KR20180049612A - Composition comprising heme-iron for promoting growth or preservation of lactic acid bacteria - Google Patents

Abstract

The present invention relates to a method for manufacturing a heme iron extract by culturing Corynebacterium glutamicum having a heme iron producing ability and a composition for promoting growth or preservation of lactic acid bacteria comprising the heme iron extract. The method comprises a step of obtaining a culture by culturing Corynebacterium glutamicum in which an expression of a gene encoding ALA synthase (5-aminolevulinic acid synthase) or an activity of the ALA synthase is increased as compared with a parent strain.

Description

[0001] The present invention relates to a composition for promoting the growth or preservation of lactic acid bacteria,

The present invention relates to a method for producing a heme iron extract by culturing Corynebacterium glutamicum having the ability to produce heme iron and a composition for promoting growth or preservation of lactic acid bacteria including a heme iron extract.

Hem is a biological molecule, called quadrupole ring-form and coordination of ferrous iron (Fe ²⁺ ), called porphyrin structure (Chembiochem. 2004; 5 (8): 1069-74). Due to the inherent structure of the outer hydrophobic ring structure and the dense electron cloud in the central region, the heme has been implicated in the electron transport chain of respiration for energy production in prokaryotes and mitochondria, the molecular oxygen cycle of red blood cells in the animal, Detoxification of oxygen species (ROS), and many redox transfer reactions. It has a structure similar to heme except for the chlorophyllmagnesium ion (Mg ^{2 +} ) chelation which acts in photosynthesis of plants and fungi.

Although heme is essential for many biological processes, excessive heme causes harmful effects on cells, i.e., excessive heme addition causes non-specific interaction with oxygen molecules, (Infect Immun. 2010; 78 (12): 4977-89; J Bacteriol. 2014; 196 (7): 1335-42). Thus, cells tightly regulate the intracellular heme concentration in the biosynthetic pathway. Two pathways are known for the hem biosynthetic pathway. The C4 pathway, found in phototrophic bacteria, yeast, and mammals, is initiated by the production of aminolevulinic acid (ALA) by the condensation of succinyl CoA with glycine. The C5-pathway found in most chemical nutrition bacteria, cyanobacteria, and fungi is initiated by the conversion of glutamate to ALA using ATP and NADPH as ancillary-substrates. The ALA synthesis step is the most critical step in the regulation of heme concentration (Sci. Rep. 2015; 5: 8584). Branching steps for the synthesis of chlorophyll, siroheme, and vitamin B ₁₂ , along with the final ferrous ion chelation step, are also involved in the regulation of intracellular heme concentration (J Microbiol Biotechnol. 2015; 25 (6 ): 880-6).

Lactic acid bacteria (LAB) are Gram-positive, aero-tolerant or anaerobic bacteria that produce lactic acid bacteria by fermentation of sugars. Lactic acid bacteria have recently been widely used in fermented foods, such as dairy products and fermented vegetable foods, together with probiotic products. Lactic acid bacteria are genetically deficient in the heme biosynthetic pathway, but some lactic acid bacteria contain the cytochrome oxidase gene in the respiratory chain. It has been reported that supplementation of bovine-derived heme allows proliferation of lactic acid bacteria to respiratory metabolism, resulting in increased biomass production and viability (Curr Opin Biotech. 2011; 22 (2): 143-9; Microb Cell Fact 2009; 8: 28. doi: 10.1186 / 1475-2859-8-28). Based on these reports, the present inventors conducted a study on whether Corynebacterium glutamicum-producing heme could be used as a supplemental electron carrier for the cultivation of lactic acid bacteria. The inventors of the present invention confirmed that the use of a strain that has been adaptively evolved to have tolerance to oxidative stress to enhance the growth of the lactic acid bacterium of Corynebacterium glutamicum or a culture thereof having the ability to produce a heme iron- .

It is an object of the present invention to provide a method for producing a heme iron extract by culturing Corynebacterium glutamicum having an improved ability to produce heme iron compared to a parent strain.

The present invention also aims to provide a composition for promoting the growth of a lactic acid bacterium, which comprises a heme iron extract obtained by culturing Corynebacterium glutamicum having hemolysis ability.

Another object of the present invention is to provide a composition for enhancing preservation of lactic acid bacteria comprising a heme iron extract obtained by culturing Corynebacterium glutamicum having the ability to produce heme iron.

One aspect of the present invention relates to a method for producing a 5-aminolevulinic acid synthase-producing microorganism by culturing Corynebacterium glutamicum, wherein the expression of a gene encoding 5-aminolevulinic acid synthase or the activity of an ALA synthase is increased as compared with the parent strain, ≪ RTI ID = 0.0 > a < / RTI > heme iron extract.

The term " heme iron " as used herein refers to iron complexes of porphyrin and is used interchangeably with heme.

