KR20180068118A - Method for measuring library complexity for next generation sequencing - Google Patents

Abstract

Provided is a method for measuring the complexity of a library. According to this, the complexity of the library can be measured in a simple and accurate method during the production of a nucleic acid sequence analysis library in real time, during nucleic acid sequence analysis after library preparation, or after nucleic acid sequence analysis. The method includes a step of fragmenting nucleic acid extracted from a target sample, a step of producing a first library and a second library, a step of calculating a first threshold cycle (Ct) value and a second Ct value, and a step of measuring the complexity of the first library.

Description

METHOD FOR MEASURING LIBRARY COMPLEXITY FOR NEXT GENERATION OF NUCLEIC ACID SEQUENCES [

A method for measuring the complexity of a library for next-generation nucleic acid sequence analysis, and an apparatus using the same.

Next generation sequencing (NGS) is widely used for research and diagnostic purposes. Although NGS differs depending on the kind of equipment, it can roughly be divided into three stages: sample collection, library production, and nucleic acid sequence analysis. After preparation of the library, quality control (QC) is performed prior to the nucleic acid sequence analysis, and whether the nucleic acid sequence analysis is carried out with the prepared library is determined. In order to confirm whether the nucleic acid sequence analysis proceeds smoothly in real time even during the nucleic acid sequence analysis, QC is performed by the method provided by the library manufacturer. After the nucleic acid sequence analysis, the generated nucleic acid sequence data (i.e., read) is analyzed to measure the data generation quality substantially before the analysis such as mutation, gene mutation, gene expression, and the like. Thus, one of the factors that determines the quality and determines the quality of each next-generation nucleic acid sequence analysis is the complexity of the library. The complexity of the library can be measured during the nucleic acid sequence analysis or after the completion of the nucleic acid sequence analysis after the library is prepared and the nucleic acid sequence analysis can be performed and the nucleic acid sequence data generated can be judged have.

It is known to perform two minimum-range nucleic acid sequence analyzes before performing bulk nucleic acid sequence analysis and to predict the complexity of the library statistically using the data obtained therefrom (U.S. Publication No. US20140324359 A1). However, in order to measure the complexity of the library, this method must first perform nucleic acid sequence analysis twice for the library, and can not directly and real-time measure the complexity of the library.

Therefore, there is a need for a method that can measure the complexity of a library in real time or under nucleic acid sequence analysis during the course of nucleic acid sequence analysis in a simple and accurate manner.

A method for measuring the complexity of a library for nucleic acid sequence analysis is provided.

According to one aspect, there is provided a method for detecting a nucleic acid fragment, comprising: fragmenting a nucleic acid extracted from a target sample;

Ligation of the first polynucleotide to one or more ends of the fragmented nucleic acid to prepare a first library for nucleic acid sequence analysis;

Preparing a second library by spiking a second polynucleotide in the first library;

Performing a first polymerase chain reaction (PCR) using the second library and a first primer set complementary to the first polynucleotide to produce a first threshold (Ct) value;

Performing a second PCR using a second primer set complementary to said second library and said second polynucleotide to yield a second Ct value; And

And calculating the ratio of the second Ct value to the first Ct value to measure the complexity of the first library. The present invention also provides a method for measuring the complexity of a library for nucleic acid sequence analysis.

The nucleic acid sequence analysis of the "library for nucleic acid sequence analysis" may be next generation sequencing (NGS). The term " next generation sequencing " (NGS) can be used interchangeably with the term "massive parallel sequencing" or the term "second- generation sequencing. NGS refers to a technique of fragmenting a full-length genome in a chip-based and PCR-based paired end format and performing ultra-high-speed nucleic acid sequence analysis based on hybridization of the fragment. NGS is a technique for simultaneous nucleic acid sequencing of a large number of fragments of nucleic acid, and can perform NGS-based targeted sequencing or panel sequencing. NGS can be obtained from, for example, the 454 platform (Roche), GS FLX Titanium, Illumina MiSeq, Illumina HiSeq, Illumina Genome Analyzer, Solexa platform, SOLiD System (Applied Biosystems), Ion Proton (Life Technologies), Complete Genomics, Helicos Biosciences Heliscope, Pacific Biosciences single-molecule real-time (SMRT) technology, or a combination thereof.

