KR20180063409A - PNA probe for pathogenic Escherichia coli and its use in ballast water - Google Patents

Abstract

The present invention relates to a pentose nucleic acid (PNA) probe specific to shiga toxin 2 subunit B (stx2B) which is a toxin gene in Escherichia coli. The present invention further relates to a method for detecting pathogenic Escherichia coli in ballast water using the same. To this end, the PNA probe includes at least one of base sequences represented by sequence number 2, 3, and 4.

Description

PNA probes for the detection of pathogenic Escherichia coli in ship equilibrium and their use {PNA probe for pathogenic Escherichia coli and its use in ballast water}

The present invention relates to a PNA probe for the detection of pathogenic Escherichia coli present in ballast water and its use, and more particularly, to a method for detecting pathogenic Escherichia coli by using a PNA probe specific for the toxic gene stx2B (shiga toxin 2 subunit B) .

The International Maritime Organization (IMO) has established a ship ballast water management agreement to reduce the movement of marine equilibrium water, which is the ship ballast water problem, which has been pointed out as the main cause of marine ecosystem disturbance. It is expected to come into effect 12 months after 30 countries have exceeded 35% of the total fleet capacity of the ratifying countries, and the Convention on Ballast Water Management will be in effect on September 8, 2017. According to IMO's D2 standard, E. coli in the effluent that has passed through the ballast water treatment system should be detected at less than 250 cfu per 100 ml.

On the other hand, PNA (peptide nucleic acid) is an organic synthesized to complement the biochemical instability of DNA, and is artificially synthesized without being found in nature. PNA is highly stable against nucleic acid degrading enzymes and is not degraded by existing restriction enzymes. It has high chemical stability to heat and acid and is easy to store and does not easily decompose. The difference in the binding force between the PNA probes reacted with the PCR products generated after the polymerase chain reaction (PCR) can be divided into the melting temperature (Tm) and the melting temperature (Tm). The probe having the desired Tm value can be designed You can adjust the length of the PNA probe. Because PNA has better binding power than DNA and has a higher Tm value, it can be designed shorter than DNA.

Accordingly, the present invention has developed a pathogenic Escherichia coli PNA probe having excellent detection sensitivity and specificity and high stability in preparation for the coming into force of the ship ballast water management convention.

The main object of the present invention is to provide a PNA probe specific to the toxic gene stx2B (shiga toxin 2 subunit B) of pathogenic Escherichia coli and a method for detecting pathogenic Escherichia coli in ship equilibrium using the same.

In order to achieve the above object, the present invention provides a PNA probe for detecting pathogenic E. coli strains comprising a base sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4. This sequence is most effective in detecting E. coli contained in ship equilibrium. The present inventors selected the O157: H7 serotype from E. coli to detect E. coli contained in the equilibrium water of the ship. The O157: H7 serotype is more virulent than other E. coli strains and is known to produce stx2B (shiga toxin 2 subunit B). By designing a PNA probe complementary to the stx2B nucleotide sequence, a method for detecting stx2B of the O157: H7 serotype by specifically amplifying only stx2B is provided. In order to prevent marine pollution, it is necessary to confirm whether there is E. coli highly virulent or not and its virulence factor. In addition, E. coli must be continuously detected in the equilibrium water of the ship, and the PNA is industrially useful because of its excellent chemical, physical and biological stability. Therefore, the present invention will be usefully used in industry and research derived from Convention on Ship Ballast Water Management.

A PNA probe for detecting equine pathogenic Escherichia coli comprising the nucleotide sequence of SEQ ID NO: 4 is more preferable. As a result of an experiment to be described later, SEQ ID NO: 4 was most excellent among SEQ ID NOS: 2 to 4.

In one embodiment of the invention, the E. coli Chapter hemorrhagic Escherichia coli (EHEC, Enterohaemorrhagic E. coli), E. coli enterotoxins small (ETEC, Enterotoxigenic E. coli), jangchim grain growth of E. coli (EIEC, Enteroinvasive E. coli), Minister May be selected from the group consisting of EAEC (Enteroaggregative E. coli ) and Pathogenic E. coli (EPEC). Pathogenic Escherichia coli refers to Escherichia coli which has acquired virulence. Depending on the onset characteristics and the type of toxin, EHEC, ETEC. EIEC, EAEC, and EPEC. Enterohemorrhagic Escherichia coli (EHEC) causes disease in livestock, plants, and humans, and mutation in genotypes leads to greater virulence. Accordingly, it is preferable to select intestinal hemorrhagic Escherichia coli (EHEC) having high virulence. In addition, since highly infectious E. coli is vulnerable to marine equilibrium water management, O157: H7 serotypes highly infectious are more preferable.

