KR20180051463A - Composition for preventing formation of biofilm comprising raffinose and method for preventing formation of biofilm using the composition - Google Patents

Abstract

The present invention relates to a composition for suppressing biofilm formation containing raffinose as an active ingredient, and a method for suppressing biofilm formation using the same. According to the present invention, provided is a composition for suppressing biofilm formation, capable of effectively suppressing biofilm formation on various membrane surfaces on which biofilms are formed. Moreover, provided is a method for suppressing biofilm formation using the same.

Description

[0001] The present invention relates to a composition for inhibiting the formation of biofilm comprising raffinose as an active ingredient and a method for inhibiting the formation of biofilm using the composition.

The present invention relates to a composition for inhibiting biofilm formation comprising raffinose as an active ingredient and a method for inhibiting biofilm formation using the same.

Microbial biofilms are their own lifestyle to adapt to the environment. Since biofilms formed by microorganisms are strongly attached to various surfaces, they are difficult to remove and have a much stronger resistance to harsh environments (such as pH, temperature, nutrient depletion, etc.) and attack of antibiotics Sterilization and disinfection are difficult. In addition, because microorganisms can obtain various benefits as a result of the formation of such biofilms, they are present in biofilm form in most natural and industrial environments. The microorganisms forming the biofilm are covered with a polymeric substance secreted by externally released individual microorganisms called EPS (extracellular polymeric substance; Carbohydrate, Protein, and Nucleic acid) and are fixed on the surface. Therefore, a biofilm is a collection of microorganisms such as bacteria, yeast, fungi and the like attached to the surface of human body (skin, oral cavity, teeth, etc.) or equipment (piping, storage tank, etc.) , It is also provided as a habitat for microorganisms, which accelerates the formation of bacteria. Such biofilm microorganisms may cause serious problems in the whole industry and the medical field. Therefore, it is required to study a composition for inhibiting biofilm formation and a method for inhibiting the formation of biofilm.

On the other hand, Raffinose is a non-reducing tri-saccharide consisting of one molecule of D-Galactose, D-Glucose and D-Fructose. It is present in various natural substances such as Eucalyptus, sugar beet molasses, Which is degraded into sucrose and D-galactose by alpha-galactosidase.

Most bacteria can survive in two different states, planktonic and sessile. Biofilm is a collection of single or multiple species encapsulated in self-produced extracellular polymeric substances (EPS), in particular bacterial infections are often associated with biofilms. For example, the Pseudomonas Patients with cystic fibrosis infected with aeruginosa develop progressive respiratory failure due to biofilm formation in the lungs. Biofilm also causes malfunction of medical devices, contact lenses and artificial implants, which ultimately leads to fatal medical problems. Furthermore, when biofilms are formed in an industrial environment (e.g., marine hulls, water pipes, membrane filters, etc.), performance is lost, resulting in increased costs for maintenance and quality control. Nonetheless, biofilms formed on biological and inanimate surfaces are known to be very difficult to remove, largely because biofilm cells are not sensitive to antimicrobial or biocidal agents. Biofilm cells are 10 to 1,000 times more resistant to antimicrobials than planktonic cells.

In contrast to traditional bactericidal or bacteriological approaches to inhibiting biofilms, studies focused on inhibiting biofilm formation without affecting bacterial growth have been reported (Non-Patent Document 1) . For example, bacterial cell-cell communication called quorum sensing (QS) is mediated by chemical signaling molecules, and this quorum sensing is known to be associated with biofilm maturation. This finding can be used to develop a strategy to destroy biofilm maturation, in which quorum recognition signal molecules and structurally similar molecules (e.g., furanone, azithromycin, and (Eg, 4-nitro-pyridine-N-oxide) or enzymes (eg, acylase and lactonase) that degrade quorum recognition molecules can be used, and some molecules enhance cell dispersibility during biofilm formation . In addition, an enzyme dispersing agent B exhibiting EPS decomposition properties has been applied for this purpose (Non-Patent Document 2), and nitrogen monoxide and an unsaturated fatty acid, cis-2-decenoic acid, (Non-Patent Document 1).

On the other hand, various natural substances are known to be effective for controlling biofilm formation. When natural substances are used for inhibition of biofilm, toxicity and specificity are higher than those of synthetic compounds (Non-Patent Document 3). Specifically, medicinal plants (e.g., Conocarpus erectus ) from grains, chamomile, carrot, propolis, yellow pepper, water lily, harbanero, garlic, Lagerstroemia speciosa , Gingerol, etc. are known to exhibit anti-QS activity (non-patent documents 4-8), some (e.g., garlic extract and 6-gingerol in ginger extract) have antibiotic efficacy ≪ / RTI > The present inventors have also found that the ginger extract is effective against P. aeruginosa by decreasing cellular cyclic di-guanylate (cdi-GMP) (Non-Patent Document 9), but the specific active compound (s) associated with such a discovery has not been disclosed.

Accordingly, the inventors of the present invention completed the present invention by confirming the biofilm inhibition effect and mechanism of raffinose present in various natural substances while studying a substance effective for a composition for inhibiting biofilm formation and a method for inhibiting biofilm formation .

Non-Patent Document 1: McDougald D, Rice SA, Barraud N, Steinberg PD, and Kjelleberg S (2012). We should stay or go for: mechanisms and ecological consequences for biofilm dispersal. Nat Rev Microbiol 10 (1): 39-50. Non-Patent Document 2: Landini P, Antoniani D, Burgess JG, & Nijland R (2010) Molecular mechanisms of compounds affecting bacterial biofilm formation and dispersal. Appl Microbiol Biot 86 (3): 813-823. Non-Patent Document 3: Koo H & Jeon J (2009) Naturally occurring molecules as alternative therapeutic agents against cariogenic biofilms. Adv Dent Res 21 (1): 63-68. Non-Patent Document 4: Teplitski M, Robinson JB, and Bauer WD (2000) Plants secrete substances that mimic bacterial N-acyl homoserine lactone signal activities and affect population dependent behavior of associated bacteria. Mol Plant Microbe In 13 (6): 637-648. Non-Patent Document 5: Singh BN, et al. (2012) Lagerstroemia speciosa fruit extract modulates quorum sensing controlled virulence factor production and biofilm formation in Pseudomonas aeruginosa. Microbiol-Sgm 158: 529-538. Non-Patent Document 6: Rasmussen TB, et al. (2005) Screening for quorum-sensing inhibitors (QSI) by use of a novel genetic system, the QSI selector. J Bacteriol 187 (5): 1799-1814. Non-Patent Document 7: Girennavar B, et al. (2008) Grapefruit juice and its furocoumarins inhibits autoinducer signaling and biofilm formation in bacteria. Int J Food Microbiol 125 (2): 204-208. Non-Patent Document 8: Kim, H.-S., Lee, S.-H., Byun, Y., and Park, H.-D. (Mar. 2015) " 6-Gingerol reduced Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition ", Scientific Reports 5, serp08656. Non-Patent Document 9: Kim H-S & Park H-D (2013) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14. PloS one 8 (9): e76106.

Accordingly, the present invention firstly revealed that raffinos, which is galactotrisaccharide, binds to carbohydrate binding proteins and controls c-di-GMP, thereby inhibiting the formation of biofilms of microorganisms. Based on this, raffinos is effective Compositions for inhibiting biofilm formation, and methods for inhibiting biofilm formation in medical and other industries.