The term "library" refers to a collection of nucleic acid fragments. The library may be, for example, a genomic library, a complementary DNA library, or a randomized mutant library.

The term "library complexity" refers to the number of unique fragments present in the library. The complexity may be affected by the amount of nucleic acid as a starting material, the amount of nucleic acid lost during the library preparation, the amount of nucleic acid amplified through PCR, and the like. The complexity of the library can be expressed at a relative level.

The method includes fragmenting the nucleic acid extracted from the target sample.

The target sample may be derived from an individual or a cell. The subject may be a mammal including humans, cows, horses, pigs, sheep, goats, dogs, cats, and rodents. The cell may be a cell or cell derived from an individual. The target sample may be a biological sample. The biological sample may be obtained from, for example, blood, plasma, serum, urine, saliva, mucous secretion, sputum, feces, tears, or a combination thereof. The biological sample may be a sample of eukaryotic cells, prokaryotic cells, viruses, bacteriophages, etc. derived from various species.

The nucleic acid may be a genome or a fragment thereof. The term "genome" is a generic term for chromosomes, chromosomes, or whole genes. The dielectrics or fragments thereof may be isolated DNA, for example, a cell-free DNA (cf DNA). The method of extracting or separating the nucleic acid from the target sample can be carried out by a method known to a person skilled in the art.

The method of extracting nucleic acid from the target sample can be carried out by a method known to a person skilled in the art.

The fragmentation may be a physical, chemical or enzymatic cleavage of the dielectric. For example, the fragmentation is to digest the genome with a restriction enzyme.

The method may further comprise the step of selecting the size of the fragmented nucleic acid. The step of selecting the size may be performed by electrophoresis, centrifugation, chromatography, or a combination thereof. Wherein the length of the fragmented nucleic acid is from about 10 bp to about 2000 bp, from about 20 bp to about 1500 bp, from about 50 bp to about 1000 bp, from about 100 bp to about 800 bp, from about 150 bp to about 600 bp, Or from about 300 bp to about 600 bp.

The method comprises ligation of a first polynucleotide to one or more ends of the fragmented nucleic acid to produce a first library for nucleic acid sequence analysis.

The step of preparing the first library may further comprise end-repair of the fragmented nucleic acid and 3'-adenosine tailing (3'-A tailing).

The first polynucleotide may be an adapter. The adapter may be a polynucleotide comprising a primer sequence for enriching the target nucleic acid in NGS. The adapter may be a polynucleotide known to the ordinarily skilled artisan. The adapter may comprise a universal sequence for nucleic acid sequence analysis. For example, it is an adapter included in a library preparation kit for nucleic acid sequencing.

Ligation refers to the binding of ends between nucleic acid fragments. The ligation can be performed using DNA ligase.

The first library may be a library prepared for nucleic acid sequence analysis.

The method comprises the step of spiking a second polynucleotide in a first library to prepare a second library.

The spiking may be by mixing a first library with a small amount of a second polynucleotide.

Wherein the second polynucleotide comprises a first region in which at least two consecutive nucleotides comprise the same nucleic acid sequence as the target nucleic acid sequence and a second region in which at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence And a second region comprising a different nucleic acid sequence.

The target nucleic acid sequence may comprise a genetic variation used in companion diagnostics (CDx).

Wherein the length of the second polynucleotide is from about 20 nt to about 500 nt, from about 30 nt to about 450 nt, from about 40 nt to about 400 nt, from about 50 nt to about 350 nt, From about 60 nt to about 300 nt, from about 70 nt to about 250 nt, from about 80 nt to about 200 nt, from about 90 nt to about 190 nt, from about 100 nt to about 180 nt, from about 110 nt to about 170 nt, To about 160 nt, from about 130 nt to about 150 nt, or about 150 nt.

