KR20180027670A - A programmable nuclease targeting hepatitis B virus and a composition for treating HBV infection comprising the same - Google Patents

Abstract

The present invention relates to a gene scissor targeting hepatitis B virus (HBV). Specifically, the present invention relates to a polynucleotide encoding a guide RNA targeting HBV, an expression vector containing the same, and a vaccine composition for treating HBV infection comprising the expression vector. The present invention also relates to a method for treating HBV infection using the vaccine composition. The HBV-specific gene scissors of the present invention can effectively remove HBV in the human body, and it is not necessary to additionally take a reverse transcriptase inhibitor which has been previously used for a lifetime after the virus is eradicated. Therefore, the gene scissor can be useful as agents for treating HBV infection.

Description

[0001] The present invention relates to a gene scissor targeting HBV and a composition for treating HBV infection comprising the same,

The present invention relates to gene scissors that target HBV (hepatitis B virus), and more particularly to a polynucleotide encoding a guide RNA that targets HBV, an expression vector containing the same, Vaccine compositions. The present invention also relates to a method of treating HBV infection using the vaccine composition.

Korea has the highest mortality rate of liver cancer among OECD countries and the economic loss due to liver cancer is 5.5 trillion, so the burden of national medical expenses is increasing rapidly. About 70% of domestic liver cancer is caused by hepatitis B virus (HBV), and it is known that more than 2 million people worldwide are infected with HBV every year. With the development of HBV vaccine, the HBV retention rate has been reduced to about 3%, but the number of carriers still reaches about 1.25 million. The major obstacle to the treatment of patients with hepatitis B is the frequent occurrence of antimicrobial resistance to HBV therapy, especially in Korea, which is highly resistant to hepatitis B treatment. Therefore, there is a continuing need to develop new therapeutic agents for HBV infection.

Currently, HBV therapeutic agents are reverse transcriptase inhibitors and exhibit drug effects by inhibiting the replication of hepatitis virus. However, since HBV infection itself can not be eradicated, it is inconvenient to take a lifetime to prevent new hepatitis virus survival in hepatocytes. In addition, the long-term use of hepatitis virus drugs may result in the emergence of new mutant viruses with drug resistance, which may impair therapeutic effects and limit drug use. Therefore, in order to eradicate HBV, there is a desperate need for a covalently closed circular DNA (cccDNA) which is a residual form of HBV.

On the other hand, programmable nuclease is a technique that not only can induce a mutation at a desired position in a chromosome, but also corrects a gene having a mutation to normal or inserts a necessary gene at a desired position. Studies are underway to treat the disease by correcting mutations using it.

The gene scissors are divided into three groups: the first generation ZFN (Zinc finger nuclease) and the second generation TALEN (transcription activator-like effector nucleases), and now the third generation gene scissors CRISPR / Cas9, that is, the RNA guided endonuclease Is developing at a very rapid rate. RGEN has many advantages such as ease of use and efficiency, and the ability to target multiple genes at the same time, and technology is rapidly spreading. In particular, the high efficiency and safety of RGEN has made great progress in the field of biotechnology, and it is in the process of starting to use RGEN technology as a treatment method of diseases.

Under these circumstances, the present inventors have made intensive efforts to develop new agents capable of treating HBV infection. As a result, they have analyzed all over 5,000 HBV nucleotide sequences published in global gene databases and applied HBV-specific gene scissors The nucleotide sequence that can be identified was identified. Based on the above sequence, it was confirmed that HBV can be cleaved to target using CRISPR / Cas9 technology, and the present invention has been completed.

One object of the present invention is to provide a separated polynucleotide encoding a guide RNA comprising a base sequence selected from the group consisting of SEQ ID NOS: 1 to 21 or a complementary base sequence thereof.

Another object of the present invention is to provide an expression vector comprising the polynucleotide.

Yet another object of the present invention is to provide a vaccine composition for the treatment of HBV infection, which comprises an expression vector comprising said expression vector and a polynucleotide encoding Cas9 nuclease or Cas9 nicase.

Yet another object of the present invention is to provide a vaccine composition for the treatment of HBV infection, which comprises an expression vector comprising the guide RNA and a polynucleotide encoding Cas9 nuclease or Cas9 nicase.

It is still another object of the present invention to provide a method for treating HBV infection comprising the step of administering the vaccine composition for treating HBV infection to an animal.