In order to solve the above problems, the present invention provides a composition for inhibiting the formation of a biofilm comprising raffinose as an active ingredient.

According to one embodiment of the present invention, the composition can be used to inhibit the formation of a biofilm formed on the surface of a medical device, a medical material or a medical implant.

According to another embodiment of the present invention, the composition can be used to inhibit the formation of the biofilm formed on the surface of the water treatment membrane.

According to another embodiment of the present invention, the composition can be used to inhibit the formation of a biofilm formed on the surface of foods and household goods.

The present invention also provides a method for inhibiting biofilm formation comprising coating the surface of an object with the composition.

According to the present invention, there can be provided a composition for inhibiting the formation of a biofilm, which can effectively inhibit the formation of the biofilm on various membrane surfaces on which the biofilm is formed, and a method for inhibiting the formation of a biofilm using the same.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a flow chart illustrating a process for screening compounds inhibiting biofilm formation from ginger,
Figure 1a is a list of potential compounds used in the present invention,
Figure 1B is a graph that quantifies the biofilm formation of P. aeruginosa by treating potential candidate compounds and furanone C-30 (both control) in wells of a microtiter plate for 24 hours, with concentrations of each compound being 10 [mu] M And error bars mean the standard deviation of 8 measurements (**, P <0.0005 compared to negative control).
Figures 2a-2d illustrate the effect of P. aeruginosa As an illustration of the effects of raffinose on phenotypes,
Figure 2a shows a graph (error bars means the standard deviation of three measurements) grown with various concentrations of raffinose (0, 1, 10 and 100 [mu] M) for 14 hours in a flask,
Figure 2b depicts the results of the untreated P. aeruginosa Biofilm (left), and P. aeruginosa treated with 10 [mu] M raffinose (DAPI; blue), carbohydrate (green), and blue (green) images before performing a confocal laser scanning microscope (CLSM) imaging on biofilms, ConA; green), and protein (Ruby (red)), and arrows indicate hollow structures in the biofilm.
Figure 2c is a view showing the colony morphology of P. aeruginosa treated with Congo Red agar raffinose untreated P. aeruginosa (left) and 10 μM raffinose on the plate,
Figure 2d shows the results of a flocking motility photograph (top view, accumulation 1 cm) and flocking mobility (Fig. 2d) incubated with various concentrations of raffinose (0, 1, 10, 100, and 1,000 μM) for 24 hours on 0.5% BM- (Bottom view, **, P < 0.0005 as compared to the control group).
Figures 3a-3c show the effect of raffinose on P. aeruginosa biofilm formation,
FIG. 3A shows the degree of biofilm formation in the presence of various concentrations (0, 0.1, 1, 10, 100, and 1,000 μM) of raffinose when cultured in a microtitre plate for 24 hours,
FIG. 3B shows the degree of biofilm formation in the presence of sucrose at various concentrations (0, 0.1, 1, 10, 100, and 1,000 μM) when cultured in a microtitre plate for 24 hours,
Figure 3c shows the degree of biofilm formation in the presence of D - (+) - galactose at various concentrations (0, 0.1, 1, 10, 100, and 1,000 μM) when cultured in microtitre plates for 24 hours The error bars mean the standard deviation of the 10 measurements **, P <0.0005; * compared to the control, P <0.005 compared to the control).
Figures 4a and 4b show the effect of raffinose on EPS production,
Figure 4a shows total carbohydrates in EPS of planktonic and biofilm cells of P. aeruginosa cultured for 24 hours with varying concentrations of raffinos (0, 1, 10, 100, and 1,000 [mu] M)
Figure 4b shows the total protein in EPS of planktonic and biofilm cells of P. aeruginosa cultured for 24 hours with varying concentrations of raffinos (0, 1, 10, 100, and 1,000 [mu] M) **, P <0.005 compared to the control group, and P <0.05 compared to the control group).
Figures 5a to 5d illustrate the interaction of P. aeruginosa LecA protein with raffinose,
5a is a graph showing the binding of raffinose to LecA by CPMG NMR spectroscopy (first line: NMR spectrum of raffinose (0.1 mM) in the absence of LecA, second line: raffinose (0.1 NMR spectrum of raffinose (0.1 mM) and LecA (50 μM) under the condition of adding galactose (1 mM)
Figure 5b shows the results of in silico analyzes of raffinose and LecA (hydrogen bonding interaction of raffinos best docked with LecA (left) and docked raffinos (right) present on the surface of LecA)
Figure 5c depicts biofilm formation according to varying concentrations of raffinos (0, 1, 10, and 100 [mu] M) in the [ Delta ] lecA mutants cultured in microtitre plates for 24 hours,
Figure 5d shows biofilm formation according to varying concentrations of raffinos (0, 1, 10, 100 and 1,000 μM) in ΔlecA - pUCP18-LecA cultured in microtitre plates for 24 hours - pUCP18, and the error bars represent the standard deviation of the 10 measurements **, P <0.0005 * compared to the control and P <0.005 compared to the control).
Figure 6 shows the monitoring of galactose signal by CPMG NMR spectroscopy when treated with excess of raffinose (first line: NMR spectra of galactose (1 mM) in the absence of LecA second line: presence of LecA (50 μM ): Third spectrum: NMR spectrum of galactose (0.1 mM) and LecA (50 μM) under the condition of adding raffinose (1 mM).
Figures 7a-7d show the effect of raffinose on cellular c-di-GMP levels,
Figure 7a shows cellular c-di-GMP levels in P. aeruginosa planktonic and biofilm cells cultured for 24 hours in the presence and absence of 10 [mu] M raffinose (Error bars mean the standard deviation of three measurements **, P <0.005; * compared to the control, P <0.05 compared to the control)
Figure 7b shows the effect of P. aeruginosa cultured with various concentrations of raffinose (0, 1, 10, and 100 [mu] M) for 24 hours in the wells of a microplate wspF (Error bars mean standard deviation of 8 measurements **, P <0.00005 * compared to the control, P <0.005 compared to the control), and the biofilm formation at the mutation
Fig. 7c shows the effect of the presence of 10 [mu] M raffinos on the 0.5% BM-2 plate (right) and wspF This is a demonstration of the herd motility of the mutation,
Figure 7d shows the effect of P. aeruginosa cultured with raffinose (0, 1, 10, and 100 [mu] M) (**, P &lt;0.000005; * compared to control, P < 0.00005 versus control), showing the degradation of PDE-specific substrate bis-pNPP by cells.
8 is a P. aeruginosa Bacterial cells formed a biofilm on slide glass, treated with 10 μM raffinos for 2 hours and 4 hours, and the released bacterial cells were counted (error The bars mean the standard deviation of the three measurements **, P <0.0005; * compared to the control, P <0.005 compared to the control).
Figures 9a and 9b show that P. aeruginosa lecA As an illustration of the effects of raffinose on gene expression and PDE activity,
Figure 9a shows the effect of lecA < RTI ID = 0.0 &gt; Deletion mutation (Δ lecA) and c-di-GMP and relatively lecA for producing mutations (ΔwspF) Lt; RTI ID = 0.0 &gt; expression,
Figure 9b lecA (Error bars indicate the standard deviation of three measurements **, P &lt;0.0005; * compared to the control, P &lt; 0.005 relative to the control), and loss of mutation ( ΔlecA ) ).
10 is a graph showing changes in biofilm formation by raffinose treatment of various gram negative, positive strains.