As used herein, the term " parent strain " refers to the original strain prior to transformation by mutagenesis or mutagenesis.

Corynebacterium glutamicum deposited with KCTC 12280BP is a strain that adaptively evolved to increase tolerance to oxidative stress by culturing under oxidative stress in order to increase the productivity of the strain (Korean Patent Laid- 2014-0064527). Specifically, the wild-type Corynebacterium glutamicum ATCC 13032 is adapted to increase resistance to oxidative stress through adaptive evolution through cultivation in which the concentration of H ₂ O ₂ is gradually increased.

Although heme is essential for many biological processes, excessive heme causes deleterious effects on cells, i.e., excessive addition of heme causes non-specific interaction with oxygen molecules, (Infect Immun. 2010; 78 (12): 4977-89; J Bacteriol. 2014; 196 (7): 1335-42). Thus, cells tightly regulate the intracellular heme concentration in the biosynthetic pathway. Two pathways are known for the hem biosynthetic pathway. The C4 pathway, found in phototrophic bacteria, yeast, and mammals, is initiated by the production of aminolevulinic acid (ALA) by the condensation of succinyl CoA with glycine. The C5-pathway found in most chemical nutrition bacteria, cyanobacteria, and fungi is initiated by the conversion of glutamate to ALA using ATP and NADPH as ancillary-substrates. The ALA synthesis step is the most critical step in the regulation of heme concentration (Sci. Rep. 2015; 5: 8584). In addition to the final ferric ion chelation step, sub-steps for the synthesis of chlorophyll, siroheme, and vitamin B ₁₂ are also involved in the regulation of intracellular heme concentration (J Microbiol Biotechnol. 2015; 25 ): 880-6).

Corynebacterium glutamicum, which is resistant to oxidative stress, can grow even under oxidative stress, so that it can tolerate oxidative stress due to the accumulation of heme iron. Therefore, a strain having resistance to oxidative stress is useful as a parent strain of a strain having increased hemolysis productivity.

In one embodiment of the present invention, the parent strain may be Corynebacterium glutamicum deposited with KCTC 12280BP.

Expression of a gene encoding an ALA synthase can be detected by an increase in the number of copies of the gene encoding the ALA synthase and a modification of a factor that controls the expression of the gene, for example, by replacement with a promoter having a high expression intensity, The expression thereof can be increased.

The activity of ALA synthase can be increased by strain of ALA synthase encoding gene or by increasing expression of gene encoding ALA synthase gene compared to parent strain.

In one embodiment of the present invention, the Corynebacterium glutamicum may be one in which the expression of the gene is increased by the introduction of the gene hemA encoding ALA synthase.

In one embodiment of the present invention, the hemA gene may have the nucleotide sequence of SEQ ID NO: 3 (GenBank NC - 007493.2).

The introduction of the hemA gene can be performed by a method that is easily selected by those skilled in the art.

As used herein, the term " heme iron extract " means heme iron itself, or an extract or composition containing heme iron extracted from a culture or the like.

In one embodiment of the present invention, the Corynebacterium glutamicum is produced by introducing the hemA gene into Corynebacterium glutamicum KCTC 12280BP, and compared to the parent strain Corynebacterium glutamicum KCTC 12280BP Can be recombinant Corynebacterium glutamicum with increased heme iron productivity.

In one embodiment of the present invention, the heme iron extract may be in the form of a culture of Corynebacterium glutamicum, a dried product of the culture, an extract of the culture, or a heme iron extract purified from the culture. Since the culture obtained by culturing the Corynebacterium glutamicum includes the heme iron produced by Corynebacterium glutamicum, it can be used as a source of heme iron itself or extracting heme iron therefrom , Or may be used as the heme iron obtained by the purification step after extraction.

In one embodiment of the present invention, the step of culturing Corynebacterium glutamicum may be carried out using media known in the art. The culture method and conditions may be selected by a person having ordinary skill in the art to which the present invention belongs.

In one embodiment of the invention, the method comprises the steps of recovering Corynebacterium glutamicum from the culture, resuspending and rupturing the recovered Corynebacterium glutamicum, obtaining a lysate, and And further obtaining a supernatant containing heme iron from the lysate.

In one embodiment of the present invention, the method may further comprise the step of obtaining a heme iron extract from the supernatant by precipitation and extraction by heating.

In one embodiment of the present invention, the heme iron extract can be obtained by extracting the supernatant obtained from the Corynebacterium glutamicum culture with an acid-acetone mixture.

 One aspect of the present invention relates to a method for producing a 5-aminolevulinic acid synthase-producing microorganism by culturing Corynebacterium glutamicum, wherein the expression of a gene encoding 5-aminolevulinic acid synthase or the activity of an ALA synthase is increased as compared with the parent strain, Which comprises a step of obtaining a fermented extract of a fermented milk fermented with a fermentation broth.