The present inventors have identified 14 guide RNA target positions that can be targets of gene scissors to treat HBV (hepatitis B virus) infection using a programmable nuclease. Thus, HBV infection can be effectively treated by cutting the guide RNA target position with gene scissors.

This will be described in detail as follows. On the other hand, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present invention fall within the scope of the present invention. Further, the scope of the present invention is not limited by the detailed description described below.

One aspect of the present invention for achieving the above object is an isolated polynucleotide encoding a guide RNA comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 21 or a complementary nucleotide sequence thereof.

The term " RNA-guided nuclease " in the present invention refers to a nuclease capable of recognizing and cleaving a specific position on a desired genome, particularly a nuclease having a target specificity by a guide RNA. The RNA-guided nuclease may be, but is not limited to, Cas protein derived from CRISPR, specifically the microbial immune system, and more specifically, Cas 9 (CRISPR-Associated Protein 9) nuclease and its variant Which may include a Cas9 nickase.

As used herein, the term "Cas protein" is a major protein component of the CRISPR / Cas system and is a protein that can act as an activated endonuclease. The Cas protein can express its activity by forming a complex with crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA).

The Cas9 nuclease recognizes a specific nucleotide sequence in the genome of animal and plant cells including human cells, resulting in a double strand break (DSB). The double helix cleavage includes both the blunt end or the cohesive end of the double helix of DNA. DSBs are efficiently repaired by homologous recombination or non-homologous end-joining (NHEJ) mechanisms within the cell, which allows the researcher to introduce desired mutations into the target site. The RNA-guided nuclease may be artificial or engineered non-naturally occurring.

Wherein the Cas9 nicase comprises at least one mutation in one of the catalytic domains of Cas9 nuclease wherein at least one of the mutations is selected from the group consisting of D10A, E762A and D986A in the RuvC domain, One or more mutations are selected from the group consisting of H840A, N854A and N863A in the HNH domain. In the present invention, the Cas9 niche may have a D10A mutation, but is not limited thereto. Unlike Cas9 nuclease, Cas9 nicase causes a single strand break. Thus, Cas9 niches require two guide RNAs to function and function as a pair. The two guide RNAs direct sequence specific binding of the CRISPR complex to each target sequence and direct the cleavage of one strand of the DNA duplex near each target sequence to create two nicks in the different strands of DNA, Lt; / RTI >

Cas protein or gene information can be obtained from known databases such as GenBank of the National Center for Biotechnology Information (NCBI). Specifically, the Cas protein may be a Cas9 protein. In addition, the Cas proteins include, but are not limited to, Staphylococcus spp ., Streptococcus spp ., Neisseria spp ., Pasteurella spp., Francisella spp. May be a Cas protein derived from Campylobacter spp., More specifically, a Staphylococcus sp. Cas9 protein. However, the present invention is not limited to the examples described above. In the present invention, the Cas protein may be a recombinant protein.

In order to treat HBV (hepatitis B virus) infection using the Cas protein, the present inventors first used a HBV genome sequence to identify a potential target site for Cas protein highly conserved in genotypes A to H (Fig. 2 ). The target positions identified in the present invention are 7 positions for Cas9 nucleases (named ST1 to ST7, respectively, having the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 7, respectively), 7 for Cas9 nicase SEQ ID NOs: 8 and 9, PT2 for SEQ ID NOs: 10 and 11, PT3 for SEQ ID NOs: 12 and 13, PT4 for PT1 to PT7, PT1 for SEQ ID NOs: SEQ ID NOs: 14 and 15, PT5 has SEQ ID NOs: 16 and 17, PT6 has SEQ ID NOs: 18 and 19, and PT7 has a nucleotide sequence of SEQ ID NOs: 20 and 21) (Table 1 and Table 2). The polynucleotide comprising the nucleotide sequence of SEQ ID NO. 1 to SEQ ID NO: 21 or a complementary nucleotide sequence may encode the guide RNA, and the guide RNA may be prepared using the polynucleotide.

Another aspect of the invention is an expression vector comprising the polynucleotide. The polynucleotide can be expressed in a cell using a vector construct prepared in the form of being inserted into an expression vector.

The polynucleotides have been described above.

The expression vector may additionally encode Cas9 nuclease or Cas9 nicase. That is, when the Cas9 protein and the guide RNA are present together, the DNA of the HBV can be cleaved, so that a polynucleotide encoding the Cas9 protein can be used as a vector containing the guide RNA and the Cas9 protein A separate expression vector encoding may be used. The vector may be a viral vector, a plasmid vector, or an agrobacterium vector, but is not limited thereto. An expression vector comprising a polynucleotide encoding the guide RNA and / or a polynucleotide encoding the Cas9 protein can be prepared by performing a cloning method known in the art, and there is no particular limitation on the method .