The first region may comprise a nucleic acid sequence having two or more consecutive nucleotides identical to the target nucleic acid sequence. The first region comprises at least about 10 nucleotides (hereinafter referred to as 'nt') to about 490 nt, about 20 nt to about 440 nt, about 30 nt to about 390 nt, about 40 nt to about 340 nt, From about 60 nt to about 240 nt, from about 70 nt to about 150 nt, from about 80 nt to about 180 nt, from about 90 nt to about 170 nt, from about 100 nt to about 160 nt, from about 110 nt to about 150 nt, nt, from about 120 nt to about 150 nt, from about 130 nt to about 150 nt, from about 140 nt to about 150 nt, or about 142 nt.

Wherein the second region is located at both ends of the first region, each second region comprises a sequence that differs from the 5 'end of the target nucleic acid sequence and a sequence that differs from the 2 or more consecutive nucleotides from the 3' end . Wherein the length of the second region is from about 2 nt to about 15 nt, from about 2 nt to about 13 nt, from about 2 nt to about 10 nt, from about 2 nt to about 8 nt, from about 2 nt to about 6 nt, To about 4 nt, about 3 nt, or about 4 nt.

The second polynucleotide may comprise, for example, a second region, a first region, and a second region in the 3 'direction from its 5'-end.

The second polynucleotide may further comprise at least two consecutive nucleotides identical to the first polynucleotide at one or more ends thereof. The second polynucleotide may comprise, for example, two or more consecutive nucleotides identical to the first polynucleotide in the 3 'direction from its 5'-end, a second region, a first region, a second region, and a second polynucleotide identical to the first polynucleotide Or more consecutive nucleotides.

The method comprises the step of performing a first polymerase chain reaction (PCR) using a second library and a first primer set complementary to the first polynucleotide to yield a first Ct (threshold cycle) value do.

The PCR may be performed by, for example, quantitative PCR (qPCR), digital PCR (dPCR), hot start PCR, touchdown PCR, nested PCR, booster ) PCR, multiplex PCR, real-time PCR, differential display PCR, D-PCR, rapid amplification of cDNA ends (RACE), inverse PCR polymerase chain reaction (IPCR), vectorette PCR, and thermal asymmetric interlaced PCR (TAIL-PCR).

The first set of primers may be a polynucleotide complementary to the first polynucleotide. The first primer set may be a universal primer set.

The second primer set may be a polynucleotide complementary to the second polynucleotide. The second set of primers may be a polynucleotide complementary to the second polynucleotide but not complementary to the first polynucleotide.

In the PCR reaction, a probe complementary to the target nucleic acid may be further used for detection of the amplified nucleic acid. The probe may have one or more ends thereof labeled with a fluorescent material, a quantum dot, FRET, or the like.

The Ct (threshold cycle) value is the number of cycles that represent the first amplified signal exceeding the background signal in the PCR. In the case of quantitative PCR, it refers to the number of cycles representing the threshold of the fluorescence signal. Since the Ct value is inversely correlated with the number of copies of the original nucleic acid as a starting material in the amplification reaction, the Ct value can be used to calculate the number of copies of the nucleic acid in the target sample.

The first Ct value may represent the total read of the second library. The term "read" refers to nucleic acid sequence information of a nucleic acid fragment obtained by nucleic acid sequence analysis.

The method comprises performing a second PCR using a second library and a second primer set complementary to the second polynucleotide to yield a second Ct value.

The second Ct value may represent the lead of the second polynucleotide in the second library.

The first PCR, the second PCR, or a combination thereof may be performed by quantitative PCR (qPCR) or digital PCR (dPCR).

The first PCR and the second PCR may be performed simultaneously or sequentially.

The method includes measuring the complexity of the first library by calculating a ratio of a second Ct value to a first Ct value.

The lower the ratio of the second Ct value to the first Ct value, the higher the complexity of the first library. The higher the ratio of the second Ct value to the first Ct value, the lower the complexity of the first library.