Hereinafter, the present invention will be described in more detail.

The present invention provides a composition for inhibiting biofilm formation comprising raffinose as an active ingredient and a method for inhibiting biofilm formation using the same.

Raffinose is a type of non-reducing tri-saccharide consisting of one molecule of D-Galatose, D-Glucose and D-Fructose, and its chemical formula is C ₁₈ H ₃₂ O ₁₆ and O- 留 -D- galactopyranosyl- (1,6) -O- alpha -D-glucopyranosyl- (1,2) - beta -D-fructo-tetranucleoside. Raffinose is a substance found in various natural substances such as Eucalyptus, molasses of sugar beet, fruit of cotton, and is decomposed into sucrose and D-galactose by alpha-galactosidase.

The present inventors have completed the present invention by confirming the inhibitory effect and mechanism of biofilm formation of raffinose in various natural substances.

As can be seen from the following examples, the composition according to the present invention does not affect the growth of microorganisms, and the biofilm formation inhibiting effect depends on the concentration of raffinose in the composition, and about 14-52% Respectively. In addition, as can be seen from the following examples, it was confirmed that raffinose can be applied to various gram negative and positive bacteria because it regulates the amount of C-di-GMP of bacteria which acts as a main factor of biofilm formation.

The composition according to the present invention can be used variously as an application for inhibiting biofilm formation in medical and other industrial fields. For example, in the medical field, a composition of a biofilm formed on the surface of a medical device, a medical material, Or &lt; / RTI &gt; More specifically, it relates to a surgical apparatus, a hospital facility, a medical emergency apparatus, an obesity and health-related apparatus, a contact lens, a stent, and a surgical apparatus such as a diagnosis and diagnostic apparatus, a clinical examination apparatus, a radiation apparatus, an IUD, Valves, molded implants, and the like.

In addition, the composition according to the present invention can be used to inhibit the formation of biofilms formed on the surface of various water treatment membranes such as reverse osmosis membranes, and further, can be used for various foods and for the surface of various household articles such as washing machines, humidifiers, Can be used to inhibit the formation of the biofilm formed in the biofilm.

The present invention also provides a method for inhibiting biofilm formation comprising coating the surface of a subject with the composition. That is, the method according to the present invention can be carried out by coating the above-mentioned various medical devices and the like on the surface of a water treatment film or the like. Such a coating treatment can be carried out by supporting the surface of the object on the composition solution, Spraying on the surface, and the like.

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following Examples are intended to assist the understanding of the present invention and are not intended to limit the scope of the present invention.

Experiment

Bacterial strains and chemicals

P. aeruginosa PA14 was used as a model biofilm-forming strain. P. The wspF knockout mutation (Δ wspF ) of aeruginosa was used to test whether raffinos are effective against bacteria producing over-the-cell c-di-GMP. 6-gingerol, farnesol, L-ascorbic acid, myricetin, and D - (+) - raffinose pentahydrate, components of ginger, were purchased from Sigma Aldrich , USA) and dissolved in dimethyl sulfoxide (Carl Roth, Karlsruhe, Germany). Escherichia coli was used as Gram negative bacteria and Stapylococcus aureus, Rhodococcus qingshengi, Bacillus megaterium and Bacillus amyloliquefaciens were used as Gram positive bacteria.

Growth inhibition test

P. aeruginosa was cultured in AB medium (300 mM NaCl, 50 mM MgSO4, 0.2% non-vitamine casamino acids, 10 mM potassium phosphate, 1 mM L-arginine, and 1% glucose, pH 7.5) (0, 1, 10, or 100 [mu] M) overnight at 37 [deg.] C and 250 rpm in a stirred incubator for 14 hours. Bacterial growth was evaluated by measuring the optical density (OD) hourly in triplicate samples at 595 nm using a UVmini-1240 spectrophotometer (Shimadzu, Kyoto, Japan).

Static biofilm formation analysis

Overnight cultures of the test bacteria (OD = 1.5 at 595 nm) were diluted in fresh AB medium (1:20) and then fractionated into wells of a TPP 96-well polystyrene microtiter plate (Sigma Aldrich). After forming the biofilm in 37 DEG C wells for 24 hours without agitation, the OD of the suspended culture was measured at 595 nm using an iMark microplate absorbance reader (BioRad, Richmond, Calif., USA) The cultures were discarded. Plates were washed with phosphate buffered saline (PBS) (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 2 mM KH2PO4, pH2 7.2) to remove residual suspended cells. The biofilm was dyed with 1.0% crystal violet for 30 minutes and then washed with sterile deionized water to remove residual unbound dye. The crystal violet bound to the biofilm was eluted with 100% ethanol and the OD of the eluent was measured at 545 nm. The biofilm was quantified as the amount of crystal violet bound to the biofilm (OD at 545 nm) and normalized to the amount of suspended cells (OD at 595 nm).

Drip - Flow  Analysis of biofilm formation using a drip-flow reactor

A 1 ml overnight culture (OD = 1.5 at 595 nm) of P. aeruginosa was diluted in fresh 19 ml AB medium (1:20) in Petri dishes. The glass slide was immersed in a petri dish containing the diluent, and then cultured at 37 캜 for 24 hours to form a biofilm on the glass slide. Glass slides covered with biofilm cells were inserted into a DFR-110 drip-flow biofilm reactor (BioSurface Technologies, Bozeman, MT, USA). Fresh AB medium containing or without raffinose (10 μM) was loaded into the reactor at a rate of 20 ml.h-1 using a metering pump (Masterflex C / L tubing pumps, Cole-Parmer, Vernon Hills, And the incubator was operated at 37 &lt; 0 &gt; C for 24 hours. The glass slide was then carefully washed with PBS (pH 7.2). The attached biofilm cells were stained with DAPI (Carl Roth), FITC-labeled ConA (Sigma Aldrich), and SYPRO Ruby (Invitrogen, Carlsbad, CA, USA) for 20 minutes continuously. The stained biofilm cells were washed twice with PBS (pH 7.2) after each staining step. DAPI, ConA, and Ruby solutions are for dyeing DNA, carbohydrates, and proteins, respectively. Next, biofilm cells were observed using CLSM (Carl Zeiss LSM700, Jena, Germany). Confocal images were observed using a 40 × objective lens (CApochromat 40x / 1.20 W Korr M27, Carl Zeiss) and blue (DAPI), green (ConA), and red (RUBY) ) Were simultaneously observed in the Z-stack mode. Detailed method for the fluorescent filters are described in previous studies (Kim HS & Park HD (2013 ) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14 PloS one 8 (9):. E76106). The bio-volume (μm ³ / μm ² ), biofilm average thickness (μm), and roughness coefficient were measured by Comstat2 in the ImageJ program (Heydorn A et al. (2000) Quantification of biofilm structures by the novel computer program COMSTAT. Microbiol - Uk 146: 2395-2407).