As used herein, the term " preservative power " used in connection with lactic acid bacteria means the degree to which lactic acid bacteria are maintained in a living state, or the number of viable cells according to preservation.

In one embodiment of the present invention, the lactic acid bacteria may be Lactobacillus lactis or Lactobacillus plantarum.

In one embodiment of the present invention, the heme iron extract may be in the form of a culture of Corynebacterium glutamicum, a dried product of the culture, an extract of the culture, or a heme iron extract purified from the culture. Since the culture obtained by culturing the Corynebacterium glutamicum includes the heme iron produced by Corynebacterium, it is used as a source of heme iron itself or further extracted from the heme iron , Or may be used as a heme iron obtained through extraction and purification steps.

In one embodiment of the present invention, the step of culturing Corynebacterium glutamicum may be carried out using media known in the art. The culture method and conditions may be selected by a person having ordinary skill in the art to which the present invention belongs.

In one embodiment of the invention, the heme iron extract comprises the steps of recovering Corynebacterium glutamicum from a Corynebacterium glutamicum culture, resuspending and breaking the Corynebacterium glutamicum, To obtain a supernatant containing heme iron from the resulting disruption, and extracting heme iron from the supernatant by heating, precipitation, extraction and freeze-drying.

In one embodiment of the present invention, the heme iron extract can be obtained by extracting the supernatant obtained from the Corynebacterium glutamicum culture with an acid-acetone mixture.

One aspect of the present invention relates to a method for producing a 5-aminolevulinic acid synthase-producing microorganism by culturing Corynebacterium glutamicum, wherein the expression of a gene encoding 5-aminolevulinic acid synthase or the activity of an ALA synthase is increased as compared with the parent strain, Comprising the step of preserving lactic acid bacteria in the presence of a preservation potentiating composition for lactic acid bacteria comprising a heme iron extract prepared by a method for producing heme iron, comprising the step of obtaining heme iron from said culture , And a method for enhancing preservation of lactic acid bacteria.

In one embodiment of the present invention, the lactic acid bacteria may be Lactobacillus lactis or Lactobacillus plantarum.

One aspect of the present invention is a method for producing a lactic acid bacterium comprising the steps of preparing a culture solution of lactic acid bacteria and culturing the cultured lactic acid bacteria in a culture medium containing lactic acid bacterium containing a heme iron extract prepared by culturing Corynebacterium glutamicum, Of a preservative-enhancing composition of the present invention.

As used herein, the term " probiotic agent " means a formulation consisting of a living microorganism that has a beneficial effect on the health of the host through the balance of intestinal microorganisms, for example, a living organism for feeding livestock May be lactic acid bacteria.

In one embodiment of the present invention, the lactic acid bacteria may be Lactobacillus lactis or Lactobacillus plantarum.

One aspect of the present invention is a method for producing a cell line, comprising the steps of culturing Corynebacterium glutamicum, in which the expression of a gene encoding ALA synthase or the activity of an ALA synthase is increased as compared with the parent strain, And a step of obtaining heme iron from the heme iron extract, wherein the heme iron extract is prepared by a method for producing heme iron.

In one embodiment of the present invention, the parent strain may be Corynebacterium glutamicum deposited with KCTC 12280BP.

In one embodiment of the invention, the lactic acid bacteria may be Lactobacillus lactis, Lactobacillus rhamosus or Lactobacillus casei.

In one embodiment of the present invention, the step of obtaining the heme iron comprises the steps of recovering Corynebacterium glutamicum from the culture, resuspending and recovering the recovered Corynebacterium glutamicum to obtain a crushed product , And obtaining a supernatant comprising heme iron from the lysate.

In one embodiment of the present invention, it is possible to further include a step of obtaining a heme iron extract from the supernatant by precipitation and extraction by heating.

The composition according to one embodiment of the present invention may further comprise additional active ingredients or excipients.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are intended to illustrate the invention and should not be construed as limiting the invention.

The present invention provides heme iron produced by culturing Corynebacterium glutamicum having increased hematocrit production ability as compared with parent strain, thereby enabling the growth promotion of lactic acid bacteria or the improvement of preservation ability to be efficiently achieved.

FIG. 1 shows a spectral scan result of a heme iron extract produced in a culture of recombinant Corynebacterium glutamicum according to an embodiment of the present invention.
Figure 2 shows the yields of biomass and heme iron obtained in the cultivation of recombinant Corynebacterium glutamicum HA_pSL360-hemA (.circle-solid.) And control Corynebacterium glutamicum ATCC 13032 (○) according to one embodiment of the present invention Respectively.
Fig. 3 is a graph showing the results of cultivation of lactic acid bacteria (.circle-solid.) Stored in the presence of the heme iron extract obtained in the culture of recombinant Corynebacterium glutamicum HA_pSL360-hemA according to an embodiment of the present invention and lactic acid bacteria (●) stored in the absence of heme iron extract, , L. lactis, L. rhamosus, L. casei, and L. plantarum.