Another aspect of the present invention is a vaccine composition for the treatment of HBV infection comprising the above expression vector.

Expression vectors are as described above.

The term " HBV (hepatitis B virus) " in the present invention refers to a virus that causes hepatitis B infection. Although a reverse transcriptase preparation is used as a vaccine against HBV infection, a drug for HBV infection is needed due to the appearance of drug resistant virus without fundamentally eradicating HBV itself.

The term " hepatitis B " in the present invention refers to a disease in which HBV infection causes an inflammation in the liver due to the immune response resulting from the HBV infection. It may mean any act that is improved or beneficially changed.

When the vector expressing the guide RNA and the Cas9 protein, or the vectors expressing the respective vectors, are introduced into the cells infected with HBV, the Cas9 protein can cleave the target sequence and thus HBV infection can be treated.

The introduction may be carried out by appropriately selecting a transformation method known in the art, and may be varied depending on the type of vector to be introduced, the purpose of introduction, and the method is not particularly limited.

The vaccine composition may further comprise at least one member selected from the group consisting of a pharmacologically acceptable carrier, a diluent, a preservative and an adjuvant according to techniques known to those skilled in the art.

The pharmaceutically acceptable carrier means a carrier medium that does not interfere with the effectiveness of the biological activity of the active ingredient, is chemically inert, and is not toxic to the subject to which it is administered. Various carriers are known in the art and may include distilled water, brine or mineral water. Examples of the preservative include EDTA salt, methiolate and the like, and examples of the adjuvant include aluminum hydroxide Such as mineralogels, surfactants such as lysolecithin, glycosides such as saponin and saponin derivatives, lanthidine, avridine, carbopol, polyphosphazene, dimethyldioctadecylammonium bromide (DDA), quil A), ammonogen, mineral oil, and the like, but are not limited thereto.

In a specific embodiment of the present invention, in order to confirm whether the guide RNA sequence of SEQ ID NO: 1 to SEQ ID NO: 21 can be cleaved by SaCas9 nuclease or SaCas9 nicase in animal cells, reporter analysis (A) and T7E1 analysis (B and B in FIG. 5) were performed to confirm that Indel (insertion and deletion) occurred at a maximum level of 80% and 34%, respectively.

Another aspect of the invention is a method of treating a hepatitis B virus (HBV) infection, comprising administering the vaccine composition to an animal.

The vaccine composition and the treatment of HBV infection are as described above.

The vaccine compositions of the present invention can be prepared according to standard techniques well known to those skilled in the pharmaceutical and veterinary arts. The content of such a vaccine may be determined by those skilled in the medical and veterinary arts, taking into consideration such factors as the age, sex, weight, race and condition of the subject to be administered and the route of administration. The composition may be administered alone or in combination with other immunological antigens, vaccine compositions or therapeutic compositions, or subsequent administration.

The animal refers to a whole mammal including dogs, cows, horses, rabbits, mice, rats, chickens or humans, but the animal of the present invention is not limited by the above examples.

Examples of formulations in which the vaccine compositions of the present invention may be used include liquid preparations such as oral, nasal, anal, vaginal, topical, or syrup, and sterile suspensions for subcutaneous, intradermal, intramuscular, Emulsion formulations.

It may also be a solid component of a particulate or soluble ingredient resuspended in a pharmaceutically acceptable diluent prior to use. Soluble ingredients or microparticles may be prepared according to techniques known to those skilled in the art of pharmacy and veterinary medicine, such as coacervation, baia sablation, coagulation, spray drying, bubble drying, precipitation, lyophilization and the like.

The HBV-specific gene scissors of the present invention can effectively remove HBV from the human body, so that it is not necessary to additionally use a reverse transcriptase inhibitor which has been previously used for a lifetime. Therefore, the gene scissors can be very usefully used as agents for the treatment of HBV infection.

