion assembly unit 130 corrects an error of the clue line using a K-mer frequency table. To describe again, using the K-mer frequency table generated in the K-mer analysis process for accurate contig assembly, the K-mer fragments corresponding to the low-depth portion The sequence may be heterozygous or may be thought of as an error in the sequencing process. In this case, the present invention is applied to 170bp, 500bp, and 700bp libraries decoded into single sequences, and the program used is SOAPec. The error correction results are shown in Table 5 below.

Insert Size Library Error corrected
 bases ratio

170bp KR01_PE_170_L1_1 0.0569% KR01_PE_170_L1_2 0.0640% KR01_PE_170_L2_1 0.0725% KR01_PE_170_L2_2 0.1675% KR01_PE_170_L3_1 0.0716% KR01_PE_170_L3_2 0.1715%

500bp KR01_PE_500_L1_1 0.0729% KR01_PE_500_L1_2 0.2081% KR01_PE_500_L2_1 0.0684% KR01_PE_500_L2_2 0.1718% KR01_PE_500_L3_1 0.0840% KR01_PE_500_L3_2 0.1615%

700bp KR01_PE_700_L1_1 0.1074% KR01_PE_700_L1_2 0.2794% KR01_PE_700_L2_1 0.1182% KR01_PE_700_L2_2 0.2401% KR01_PE_700_L3_1 0.0757% KR01_PE_700_L3_2 0.2625%

Also, the congestion assembly 130 assembles a contig based on a single error-corrected sequence using a K-mer frequency table and a DeBruijn graph. do. 2 (b), the congestion assembly unit 130 assembles the contig using the single-sequence filtering and the error-corrected single-sequence. At this time, contigs are assembled using SOAPdenovo2 (r240), which is a program using the de Bruijn graph method among various assembly algorithms. In other words, the two processes (the pregraph process: generating the K-mer frequency table according to the K-mer value) / contig process: the frequency table and the de Bruijn And a contig is created through the use of a graph algorithm to create a contig. In order to find the optimal K-mer value, a contig assembly is performed on the K-mer values of 29, 39, 49, 55, 59, 63, 69, 75, After confirming the assembly result, K = 55 is used to carry out the subsequent analysis). The contig assembly results are shown in Table 6 below.

K-mer size All sequences Longer than 100 bp Total size Longest N50 Total size Longest N50 29 5,187,304,717 16,946 90 2,275,359,750 16,946 1,099 39 4,459,796,947 35,726 300 2,529,816,579 35,726 1,939 49 4,066,593,737 51,838 980 2,740,134,913 51,838 2,375 55 3,860,731,497 44,789 1,447 2,915,054,629 44,789 2,559 59 3,744,446,380 48,982 1,773 2,990,197,206 48,982 2,735 63 3,641,677,654 54,683 2,113 3,029,961,853 54,683 2,964 69 3,524,281,519 54,689 2,589 3,072,247,309 54,689 3,295 75 3,429,622,648 62,488 2,918 3,097,380,667 62,488 3,466 79 3,343,414,611 80,399 2,789 3,086,359,621 80,399 3,187

The scaffold assembly 140 assembles a scaffold based on contig and contiguous sequences.

That is, the scaffold assembly 140 aligns the contiguous sequence to the contig to measure the actual insert size. Again, in order to obtain the actual insert size of the decoded single sequence or gapped sequence, alignment of the clue sequence and gapped sequence on the contig created above is performed to determine the actual fragment size per insert size (insert size ) And the standard deviation. At this time, the alignment program used in the present invention is Burrows-Wheeler Aligner (BWA, v0.7.7) and Samtools (v.0.1.19). The insert size of each library is measured using the value corresponding to the ninth column of the generated BAM file (the alignment distance between the first read and the second read). At this time, the program used in the present invention uses a script developed by itself.

Then, the scaffold assembly unit 140 assembles a scaffold based on the contiguous sequence using the actual insert size. As shown in FIG. 2 (c), the contiguous sequence, the single sequence and the double sequence, and the calculated insert size are used to calculate the scaffold scaffold. In this case, for the insert size value to be input, a value corresponding to 20% of the insert size average was used as the standard deviation. The scaffold assembling unit 140 performs a total of two processes (map process: alignment of a single sequence and a tight sequence to a contig sequence / scaff process: alignment result to a contig And a scaffold is assembled using the information of the insert size and the scaffold size. At this time, the program used in the present invention is SOAPdenovo2 (r240). The resulting scaffold assembly results are shown in Table 7 below.

Scaffold Size (Mb) No. N90 3.09 178 N80 6.45 116 N70 10.45 81 N60 16.16 59 N50 19.85 42 Longest 81.91 - Gaps 1.65% - Total (≥ 200bp) 2.92 Gb 68,170 Total (≥10 Kb) 2.88 Gb 1,243

Also, the scaffold assembly 140 carries out a gap on the scaffold. In other words, the generated scaffold sequence has a large number of portions (N base) that do not satisfy the distance corresponding to the insert size of the single sequence and the short sequence, and this portion is referred to as a gap do. The gap closing operation is repeated twice to fill the sequence of the gap portion. At this time, the program used in the present invention is a gapcloser.

The super-scaffold assembly 150 assembles a super-scaffold based on a single molecule map and a scaffold. Again, in order to extend the scaffold to a super-scaffold, OpGen obtains whole genome optical mapping data.

That is, the super-scaffold assembly 150 assembles a super-scaffold through a single molecule map and a comparison of restriction enzymes based on the scaffold. do.