Example  One. In the mother strain  Improved compared to Hempel Production capacity  Recombination Corynebacterium  Glutamicum Construction

In order to construct a Corynebacterium glutamicum strain having high heme iron production ability, Corynebacterium glutamicum HA (KCTC 12280BP) obtained by adaptive evolution which is resistant to oxidative stress as a parent strain was used . Corynebacterium glutamicum HA is a strain obtained by adaptive evolution from wild-type Corynebacterium glutamicum (ATCC 13032) (Biotechnol Lett. 2013; 35 (5): 709-17).

1-1. Construction of recombinant strains

In order to increase the yield of hemolysis, a gene encoding ALA synthase involved in ALA synthesis, which is a rate determining step in the biosynthesis of heme iron, was introduced into Corynebacterium glutamicum HA.

The hemA gene coding for the ALA synthase was purchased from J Microbiol Biotechnol. The primers CTGCAG AGGAAA CAGACCATGGACTACAATCTGG and CTGCAGAAA CCTAGG GGATCCGCCAGCGGATCCTAG of SEQ ID NOs: 1 and 2 (underlined portions are Pst I (SEQ ID NOs: 1 and 2) using pTrc (P _lac hemA ⁺ - coaA ) The recognition site, and the area denoted by the thick letter indicates the ribosome binding site). The amplified PCR product was subcloned into TA-vector (T-blunt PCR Cloning Kit, Solgent, Daejeon, Korea) and transformed into E. coli DH10B. E. coli DH10B was cultured in LB (Luria-Bertani) medium at 37 占 폚.

After confirming the sequence, the subcloned vector was treated with Pst I and the DNA fragment (1.7 kb) was ligated to the Corynebacterium expression vector Pst I-treated pSKlcat-P ₁₈₀ (J Microbiol Biotechn. 2004; 14 4): 789-95) to give pSL360- hemA . The constructed vectors were transformed into Corynebacterium glutamicum HA strains for the production of heme iron, and recombinant Corynebacterium glutamicum HA_pSL360- hemA .

1-2. Cultivation of recombinant strains and production of heme iron extract

(1) Culture of a recombinant strain

Recombinant Corynebacterium glutamicum obtained in 1-1 was cultured in an MCGC minimal medium (40 g glucose, 4 g (NH ₄ ) ₂ SO ₄ , 3 g KH ₂ PO ₄ , Na ₂ HPO ₄ 6 g, NaCl 1 g, sodium citrate dihydrate 1 g, biotin 0.2 mg, thiamine and HCl 1 mg, FeSO ₄ and 7H ₂ O 20 mg, MgSO ₄ and 7H ₂ O 0.2 g, MnSO ₄ and H ₂ O 2 mg, FeCl ₃ 2 mg, ZnSO ₄揃 7H ₂ O 0.5 mg, CuCl ₂揃 2H ₂ O 0.2 mg, (NH ₄ ) ₆ Mo ₇ O ₂₄揃 4H ₂ O 0.1 mg, Na ₂ B ₄ O _7, 10 H ₂ O, and CaCl ₂ 70 mg) at 30 ° C. As a control, Corynebacterium glutamicum ATCC 13032 was cultured under the same conditions.

The biomass of Corynebacterium glutamicum was measured at OD (optical density) at 600 nm. The dry cell weight of Corynebacterium glutamicum was converted to the extinction coefficient of 1 OD _{600 nm} = 0.25 mg / mL (AMB Express. 2014; 4:15).

ALA synthase activity was determined by incubating 20 mM MgCl ₂ , 0.1 M disodium succinate, 0.1 M glycine, 0.1 mM pyridoxal phosphate, 15 mM ATP, 0.2 mM CoA, and 50 μl of cells in 50 mM Tris-HCl (J Microbiol Biotechnol. 2007; 17 (9): 1579-84). ≪ / RTI > The enzyme reaction mixture was visualized by adding Ehrlich reaction buffer (0.02 g of para-dimethylaminobenzaldehyde, 0.84 mL of glacial acetic acid, 0.16 mL of 70% (v / v) perchloric acid), and the absorbance at 555 nm . The protein content of the extract was measured using Protein Assay Kit (Bio-Rad Inc., Hercules, CA, USA) using bovine serum albumin (BSA) as a standard. One unit of ALA synthase activity was defined as the amount of enzyme that converted 1 μmole of ALA per minute.

Recombinant Corynebacterium glutamicum is a vector that expresses a gene ( hemA ) encoding ALA synthase under the control of the P180 promoter (constitutive promoter) to bypass the rate determining step of the hem biosynthetic pathway, The extract of recombinant Corynebacterium glutamicum, which was constructed by introducing into four bacterium glutamicum HA and actively growing, showed that when the extract of wild type Corynebacterium glutamicum did not show the activity of ALA synthase ALA synthase activity, indicating that the hemA gene was functionally expressed.