Other aspects include fragmenting the nucleic acid extracted from the target sample;

Ligation of the first polynucleotide to one or more ends of the fragmented nucleic acid to prepare a first library for nucleic acid sequence analysis;

Adding a second polynucleotide to said first library to prepare a second library,

Wherein the second polynucleotide comprises a first region in which at least two consecutive nucleotides comprise the same nucleic acid sequence as the target nucleic acid sequence and a second region in which at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence A second region comprising a different nucleic acid sequence;

Performing nucleic acid sequencing using the second library and the first primer complementary to the first polynucleotide to obtain a total read of the second library;

Selecting leads of the second polynucleotide from the obtained total leads to obtain leads of the second polynucleotide; And

And calculating the ratio of the number of leads of the second polynucleotide to the total number of leads to measure the complexity of the first library.

A method for measuring the complexity of a library for nucleic acid sequence analysis is provided.

The complexity of the target sample, nucleic acid, nucleic acid sequence analysis, fragmentation, first polynucleotide, ligation, addition, second polynucleotide, PCR, Ct value, library, and library is as described above.

The method includes fragmenting the nucleic acid extracted from the target sample.

The method comprises ligation of a first polynucleotide to one or more ends of the fragmented nucleic acid to produce a first library for nucleic acid sequence analysis.

The method comprises the step of preparing a second library by adding a second polynucleotide to the first library.

The method comprises performing a nucleic acid sequence analysis using a second library and a first primer complementary to the first polynucleotide to obtain the total lid of the second library.

The first primer may be one primer or a set of primers.

The method comprises selecting a lead of a second polynucleotide from the resulting total lead to obtain a lead of a second polynucleotide.

The method includes measuring the complexity of the first library by calculating the ratio of the number of leads of the second polynucleotide to the total number of leads.

The lower the ratio of the number of leads of the second polynucleotide to the total number of leads, the higher the complexity of the first library. The higher the ratio of the number of leads of the second polynucleotide to the total number of leads, the lower the complexity of the first library.

The method can monitor the complexity of the first library in real time during nucleic acid sequencing or after nucleic acid sequence analysis.

According to a method for measuring the complexity of a library according to one aspect or another aspect, it is possible to provide a library for nucleic acid sequence analysis in real time, during library nucleic acid sequence analysis, or after completion of nucleic acid sequence analysis, Can be measured.

FIG. 1A is a schematic diagram showing the principle of a method for measuring the complexity of a library for NGS according to an aspect, and FIG. 1B is a schematic diagram showing a ratio of an artificial sequence leader among all the leads when the complexity of a library is high or low ■: adapter, lead in □: artificial sequence).
2 is a graph showing Ct values in quantitative PCR according to library complexity.
3 is a graph showing the ratio of an artificial sequence leader among total leads according to library complexity.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  1. Next generation Hexane  Measuring library complexity for sequencing

1. Preparation of nucleic acid fragments containing artificial sequences

For next generation sequencing (NGS), the genes KRAS, IDH1, BRAC1, ALK, and ERBB2, which contain mutations known to be used in companion diagnostics (CDx) as target sequences, Respectively. A reference sequence of about 150 bp was selected based on the selected site.

The selected reference sequence and the nucleic acid sequence are the same, but 4 bp from the 5 'end and 4 bp from the 3' end are substituted with an artificial sequence, and nucleic acid fragments including the adapter nucleic acid sequence of the library , "An artificial sequence-containing nucleic acid fragment") was prepared by a gene synthesis method.