pUCP - LecA  Construction of expression plasmids

LecA protein was ectopically expressed using a multiple copy plasmid, pUCP18 (Schweizer H (1991) Escherichia-Pseudomonas shuttle vectors derived from pUC18 / 19. Gene 97 (1): 109-112). lecA Sequence of the gene region, Pfu polymerase by PCR using (PfuUltra II Fusion HS DNA Polymerase, Agilent Technologies, Santa Clara, CA, USA), was amplified with oligonucleotide to the oligonucleotides: 5'- ATGGCC CGTTGCTGTGCTTTGCTG GGATCC (BamHI Restriction enzyme sites are underlined) and 5'-CAG AAGCTT CGGCCACACGGGCAACTTCAC (HindIII restriction site is underlined). The amplified 540-bp fragment and plasmid pUCP18 were all treated with BamHI and HindIII endonuclease followed by gel purification and ligated using T4 ligase (Promega, Madison, WI, USA). The ligated plasmids were transformed into Escherichia coli (XL10-Gold Ultracompetent cells, Agilent Technologies).

pUCP - LecA  Using expression plasmids P. aeruginosa of  Transformation

Generation of competent cells for P. aeruginosa wild-type and ΔlecA mutants and transformation of P. aeruginosa using electroporation were performed according to previous studies (Choi KH, Kumar A, & Schweizer HP (2006) A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application of DNA fragment transfer between chromosomes and plasmid transformation J Microbiol Meth 64 (3): 391-397). A 1.5 mL overnight culture of P. aeruginosa wild-type and ΔlecA cells grown in LB medium was collected by centrifugation at 16,000 × g for 3 minutes at room temperature. The cell pellet was washed twice with 1 mL of 300 mM sucrose, and then the cell pellet was resuspended in 100 μL of 300 mM sucrose. Subsequently, purified plasmid DNA (pUCP18 and pUCP-LecA) was mixed with 100 μL of P. aeruginosa sensitive cells using Qiagen plasmid prep kit (Qiagen, Chatsworth, CA, USA) for electroporation. Purified plasmid DNA pUCP18 (empty vector) was mixed with wild type and ΔlecA mutant sensitive cells, while purified pUCP-LecA was mixed with ΔlecA sensitive cells. The mixture was transferred to a 0.2 cm gap electroporation cuvette (BIO4 RAD, Hercules, Calif., USA) and pulsed (25 μF, 200 Ω, 2.5 kV) was applied using the Gene Pulser Xcell ™ electroporation system (BIO-RAD). Electroporated cells (100 μL) were transferred to a 15-ml conical tube, 1 mL of fresh LB medium was added, and the mixture was stirred at 250 rpm at 37 ° C. for 1 hour. Cells were plated on LB plates with 100 [mu] g / mL carbenicillin and incubated at 37 [deg.] C for 14 hours. Colonies were selected and grown in LB broth. Plasmid DNA was isolated, treated with BamHI and HindIII endonuclease, and then separated by gel electrophoresis to obtain lecA It was confirmed that the gene was inserted into the plasmid.

Colony Morphology  analysis

The overnight culture of P. aeruginosa is diluted in fresh T-broth medium (10 g / L triptone) with raffinose (0 or 10 μM) and the dilutions are diluted 14 (OD = 1.0 at 595 nm). Of 2 μL culture taking place in the Congo-red plates (Kim HS & Park HD (2013 ) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14 PloS one 8 (9):. E76106), for 3 to 7 days at room temperature Cultured

EPS analysis

The EPS of plankton sex cells and the biofilm cells were analyzed using a modified sonic treatment (Kim HS & Park HD (2013 ) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14 PloS one 8 (9):. E76106). Planktonic cells were prepared by diluting overnight cultures of P. aeruginosa in fresh AB medium (1:20) with 0-1,000 μM raffinose and incubating at 37 ° C, 250 rpm on a shaker stirrer. The biofilm cells were diluted with overnight cultures of P. aeruginosa in fresh AB medium (1:20) with 0-1,000 μM raffinose using a borosilicate bottle and the dilutions were incubated at 37 ° C. for 24 hours without shaking . The ODs for the suspended cells from both planktonic cultures and biofilm cultures were measured at 595 nm using a spectrophotometer. The biofilm cells were resuspended in 3 mL of 0.01 M KCl by vortexing. The planktonic cultures and biofilm cultures were centrifuged at 8,000 xg, and the harvested cells were resuspended in 10 mL and 3 mL of 0.01 M KCl, respectively. The resuspended cells were disrupted for 4 cycles using a sonicator (VCX 750, SONICS, Newtown, CT, USA) at a power level of 3.5 Hz for 5 seconds of operation time and 5 seconds of rest time. The sonicated cells were centrifuged at 4,000 xg and the supernatant was filtered through a 0.22-μm Millex filter (Car Roth). Protein and carbohydrates were quantified using the filtered supernatant. Protein analysis was performed by the Lowry method in 96-well microtiter plates: 40 μL filtrate and 200 μL lowry reagent (L3540, Sigma Aldrich) were mixed in a microtiter plate and the mixture was incubated at room temperature for 10 minutes , 20 [mu] L of Folin-Ciocalteu reagent (F9252, Sigma Aldrich) was added to the mixture and the mixture was incubated for 30 minutes. Protein content was determined by measuring the OD at 750 nm using an iMark microplate reader. Carbohydrates were analyzed by the phenol-sulfuric acid method in a 96-well microtiter plate: 15 μL filtrate and 150 μL sulfuric acid were mixed in a microtiter plate and the mixture was incubated at room temperature for 30 minutes: 30 μL 5% phenol Was added to the mixture, and the mixture was incubated at 90 DEG C in a water bath. Carbohydrate content in the mixture was determined by measuring the OD at 490 nm using an iMark microplate reader. Protein (OD at 750 nm) and carbohydrate (OD at 490 nm) were normalized to the suspended cells (OD at 595 nm).

Swarming motility assay

The herd movement was analyzed according to the existing method (Kim HS & Park HD (2013) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14. PloS one 8 (9): e76106.). (0 - 1,000 μM) of P. aeruginosa containing raffinose 10 μL overnight cultures were spotted onto BM-2 plates (62 mM potassium phosphate [pH 7.0], 2 mM MgSO4, 10 mM FeSO4, 1% Casamino acid, 0.4% glucose, and 0.5% Bacto agar) For 24 hours. The degree of flock movement was assessed by measuring the average length of dendrites.

RT- qPCR  analysis

RT-qPCR was performed to detect P. aeruginosa lecA The levels of gene expression were quantified and compared. lecA and housekeeping gene proC Primer sets were designed using Primer 3 version 0.4.0 (http://frodo.wi.mit.edu/) (see Table 1 below). Battlefield RNA extraction, using the TRI REAGENT (Molecular Research Center, OH , USA) P. aeruginosa Lt; / RTI &gt; cells. RT-qPCR was performed using a Bio-Rad CFX-96 real-time system (Bio-Rad, Hercules, Calif., USA). The reaction mixture consisted of the following reagents: 10 μL SYBR Premix Ex Taq ™ (Takara, Shiga, Japan), 0.8 μL (10 μM) of the forward primer and the back primer, 0.4 μL of 50 X ROXTM Reference Dye I, Total RNA extracted (100 ng / ml), and RNase-free water, final volume 20 μL. The detailed protocols for RNA extraction and RT-qPCR methods were reviewed (Kim HS, Lee SH, Byun Y, & Park HD (2015) 6-Gingerol reduced biofilm formation and virulence via quorum sensing inhibition. Scientific reports 5: 8656).

primer Target gene The sequence (5 '- &gt; 3') Tm (占 폚) GC% Product size (bp) references lecA-F lecA GGG TTG CAC CCA ATA ATG TC 57.3 50 100 Invention lecA-R lecA CCA ATA TTG ACG CTG AAC G 55.3 45 proC-F proC GGC GTA TTT CTT CCT GCT GA 60.4 50 236 Conventional Literature * proC-R proC CCT GCT CCA CTA GTG CTT CG 61.2 60

*: Savli H , et al. (2003) Expression stability of six housekeeping genes: A proposal for resistance gene quantification studies of Pseudomonas aeruginosa by real-time quantitative RT-PCR. J Med Microbiol 52 (Pt 5): 403-408.