In one embodiment of the present invention, the probe may further comprise a reporter molecule and a quencher molecule. The reporter material and the minerals may be used to visualize the annealing of the PNA, and a fluorescence signal may be generated when there is a complementary DNA sequence. Wherein the reporter material is selected from the group consisting of FAM (6-carboxyfluorescein), Alexa Fluor, fluorescein, fluorescein chlorotriazinyl, HEX (2 ', 4', 5 ' Rhodamine green, rhodamine red, TRITC (tetramethyl rhodamine isothiocyanate), FITC (fluorescein isothiocyanate), Oregon green (Oregon green) ), JOE (6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein), ROX (6-carboxy-X- rhodamine), Texas Red, TET (N, N, N ', N'-tetramethyl-6-carboxyrhodamine), cyanine dyes and thiadicarbocyanine dyes At least one selected from the group consisting of, but not limited to. The minerals may be selected from the group consisting of Dabcyl, TAMRA, Eclipse Deep Dark Quencher, QSY, Blackberry, Blackberry Quencher, Black Hole Quencher, Iowa Black FQ , Iowa black FQ, Iowa black RQ, and IRDye QC-1. In an embodiment of the present invention, it is more preferred to use the reporter material as FAM and the small mineral material as Dabcyl.

In one embodiment of the present invention, the probe may be specific to the toxic gene stx2B. Among the EHEC Escherichia coli, O157: H7 serotype E. coli is a highly pathogenic Escherichia coli producing stx1 and stx2 toxic genes, and studies have shown that stx2 is more toxic than stx1. stx2 is highly deleterious to humans since it binds to the human cell surface and is then able to enter the cell by receptor-mediated intracellular entry. Therefore, the present invention has developed a probe specific to stx2B.

In one embodiment of the present invention, the detection limit of stx2B may be 10 < ^-3 > to 10 &^lt; ¹ > cfu / Preferably, it may be 10 < ^-3 > cfu / mu l concentration. According to the Convention on Ballast Water Management, E. coli in effluent should be detected at 250 cfu or less per 100 ml. The detection limit is a range capable of covering the detection limit, and the detection sensitivity is high.

Further, the present invention provides a method for detecting a DNA fragment, comprising the steps of: (a) separating DNA from a target sample; (b) amplifying the target sequence by performing PCR using the separated DNA as a template; (c) performing real-time PCR by adding the above-described PNA probe to the PCR amplification product; (d) melting the amplification product amplified by the real-time PCR while changing the temperature to obtain a melting curve; And (e) detecting the E. coli by confirming the melting temperature of the melting curve; The present invention also provides a method for detecting equine pathogenic Escherichia coli.

In one embodiment of the present invention, the PCR may be performed using a primer set consisting of SEQ ID NO: 3 and SEQ ID NO: 4. When the above primer set is used, the PCR amplified product is specific and the amplification time can be shortened.

In one embodiment of the present invention, the PCR may be performed by asymmetric PCR.

In one embodiment of the present invention, in order to produce a single strand to be annealed by the probe, 5 to 10 times, more preferably 5 times as much as the forward primer can be added to the reverse primer during asymmetric PCR. This increases the number of single strands produced from the reverse primer.

In one embodiment of the present invention, the step of obtaining the melting curve may be performed by measuring the fluorescence intensity while increasing the temperature and analyzing the fluorescence value relative to the temperature.

In one embodiment of the present invention, the fluorescence intensity may be measured by increasing the temperature to 37 ° C to 80 ° C and measuring fluorescence. When the fluorescence intensity is measured while increasing by 0.1 ° C per second, complementary DNA is separated from the detection probe as the temperature increases. As a result, the fluorescence is extinguished, the fluorescence intensity is lowered, and the melting peak can be confirmed. Thus, the presence or absence of the target nucleic acid can be confirmed.