The nucleic acid sequences other than the adapter nucleic acid sequences in the nucleic acid sequences of the selected genes, reference sequences, and artificial sequence-containing nucleic acid fragments are shown in Table 1 below.

number Location of Reference Dielectric Reference sequence An artificial sequence-containing nucleic acid fragment One KRAS: Chromosome number 12:
Exon number: 3:
Chromosome 12: 25380168-25380346 5 ' -AGGAATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACACTTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGATGAC-3 '(SEQ ID NO: 1) 5'- CTTC ATCCTGAGAAGGGAGAAACACAGTCTGGATTATTACAGTGCACCTTTTACTTCAAAAAAGGTGTTATATACAACTCAACAACAAAAAATTCAATTTAAAAATGGGCAAAGGACTTGAAAAGACATTGTTCCTGCTCCAAAGA GAAG -3 '(SEQ ID NO: 2) 2 IDH1: chromosome number 12
Exon number: 4:
Chromosome 2: 209113048-209113359 5'-AGATAATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTCTTTA-3 '(SEQ ID NO: 3) 5'- CTTC AATGGCTTCTCTGAAGACCGTGCCACCCAGAATATTTCGTATGGTGCCATTTGGTGATTTCCACATTTGTTTCAACTTGAACTCCTCAACCCTCTTCTCATCAGGAGTGATAGTGGCACATTTGACGCCAACATTATGCTTC GAAG -3 '(SEQ ID NO: 4) 3 BRAC1: chromosome number 17
Exon number: 15:
Chromosome 17: 41222945-41223255 5'-TCAATTCTGGCTTCTCCCTGCTCACACTTTCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGGTATG-3 '(SEQ ID NO: 5) CTTC TTCTGGCTTCTCCTTCCATTGCATTATACCCAGCAGTATCAGTAGTATGAGCAGCAGCTGGACTCTGGGCAGATTCTGCAACTTTCAACTTTCAATTGGGGAACTTTCAATGCAGAGGTTGAAGATGG GAAG -3 '(SEQ ID NO: 6) 4 ALK: chromosome number 2
Exon number: 20:
Chromosome 2: 29446208-29446394 5'-GGTCACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCTGTGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGGTACA-3 '(SEQ ID NO: 7) 5'- CTTC ACTGATGGAGGAGGTCTTGCCAGCAAAGCAGTAGTTGGGGTTGTAGTCGGTCTGATGGTCGAGGTGCGGAGCTTGCTCAGCTTGTACTCAGGGCTCTGCAGCTCCATCTGCATGGCTTGCAGCTCCTGGTGCTTCCGGCGG GAAG -3 '(SEQ ID NO: 8) 5 ERBB2: chromosome number 17
Exon number: 6:
Chromosome 17: 37864574-37864787 5'-CAGGGCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGTCACA-3 '(SEQ ID NO: 9) 5'- CTTC GCTACGTGCTCATCGCTCACAACCAAGTGAGGCAGGTCCCACTGCAGAGGCTGCGGATTGTGCGAGGCACCCAGCTCTTTGAGGACAACTATGCCCTGGCCGTGCTAGACAATGGAGACCCGCTGAACAATACCACCCCTGT GAAG -3 '(SEQ ID NO: 10)

In Table 1, the artificial sequences of the artificial sequence-containing nucleic acid fragments are shown in bold letters and underlined.

2. NGS And the addition of an artificial sequence-containing nucleic acid fragment

To prepare a library for NGS, a HapMap mixed sample in which 10 kinds of samples of human genomic samples HapMap NA07014, NA10840, NA18595, NA18957, NA18488, NA18511, NA18867, NA18924, NA19108 and NA19114 were mixed at the same molar ratio 50 ng or 200 ng were prepared. Fragments of the human genome, end-repair, 3'-adenosine tailing, and adapter ligation were sequentially performed using Kapa hyper prep kits for illumine (Kapa Biosystems) according to the method provided by the manufacturer Respectively.

50 atmoles of each of the artificial sequence-containing nucleic acid fragments prepared in Example 1.1 were spiked to the libraries to which the adapters were ligated. The library to which the artificial sequence-containing nucleic acid fragment was added was subjected to a pre-capture polymerase chain reaction (PCR) followed by target enrichment. The target enriched library was then subjected to post-capture PCR.

Real time PCR was performed using quantitative PCR (qPCR) kit for KAPA Illumina library concentration measurement, and Ct (cycle threshold) value was calculated from real time qPCR results. Here, the calculated Ct value represents the total number of leads.