At this time, the super-scaffold assembly 150 may select a restriction enzyme. Again, a suitable restriction enzyme is selected for the assembled scaffold sequence. In this case, the present invention measures the size and amount of the average fragment size (AFS), usable sequence information, and large fragments of various restriction enzymes, and finally, a suitable restriction enzyme is analyzed through Genome-Builder ™ analysis .

The specific selection method of the restriction enzyme is as follows.

 - usable sequence information% (5-20 Kb): 90% or more

 - usable sequence information% (6-15 Kb): 70% or more

 - usable sequence information% (6-12 Kb): 60% or more

 - average fragment size (AFS): 5 Kb or more

Among the restriction enzymes satisfying the above conditions, select the number of fragments> 100 Kb and the large fragment size.

The selection result of the restriction enzyme (selection of Spel restriction enzyme) is as shown in [Table 8].

Enzyme Usable%  5Kb-20Kb Usable%  6Kb-15Kb Usable% 6Kb - 12Kb Ave. Frags size (kb) # of Frags> 100kb Max Frag  size (Kb) AflII 25.12 10.31 10.07 4.58 4 117.49 BamHI 94.94 82.36 72.76 8.08 19 159.82 KpnI 98.76 91.89 69.64 10.35 50 154.09 NcoI 17.1 3.37 3.35 3.85 0 84.46 NheI 98.08 89.26 65.1 10.67 62 149.61 SpeI 94.8 73.17 67.9 7.44 63 196.12 BglII 7.01 2.12 2.07 3.79 One 104.69 EcoRI 7.86 2.87 2.85 3.65 0 71.37 MluI 0.76 0.23 0.09 130.62 9422 1529.97 NdeI 12.35 6.4 6.21 3.25 3 105.73 PvuII 2.2 0.4 0.4 2.7 3 149.7 XbaI 9.27 3.33 3.26 3.64 3 147.38 XhoI 26.46 11.1 4.88 23.64 2612 372.38

Then, the super-scaffold assembly 150 compares a single molecule map generated by optical mapping with a restriction enzyme pattern selected based on a scaffold, A super-scaffold can be assembled through the through-hole. 2 (d), a single molecule map generated from a scaffold sequence and an optical mapping scheme is referred to as a restriction enzyme pattern, Assemble together through comparison. Herein, Genome Builder ™ is used to identify a restriction enzyme on a scaffold. For accurate super-scaffold assembly, the scaffold only covers a size greater than 200 Kb, and the single molecule map utilizes only a size greater than 250 Kb. Then, using the position of the restriction enzyme of the scaffold and the position information of the restriction enzyme of the single molecule map, the extension scaffold and the scaffold the scaffolds are connected to each other to assemble a super-scaffold. The results of single molecule map generation are shown in Table 9 below, and super-scaffold assembly results are shown in Table 10 below.

Summary of SMRM  data Maps used in analysis Total Size (Gb) 745.51 Number of Molecules 2,071,951 Average Size of Molecules (Kb) 359.81 Minimum molecule size (Kb) 250 Average Size of Fragments (Kb) 13.24

Whole-genome
Super-scaffold assembly using optical mapping Size (Mb) No. N90 3.86 140 N80 9.45 92 N70 14.47 67 N60 19.56 49 N50 25.93 36 Longest 101.22 - Gaps 1.75% - Total (≥ 200bp) 2.92 Gb 68,103 Total (≥10 Kb) 2.88 Gb 1,176

The super-scaffold assembly 150 then masks the gap on the super-scaffold using the PacBio long sequence decode method and the Illumina TSLR synthesized long sequence decode method. Again, in order to fill in a gap (denoted as nucleotide sequence 'N') on the super-scaffold, as shown in Figure 2 (e), two types of long sequence decodings . Herein, the present invention utilizes PacBio long sequence decoding method and Illumina TSLR synthesized long sequence decoding method. Perform the PBJelly2 program (version 14.9.9) as a default option so that long sequence errors are minimized by entering multiple long sequences at the same time and creating a consensus sequence (combining multiple sequence information). The results of PacBio long sequence decoding are the same as those of [Table 11] (P4C2 chemistry) and [Table 12] (P5C3 chemistry), and results of Illumina TSLR synthesis long sequence decode are shown in [Table 13] The results of covering the gaps on the super-scaffold are shown in Table 14 below.

Size Number of bases (bp) Number of reads Mean length (bp) ~ 2kb 2,200,375,125 2,023,326 1,088 ~ 3kb 2,598,138,881 1,054,927 2,463 ~ 4kb 2,253,729,183 650,819 3,463 ~ 5kb 1,993,913,569 445,503 4,476 ~ 6kb 1,868,335,867 341,037 5,478 ~ 7kb 1,692,679,373 261,244 6,479 ~ 8kb 1,490,151,540 199,293 7,477 ~ 9kb 1,264,147,938 149,166 8,475 ~ 10kb 1,025,254,470 108,261 9,470 10kb ~ 2,404,653,532 202,921 11,850 Total 18,791,379,478 5,436, 497 3,457

Region Number of bases (bp) Number of reads Mean length (bp) ~ 2kb 376,691,922 352,650 1,068 ~ 3kb 448,189,058 179,744 2,493 ~ 4kb 581,090,138 166,158 3,497 ~ 5kb 707,030,086 157,272 4,496 ~ 6kb 815,006,427 148,315 5,495 ~ 7kb 905,881,157 139,481 6,495 ~ 8kb 978,965,060 130,607 7,496 ~ 9kb 1,063,290,046 125,158 8,496 ~ 10kb 1,084,089,752 114,232 9,490 10kb ~ 5,347,185,274 406,019 13,170 Total 12,307,418,920 1,919,636 6,411