The activity of ALA synthase was measured as follows.

The Corynebacterium glutamicum cells of the exponential growth period were separated by centrifugation (5000 rpm, 10 min, 4 ° C) and 10% (w / w) of glass beads (212-300 mm, Sigma-Adrich Co.) And then shaken for 30 minutes in a bead pulverizer (Mini-BeadBeater16, Biospec, Bartlescille, OK, USA). After removing the crushed cell suspensions by centrifugation (12000 rpm, 10 min, 4 ° C), the enzyme activity contained in the remaining cell extracts was measured using an enzyme reaction solution (50 mM Tris-HCl (pH 7.5), 20 mM MgCl ₂ , 0.1 M Disodium succinate, 0.1 M glycine, 0.1 mM pyridoxal phosphate, 15 mM ATP, 0.2 mM CoA, and 50 [mu] l cell extract) were reacted at 37 [deg.] C for 30 minutes to induce ALA synthesis. The concentration of synthesized ALA was determined by measuring the absorbance of the synthesized ALA in a spectrophotometer at 550 nm after color development with an Ehrlich reaction solution (UV-2450, Shimadzu, Kyoto, Japan). The results are summarized in Table 1 below.

cell ALA concentration (μmol / min. OD1) C. glutamicum 13031 (wild type) 0 ± 0.05 C. glutamicum HA (evolutionary adaptive) 0 ± 0.03 C. glutamicum 13031 + hema 1.77 ± 0.09 C. glutamicum HA + hema 1.82 + 0.11

Recombinant Corynebacterium containing plasmid containing hemA gene was initially grown on MCGC minimal medium and turned yellow within 72 hours after incubation. The red pigment was considered to be heme, and the pigment was separated and spectral analysis was performed as described below.

(2) Production of heme iron extract and confirmation of heme iron

The culture of the recombinant Corynebacterium glutamicum obtained by the culture in (1) and the culture of wild-type Corynebacterium glutamicum ATCC 13032 were each centrifuged at 3,000 g at 4 ° C for 15 minutes, Corynebacterium glutamicum, which had been stained with Triton X-100, was washed and washed twice with distilled water.

The cells were suspended in 15 ml of distilled water and shaken on ice for 20 minutes using an ultrasonic sonicator (UP200S, Hielscher Ultrasonics GmbH, Teltow, Germany) set at 30 W at 1 second intervals. The cell lysates were removed by centrifugation at 10,000 g for 10 minutes at 4 ° C, and the supernatant was stored in a 65 ° C water bath for 30 minutes. Thereafter, centrifugation was performed at 4O < 0 > C and 10,000 g for 10 minutes to remove the protein precipitate, and the supernatant was used to obtain a heme iron extract.

Hem-iron, a red pigment, was extracted using a cold acid-acetone extraction method (Di Iorio, E. E., Methods Enzymol, 1981. 76: p. 57-72). The supernatant of the cell extract obtained above was added dropwise to 100 ml of acid-acetone (99.8 ml of acetone + 0.2 ml of 10 N HCl) with stirring at -20 ° C. The solution was then centrifuged at 10,000 g for 30 minutes at -20 < 0 > C. The extraction procedure was repeated to completely remove red from the precipitate. The acid-acetone obtained in the above procedure was neutralized by the addition of 10N NaOH and evaporated using a rotary evaporator. The remaining solution after evaporation was lyophilized to give a purified heme iron extract.

Protein content of each extract was determined using Bio-Rad protein assay kit (Bio-Rad, Hercules, Calif., USA) using bovine serum albumin as standard. The amount of iron _{[Fe (NH 4) 2 (} SO 4) 2 · 6H 2 O] using as a standard the ortho-phenanthroline colorimetry (Volkova, TNand NV Patrina, Lab Delo, 1967. 2: 97-8) using the Respectively.

The heme concentration was measured using a C18 column (Xbridge, Waters Co.) and an HPLC system (Waters Co., Milford, Mass., USA) equipped with a UV detector at 400 nm (J Microbiol Biotechnol. ): 880-6). The eluent (1 M ammonium acetate mixed with 86% methanol, v / v, pH 5.16) is isocratically flowed at a flow rate of 1 mL / min. Hemine chloride from cows (Sigma-Aldrich, St. Louis, Mo., USA) was used to generate quantitative standard curves.

To confirm that the red color observed in the culture of the recombinant Corynebacterium glutamicum was due to heme iron, the spectrum of the extract was examined using a UV1240 spectrometer (Shimadzu Corp., Kyoto, Japan). The spectrum of the extract obtained from the recombinant Corynebacterium glutamicum showed a main peak at 407 nm and a small peak at 500 and 503 nm, consistent with the characteristic spectrum of heme (Berry and Trumpower, Simultaneous determination Analis Biochem 161 (1): 1-15, 1987). Figure 1 shows the spectrum of the extract containing heme iron produced in the culture of recombinant Corynebacterium glutamicum. As a result, the red dye produced in the culture of recombinant Corynebacterium glutamicum was identified as heme iron.