On the other hand, in order to measure the number of leads of artificial sequence-containing nucleic acid fragments contained in the library, real-time qPCR was performed using the primer sets and probes shown in Table 2 below. Here, the calculated Ct value represents the number of leads derived from an artificial sequence-containing nucleic acid fragment.

primer Nucleic acid sequence IDH1_Artificial_forward 5'-CCACCGAGATCTACACTCTTTC-3 '(SEQ ID NO: 11) IDH1_ Artificial probe 5'-ACGCTCTTCCGATCTCTTCAATGGC-3 '(SEQ ID NO: 12) IDH1_an artificial_orverse 5'-AAATCACCAAATGGCACCATAC-3 '(SEQ ID NO: 13) BRCA1_Artificial_forward 5'-GCGACCACCGAGATCTACA-3 '(SEQ ID NO: 14) BRCA1_ Artificial probes 5'-ACGACGCTCTTCCGATCTCTTCTTCT-3 '(SEQ ID NO: 15) BRCA1_ Artificial _ reverse direction 5'-GAAAGTGTGAGCAGGGAGAAG-3 '(SEQ ID NO: 16) ERBB2_ artificial_forward 5'-CCACCGAGATCTACACTCTTTC-3 '(SEQ ID NO: 17) ERBB2_ Artificial probes 5'-ATCTCTTCGCTACGTGCTCATCGC-3 '(SEQ ID NO: 18) ERBB2_ artificial _ reverse direction 5'-CCTGCCTCACTTGGTTGT-3 '(SEQ ID NO: 19)

In order to confirm whether or not the ratio of an artificial sequence lead among all leads changes according to the complexity of the library, a library in which the library complexity is changed in the course of manufacturing the library was prepared. Utilizing the library preparation method provided by the manufacturer of Kapa hyper prep kits for illumine (Kapa Biosystems), the ligation product was purified once in the adapter ligation step, using a 30 [mu] M adapter, The prepared library was used as a negative control. In order to artificially reduce the complexity of the prepared library, complexity is achieved by using two rounds of purification of the ligation product in the ligation step, using an adapter of 3 [mu] M (i.e., 1/10 dilution) A reduced library was prepared.

A negative control library and a library artificially reduced in complexity were subjected to real-time qPCR in the same manner as above, and the Ct value was calculated. The calculated Ct value according to the complexity of the library is shown in Fig. As shown in Figure 2, as the complexity of the library decreased, the Ct value of the artificial sequence containing nucleic acid fragments decreased. In contrast, the Ct value of the total lead did not change significantly, despite the change in the complexity of the library.

The nucleic acid sequence of the prepared library was analyzed and the unprocessed lead data analyzed was used to calculate the total number of leads and the ratio of anthraquent sequence leads among the total leads. Fig. 3 shows the number of total leads calculated and the ratio of the artificial sequence leads among the total leads according to the change in complexity. In Figure 3, "50 ng" means that the amount of human genomic DNA HapMap mixed sample is 50 ng when the library is prepared. As shown in FIG. 3, the number of total leads and the number of artificial sequence leads do not correlate with library complexity, but it was confirmed that the ratio of artificial sequence leads among all leads was inversely correlated with library complexity.