Biofilm dispersion analysis

Overnight cultures of P. aeruginosa were diluted in fresh AB medium (OD = 0.05 at 595 nm). The polystyrene petri dishes were filled with 20 mL of diluent. The sterilized glass slide was immersed in a petri dish and incubated at 37 DEG C for 24 hours to form a biofilm on the glass slide. The slides were then rinsed gently using PBS (pH 7.2) and immersed in a Petri dish containing 20 mL of AB medium with or without 100 [mu] M raffinose. Petri dishes were incubated at 37 [deg.] C for 2 hours and 4 hours, respectively. 100 [mu] L of the culture was serially diluted to 10 &lt; ^-5 &gt; in PBS (pH 7.2). To count colonies, 100 μL of the final dilution was plated on LB agar plates and stirred overnight at 37 ° C.

Statistical analysis

P -values for testing statistical differences between measurements were estimated by student's t test (Excel software, Microsoft, Redmond, WA, USA).

NMR analysis

All spectra were measured at 298 K using a Bruker Avance 600 MHz spectrometer (Billerica, MI, USA). 1D relaxation-edited NMR experiments used CPMG pulse sequences with excitation sculpting for water inhibition. The pre-acquisition delay was 1.2 seconds and the total spin lock time was 400 ms. In the CPMG experiment, the delay for spin echo between successive 180 pulses was 2 ms. Data were collected with a sweep width of 16 ppm (9,600 Hz) and 128 scans. Data processing was performed using Topspin 3.0 (Bruker) software, which has a sine-squared window function prior to Fourier transform for 16384 complex data. Samples contained 50 μM protein and 0.1 mM raffinose or galactose in 10% D20 buffered solution. For displacement experiments, 1 mM competitor (raffinose vs. galactose) was added to each sample.

sign Silico  Docking Studies ( In silico docking studies)

Ligand Preparation and Optimization: Raffinose was purified by ChemBioDraw (ver. 11.0.1) and Chem3D Pro (ver. 11.0.1), respectively . mol File format. The process of ligand preparation and optimization was performed by the 'Sanitize' manufacturing protocol in SYBYL- X 2.1.1 (Tripos Inc., St Louis, MI, USA).

Protein Construction: The protein structure of lectin PA-IL from P. aeruginosa in PDB format was downloaded from the RCSB Protein Data Bank (PDB ID: 4AL9). Protein production was performed using the constructing tool in SYBYL- X 2.1.1. For docking, other chains were removed from the protein-ligand complex except for the crystalline ligand melibiose, water molecule, Ca2 + ion, and chain F. [ The collision side chains of amino acid residues were corrected. Hydrogen atoms were added under TRIPOS Force Field application as default setting. The minimization process is POWELL , And the initial optimization option was changed from the default setting SIMPLEX to None, and the final gradation and maximum repetition were set to 0.5 kcal / ( mol * A) and 1000 cycles, respectively. After protein minimization, the engineered LecA protein structure was assayed for &lt; RTI ID = 0.0 &gt; File format.

Docking and Scoring Function Study: Raffinos docking study is SYBYL- X 2.1. 1 Surflex-Dock GeomX Module. Docking was guided by the Surflex- Dock protomol . The prototype containing information on the binding site of the lectin PA-IL to the Surflex- Dock was defined according to the positional information of the original crystalline ligand melibiose. The two factors involved in the generation of the proto are Bloat (Å) and Threshold , which are set to 0.5 and 0, respectively. The minimum number of poses generated per ligand and the minimum RMSD between the final poses were 20 and 0.05, respectively. The other parameters were applied with default settings for all drives.

The cellular c- di - GMP  Concentration analysis

For the analysis of the property from the plankton cell c-di-GMP, raffinose 37% formaldehyde (Carl Roth) of 4.9 mL containing (10 μM), and grown under-free P. aeruginosa overnight (OD at 595 nm is 1.5). The cultures were centrifuged at 8,000 xg for 10 min, and the harvested cells were resuspended in 40 mL PBS (pH 7.2) containing 0.18% formaldehyde. For analysis of c-di-GMP in biofilm cells, overnight cultures of P. aeruginosa were initially diluted (1:20) in fresh AB medium. The diluted solution was fractionated into a raffinose-containing (10 [mu] M) or no-contained state in a borosilicate bottle and cultured at 37 [deg.] C for 24 hours without shaking. After following the suspension of cells, the biofilm cells were washed twice with PBS (pH 7.2). The biofilm cells were resuspended by vortexing in 3 mL PBS containing 0.18% formaldehyde. The planktonic and biofilm cells were centrifuged at 8,000 xg for 10 min, and the harvested cells were resuspended in 5 mL deionized water. The reconstituted pellet was boiled for 10 minutes and cooled in ice for 10 minutes. The cooled replicates were mixed with 100% ethanol (9.3 mL) for nucleotide extraction and the mixture was centrifuged at 8,000 xg for 10 minutes at 4 ° C. To analyze cellular c-di-GMP, the supernatant was filtered through a 0.22-μm filter (Car Roth, Karlsruhe, Germany). Total proteins were analyzed by the Lowry method described above using the collected cells. The filtered supernatant was lyophilized using Savant SpeedVac (SC201A, Thermo Scientific, San Jose, Calif., USA) and lyophilized cells were washed with 200 μL Buffer A (100 mM KH2PO4, 4 mM ammonium tetrabutylammonium hydrogen sulfate, pH 5.9). The dissolved solution was filtered through a 0.45-μm filter (Car Roth). The filtered solution (20 μL) was analyzed using high performance liquid chromatography (HPLC) (Hewlett Packard 1100 Series, Agilent, Santa Clara, CA, USA). HPLC was performed using an ultraviolet detector (254 nm), a Kinetex C-18 column (4.6 x 250 mm, 5u, Phenomenex, Torrance, CA, USA) as a device of the Korea Basic Science Research Institute Solution (75% buffer A, and 25% pure methanol). C-di-GMP separation was carried out using a concentration gradient HPLC method as follows: 0 - 4; 50:50, 5 - 20; 0: 100, and 21 - 30; 50: 50 (operating time (min); ratio of buffer A and methanol), flow rate 0.8 mL min -1.