Figures 1 A and B relate to an HBV dielectric, wherein A in Figure 1 is a schematic diagram of an HBV dielectric, and B in Figure 1 is a topographical distribution of an HBV dielectric.
Figure 2 is a schematic representation of a functional assessment of the potential target location for HBV.
Figures 3 A and B show the highly conserved positions of the guide RNA target sites of SaCas9 nuclease (A) and SaCas9 nicase (B) in HBV genotypes A and C.
FIG. 4 schematically shows a reporter system capable of detecting the activity of Cas protein.
Figures 5A-C depict activity of the SaCas9 nuclease target site in the HEK293 cell line. FIG. 5A shows the fluorescence photograph of the reporter analysis, FIG. 5B shows the T7E1 analysis result, and FIG. 5C shows the reporter analysis result.
FIGS. 6A to 6C are the results of evaluating the activity of the SaCas9 niche target position in the HEK293 cell line. FIG. 6A shows the fluorescence photograph of the reporter analysis, FIG. 6B shows the T7E1 analysis result, and FIG. 6C shows the reporter analysis result.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are intended to illustrate the present invention, and the scope of the present invention is not limited to these examples.

Example 1: Reporter Vector Production

Reporter plasmids containing SaCas9 or SaCas9n target sequences were prepared as follows. Specifically, oligonucleotides containing the target sequences (Table 1 and Table 2) were synthesized (bioneer) and annealed in vitro using PCR (5 min at 95 ° C, 5 ° C per minute to 25 ° C Respectively. The annealed oligonucleotides were ligated to a reporter vector digested with EcoRl and BamHl.

Example 2: Cell culture

HEK293T (human embryonic kidney 293T) cells were purchased from ATCC (American Type Culture Collection, Manassas, Va.). HEK293T and NIH3T3 cells were cultured in DMEM (Invitrogen, Carlsbad, Calif.) Containing 100 units / ml penicillin, 100 [mu] g / ml streptomycin and 10% FBS.

Example 3: Transformation

HEK293T cells were transformed with a plasmid mixture encoding SaCas9n (or SaCas9) using Lipofectamine 2000 (linear, MW ~ 25,000; Polysciences, Warrington, PA) according to the manufacturer's instructions. Cells were analyzed 3 days after transfection.

Example 4: Surrogate reporter assay

The episomal reporter assay was performed as follows. Plasmids and reporter plasmids encoding SaCas9 or SaCas9n / sgRNA were transformed into HEK293T cells at a 1: 1 mass ratio. Three days after the transformation, the cells were analyzed using a flow cytometer (FACSAria II; BD Biosciences). Cells transformed with the reporter alone were used as an analytical control.

Example 5: Flow cytometry

Three days after the transformation, the cells were recovered by treatment with trypsin and suspended in PBS containing 2% FBS. The cells were then analyzed using a FACSAria II cell sorter (BD Biosciences, San Jose, Calif.).

Example 6: T7E1 assay

T7E1 assay was performed as follows. Specifically, genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega, Madison, Wis.) According to the manufacturer's instructions. SaCas9 nicase or SaCas9 nuclease target regions were amplified by nested PCR using appropriate primers. The amplification product was heated to denature, annealed to form heterologous double stranded DNA, treated with 5 units of T7 endonuclease 1 (New England Biolabs) for 20 minutes at 37 ° C and resuspended in 2% agarose gel electrophoresis Respectively. The variation frequency was calculated based on the band intensity using Image J software and the following formula:

Variation frequency (%) = 100 x (1 - (1 - cut ratio) ^1/2 )

The cut rate is the total relative density of the cut bands divided by the sum of the relative densities of the cut and uncut bands.

Experimental Example 1: Identification of potential target positions conserved in HBV genotypes A and C

HBV is divided into various genotypes based on HBV genomic sequences of the eight genotypes A to H which are known to be distributed worldwide (Fig. 1). For SaCas9 or SaCas9n, to identify the conserved potential target positions of HBV, we first identified conserved sequences in the viral genomes of HBV genotypes A and C. Specifically, sequence conservation was analyzed using the known HBV genomic sequence (Figure 2). First, using a total of 1,931 genotyped A sequences, the HBV genome was analyzed to find a region of at least 50 nucleotides in length with high conservation values (> 99.9%) according to the alignment dataset . Two conserved regions present in the ORF (open reading frame) S of the HBV genome were identified (indicated by scissors in FIG. 1A). In each of the conserved sequences, a highly conserved single guide RNA (sgRNA) SaCas9 or SaCas9n target sequence (Fig. 3) and a proto-spacer adjacent motifs (PAM) sequence pair were identified (ST1 to ST7 or PT1 to PT7 Table 1 < tb > < TABLE >