<110> SAMSUNG ELECTRONICS CO., LTD          Samsung Life Public Welfare Foundation <120> Method for measuring library complexity for next generation          sequencing <130> PN115614-KR <160> 19 <170> Kopatentin 2.0 <210> 1 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> KRAS reference sequence <400> 1 aggaatcctg agaagggaga aacacagtct ggattattac agtgcacctt ttacttcaaa 60 aaaggtgtta tatacaactc aacaacaaaa aattaattt aaaaatgggc aaaggacttg 120 aaaagacatt gttcctgctc caaagatgac 150 <210> 2 <211> 150 <212> DNA <213> Artificial Sequence <220> Nucleic acid fragment containing artificial sequence <400> 2 cttcatcctg agaagggaga aacacagtct ggattattac agtgcacctt ttacttcaaa 60 aaaggtgtta tatacaactc aacaacaaaa aattaattt aaaaatgggc aaaggacttg 120 aaaagacatt gttcctgctc caaagagaag 150 <210> 3 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> IDH1 reference sequence <400> 3 agataatggc ttctctgaag accgtgccac ccagaatatt tcgtatggtg ccatttggtg 60 atttccacat ttgtttcaac ttgaactcct caaccctctt ctcatcagga gtgatagtgg 120 cacatttgac gccaacatta tgcttcttta 150 <210> 4 <211> 150 <212> DNA <213> Artificial Sequence <220> Nucleic acid fragment containing artificial sequence <400> 4 cttcaatggc ttctctgaag accgtgccac ccagaatatt tcgtatggtg ccatttggtg 60 atttccacat ttgtttcaac ttgaactcct caaccctctt ctcatcagga gtgatagtgg 120 cacatttgac gccaacatta tgcttcgaag 150 <210> 5 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> BRAC1 reference sequence <400> 5 tcaattctgg cttctccctg ctcacacttt cttccattgc attataccca gcagtatcag 60 tagtatgagc agcagctgga ctctgggcag attctgcaac tttcaacttt caattgggga 120 actttcaatg cagaggttga agatggtatg 150 <210> 6 <211> 150 <212> DNA <213> Artificial Sequence <220> Nucleic acid fragment containing artificial sequence <400> 6 cttcttctgg cttctccctg ctcacacttt cttccattgc attataccca gcagtatcag 60 tagtatgagc agcagctgga ctctgggcag attctgcaac tttcaacttt caattgggga 120 actttcaatg cagaggttga agatgggaag 150 <210> 7 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> ALK reference sequence <400> 7 ggtcactgat ggaggaggtc ttgccagcaa agcagtagtt ggggttgtag tcggtcatga 60 tggtcgaggt gcggagcttg ctcagcttgt actcagggct ctgcagctcc atctgcatgg 120 cttgcagctc ctggtgcttc cggcggtaca 150 <210> 8 <211> 150 <212> DNA <213> Artificial Sequence <220> Nucleic acid fragment containing artificial sequence <400> 8 cttcactgat ggaggaggtc ttgccagcaa agcagtagtt ggggttgtag tcggtcatga 60 tggtcgaggt gcggagcttg ctcagcttgt actcagggct ctgcagctcc atctgcatgg 120 cttgcagctc ctggtgcttc cggcgggaag 150 <210> 9 <211> 150 <212> DNA <213> Artificial Sequence <220> <223> ERBB2 reference sequence <400> 9 cagggctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg 60 attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga 120 gacccgctga acaataccac ccctgtcaca 150 <210> 10 <211> 150 <212> DNA <213> Artificial Sequence <220> Nucleic acid fragment containing artificial sequence <400> 10 cttcgctacg tgctcatcgc tcacaaccaa gtgaggcagg tcccactgca gaggctgcgg 60 attgtgcgag gcacccagct ctttgaggac aactatgccc tggccgtgct agacaatgga 120 gacccgctga acaataccac ccctgtgaag 150 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Forward primer <400> 11 ccaccgagat ctacactctt tc 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Probe <400> 12 acgctcttcc gatctcttca atggc 25 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> IDH1_art_Reverse primer <400> 13 aaatcaccaa atggcaccat ac 22 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Forward primer <400> 14 gcgaccaccg agatctaca 19 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Probe <400> 15 acgacgctct tccgatctct tcttct 26 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BRCA1_art_Reverse primer <400> 16 gaaagtgtga gcagggagaa g 21 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Forward primer <400> 17 ccaccgagat ctacactctt tc 22 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Probe <400> 18 atctcttcgc tacgtgctca tcgc 24 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> ERBB2_art_Reverse primer <400> 19 cctgcctcac ttggttgt 18

Claims (19)