Region Number of bases (bp) Number of reads Mean length (bp) ~ 2kb 1,745,885,089 1,627,362 1,073 ~ 3kb 1,227,839,348 498,112 2,465 ~ 4kb 1,200,052,670 345,449 3,474 ~ 5kb 1,170,624,980 261,313 4,480 ~ 6kb 1,141,935,546 208,259 5,483 ~ 7kb 1,132,652,780 174,578 6,488 ~ 8kb 1,358,992,691 181,044 7,506 ~ 9kb 2,532,232,743 294,819 8,589 ~ 10kb 2,879,791,577 304,656 9,453 10kb ~ 1,910,098,184 181,128 10,546 Total 16,300,105,608 4,076,720 3,998

Long sequence  Utilized gap Closing (gap closing)
(PacBio and TSLR ) Size (Mb) No. N90 3.53 143 N80 9.26 93 N70 14.53 67 N60 19.36 50 N50 26.08 36 Longest 101.48 - Gaps 1.06% - Total (≥ 200bp) 2.94 Gb 68,451 Total (≥10 Kb) 2.90 Gb 1,369

The super-scaffold assembly 150 also verifies the misassembly region of the super-scaffold. That is, the super-scaffold assembly 150 can verify the super-scaffold misassembly region using nanochannel-based genome mapping data. 2 (f), using the nanochannel-based genome mapping data of BioNano Genomics, the super-scaffold assembly of the super-scaffold Verify the area. At this time, the super-scaffold only covers a size exceeding 10 Kb. Genome mapping data were assembled into consensus genome maps using the BioNano Genonmics Irys genome mapping system and BioNano consensus genome maps and assembled super-scans using the Linux command of irysView software (version 2.1.0.30787) Compare the genome structure of the super-scaffolds. To verify the area of assembly, the BioNano consensus genome maps are compared to the human genome map (GRCh38). All alignment results are confirmed manually to identify and isolate the area of misassembly. In addition, the BioNano consensus map can also cause misassembly. Therefore, we perform misassembly tests on the consensus map with an alignment confidence score of 20 or more, and compare the structure of the super-scaffold, BioNano consensus map, and GRCh38 By comparison, the area of misassembly is identified. The result of the genome map production is shown in Table 15 below, and the result of the verification of the super-scaffold using the BioNano genome map is shown in FIG. As shown in FIG. 3, the BioNano genome map (blue block in FIG. 3) for the longest assembled super-scaffold (green block in FIG. 3) (super-scaffold).

BioNano single molcules BioNano  consensus maps Total data 210 Gb - Single molecule N50 273 Kb - Moleulces above 150Kb 145 Gb - Coverage depth 45 × - Assembly size - 2.78 Gb Consensus map N50 - 1.12 Mb

The chromosome sequence assembling unit 160 assembles the chromosome sequence based on the position and strand information of the super-scaffold. That is, the chromosome sequence assembling unit 160 can assemble a chromosome sequence based on the position and strand information of a super-scaffold aligned to the human genome map GRCh38 have.

2 (g), in order to extend the assembled and verified super-scaffold sequence into a chromosome sequence, the verified sequence is referred to as a human genome map (Fig. 2 GRCh38) with the SyMap program (v4.2) as the default comparison parameters (whole genome alignment). At this time, a whole genome alignment is performed on super-scaffolds of 10 Kb or more in order to eliminate the bias due to the repetitive sequence on the genome. Unmapped super-scaffolds reorder the GRCh38 with a mapped anchor number of 4 or more. Smaller super-scaffolds (200 bp to 10 Kb) perform the BLASR program as the default option and align to GRCh38. At this time, it is used only when mapping quality = 254. It extends to the chromosome sequence using the position and strand information of the super-scaffold aligned to the human genome map (GRCh38). The gap information between the super-scaffolds uses the length of the free region on the human genome map. If super-scaffold positions are overlapped, the gap information between the super-scaffolds is 10 Kb random Of the gap. Assign a sequence of telomeric regions by adding a 10 Kb gap sequence to both ends of the chromosome. Super-scaffolds that are not aligned to GRCh38 and whose location on the chromosome is unknown are located in the chrUn group. At this time, in the present invention, the chromosome sequence assembly uses a script developed by itself. The result of the structure comparison between the human genome map (GRCh38) and the assembled / verified super-scaffold is shown in FIG. 4, and the chromosome assembly results are shown in Table 16 below.

Chromosomes
* Unplaced scaffolds were excluded. Size (Mb) No. N90 81.54 19 N80 103.05 16 N70 136.43 13 N60 137.59 11 N50 155.88 8 Longest 251.92 - Gaps 9.44% - Total (≥ 200bp) 3.12 Gb 24 Total (≥10 Kb) 3.12 Gb 24

The sequence replacement unit 170 replaces a chromosome sequence using whole genome re-sequencing data.

In other words, as shown in FIG. 2 (h), the assembled chromosome sequence is replaced with whole genome re-sequencing data used for population common sequence replacement. In the present invention, 40 whole genome re-sequencing data as shown in Table 17 below was utilized.