SaCas9 nuclease targeting HBV genotypes A and C Target sgRNA ranking name The sgRNA sequence (5'-3 ') direction Coverage sgRNA target status Genotype C Genotype A One ST1 AGAAAATTGAGAGAAGTCCACC (SEQ ID NO: 1) Anti-sense 93.8% O O 2 ST2 GTTCAAGCCTCCAAGCTGTGCC (SEQ ID NO: 2) sense 93.7% O O 3 ST3 CTGTAACACGAGCAGGGGTCCT (SEQ ID NO: 3) Anti-sense 88.5% O O 4 ST4 AAACCCCGCCTGTAACACGAGC (SEQ ID NO: 4) Anti-sense 85.7% O O 5 ST5 GGACCCCTGCTCGTGTTACAGG (SEQ ID NO: 5) sense 85.6% O O 6 ST6 ACAAGAAGATGAGGCATAGCAG (SEQ ID NO: 6) Anti-sense 82.4% O X 7 ST7 CGTCGCAGAAGATCTCAATCTC (SEQ ID NO: 7) sense 76.7% O O

SaCas9 nuclease targeting HBV genotypes A and C Target sgRNA ranking name The sgRNA sequence (5'-3 ')
Sense direction The sgRNA sequence (5'-3 ')
Anti-sense direction Coverage sgRNA target status Genotype C Genotype A One PT1 GAGACCTTCGTCTGCGAGGCGA (SEQ ID NO: 8) CGTCGCAGAAGATCTCAATCTC (SEQ ID NO: 9) 55.0% O X 2 PT2 AAACCCCGCCTGTAACACGAGC (SEQ ID NO: 10) GACAAGAATCCTCACAATACCG (SEQ ID NO: 11) 31.0% X O 3 PT3 CTGTAACACGAGCAGGGGTCCT (SEQ ID NO: 12) GACAAGAATCCTCACAATACCG (SEQ ID NO: 13) 30.0% X O 4 PT4 CTGTAACACGAGCAGGGGTCCT (SEQ ID NO: 14) GACAAGAATCCTCACAATACCA (SEQ ID NO: 15) 27.0% O X 5 PT5 AAACCCCGCCTGTAACACGAGC (SEQ ID NO: 16) GACAAGAATCCTCACAATACCA
(SEQ ID NO: 17) 27.0% O X 6 PT6 GAGTGATTGGAGGTTGGGGACT (SEQ ID NO: 18) CTCCAATTTGTCCTGGCTATCG (SEQ ID NO: 19) 23.0% O X 7 PT7 CCATGCTGTAGCTCTTGTTCCC (SEQ ID NO: 20) CAAACCTCGACAAGGCATGGGG (SEQ ID NO: 21) 19.0% O X

They all meet the filtering criteria. That is, the sequence pairs show more than 94% conservation in the entire 22 nucleotides (nt) out of 1,931 genotypes A (see Examples and FIG. 1B for details). The conservation of each 23 nt target sequence in the B, C, D, E, F, and G genotypes was then calculated to assess the likelihood of using the conserved region for the purpose of inactivating other genotypes. The sgRNA target sequences of ST1 to ST7 and PT1 to PT7 showed 93% or 55% conservation respectively over the entire sequence of 23 nt in the analyzed B, C and E genotypes, and over 89% conservation of the D genotype sequence , Suggesting that there is a high degree of sequence conservation between HBV genotypes depending on geographical distribution (FIG. 1B).

Experimental Example  2: All ORF  Functional evaluation of preserved target location in open reading frame

For functional analysis, the selected conserved 22 bp gRNA sequence was amplified with expression of human codon-optimized SaCas9 or SaCas9n (D10A) with a pol III (U6) promoter to induce sgRNA (single guide RNA) The vector was cloned in the form of 20 nt gRNA and trans-activating CRISPR RNA (TracRNA) fusion, respectively. After identifying the potential sgRNA target sequences (Table 1, Table 2 and Figure 3), the pRG-HBV dual fluorescent reporter construct was constructed to detect SaCas9 or SaCas9n activity on the selected target.