In bito PDE  Activity analysis

In vitro PDE activity it was analyzed in accordance with previous studies (Barraud N, et al. ( 2009) Nitric oxide signaling in Pseudomonas aeruginosa biofilms mediates phosphodiesterase activity, decreased cyclic di-GMP levels, and enhanced dispersal. J Bacteriol 191 (23): 7333-7342). P. The overnight cultures of aeruginosa were diluted in fresh AB medium (1: 100), treated with various raffinose concentrations (0 - 1,000 μM) and incubated for 14 hours at 37 ° C and 250 rpm in shaking incubator. The suspended cultures were centrifuged at 6,000 xg for 10 minutes at 4 ° C and the collected cells were suspended in 1 ml of PDE activity assay buffer (50 mM NaCl, 50 mM Tris base [pH 8.1], 1 mM MnCl2, and 5 mM bis-pNPP). Bis-pNPP (N3002, Sigma Aldrich) was used as a synthesis substrate for c-di-GMP specific PDE. Resuspended cells were lysed using CelLytic Express (C5491, Sigma Aldrich). For the PDE reaction, the mixture was incubated at 37 [deg.] C for 2 hours at 60 rpm in a shaking incubator. The OD of the mixture was then measured at 410 nm using an iMark microplate absorber reader to analyze the decomposition of bis-pNPP into p -nitrophenol. PDE activity (OD at 410 nm) was normalized by the total protein measured by the Lowry method as described above.

result

Screening of biofilm inhibitors in ginger

The efficacy of inhibiting biofilm formation on the five candidate components frequently found in ginger extracts (6-gingerol, fenezol, L-ascorbic acid, myricetin, and raffinose, see Fig. The degree of inhibition of biofilm formation by these candidate substances was assessed using a static biofilm assay, which indicated that P. aeruginosa as a model bacterium in 96-well microtiter plates It is based on using PA14. Furonon C-30 (Hentzer M , et al. (2003) Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. The EMBO journal 22 (15): 3803-3815) , which is known to inhibit biofilm formation through QS inhibition , Were used as both controls for these experiments. Figure 1B shows that 6-gingerol and raffinose reduced biofilm production by 39% and 43%, respectively, whereas fenesol, L-ascorbic acid, and myricetin did not significantly decrease biofilm production. The biofilm inhibitory effect of 6-gingerol and raffinose is comparable to that of furanone C-30, which shows 46% inhibition. Effect of 6-jinjeorol for biofilm inhibition is reported in the existing bar and (Kim HS, Lee SH, Byun Y, & Park HD (2015) 6-Gingerol reduces Pseudomonas aeruginosa biofilm formation and virulence via quorum sensing inhibition. Scientific reports 5: 8656), the present invention describes the ability of raffinos to inhibit biofilm formation and associated inhibition mechanisms.

Growth and Biofilm Generation Raffinose  effect

Growth of P. aeruginosa was measured for batch cultures containing 0-100 [mu] M raffinose. Growth curves for the various raffinose concentrations were not significantly different in the lag phase, the exponential phase and the stationary phase during the 14 hour incubation period (Fig. 2a). These results suggest that growth of P. aeruginosa is not affected until 100 μM of raffinose is added. Static biofilm analysis was performed using varying concentrations of raffinose (0-1,000 μM). Biofilm formation decreased gradually with increasing raffinose concentration (17-58%) (see Figures 3a-3c), which means that raffinose inhibits biofilm formation in a concentration dependent manner. The biofilm inhibiting ability of raffinose hydrolysis products (D-galactose and sucrose) was further evaluated using? -Galactosidase. The enzyme is widely distributed among microorganisms, plants, and animals. D-galactose and sucrose did not decrease or increase biofilm formation statistically (P > 0.05) up to a concentration of 1,000 μM, respectively (see FIGS. In addition, the effect of raffinose on the biofilm formation was tested in a flow reactor. Growth medium containing or not containing 10 [mu] M raffinose was continuously dropped on the glass slide for 24 hours. Figure 2b shows a typical biofilm. The biofilm formed with the raffinose treatment exhibited a relatively thin thickness (8.4 μm) and a small volume (4.8 μm ³ / μm ² ) compared to the biofilm without the raffinose treatment. Although the biofilm produced without raffinose showed a typical P. aeruginosa mushroom morphology, the biofilm produced with 10 μM raffinose treatment was relatively flat. Interestingly, the biofilm produced with 10 [mu] M raffinose treatment exhibited a hollow structure (see arrow in Fig. 2b), and this structure did not appear in biofilms without raffinose treatment.

About phenotypes Raffinose  effect

P. aeruginosa The conformational morphology was observed and a Congo-red staining plate was used to evaluate the effect of raffinos on the exopolysaccharide production. Congo red is a dye that binds to the exopolysaccharide substrate of the bacterial biofilm and forms a corrugated community morphology in P. aeruginosa . As shown in FIG. 2C, a typical pink corrugated morphology was evident for the community without raffinose treatment, whereas a pink, smooth morphology for the raffinose treated community (10 μM) was observed. This is an indication that the production of exopolysaccharide is reduced by raffinose treatment in P. aeruginosa . In addition, the effect of raffinos on exopolysaccharide production was assessed by directly measuring total carbohydrate content in EPS from both planktonic and biofilm cells grown with 0-1,000 μM raffinose in the growth medium. In addition, the production of exoprotein (a component of the biofilm substrate) was also analyzed. In both planktonic and biofilm cells treated with raffinose, the protein content of total carbohydrates and EPS was significantly reduced (Figs. 4A and 4B). When treated with raffinose, total carbohydrates were reduced by 21 - 53% and 22 - 48% (in both planktonic and biofilm cells, respectively) while total protein was decreased by 1 - 41% and 9 - 42% Lt; / RTI &gt; in each of the &lt; RTI ID = 0.0 &gt; Biofilm formation in P. aeruginosa has been reported to be reversed by flocking (Caiazza NC, Merritt JH, Brothers KM, and O'Toole GA (2007). Inverse regulation of biofilm formation and swarming motility by Pseudomonas aeruginosa PA14. J Bacteriol 189 (9): 3603-3612). The effect of raffinos (0 - 1,000 μM) on the herd motility was observed in P. aeruginosa Cells were cultured on 0.5% soft agar plates and evaluated by measuring the length of the resin from the center (Fig. 2D). The resin length of cells grown with raffinose was 1.6-2.4 times longer than those grown without raffinose treatment, and this length increased with increasing raffinose concentration. This suggests that raffinose promoted herd movement on soft agar plates.