Sample ID Total number of
raw reads Mapped
read depth (except 'N') Read mapping
rate ( % ) Homozygous
SNVs Homozygous
INDELs Heterozygous
SNVs Heterozygous
INDELs All
variants KPGP-00002 98,317,515,960 27.64 99.29 962,066 146,462 2,958,707 292,082 4,359,317 KPGP-00006 93,448,081,980 24.73 99.28 1,431,527 204,234 2,915,971 276,219 4,827,951 KPGP-00032 112,190,946,660 30.36 99.29 1,444,163 215,475 2,955,815 296,145 4,911,598 KPGP-00033 108,196,466,760 29.95 99.30 1,406,058 211,651 2,961,708 297,035 4,876,452 KPGP-00039 101,141,448,400 30.19 99.16 1,391,102 212,028 2,991,047 315,678 4,909,855 KPGP-00056 111,361,334,200 32.24 99.34 1,419,373 230,317 3,100,438 340,429 5,090,557 KPGP-00086 102,626,322,600 29.88 99.34 1,423,097 228,216 3,074,640 335,156 5,061,109 KPGP-00125 118,670,365,980 33.12 99.31 1,438,747 211,687 2,932,733 291,074 4,874,241 KPGP-00127 118,883,354,760 32.81 99.33 1,416,527 206,959 2,948,523 288,104 4,860,113 KPGP-00128 117,849,278,700 32.76 99.29 1,407,530 208,532 2,941,634 292,805 4,850,501 KPGP-00129 107,124,150,780 29.96 99.28 1,440,746 203,979 2,908,731 271,108 4,824,564 KPGP-00131 120,142,829,340 33.36 99.29 1,432,319 211, 261 2,970,372 289,604 4,903,556 KPGP-00132 122, 237, 363, 160 33.93 99.30 1,411,276 210,946 2,946,694 297,988 4,866,904 KPGP-00134 119,540,641,320 32.54 99.28 1,416,157 207,904 2,931,855 288,305 4,844,221 KPGP-00136 114,984,689,940 30.71 99.30 1,429,777 204,804 2,940,492 274,170 4,849,243 KPGP-00137 118,027,255,140 32.97 99.28 1,403,331 207,581 2,940,643 289,256 4,840,811 KPGP-00138 123,868,546,380 33.39 99.32 1,398,902 207,327 2,938,964 289,045 4,834,238 KPGP-00139 105,730,760,700 29.32 99.28 1,397,287 207,216 2,918,240 291,707 4,814,450 KPGP-00141 111,508,577,820 31.41 99.24 1,405,400 207,892 2,926,108 288,957 4,828,357 KPGP-00142 125,024,326,200 32.62 99.29 1,443,241 211,075 2,943,175 292,818 4,890,309 KPGP-00144 127,001,127,600 33.96 99.30 1,422,369 211,512 2,973,541 296,396 4,903,818 KPGP-00145 111,861,808,380 31.18 99.29 1,438,003 210,730 2,953,375 293,052 4,895,160 KPGP-00205-B01-G 123,835,438,866 37.24 98.41 1,422,423 221,835 3,072,207 332,313 5,048,778 KPGP-00220 106,317,727,560 28.21 99.28 1,411,132 201,485 2,931,702 284,397 4,828,716 KPGP-00227 115,164,844,920 34.39 99.30 1,419,518 217,159 3,039,274 308,248 4,984,199 KPGP-00228 112,898,405,520 33.34 99.30 1,455,818 221,343 3,052,488 303,008 5,032,657 KPGP-00230 110,458,697,940 32.86 99.31 1,414,415 214,448 3,031,789 301,182 4,961,834 KPGP-00232 109,620,112,860 32.01 99.29 1,442,223 214,897 3,020,544 292,548 4,970,212 KPGP-00233 107,091,428,940 32.08 99.27 1,421,451 216,917 3,014,334 302,473 4,955,175 KPGP-00235 114,400,539,900 34.74 99.31 1,414,391 218,911 3,047,216 309,518 4,990,036 KPGP-00245-B01-G-PE500 102,078,086,860 31.40 99.11 1,465,527 223,235 3,031,190 322,301 5,042,253 KPGP-00254 122,277,928,000 34.56 99.24 1,427,301 221,720 3,080,569 313,709 5,043,299 KPGP-00255 102,221,657,600 29.67 99.34 1,414,140 227,857 3,083,228 336,527 5,061,752 KPGP-00256 127,033,362,000 36.61 99.35 1,422,753 235,874 3,174,628 355,538 5,188,793 KPGP-00265-B01-G-P500 90,922,729,400 27.53 99.29 1,414,977 216,811 2,964,359 306,126 4,902,273 KPGP-00266-B01-G-P500 91,666,078,800 27.38 99.32 1,374,215 212,665 2,962,424 307,516 4,856,820 KPGP-00269-B01-G-PE500 100, 240, 975, 874 30.81 99.32 1,449,250 219,822 3,052,622 324,886 5,046,580 KPGP-00317-B01-G-PE500 103,075,371,660 26.76 87.15 1,400,454 208,300 3,002,602 306,055 4,917,411 KPGP-00318-B01-G-PE500 101,805,865,370 28.22 95.42 1,440,304 218,383 2,971,844 319,451 4,949,982 KPGP-00319-B01-G-PE500 100,957,938,100 27.77 97.17 1,403,626 213,564 3,063,114 315,785 4,996,089

Whole genome re-sequencing is mapped to the assembled chromosome sequence using the BWA-MEM program (version 0.7.8) as the default option. The mapping results are shown in Table 18 below.