Further, another embodiment of the present invention provides a kit for detecting equine pathogenic Escherichia coli comprising the above probe. The kit may include, but is not limited to, reagents necessary to perform PCR reactions such as buffers and DNA polymerase.

According to the present invention, a toxic gene of Escherichia coli existing in ballast water can be accurately detected by using a PNA probe specific to the toxic gene stx2B. PNA probes are highly stable and have excellent sensitivity and specificity of detection, so they can be more effectively used for quarantine of ship ballast water.

1 is a schematic diagram of a pBHA vector into which the stx2B gene is inserted.
2 is a photograph showing electrophoresis results of PCR products of the forward / reverse primer combination used for Escherichia coli toxin gene detection.
Fig. 3 is a graph showing the detection limit of Escherichia coli toxin gene in real-time PCR using SYBR.
4 is a graph showing the melting curve after asymmetric PCR using PNA probe.
5 is a graph showing the detection limit of Escherichia coli toxicity gene asymmetric PCR using PNA probe.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

[ Example ]

Example  1. Escherichia coli stx2B  Screening of gene sequences

The stx2B toxic gene sequence of 10 E. coli O157: H7 10 species registered in the NCBI database was compared with the nucleotide sequences of 37 other E. coli strains. 225 bp of the stx2B gene sequence was finally selected and gene synthesis was commissioned to bioneer (SEQ ID NO: 1).

E. coli stx2B gene sequence selection division Name (SEQ ID NO) Base sequence Size (mer) E. coli stx2B gene sequence stx2B (SEQ ID NO: 1) gcattagcttctgttaatgcaatggcggcggattgtgctaaaggtaaaattgagttatccaagtataatgaggatgacacatttacagtgaaggttgacgggaaagaatactggaccagtcgctggaatctgcaaccgttactgcaaagtgctcagttgacaggaatgactgtcacaatcaaatccagtacctgtgaatcaggctccggatttgctgaagtgcag 225

After the EcoRI restriction enzyme digestion and sequencing were performed to confirm whether or not the synthesized gene was properly inserted into the pBHA vector, it was used as a template for a primer for detecting E. coli and a probe selection test (FIG. 1).

Example  2. Escherichia coli stx2B  For gene detection primer  Screening and detection limit analysis

The nucleotide sequences of the designed primers including the site used for Escherichia coli toxicity gene detection are shown in Table 2. Genomic amplification size of 94-212 bp was amplified according to the combination of forward and reverse primers and the same experimental conditions were selected for conventional PCR to synthesize PCR products of various sizes. The sequences and combinations of the primers and the size of the PCR products are shown in Table 3, and the optimal PCR composition, reaction time and reaction temperature are shown in Tables 4 and 5, and the PCR products were electrophoresed using 2% agarose gel (Fig. 2). Real-time PCR was performed using real-time PCR to combine forward primers F1, F2, F3 and F4 and reverse primers R1, R2, R3 and R4 to select F2 (SEQ ID NO: 5) / R3 (SEQ ID NO: 6) combinations.

Primer sequences for E. coli toxin gene stx2B detection division Name (SEQ ID NO) Base sequence Size (mer) stx2B forward primer stx2B F1 CGGCGGATTGTGCTAAAGGT 20 stx2B  F2 (SEQ ID NO: 5) TTCTGTTAATGCAATGGCGGC 21 Stx2B F3 CAGTCGCTGGAATCTGCAAC 20 stx2B F4 GGAATCTGCAACCGTTACTGC 21 stx2B reverse primer stx2B R1 GGTTGCAGATTCCAGCGACT 20 stx2B R2 GCAGTAACGGTTGCAGATTCC 21 stx2B  R3 (SEQ ID NO: 6) CTTCAGCAAATCCGGAGCCT 20 stx2B R4 TCAGCAAATCCGGAGCCTG 19

Primer combination and resulting PCR product size Primer combination PCR product size (bp) stx2B F1 / stx2B R1 112 stx2B  F2 / stx2B  R2 137 stx2B F3 / stx2B R3 104 stx2B F4 / stx2B R4 94 stx2B F2 / stx2B R3 212

composition of conventional PCR Furtherance Capacity (μl) Template One Forward primer One Reverse primer One 10X PCR buffer 2 dNTP mix 2 Taq polymerase 0.5 Distilled water up to 20