On LecA  About Raffinose  Combination

P. aeruginosa produces two carbohydrate binding proteins (lectins): LecA (PA-IL) and LecB (PA-IIL), which are specific for D-galactose and L-fucose respectively (Garber N, Guempel U, Belz A, Gilboa-Garber N, & Doyle RJ (1992) On the specificity of the D-galactose-binding lectin (PA-I) of Pseudomonas aeruginosa and its strong binding to hydrophobic derivatives of D-galactose and thiogalactose. BBA -Gen Subjects 1116 (3): 331-333; Glick J & Garber N (1983) The intracellular localization of Pseudomonas aeruginosa lectins. J Gen Microbiol 129 (10): 3085-3090). LecA shows high affinity for D-galactose and its derivatives, and P. aeruginosa Since it is also involved in biofilm formation, raffinos, a derivative of D-galactose, binds to LecA and causes P. aeruginosa We can assume a mechanism that affects biofilm formation. To test this hypothesis, in the present invention, the binding of raffinose to LecA was first evaluated according to 1D relaxation-edited nuclear magnetic resonance binding experiments using raffinose and purified LecA (Hajduk PJ, Olejniczak ET, & Fesik SW (1997) One-dimensional relaxation- and diffusion-edited NMR methods for screening compounds that bind to macromolecules. J Am Chem Soc 119 (50): 12257-12261; Palmer AG, 3rd, Kroenke CD, & Loria JP (2001) Nuclear magnetic resonance methods for quantifying microsecond-to-millisecond motions in biological macromolecules. Method Enzymol 339: 204-238) (see Fig. 5A). NMR signals of 0.1 mM raffinose were monitored in buffer solution in the presence and absence of 50 [mu] M LecA. Furthermore, 1 mM galactose was added to monitor changes in raffinose signal due to competition at the same binding site. Under the absence of the LecA protein (first row of FIG. 5A), peaks representing Hl and H2 signals of raffinos were observed at 5.33 and 4.13 ppm. These peaks widened and weakened in the presence of the LecA protein (second row in Figure 5a) and signal strength was restored by the addition of a 10-fold excess of galactose (third row in Figure 5a). These results indicate that raffinose binds to LecA and its binding site overlaps with the galactose-binding site. Further, the signal of the proton at the C-1 and C-6 positions of galactose at 5.17 and 3.40 ppm in 50 mM LecA solution was also obtained by adding 1 mM raffinose (Fig. 6). Conversely, galactose (0.1 mM) signals in LecA solution were also enhanced by treatment with a 10-fold excess of raffinose (Fig. 6). These results imply that raffinose and galactose compete for the same region of the LecA protein.

To better understand the binding of raffinose to LecA, raffinos in silico docking studies ( in silico docking studies were performed using the X-ray structure of LecA in a complex with melibiose (PDB: 4AL9). Most of the docked raffinos exhibited common binding patterns where the galactose residue protrudes towards the calcium ion of the LecA active site while the glucose and fructose residues are oriented toward the surface and loop regions of LecA. An optimal docking form for raffinose is shown in Figure 5b. Galactose residues of raffinose strongly interacted with Tyr 36, His 50, Pro 51, Asp 100, Val 101, and Thr 104. Glucose and fructose regions also interacted with Gln 53, Gly 37 and Asn 107, respectively, by hydrogen bonding. The association between the binding of raffinose to LecA and the inhibition of biofilm was further confirmed by using P. aeruginosa strains, one strain being unable to produce LecA and the other strain producing LecA . As shown in FIG. 5C, lecA knockout mutants (strains incapable of producing LecA) showed reduced biofilm formation, and further, biofilm formation was not reduced even with increasing raffinose concentration (P > 0.05) . In contrast, as shown in Fig. 5D, lecA (LecA) carrying pUCP18-LecA (a strain producing LecA ) The knockout mutants formed a biofilm similar to the wild type strains harboring the empty vector (pUCP18). Further, lecA with pUCP18 - LecA The knockout mutation showed a biofilm formation reduction in the concentration-dependent manner (0-1000 [mu] M) in the presence of raffinos (Fig. 5d). These results imply that LecA is essential for biofilm formation, and that in the biofilm suppression, it is necessary for raffinos to bind to LecA.

Cellularity Cyclic Di guanylate  (c- di - GMP ) Decrease in production

Cellular c-di-GMP plays an important role in molecular determinations between planktonic and adherent lifestyles, regulation of motility, and induction of virulence factor production (Romling U, Gomelsky M, & Galperin MY (2005) C-di-GMP: the dawning of a novel bacterial signaling system. Mol Microbiol 57 (3): 629-639). The present inventors have also reported that ginger extract lowers cellular c-di-GMP levels in planktonic and biofilm cells of P. aeruginosa (Kim HS & Park HD (2013) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14. PloS one 8 (9): e76106). Thus, the present invention evaluated the effect of raffinose on cellular c-di-GMP in both planktonic and biofilm cells. Generally, biofilm cells showed higher c-di-GMP levels than planktonic cells (Fig. 7A). In addition, c-di-GMP levels were decreased in both planktonic (47%) and biofilm cells (59%) by treatment with 10 μM raffinose. Additionally, in order to confirm the relevance of raffinose treatment to cellular c-di-GMP regulation, P. aeruginosa over- producing c-di-GMP Mutation ( ΔwspF ) was used. P. wspF from aeruginosa The gene is known to encode a methyl esterase, and it is presumed that the methyl esterase regulates the activity of the WspR protein containing the CheY-like receptor and the di guanylate cyclase (GGDEF) domain (Hickman JW, Tifrea DF , & Harwood CS (2005) A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. P Natl Acad Sci USA 102 (40): 14422-14427). Because ΔwspF causes constitutive activation of WspR protein, ΔwspF leads to an increase in cellular c-di-GMP level and EPS production (Chung IY, Choi KB, Heo YJ, & Cho YH (2008) Effect of PEL exopolysaccharide on the wspF mutant phenotypes in Pseudomonas aeruginosa PA14. J Microbiol Biotechn 18 (7): 1227-1234). As shown in Figure 7b, [ Delta] wspF induces approximately a two-fold increase in biofilm formation compared to wild-type strains. However, biofilm formation of ΔwspF was reduced by 12 -26% by raffinose treatment (0 - 100 μM), although the reduction of biofilm formation did not reach the wild-type strain level. Interestingly, raffinose enhanced the motility of ΔwspF . As shown in Figure 7c, ΔwspF showed limited motility on 0.5% soft agar plates, but ΔwspF grown with 10 μM raffinose showed clearly longer resins.

These results appear to be related to a decrease in cellular c-di-GMP levels by enhanced c-di-GMP-specific phosphodiesterase (PDE) activity of P. aeruginosa . This was tested by measuring the activity of PDE by analyzing the degradation of bis-p-nitrophenol phosphate (bis-pNPP), a PDE-specific substrate, in P. aeruginosa grown with raffinose. Figure 7d shows that P. aeruginosa grown with raffinose increases the activity of bis-pNPP degradation by 1.1 - 2.3 times compared to the same strain grown without raffinose. These results indicate that raffinose reduced P. aeruginosa cellular c-di-GMP levels by inducing PDE activity.

Model strain  Other Gram-negative, positive strains Raffinos  Identification of changes in biofilm formation by treatment

As described above, since the raffinose regulates the amount of C-di-GMP of bacteria, it is possible to observe the biofilm inhibitory effect of raffinose on the Gram-negative bacteria Respectively.

10 is a graph showing changes in biofilm formation by raffinose treatment of various gram negative, positive strains. As shown in FIG. 10, it was confirmed that formation of biofilm was inhibited in all strains which were subjected to the treatment with raffinose, depending on the concentration of raffinose. Therefore, it is suggested that the raffinose of the present invention can be utilized as an effective inhibitor of biofilm formation.

Review

In addition to biofilm reduction, raffinos altered other phenotypes of P. aeruginosa , including the inhibition of wrinkle community formation (Fig. 2d), reduced EPS production (Fig. 4a and 4b), and Increased migratory motility (Figure 2d), and the like. These altered phenotypes are observed when the normally cellular c-di-GMP have reduced levels (Kim HS & Park HD (2013 ) Ginger extract inhibits biofilm formation by Pseudomonas aeruginosa PA14 PloS one 8 (9):. E76106; Ueda A & Wood TK (2009) Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathog 5 (6): e1000483). Thus, it can be inferred that raffinose caused a variety of phenotypic changes by reducing cellular c-di-GMP. This hypothesis suggests that P. aeruginosa, which overexpresses cellular c-di-GMP Confirmed by experiments using the mutation (? WspF ): raffinose reduced biofilm formation (Fig. 7b) and resulted in recovery of herd motility (Fig. 2d).