Sample ID Total amount of
raw reads Mapped
read depth (except 'N') Read mapping
rate (%) Homozygous
 SNP Homozygous
INDEL Heterozygous
SNP Heterozygous
INDEL All
variants KPGP-00002 98,317,515,960 27.64 99.29 962,066 146,462 2,958,707 292,082 4,359,317 KPGP-00006 93,448,081,980 24.73 99.28 1,431,527 204,234 2,915,971 276,219 4,827,951 KPGP-00032 112,190,946,660 30.36 99.29 1,444,163 215,475 2,955,815 296,145 4,911,598 KPGP-00033 108,196,466,760 29.95 99.30 1,406,058 211,651 2,961,708 297,035 4,876,452 KPGP-00039 101,141,448,400 30.19 99.16 1,391,102 212,028 2,991,047 315,678 4,909,855 KPGP-00056 111,361,334,200 32.24 99.34 1,419,373 230,317 3,100,438 340,429 5,090,557 KPGP-00086 102,626,322,600 29.88 99.34 1,423,097 228,216 3,074,640 335,156 5,061,109 KPGP-00125 118,670,365,980 33.12 99.31 1,438,747 211,687 2,932,733 291,074 4,874,241 KPGP-00127 118,883,354,760 32.81 99.33 1,416,527 206,959 2,948,523 288,104 4,860,113 KPGP-00128 117,849,278,700 32.76 99.29 1,407,530 208,532 2,941,634 292,805 4,850,501 KPGP-00129 107,124,150,780 29.96 99.28 1,440,746 203,979 2,908,731 271,108 4,824,564 KPGP-00131 120,142,829,340 33.36 99.29 1,432,319 211, 261 2,970,372 289,604 4,903,556 KPGP-00132 122, 237, 363, 160 33.93 99.30 1,411,276 210,946 2,946,694 297,988 4,866,904 KPGP-00134 119,540,641,320 32.54 99.28 1,416,157 207,904 2,931,855 288,305 4,844,221 KPGP-00136 114,984,689,940 30.71 99.30 1,429,777 204,804 2,940,492 274,170 4,849,243 KPGP-00137 118,027,255,140 32.97 99.28 1,403,331 207,581 2,940,643 289,256 4,840,811 KPGP-00138 123,868,546,380 33.39 99.32 1,398,902 207,327 2,938,964 289,045 4,834,238 KPGP-00139 105,730,760,700 29.32 99.28 1,397,287 207,216 2,918,240 291,707 4,814,450 KPGP-00141 111,508,577,820 31.41 99.24 1,405,400 207,892 2,926,108 288,957 4,828,357 KPGP-00142 125,024,326,200 32.62 99.29 1,443,241 211,075 2,943,175 292,818 4,890,309 KPGP-00144 127,001,127,600 33.96 99.30 1,422,369 211,512 2,973,541 296,396 4,903,818 KPGP-00145 111,861,808,380 31.18 99.29 1,438,003 210,730 2,953,375 293,052 4,895,160 KPGP-00205-B01-G 123,835,438,866 37.24 98.41 1,422,423 221,835 3,072,207 332,313 5,048,778 KPGP-00220 106,317,727,560 28.21 99.28 1,411,132 201,485 2,931,702 284,397 4,828,716 KPGP-00227 115,164,844,920 34.39 99.30 1,419,518 217,159 3,039,274 308,248 4,984,199 KPGP-00228 112,898,405,520 33.34 99.30 1,455,818 221,343 3,052,488 303,008 5,032,657 KPGP-00230 110,458,697,940 32.86 99.31 1,414,415 214,448 3,031,789 301,182 4,961,834 KPGP-00232 109,620,112,860 32.01 99.29 1,442,223 214,897 3,020,544 292,548 4,970,212 KPGP-00233 107,091,428,940 32.08 99.27 1,421,451 216,917 3,014,334 302,473 4,955,175 KPGP-00235 114,400,539,900 34.74 99.31 1,414,391 218,911 3,047,216 309,518 4,990,036 KPGP-00245-B01-G-PE500 102,078,086,860 31.40 99.11 1,465,527 223,235 3,031,190 322,301 5,042,253 KPGP-00254 122,277,928,000 34.56 99.24 1,427,301 221,720 3,080,569 313,709 5,043,299 KPGP-00255 102,221,657,600 29.67 99.34 1,414,140 227,857 3,083,228 336,527 5,061,752 KPGP-00256 127,033,362,000 36.61 99.35 1,422,753 235,874 3,174,628 355,538 5,188,793 KPGP-00265-B01-G-P500 90,922,729,400 27.53 99.29 1,414,977 216,811 2,964,359 306,126 4,902,273 KPGP-00266-B01-G-P500 91,666,078,800 27.38 99.32 1,374,215 212,665 2,962,424 307,516 4,856,820 KPGP-00269-B01-G-PE500 100, 240, 975, 874 30.81 99.32 1,449,250 219,822 3,052,622 324,886 5,046,580 KPGP-00317-B01-G-PE500 103,075,371,660 26.76 87.15 1,400,454 208,300 3,002,602 306,055 4,917,411 KPGP-00318-B01-G-PE500 101,805,865,370 28.22 95.42 1,440,304 218,383 2,971,844 319,451 4,949,982 KPGP-00319-B01-G-PE500 100,957,938,100 27.77 97.17 1,403,626 213,564 3,063,114 315,785 4,996,089

The result mapped to the same position is eliminated. IndelRealigner is performed to improve mapping quality, and base quality scores are recalibrated using GATK's TableRecalibration algorithm. Single nucleotide variation (SNV) and small insertion or deletion (indel) mutations of whole genome re-sequencing in Korean were performed using the Genome Analysis Toolkit (GATK, version 2.3.9) . The results of the mutations used in the common sequence substitution are shown in Table 19 below.

SNVs indels Total 1,951,986 219,728 2,171,714

In the case of SNV, allele ratios of each base position are measured, and if the nucleotide sequence found at the highest frequency among all the total genome sequences (n) * 2 haploids = 2n is different from the KOREF nucleotide sequence, the nucleotide sequence is substituted. In the case of indel, it is substituted if it is found in more than 50% of the entire total genome sequence (n) * 2 haploids = 2n. For sex chromosomes (X and Y chromosomes), the X chromosome measures common mutations from 2n per female and 1n per male, and the Y chromosome measures common mutations from 1n per male. At this time, the program used in the present invention uses a script developed by itself.