The reaction time and reaction temperature of conventional PCR Pre-denaturation 95 ℃ 10 min Amplification Denaturation 95 ℃ 30 sec 35 cycles Annealing 60 ° C 30 sec Extension 72 ℃ 30 sec Final-Extension 72 ℃ 10 min

The detection limit of Escherichia coli toxin gene was analyzed by qPCR (Real-time PCR) using SYBR with F2 / R3 primer combination selected by conventional PCR. The compositions and reaction conditions of qPCR using SYBR are shown in Tables 6 and 7. As a result, the detection limit of Escherichia coli toxin gene stx2B was 1 × 10 ³ copies / ml (FIG. 3).

Composition of real-time PCR using SYBR Furtherance Capacity (μl) Template One Forward primer (5pM) One Reverse primer (5 pM) One 2X SYBR qPCR mix 10 Distilled water up to 20

The reaction time and reaction temperature of PCR using SYBR Pre-denaturation 95 ℃ 5 min Amplification Denaturation 95 ℃ 10 sec 45 cycles Annealing 60 ° C 30 sec Melting 60 ° C to 97 ° C at 0.1 ° C / sec

Example  3. Escherichia coli stx2B  For gene detection Of the probe  Selection

PNA probes for E. coli toxin gene stx2B detection were designed to allow complementary binding of PNA probes to the stx2B gene sequence for optimizing the fusion temperature (Tm), and the PNA probe sequences are shown in Table 8. All PNA probes used in the present invention were synthesized by HPLC purification method in Panagene (Korea), and the purity of all synthesized probes was confirmed by mass spectrometry.

PNA probe sequence for E. coli toxin gene stx2B detection division Name (SEQ ID NO) Base sequence Tm (占 폚) PNA probes
Base sequence stx2B  1 (SEQ ID NO: 2) TCCAAGTATAATG 47.7 stx2B  2 (SEQ ID NO: 3) ATGACACATTTACAG 56.4 stx2B  3 (SEQ ID NO: 4) GTGCTCAGTTGACA 61.2 Structure of PNA probes stx2B PNA1 Dabcyl-TCCAAGTATAATG-O-K (FAM) stx2B PNA2 Dabcyl-ATGACACATTTACAG-O-K (FAM) stx2B PNA3 Dabcyl-GTGCTCAGTTGACA-O-K (FAM)

Example  4. Escherichia coli toxicity gene stx2B  For detection PCR  And melting curve analysis

MyGo mini real-time PCR (IT-IS Life Science Ltd. Island) was used for the PCR for the melting curve analysis using the primer set (F2 / R3) selected in Example 2 and the PNA probe. All experimental conditions were asymmetric PCR using primer sets and PNA probes to generate single-stranded target nucleic acids. Asymmetric PCR reaction was performed with the composition shown in Table 9 so that the Escherichia coli toxin gene stx2B was amplified correctly. In the asymmetric PCR, the ratio of the forward primer to the reverse primer was 1: 5. Asymmetric PCR was denatured at 95 ° C for 10 minutes and then reacted at 95 ° C for 10 seconds, 60 ° C for 30 seconds, and 72 ° C for 15 seconds (Table 10).

Composition of PNA probe asymmetric PCR Furtherance Capacity (μl) Template One PNA probes One Forward primer (4pM) One Reverse primer (20 pM) One 2.5X PCR buffer 9 Taq polymerase One Distilled water up to 25

Conditions of PNA probe asymmetric PCR Pre-denaturation 95 ℃ 10 min Amplification Denaturation 95 ℃ 10 sec 45 cycles PNA annealing 60 ° C 30 sec Extension 72 ℃ 15 sec Pre-melt Hold 95 ℃ 5 min 37 ℃ 5 min Melting 37 ° C to 80 ° C at 0.1 ° C / sec

Melting curve analysis was performed after asymmetric PCR reaction at 95 ° C for 5 min, denaturation at 37 ° C for 5 min, and then 37 ° C to 80 ° C elevated by 0.1 ° C per second and fluorescence was measured. Analysis of the melting curve after asymmetric PCR showed that the stx2B PNA 1, 2, and 3 probes with different Tm values showed melting peaks at each temperature (FIG. 4). Based on the results, stx2B PNA 3 probes showing high Tm values were selected.