Since excess heme may have caused oxidative stress (P Natl Acad Sci USA 2013; 110 (20): 8206-11), oxidative stress-resistant Corynebacterium glutamicum strains were used as parent strains, Led to accumulation. HA strain (Biotechnol Lett. 2013; 35 (5): 709-17) adaptively evolved under H ₂ O ₂ stress was used as parent strain of Corynebacterium glutamicum expressing ALA synthase. FIG. 2 shows the biomass and hemolysis yields of cultured recombinant Corynebacterium glutamicum and wild-type Corynebacterium glutamicum (ATCC 13032) prepared in 1-1 above. The culture (OD = 47.7) of the recombinant Corynebacterium glutamicum HA strain expressing ALA synthase produced a level of biomass similar to the wild type Corynebacterium glutamicum strain (OD = 47.6). However, the amount of heme was 0.74 ± 0.15 mg _{- heme} / g- _DCW for the recombinant HA strain and 0.33 ± 0.08 mg _{- heme} / g- _DCW for the wild-type strain. Thus, the recombinant Corynebacterium glutamicum HA strain produced more than twice as much heme as the wild type Corynebacterium glutamicum strain.

Example  2. Hemp  production

For rap-scale heme iron production, the recombinant Corynebacterium glutamicum strain having pSL360- hemA obtained in Example 1 was added to MCGC minimal medium (40 g glucose, (NH ₄ ) ₂ SO ₄ 4 g, KH ₂ PO ₄ 3 g, Na ₂ HPO ₄ 6 g, NaCl 1 g, sodium citrate dihydrate 1 g, biotin 0.2 mg, thiamine HCl 1 mg, FeSO ₄揃 7H ₂ O 20 MgSO ₄揃 7H ₂ O 0.2 g, MnSO ₄揃 H ₂ O 2 mg, FeCl ₃ 2 mg, ZnSO ₄揃 7H ₂ O 0.5 mg, CuCl ₂揃 2H ₂ O 0.2 mg, (NH ₄ ) ₆ Mo ₇ 0.1 mg of O ₂₄揃 4H ₂ O, 0.2 mg of Na ₂ B ₄ O ₇揃 10H ₂ O, and 70 mg of CaCl ₂ ) in an Erlenmeyer flask. The flasks were incubated for 72 hours in a 30 DEG C shaking incubator and biomass was collected for extraction of heme iron. After collecting the biomass by centrifugation (10,000 xg, 4 캜, 10 min), the cells were dispersed in 1 N NaOH solution (1 mL) and incubated with a bead bitter (Minibeadbeater-16, BioSpec Products Inc., Bartlesville, ) For 1 minute. Cell debris was centrifuged at 10,000 x g for 10 min at 4 ° C and the supernatant (200 mL) of the dispersed cells was dissolved in 400 mL of acetonitrile: dimethylsulfoxide (DMSO) (4: 1, v / v) , Vortexed and centrifuged at 10,000 xg for 10 minutes at 4 < 0 > C. The upper layer was removed and the bottom layer was filtered with a PTFE (polytetrafluoroethylene) membrane filter (J Microbiol Biotechnol. 2015; 25 (6): 880-6). HPLC quantification was performed with the filtrate or used as a heme iron extract.

The spectrum of the heme extract of purified Corynebacterium glutamicum was monitored using a spectrophotometer (UV1240, Shimadzu, Kyoto, Japan) (Biochem Biophys Res Commun. 1975; 67 (2): 747-51). The iron content of the Corynebacterium glutamicum-derived hemp extract was confirmed by the ortho-phenanthroline colorimetric method using [Fe (NH ₄ ) ₂ (SO ₄ ) ₂ .6H ₂ O] as a standard (Lab Delo 1967; 2: 97-8).

Example  3. Promote growth of lactic acid bacteria

Some of the stricter fermentative lactic acid bacteria have been reported to be capable of aerobic growth when a respiratory component (e. G., Bovine hem, or menaquinone) is supplied from the outpatient to the medium (Curr Opin Biotech. The production of corynebacterium glutamicum-producing heme extracts was also increased by the addition of lactic acid biomass production (Fig. In order to confirm whether the biomass could be increased, four lactic acid bacteria were aerobically cultured and the biomass was compared with the anaerobically cultivated biomass.