<Autosomal chromosome (1 to 22 chromosomes)>

- Number of autosomal haploids: total length of genome sequence (n) * 2 haploids = 2n

- Representative SNV selection: Sequence of the highest frequency among 2n haploids (select the same base sequence as the KOREF sample if there are two or more highest frequency bases)

- Common indel selection: Indel mutations commonly found in more than 50% of 2n haploids

<Sex chromosome (X, Y chromosome)>

- number of haploids of X chromosome target: (male total genome sequence number of samples (n) * 1 haploid) + (female total genome sequence number of samples (m) * 2 haploids) = n + 2m

- number of haploids of Y chromosome target: (male total genome sequence number of samples (n) * 1 haploid) = n

- Representative SNV selection: n + 2m number of haploids that occur at the highest frequency (if more than 2 bases with the highest frequency, select the same base sequence as the KOREF sample)

- Common indel selection: Indel mutations commonly found in more than 50% of n haploids

Table 20 summarizes the assembly results of the standard reference genome maps as described above.

Scaffold Whole-genome
광학 매핑 Super-scaffold
(Long reads) Chromosomes
(Assessment using BioNano maps) Size
(Mb) No. Size
(Mb) No. Size
(Mb) No. Size
(Mb) No. N90 3.09 178 3.86 140 3.53 143 81.54 19 N80 6.45 116 9.45 92 9.26 93 103.05 16 N70 10.45 81 14.47 67 14.53 67 136.43 13 N60 16.16 59 19.56 49 19.36 50 137.59 11 N50 19.85 42 25.93 36 26.08 36 155.88 8 Longest 81.91 - 101.22 - 101.48 - 251.92 - Gaps 1.65% - 1.75% - 1.06% - 9.44% - Total
(≥ 200bp) 2.92 Gb 68,170 2.92 Gb 68,103 2.94 Gb 68,451 3.12 Gb 24 Total
(≥10 Kb) 2.88 Gb 1,243 2.88 Gb 1,176 2.90 Gb 1,369 3.12 Gb 24

The effect of the reference standard genome map according to the preferred embodiment of the present invention will now be described with reference to FIG.

5 is a graph illustrating the effect of a reference standard genome map according to a preferred embodiment of the present invention.

The X-axis of the graph shown in FIGS. 5 (a) and 5 (b) is composed of five black (Mandeka, Yoruba, San, Mbuti, Dinka), five white (Sardinian, French, CEU) Mongolian, Chinsese, Japanese) and 5 Korean (Korean) whole genome re-sequencing data. The Y-axis of the graph shown in FIG. 5 (a) represents the number of homozygous SNVs, and the Y-axis of the graph shown in FIG. 5 (b) represents the number of homozygous indels.

5, the human genome map (GRCh38), KOREF_S (chromosome assembled with one person in the present invention), KOREF_C (in the present invention, the chromosomal sequence assembled into one person is divided into 40 common mutations Substitution) is used as the reference sequence, the number of mutations can be confirmed in 20 whole genome re-sequencing data. Reference standard genomic maps (GRCH38 and KOREF_S) assembled into one person, and reference standard genomic maps (KOREF_C) containing consensus sequences, reveal fewer variations. Thus, the reference standard genome map including the population common sequence can be confirmed to have a common sequence suitable for reference standard genome map by eliminating the sequence having the individual specificity.

The results of comparing the quality of the reference standard genome map ('KOREF') according to the present invention are shown in Table 21 below.

Genome map Assembly sequence length (bp) Scaffold / Contig
N50
(Mb) Human genome map
( GRCh38 ) Restoration rate (%) Segmental duplication area Repeat sequence NCBI  Gene restoration Length (bp) % Length (bp) % Number % Human genome map
GRCh38 (chromosome) 3,209,286,105 67.79 - 212,777,868 - 1,564,209,365 - 20,135 - KOREF (chromosome) 3,211,075,818 26.46 88.47 149,353,191 70.19 1,452,404,484 92.85 17,758 88.19 AK1 2,904,207,228 44.85 87.90 144,868,735 68.08 1,454,888,506 93.01 17,759 88.20 CHM1_PacBio_r2 2,996,426,293 26.90 88.02 205,559,250 96.61 1,541,211,387 98.53 17,657 87.69 ASM101398v1 3,176,574,379 26.83 88.26 168,652,649 79.26 1,545,168,387 98.78 6,610 32.83 HsapALLPATHS1 2,786,258,565 12.08 82.89 90,343,965 42.46 1,250,655,296 79.95 16,995 84.41 HuRef (chromosome) 2,844,000,504 17.66 85.85 134,317,812 63.13 1,411,487,301 90.24 16,968 84.27 Mongolian 2,881,945,563 7.63 86.54 121,384,034 57.05 1,399,420,366 89.47 17,189 85.37 YH_2.0 2,911,235,363 20.52 86.31 127,254,909 59.81 1,397,013,571 89.31 17,125 85.05 African 2,676,008,911 0.062 69.47 55,830,170 26.24 968,988,149 61.95 9,167 45.53

Here, as the length of the assembled sequence is similar to the length of the assembled sequence of the human genome map, the longer the scaffold / contig N50 is, the better the assembly quality is as the human genome map reconstruction rate / fragment redundancy restoration rate, repetitive sequence restoration rate and NCBI gene restoration rate are higher .

A reference standard genome map construction method including a common sequence according to a preferred embodiment of the present invention will now be described with reference to FIG.