The pRG-HBV reporter plasmid expresses RFP and also has a gene encoding the eGFP located outside the RFP sequence, including the corresponding HBV genotype A and C gene target sequences (34 bp or 79 bp in length) 4). The sequence includes the adjacent PAM sequence and two 20 bp regions required for gRNA binding and subsequent SaCas9 or SaCas9n-mediated double nicking. Thus, SaCas9 or SaCas9n activity acts on the corresponding HBV-specific target sequence by two appropriately spaced sgRNAs, resulting in double-strand breaks (indicated by the red arrow in Figure 4) and insertion or deletion by the NHEJ repair mechanism ). Because of the use of codon triplets, a statistically one-third of the repairs lead to an "in frame" fusion of the mRFP gene and the eGFP gene located upstream of the cleavage site. Thus, the presence of a reporter can be detected with the RFP alone signal, and the nuclease activity can be visualized as the simultaneous expression of GFP and RFP fluorescence.

Using two sets of plasmids containing the pRG-HBV-ST or pRG-HBV-PT target reporter construct with appropriate SaCas9n / sgRNA expression plasmids, the activity of SaCas9 or SaCas9n on the corresponding HBV sequences in human HEK293 cells Respectively. After 48 hours of transformation, SaCas9 or SaCas9n activity was detected in the transfected HEK293 cells (Fig. 5A and 6A). As expected, GFP signals were detected in cells cotransfected with SaCas9 or SaCas9n, and a vector expressing sgRNA with a matching HBV reporter (Figures 5 and 6). The result implies that the sequence encoding GFP and the sequence encoding RFP are located within the frame, resulting in NHEJ repair following SaCas9 or SaCas9n / sgRNA-mediated cleavage in the corresponding target sequence.

Next, the reporter plasmids were separated from the transformed cell population and T7E1 analysis was performed to evaluate the indelite frequency at the target position (B in Fig. 5 and B in Fig. 5). In the same way, the inventors performed three experiments, confirming similar trends in all experiments (C in FIGS. 5 and 6).

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Industry-Academic Cooperation Foundation, Yonsei University <120> A programmable nuclease targeting hepatitis B virus and a          composition for treating HBV infection comprising the same <130> KPA160058-KR <160> 21 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST1 <400> 1 agaaaattga gagaagtcca cc 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST2 <400> 2 gttcaagcct ccaagctgtg cc 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST3 <400> 3 ctgtaacacg agcaggggtc ct 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST4 <400> 4 aaaccccgcc tgtaacacga gc 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST5 <400> 5 ggacccctgc tcgtgttaca gg 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST6 <400> 6 acaagaagat gaggcatagc ag 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ST7 <400> 7 cgtcgcagaa gatctcaatc tc 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT1 sense <400> 8 gagaccttcg tctgcgaggc ga 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT1 anti-sense <400> 9 cgtcgcagaa gatctcaatc tc 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT2 sense <400> 10 aaaccccgcc tgtaacacga gc 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT2 anti-sense <400> 11 gacaagaatc ctcacaatac cg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT3 sense <400> 12 ctgtaacacg agcaggggtc ct 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT3 anti-sense <400> 13 gacaagaatc ctcacaatac cg 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT4 sense <400> 14 ctgtaacacg agcaggggtc ct 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT4 anti-sense <400> 15 gacaagaatc ctcacaatac ca 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT5 sense <400> 16 aaaccccgcc tgtaacacga gc 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT5 anti-sense <400> 17 gacaagaatc ctcacaatac ca 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT6 sense <400> 18 gagtgattgg aggttgggga ct 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT6 anti-sense <400> 19 ctccaatttg tcctggctat cg 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT7 sense <400> 20 ccatgctgta gctcttgttc cc 22 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PT7 anti-sense <400> 21 caaacctcga caaggcatgg gg 22

Claims (8)

Wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 21, or a complementary base sequence thereof.
2. The isolated polynucleotide of claim 1, wherein the polynucleotide is for producing a guide RNA.
An expression vector comprising the polynucleotide of claim 1.
4. The expression vector of claim 3, wherein the expression vector comprises a polynucleotide encoding Cas9 nuclease or Cas9 nickase.
5. The expression vector according to claim 4, wherein the Cas9 nuclease or Cas9 nicase is derived from Staphylococcus sp.
A vaccine composition for treating hepatitis B virus (HBV) infection, comprising an expression vector according to claim 4, and an expression vector comprising a Cas9 nuclease or a polynucleotide encoding Cas9 nicase.
A vaccine composition for the treatment of hepatitis B virus (HBV) infection, comprising the expression vector of claim 5.
A method for treating a hepatitis B virus (HBV) infection, comprising administering the vaccine composition of claim 6 or 7 to an animal other than a human.

Images