Fragmenting the nucleic acid extracted from the target sample;
Ligation of the first polynucleotide to one or more ends of the fragmented nucleic acid to prepare a first library for nucleic acid sequence analysis;
Preparing a second library by spiking a second polynucleotide in the first library,
Wherein the second polynucleotide comprises a first region in which at least two consecutive nucleotides comprise the same nucleic acid sequence as the target nucleic acid sequence and a second region in which at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence A second region comprising a different nucleic acid sequence;
Performing a first polymerase chain reaction (PCR) using the second library and a first primer set complementary to the first polynucleotide to produce a first threshold (Ct) value;
Performing a second PCR using a second primer set complementary to said second library and said second polynucleotide to yield a second Ct value; And
Calculating a ratio of a second Ct value to the first Ct value to measure complexity of the first library;
A method for measuring the complexity of a library for nucleic acid sequencing. The method according to claim 1, wherein the nucleic acid sequence analysis is next generation sequencing (NGS). The method according to claim 1, wherein the target sample is derived from an individual or a cell. The method according to claim 1, wherein the nucleic acid is a genome or a fragment thereof. The method of claim 1, wherein the first polynucleotide is an adapter. The method of claim 1, wherein the target nucleic acid sequence comprises a genetic variation used in companion diagnostics (CDx). The method of claim 1, wherein the length of the second polynucleotide is 20 nucleotides to 500 nucleotides. 2. The method of claim 1, wherein the second region is located at both ends of the first region, each second region comprises a sequence that differs from the 5 'end of the target nucleic acid sequence by 2 or more consecutive nucleotides and 2 or more consecutive nucleotides from the 3 &Lt; RTI ID = 0.0 &gt; sequence. &Lt; / RTI &gt; 2. The method of claim 1, wherein the length of the second region is from 2 nucleotides to 15 nucleotides. The method of claim 1, wherein the second polynucleotide further comprises at least two consecutive nucleotides identical to the first polynucleotide at one or more ends thereof. The method of claim 1, wherein the first PCR, the second PCR, or a combination thereof is performed with quantitative PCR (qPCR) or digital PCR (dPCR). The method according to claim 1, wherein the first PCR and the second PCR are performed simultaneously or sequentially. The method of claim 1, wherein the first Ct value represents a total read of a second library. 3. The method of claim 1, wherein the second Ct value represents a second polynucleotide of the second library. The method of claim 1, wherein as the ratio of the second Ct value to the first Ct value is lower, the complexity of the first library is higher, and the higher the ratio of the second Ct value to the first Ct value, Lt; / RTI &gt; is low. Fragmenting the nucleic acid extracted from the target sample;
Ligation of the first polynucleotide to one or more ends of the fragmented nucleic acid to prepare a first library for nucleic acid sequence analysis;
Adding a second polynucleotide to said first library to prepare a second library,
Wherein the second polynucleotide comprises a first region in which at least two consecutive nucleotides comprise the same nucleic acid sequence as the target nucleic acid sequence and a second region in which at least two consecutive nucleotides from one or more ends of the target nucleic acid sequence A second region comprising a different nucleic acid sequence;
Performing nucleic acid sequencing using the second library and the first primer complementary to the first polynucleotide to obtain a total read of the second library;
Selecting leads of the second polynucleotide from the obtained total leads to obtain leads of the second polynucleotide; And
And calculating the ratio of the number of leads of the second polynucleotide to the total number of leads to measure the complexity of the first library.
A method for measuring the complexity of a library for nucleic acid sequencing. 17. The method of claim 16, wherein the nucleic acid sequence analysis is next generation nucleic acid sequence analysis (NGS). 17. The method of claim 16, wherein the lower the ratio of the number of leads of the second polynucleotide to the total number of leads is, the higher the complexity of the first library, and the more the number of leads of the second polynucleotide relative to the total number of leads And the higher the ratio, the lower the complexity of the first library. 17. The method of claim 16, wherein the method is to monitor the complexity of the first library in real time during nucleic acid sequencing or after nucleic acid sequence analysis.

Images