Example  5. E. coli stx2B  Gene-specific PNA Probe  real time Of PCR  Detection limit analysis

In order to analyze the detection limit of cfu unit in accordance with IMO D2 standard, asymmetric PCR was performed on E. coli colonies using the stx2B PNA 3 probe showing the highest Tm value among the selected probes, as shown in Table 9. As a result, The detection limit of toxic gene stx2B was 1x10 ^-3 cfu / μl (100 cfu / 100 ml) (FIG. 5).

<110> Korea Institute of Ocean Science & Technology <120> PNA probe for pathogenic Escherichia coli and its use in ballast          water <130> PA-D16557 <160> 6 <170> KoPatentin 3.0 <210> 1 <211> 225 <212> DNA <213> Escherichia coli <400> 1 gcattagctt ctgttaatgc aatggcggcg gattgtgcta aaggtaaaat tgagttttcc 60 aagtataatg aggatgacac atttacagtg aaggttgacg ggaaagaata ctggaccagt 120 cgctggaatc tgcaaccgtt actgcaaagt gctcagttga caggaatgac tgtcacaatc 180 aaatccagta cctgtgaatc aggctccgga tttgctgaag tgcag 225 <210> 2 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> E. coli stx2B PNA probe 1 <400> 2 tccaagtata atg 13 <210> 3 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> E. coli stx2B PNA probe 2 <400> 3 atgacacatt tacag 15 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > E. coli stx2B PNA probe 3 <400> 4 gtgctcagtt gaca 14 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of E. coli stx2B <400> 5 ttctgttaat gcaatggcgg c 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of E. coli stx2B <400> 6 cttcagcaaa tccggagcct 20

Claims (13)

A PNA probe for detecting equine pathogenic Escherichia coli comprising a nucleotide sequence of any one of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.
A PNA probe for detecting equine pathogenic Escherichia coli comprising the nucleotide sequence of SEQ ID NO: 4.
The method according to claim 1,
The pathogenic Escherichia coli is selected from the group consisting of Enterohaemorrhagic E. coli , Enterotoxigenic E. coli , EIEC, Enteroinvasive E. coli , EAEC, Enteroaggregative E. coli, ), and Chapter E. coli (EPEC, pathogenic E. coli) E. coli is detected PNA probe is selected from the group consisting of.
The method according to claim 1,
Wherein the probe further comprises a reporter molecule and a quencher molecule. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt;
The method according to claim 1,
The probe is specific for the toxic gene stx2B (shiga toxin 2 subunit B).
5. The method of claim 4,
Wherein the detection limit of stx2B is 10 &lt; ^-3 &gt; cfu / [mu] l concentration.
(a) separating DNA from the target sample;
(b) amplifying the target sequence by performing PCR using the separated DNA as a template;
(c) performing real-time PCR by adding the PNA probe according to any one of claims 1 to 6 to the PCR amplification product;
(d) melting the amplification product amplified by the real-time PCR while changing the temperature to obtain a melting curve; And
(e) detecting the E. coli by confirming the melting temperature of the melting curve;
And detecting the equilibrium pathogenic Escherichia coli.
8. The method of claim 7,
Wherein the PCR is carried out using a primer set consisting of SEQ ID NO: 5 and SEQ ID NO: 6.
8. The method of claim 7,
Wherein the PCR is performed by asymmetric PCR.
10. The method of claim 9,
Wherein the asymmetric PCR is performed by adding 5 to 10 times more the reverse primer than the forward primer.
8. The method of claim 7,
Wherein the step of obtaining the melting curve is performed by measuring the fluorescence intensity while increasing the temperature and analyzing the fluorescent value with respect to the temperature.
12. The method of claim 11,
Wherein the fluorescence intensity is measured by increasing the temperature to 37 DEG C to 80 DEG C and measuring fluorescence.
A kit for detecting equilibrium waterborne pathogenic Escherichia coli comprising a probe according to any one of claims 1 to 6.

Images