FIG. 6 is a flowchart illustrating a method of constructing a reference standard genome map including a common sequence according to a preferred embodiment of the present invention.

Referring to FIG. 6, the genome map construction apparatus 100 produces sequences of clues and sequences (S110). That is, the genome map construction apparatus 100 uses a next generation sequencing (NGS) to generate a single sequence (short insert [short paired-end]) having a smaller insert size than a preset value, Produces a long insert [long-mate pair] with an insert size. Here, the predetermined value may be 1 Kb (fragment size).

Then, the genome map construction apparatus 100 filters the clusters and clusters (S120). In other words, the genome map construction apparatus 100 filters the pre-set read in the sequence of clues and sequences. Here, the predetermined read may include a redundant read, a read including an adapter sequence, a sequence having a quality score value smaller than a preset value, a junction adapter, And the like.

Then, the genome map construction apparatus 100 assembles the contig based on the single sequence (S130). That is, the genome map building apparatus 100 assembles a contig based on a single sequence using a De Bruijn graph.

Then, the genome map building apparatus 100 assembles a scaffold based on the contig and the contiguous sequence (S140).

Then, the genome map building apparatus 100 assembles a super-scaffold based on a single molecule map and a scaffold (S150). That is, the genome map construction apparatus 100 assembles a super-scaffold through a single molecule map and a restriction enzyme comparison based on the scaffold.

Then, the genome map building apparatus 100 carries out a gap on a super-scaffold (S160). That is, the genome map building device 100 masks the gap on the super-scaffold using the PacBio long sequence decode method and the Illumina TSLR synthesized long sequence decode method.

In addition, the genome map construction apparatus 100 verifies the misassembly region of the super-scaffold (S170). That is, the genome map construction apparatus 100 can verify the super-scaffold misassembly region using nanochannel-based genome mapping data.

Then, the genome map construction apparatus 100 assembles a chromosome sequence (S180). That is, the genome map construction apparatus 100 can construct a chromosome sequence based on the position and strand information of a super-scaffold aligned to the human genome map GRCh38 have.

Thereafter, the genome map construction apparatus 100 may replace the chromosome sequence (S190). That is, the genome map construction apparatus 100 can replace a chromosome sequence using whole genome re-sequencing data.

The sequence filtering step according to a preferred embodiment of the present invention will now be described in more detail with reference to FIG.

FIG. 7 is a flow chart illustrating the sequence filtering step shown in FIG. 6 in more detail.

Referring to FIG. 7, the genome map construction apparatus 100 may filter overlapping readings in the clustering sequence and the clustering sequence (S121).

Then, the genome map construction apparatus 100 can filter the read including the adapter sequence in the clue sequence and the clue sequence (S123).

In addition, the genome map construction apparatus 100 may filter the clue sequence and the clue sequence based on the quality score value (S125). That is, the genome map construction apparatus 100 can filter sequences having a quality score value smaller than a predetermined value in the clue sequence and the clue sequence.

Then, the genome map building apparatus 100 may filter a read containing the junction adapter in the gapped sequence (S127).

In addition, the genome map construction apparatus 100 may trim the clue sequence and the clue sequence so as to have a predetermined length (S129).

The concrete construction step according to the preferred embodiment of the present invention will now be described in more detail with reference to FIG.

8 is a flowchart showing the concrete construction step shown in Fig. 6 in more detail.

Referring to FIG. 8, the genome map construction apparatus 100 can perform a K-mer analysis based on a single sequence to obtain a K-mer frequency table (S131).

Then, the genome map construction apparatus 100 can correct an error of the clue line using a K-mer frequency table (S133).

In addition, the genome map construction apparatus 100 constructs a contig based on a single-sequence error-corrected using a K-mer frequency table and a DeBruijn graph (S135).

The scaffold assembly step according to a preferred embodiment of the present invention will now be described in more detail with reference to FIG.

FIG. 9 is a flowchart showing the scaffold assembly step shown in FIG. 6 in more detail.

Referring to FIG. 9, the genome map construction apparatus 100 may measure an actual insert size by aligning a contiguous sequence to a contig (S141).

Then, the genome map construction apparatus 100 can assemble a scaffold based on the contig and the gap sequence using the actual insert size (S143).

In addition, the genome map construction apparatus 100 can offset a gap on a scaffold (S145).

The super-scaffold assembly step according to a preferred embodiment of the present invention will now be described in more detail with reference to FIG.

FIG. 10 is a flowchart showing the super-scaffold assembly step shown in FIG. 6 in more detail.

Referring to FIG. 10, the genome map construction apparatus 100 may select a restriction enzyme (S151).

The genome map constructing apparatus 100 compares the restriction enzyme patterns selected on the basis of a single molecule map generated by optical mapping with a scaffold, A super-scaffold can be assembled (S153).

The present invention can also be embodied as computer-readable codes on a computer-readable recording medium. A computer-readable recording medium includes all kinds of recording apparatuses in which data that can be read by a computer is stored. Examples of the computer-readable recording medium include a ROM, a RAM, a CD-ROM, a magnetic tape, a floppy disk, an optical data storage device, and a carrier wave Transmission). In addition, the computer-readable recording medium may be distributed to computer devices connected to a wired / wireless communication network, and a computer-readable code may be stored and executed in a distributed manner.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, It will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the scope of the appended claims.