The level of c-di-GMP is regulated by two enzymes that work in opposition to each other. c-di-GMP is produced from two GTPs by di-guanylate cyclase (DGCs) and is degraded into two GTPs via pGpG by phosphodiesterase (PDEs) (Schirmer T & Jenal U ) Structural and mechanistic determinants of c-di-GMP signaling. Nat Rev Microbiol 7 (10): 724-735). To reduce cellular c-di-GMP levels, two routes are possible: reducing the activity of DGCs with the GGDEF domain, or increasing the activity of PDEs with EAL and / or HD-GYPs domains will be. As a result of experiments, it was shown that increasing the concentration of raffinose resulted in an increase in the PDE activity of P. aeruginosa (Fig. 7d), which means that the latter pathway is a mechanism by which the level of c-di-GMP is reduced by raffinose . This hypothesis is supported by other studies (Chung IY, Choi KB, Heo YJ, & Cho YH (2008) Effect of PEL exopolysaccharide on the wspF mutant phenotypes in Pseudomonas aeruginosa PA14. J Microbiol Biotechn 18 (7): 1227-1234). In the above study, P. aeruginosa ΔwspF Mutations were used to increase PDE activity by cloning pvrR , a PDE gene, among the plasmid vectors. Transformed? WspF Mutations showed decreased c-di-GMP levels with increased PDE activity and increased motility. In explaining that the level of c-di-GMP is reduced by raffinose treatment, the possibility that the activity of DGCs is decreased can not be excluded.

On the other hand, reduced levels of cellular c-di-GMP have been reported to be associated with reduced modes of biofilm formation as well as with the mode of growth and dispersion (Ueda A & Wood TK (2009) Connecting quorum sensing, c-di-GMP, pel polysaccharide, and biofilm formation in Pseudomonas aeruginosa through tyrosine phosphatase TpbA (PA3885). PLoS Pathog 5 (6): e1000483). Biofilm dispersions are initiated by unidirectional cell death and lysis, providing nutrients to the escape cells (McDougald D, Rice SA, Barraud N, Steinberg PD, & Kjelleberg S (2012) go: mechanisms and ecological consequences for biofilm dispersal. Nat Rev Microbiol 10 (1): 39-50). This is related to the hollowing of biofilm microbial communities (Barraud N , et al. (2006) Involvement of nitric oxide in biofilm dispersal of Pseudomonas aeruginosa. J Bacteriol 188 (21): 7344-7353). In the present invention, hollow structures were found in raffinose-treated biofilms (Fig. 2c), raffinose not only reduced biofilm formation by reducing cellular c-di-GMP levels, . This assumption is based on the fact that P. aeruginosa Can be further evaluated by measuring the planktonic cells released from the biofilm. The number of released cells increased 1.8- to 3.6-fold when treated with 100 [mu] M raffinos compared to untreated cells (Fig. 8). Taken together, data according to the present invention show that cellular c-di The fact that galactosidases bind to LecA by regulation of the GMP level and the fact that they inhibit the formation of P. aeruginosa biofilm (i.e., that only LecA-ligand competitive inhibition is not the only mechanism for biofilm inhibition) . Nevertheless, it is unclear whether LecA-raffinose binding caused cdi-GMP reduction or whether raffinose reduced c-di-GMP independently of LecA-raffinose binding.

On the other hand, it is important to note that the LecA protein is involved in biofilm formation. Diggle, etc. (Diggle SP, et al (2006 ) The galactophilic lectin, LecA, contributes to biofilm development in Pseudomonas aeruginosa Environ Microbiol 8 (6):.. 1095-1104) is a P. aeruginosa LecA in biofilm Gene expression was observed, and biofilm formation was increased in LecA- and the production strain, and lecA And decreased in mutations. In the present invention, by using the RT-qPCR analysis method, lecA by raffinose treatment The interference of gene expression was examined (Figs. 9A and 9B). In the wild type P. aeruginosa , lecA Gene expression was reduced by 50%. Interestingly, P. aeruginosa over- producing cellular c-di-GMP The mutation ( Δ wspF ) showed a 1.5-fold increase in lecA gene expression compared to the wild-type strain and a 30% decrease in lecA gene expression after raffinose treatment. In addition, P. aeruginosa lecA The knockout mutant ( ΔlecA ) showed a decrease at the level of cellular c-di-GMP and a 1.5-fold increase in the activity of c-di-GMP-specific PDE compared to the wild type strain. These results showed that raffinose reduced lecA gene expression by binding to LecA , which also resulted in a decrease in cellular cdi-GMP levels and ultimately biofilm inhibition.

Raffinose is a common galacto-oligosaccharide found in a variety of plants (for example, beans, cabbage and broccoli) and plant seeds, also in ginger. It is not yet clear why some plants produce bacterial biofilm inhibitors such as raffinose, and it is worth investigating whether such biofilm inhibitors are produced by chance or evolutionary processes. For whatever reason, the production of biofilm inhibitors appears to confer a survival benefit to the plants. For example, Austrian red algae produce halogenated furanones effective to inhibit biofilm formation (Hentzer M , et al. (2003) Attenuation of Pseudomonas aeruginosa virulence by quorum sensing inhibitors. The EMBO journal 22 (15): 3803-3815), which has been reported to prevent microbial communityization again blocking light to plants. Biofilm inhibitors can be applied in a variety of medical and industrial applications. For example, over 95% of P. aeruginosa has been found to be effective against gentamicin, carbenicillin, ko-tree pasta (&lt; RTI ID = 0.0 &gt; co-trimoxazole, ceftizoxime, and tetracycline therapy (Davies D (2003).) Nat Rev Drug Discov (2003) Understanding biofilm resistance to antibacterial agents 2 (2): 114-122). Biofilm inhibitors that do not affect bacterial growth are emerging as a new alternative to antibiotics in the treatment of infectious diseases involving biofilm formation. These materials can also address biofouling problems and can replace biocides used in membrane filters for a variety of devices such as water treatment, water distribution pipes, ship hulls, washing machines, humidifiers, dishwashers, and the like.

Claims (4)

Wherein the raffinose binds to the sugar receptor protein LecA in the biofilm cell to lower the level of cellular cyclic di-guanylate (c-di-GMP) to inhibit biofilm formation,
It does not affect the growth of the biofilm-forming microorganism at a raffinose concentration of 1 to 100 [mu] M, and the microorganism is Pseudomonas aeruginosa aeruginosa ). &lt; / RTI &gt; The method according to claim 1,
A composition for inhibiting biofilm formation, which inhibits the formation of a biofilm formed on a surface of a medical device, a medical material or a medical implant. The method according to claim 1,
A composition for inhibiting biofilm formation, which inhibits the formation of a biofilm formed on a surface of a water treatment film. The method according to claim 1,
A composition for inhibiting biofilm formation, which inhibits the formation of a biofilm formed on the surface of food and household articles.

Images