To compare biomass, four lactic acid bacteria were cultured in deMan Rogosa Sharpe (MRS) medium (Difco, BD BioSciences, San Jose, CA, USA). Lactic acid bacteria were aerobically cultivated for 48 hours at 220 rpm using a 15 mL-test tube with a cotton plug. The temperature was measured by Lactobacillus casei , L. rhamosus The culture was maintained at 37 ° C, and Lactococcus lactis subsp. Culture of lactis And kept at 30 캜. The Corynebacterium glutamicum-derived heme extract obtained in Example 2 was added to the MRS medium to be 0, 2.5 or 5 mg-heme / mL. To measure anaerobic cultures, lactobacilli were incubated in anaerobic glass tubes (Bellco Glass Inc., Vineland, NJ, USA) sealed with rubber stoppers and aluminum caps. Air in the headspace was flushed with nitrogen for 5 minutes. To avoid oxygen contamination, inoculation and sample collection were performed using a 1 mL syringe. The temperature was kept the same as the aerobic culture. Biomass of lactic acid bacteria was measured at OD (optical density) at 600 nm. The biomass of the lactic acid bacteria was determined from three or more repeated experiments. The results are summarized in Table 2 below.

Strain anaerobe Expiration
(Heme extract 0 [mu] g / mL) Expiration
(Heme extract 2.5 [mu] g / mL) Expiration
(Heme extract 5.0 [mu] g / mL) Lactococcus lactis subsp. lactis (KCTC 3769) 1.67 ± 0.02 1.82 + 0.08 2.94 + - 0.13 3.30 ± 0.57 Lactobacillus rhamosus (KCTC 5033) 12.27 ± 0.39 12.17 ± 0.05 13.64 + 0.13 14.16 ± 0.35 Lactobacillus casei (KCTC 3109) 10.68 ± 0.50 6.25 + - 0.40 6.95 + - 0.31 11.07 ± 1.22 Lactobacillus plantarum (KCTC 33131) 10.25 + 0.13 6.92 ± 0.27 8.35 ± 0.49 8.52 ± 0.01

Data are mean ± SD of biomass measured by OD _{600 nm} from three or more repeated measurements

The addition of the heme iron extract (5 mg / mL) produced by the recombinant Corynebacterium glutamicum obtained in Example 1 was inhibited by Lactococcus lactis , Lactobacillus rhamosus , and L. casei were able to produce 97%, 15%, and 4% more biomass than the biomass produced by anaerobic cultivation, respectively. However, biomass of L. plantarum from aerobic culture was lower than biomass from anaerobic culture. Biomass increased by heme iron addition was dose-dependent, suggesting that biomass increase could be increased by supplementing higher amounts of Corynebacterium glutamicum-producing heme iron extracts.

Example  4. Lactic acid bacteria Conservative power  Improving

To confirm the effect of the addition of the recombinant Corynebacterium glutamicum-producing heme iron extract on the viability of the lactic acid bacteria, the lactic acid bacteria cells were anaerobically cultured in a rubber-capped tube containing the MRS medium. Heme extract (5 μg-heme / L) was added to the culture, the membrane was transferred to a membrane with cotton and stored at 4 ° C without shaking. Control cultures to which no heme extract was added were kept in tubes with rubber spats during storage at 4 ° C. The culture was aseptically sampled (0.1 mL), diluted in sterile saline, and plated on MRS-agar plates. Plates were incubated for 3 days and colonization was counted.

To identify potential retention, Corynebacterium glutamicum-producing heme iron extracts were added to 4 ° C storage culture and living cells were counted (Figure 3). Cultures of L. lactis and L. plantarum containing heme showed a slowing decrease at 4 ℃ storage. Cultures of L. rhamosus and L. casei were not significantly decreased during 15-day storage regardless of the addition of heme. The results are shown in Fig.

Three of the four tested lactic acid bacteria biomass were increased by the addition of the extract of Corynebacterium glutamicum with the ability to produce heme (Table 2). The extent of biomass increase with heme addition was dependent on the species of lactic acid bacteria tested. The species differences of these lactic acid bacteria will depend on the genomic information of the lactic acid bacteria against the minimum respiration machinery. As long as the lactic acid bacteria have a respiratory tract, the addition of foreign heme allows the cells to multiply under respiratory metabolism to produce more energy than anaerobic metabolism, resulting in an increase in biomass in the same medium. The effect of the hemorrhagic extract derived from Corynebacterium glutamicum differs depending on the lactic acid bacteria species, but the reason for the higher survival rate (Fig. 3) during storage of the lactic acid bacteria by heme iron derived from Corynebacterium glutamicum (J Bacteriol. 2007; 189 (14): 5203-9), which is the proton motive force used for maintenance energy during cryopreservation, Therefore, as long as the lactic acid bacteria have a respiratory system, the Colebacterium glutamicum-producing heme extract increases the productivity of biomass, provides conservation energy to increase viability, and is useful as a starter culture for probiotics The medium can be reduced.