100: reference standard genome map building device, 110: sequence production department,
120: a sequence filtering unit, 130: a contig assembly unit,
140: scaffold assembly, 150: super-scaffold assembly,
160: chromosome sequence assembly, 170: sequence substitution

Claims (17)

A sequence generator for generating a sequence having a smaller insert size and a larger insert size than the predetermined value using next generation sequencing (NGS);
A sequence filtering unit for filtering a predetermined read in the clue sequence and the clue sequence;
A contig assembly for assembling a contig based on the single sequence using a De Bruijn graph;
A scaffold assembly for assembling a scaffold based on the contig and the gap sequence;
A super-scaffold was assembled through comparison of a single molecule map and a restriction enzyme based on the scaffold, and the PacBio long sequence decode method and the Illumina TSLR synthesized long A super-scaffold assembly for inserting a gap on the super-scaffold using a sequence decoding method and verifying an erroneous region of the super-scaffold; And
A chromosome sequence assembling unit for assembling a chromosome sequence based on the position and strand information of the super-scaffold;
Gt; genomic &lt; / RTI &gt; The method of claim 1,
The congestion-
A K-mer frequency table is obtained by performing a K-mer analysis based on the single sequence, an error of the clue string is corrected using the K-mer frequency table, A reference standard genome map construction including a common sequence for assembling the contig based on the error-corrected single sequence using the K-mer frequency table and the DeBruijn graph Device. The method of claim 1,
Wherein the sequence filtering unit comprises:
And a reader that filters an overlap between the clue line and the juxtaposition and filters a read including an adapter sequence in the clue line and the juxtaposition, quality score) is smaller than a preset value, filtering a read containing a junction adapter in the gapped sequence, and cutting the gapped sequence so that the gapped sequence has a predetermined length A reference standard genomic map building device containing a trimming common sequence. The method of claim 1,
The scaffold assembly includes:
Aligning the contiguous sequence with the contig to measure an actual insert size and using the actual fragment size to scaffold the contig and the contiguous sequence based on the contig ) And including a common sequence that fills a gap on the scaffold. The method of claim 1,
The super-scaffold assembly comprises:
The restriction enzyme is selected and the single molecule map generated by optical mapping and the restriction enzyme pattern selected on the basis of the scaffold A reference standard genomic map building device comprising a common sequence for assembling said super-scaffold through comparison. The method of claim 1,
The super-scaffold assembly comprises:
A reference standard genomic map building device comprising a common sequence that verifies the misassembly region of the super-scaffold using nanochannel-based genome mapping data. The method of claim 1,
The chromosomal sequence-
A reference standard genomic map including a common sequence for assembling the chromosome sequence based on the position and strand information of the super-scaffold aligned to the human genome map (GRCh38) Building device. The method of claim 1,
A reference standard genomic map building device comprising a common sequence further comprising a sequence substitution portion that replaces the chromosome sequence using whole genome re-sequencing data. A method of constructing a genome map of a reference standard genomic map building apparatus comprising a common sequence,
Producing a clue sequence having an insert size smaller than a preset value and a clone sequence having an insert size larger than the predetermined value using NGS (next generation sequencing);
Filtering a predetermined read in the clue sequence and the clue sequence;
Assembling a contig based on the single sequence using a de Bruijn graph;
Assembling a scaffold based on the contig and the gating sequence;
Assembling a super-scaffold by comparing a single molecule map with a restriction enzyme based on the scaffold;
Interposing a gap on the super-scaffold using a PacBio long sequence detoxification method and an Illumina TSLR synthetic long sequence detoxification method;
Verifying the misassembly region of the super-scaffold; And
Assembling a chromosome sequence based on the position and strand information of the super-scaffold;
&Lt; RTI ID = 0.0 &gt; genomic &lt; / RTI &gt; The method of claim 9,
The method of claim 1,
Performing a K-mer analysis based on the single sequence to obtain a K-mer frequency table;
Correcting an error of the clue line using the K-mer frequency table; And
Assembling the contig based on the error-corrected single sequence using the K-mer frequency table and the DeBruijn graph;
&Lt; RTI ID = 0.0 &gt; genomic &lt; / RTI &gt; The method of claim 9,
Wherein the read filtering step comprises:
Filtering the overlapped read from the clue sequence and the clue sequence;
Filtering a read containing an adapter sequence in the cue sequence and the cyan sequence;
Filtering a sequence having a quality score value smaller than a predetermined value in the clue sequence and the clue sequence;
Filtering a read containing a junction adapter in the jitter sequence; And
Trimming the clue sequence so that the clue sequence and the clue sequence have a predetermined length;
&Lt; RTI ID = 0.0 &gt; genomic &lt; / RTI &gt; The method of claim 9,
The scaffold assembly step may comprise:
Aligning the contiguous sequence to the contig to measure an actual insert size;
Assembling the scaffold based on the contig and the gap sequence using the actual insert size; And
Etching a gap on the scaffold;
&Lt; RTI ID = 0.0 &gt; genomic &lt; / RTI &gt; The method of claim 9,
The super-scaffold assembly includes:
Selecting the restriction enzyme; And
The super-scaffold may be identified through comparison of the single molecule map generated by optical mapping with the restriction enzyme pattern selected based on the scaffold. assembling a scaffold;
&Lt; RTI ID = 0.0 &gt; genomic &lt; / RTI &gt; The method of claim 9,
The super-scaffold verification step may comprise:
A method of constructing a reference standard genome map comprising a common sequence consisting of verifying the super-scaffold misassembly region using nanochannel-based genome mapping data. The method of claim 9,
The chromosome sequence assembly step comprises:
Including a common sequence consisting of assembling the chromosome sequence based on the position and strand information of the super-scaffold aligned to the human genome map GRCh38, How to build a genome map. The method of claim 9,
And replacing the chromosome sequence with whole genome re-sequencing data. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt; A computer program stored on a computer readable recording medium for execution on a computer of a method of constructing a reference standard genome map comprising the common sequence of any one of claims 9 to 16.

Images