<110> Catholic University Industry-Academic Cooperation Foundation <120> Composition comprising heme-iron for promoting growth or          preservation of lactic acid bacteria <130> PN160274 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primer for hemA <400> 1 ctgcagagga aacagaccat ggactacaat ctgg 34 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primer for hemA <400> 2 ctgcagaaac ctaggggatc cgccagcgga tcctag 36 <210> 3 <211> 1224 <212> DNA <213> Rhodobacter sphaeroides <220> <221> gene &Lt; 222 > (1) .. (1224) <223> hema <400> 3 atggactaca atctggcact cgataccgct ctgaaccggc tccataccga gggccggtac 60 cggaccttca tcgacatcga gcggcgcaag ggtgccttcc cgaaagccat gtggcgcaag 120 cccgacggga gcgagaagga aatcaccgtc tggtgcggca acgactatct cggcatgggc 180 cagcatccgg tggtgctggg ggccatgcac gaggcgctgg attcgaccgg cgccgggtcg 240 ggcggcacgc gcaacatctc gggcaccacg ctctatcaca agcgcctcga ggccgagctc 300 gccgacctgc acggcaagga agcggcgctg gtcttctcgt cggcctatat cgccaacgac 360 gcgaccctct cgacgctgcc gcagctgatc ccgggcctcg tcatcgtctc ggacaagttg 420 aaccacgctt cgatgatcga gggcatccgc cgctcgggca ccgagaagca catcttcaag 480 cacaatgacc tcgacgacct gcgccggatc ctgacctcga tcggcaagga ccgtccgatc 540 ctcgtggcct tcgaatccgt ctattcgatg gatggcgact tcggccgcat cgaggagatc 600 tgcgacatcg ccgacgagtt cggcgcgctg aaatacatcg acgaggtcca tgccgtcggc 660 atgtacggcc cccgcggcgg cggcgtggcc gagcgggacg ggctgatgga ccggatcgac 720 atcatcaacg ggacgctggg caaggcctat ggcgtgttcg gcggctatat cgcggcctcg 780 tcaaagatgt gcgacgcggt gcgctcctac gcgccgggct tcatcttctc gacctcgctg 840 ccgcccgtcg tggcggccgg tgcggcggcc tcggtgcgcc acctcaaggg cgatgtggag 900 ctgcgcgaga agcaccagac ccaggcccgc atcctgaaga tgcgcctcaa ggggctcggc 960 ctgccgatca tcgaccacgg ctcgcacatc gtgccggtcc atgtgggcga ccccgtgcac 1020 tgcaagatga tctcggacat gctgctcgag catttcggca tctatgtcca gccgatcaac 1080 ttcccgaccg tgccgcgcgg gaccgagcgg ctgcgcttca ccccgtcgcc cgtgcatgat 1140 tccggcatga tcgatcacct cgtgaaggcc atggacgtgc tctggcagca ctgtgcgctg 1200 aatcgcgccg aggtcgttgc ctga 1224

Claims (13)

Comprising culturing Corynebacterium glutamicum, wherein the expression of the gene encoding ALA synthase (5-aminolevulinic acid synthase) or the activity of the ALA synthase is increased relative to the parent strain, to obtain a culture , A method for producing a heme iron extract. The method according to claim 1, wherein the parent strain is Corynebacterium glutamicum deposited with KCTC 12280BP. The method according to claim 1, wherein the Corynebacterium glutamicum has increased expression of the gene by introducing a gene hemA encoding ALA synthase. The method according to claim 1, wherein the heme iron extract is in the form of a culture of Corynebacterium glutamicum, an extract thereof, or a heme iron isolated and purified therefrom. The method of claim 1, wherein the method comprises the steps of recovering Corynebacterium glutamicum from the culture, resuspending and crushing the recovered Corynebacterium glutamicum, and obtaining a lysate from the lysate Further comprising the step of obtaining a supernatant comprising heme iron. The method according to claim 5, further comprising the step of obtaining a heme iron extract by precipitation and extraction from the supernatant by heating. A composition for improving the preservation ability of a lactic acid bacterium, comprising a heme iron extract produced by the method according to any one of claims 1 to 6. The composition according to claim 7, wherein the lactic acid bacterium is Lactobacillus lactis or Lactobacillus plantarum. A method for improving the preservation of lactic acid bacteria, comprising the step of preserving the lactic acid bacteria in the presence of the heme iron extract prepared by the method according to any one of claims 1 to 6. Preparing a culture of a lactic acid bacterium; and adding the composition of claim 7 to the culture of the lactic acid bacterium. The method according to claim 10, wherein the lactic acid bacterium is Lactobacillus lactis or Lactobacillus plantarum. A composition for promoting growth of a lactic acid bacterium, comprising a heme iron extract prepared by the method according to any one of claims 1 to 6. The composition according to claim 12, wherein the lactic acid bacterium is Lactobacillus lactis, Lactobacillus rhamosus or Lactobacillus casei.

Images