KR20180024184A - GnRH gene from Haliotis discus hannai and uses thereof - Google Patents

GnRH gene from Haliotis discus hannai and uses thereof Download PDF

Info

Publication number
KR20180024184A
KR20180024184A KR1020160109871A KR20160109871A KR20180024184A KR 20180024184 A KR20180024184 A KR 20180024184A KR 1020160109871 A KR1020160109871 A KR 1020160109871A KR 20160109871 A KR20160109871 A KR 20160109871A KR 20180024184 A KR20180024184 A KR 20180024184A
Authority
KR
South Korea
Prior art keywords
gnrh
abalone
gene
northern
protein
Prior art date
Application number
KR1020160109871A
Other languages
Korean (ko)
Other versions
KR101864704B1 (en
Inventor
이정식
손영창
김재원
Original Assignee
전남대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 전남대학교산학협력단 filed Critical 전남대학교산학협력단
Priority to KR1020160109871A priority Critical patent/KR101864704B1/en
Publication of KR20180024184A publication Critical patent/KR20180024184A/en
Application granted granted Critical
Publication of KR101864704B1 publication Critical patent/KR101864704B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Physics & Mathematics (AREA)
  • Endocrinology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a gonadotropin releasing hormone (GnRH) gene from Nordotis discus hannai and to uses thereof, and in the present invention, it was confirmed that GnRH gene in the Nordotis discus hannai can be specifically detected using a specific primer set to determine the developmental status of abalone. Therefore, by using a maturation index of abalone obtained from the present invention, it is judged that it is possible to mass-produce healthy abalone spats by selecting healthy mothers which are suitable for seedling production, reaching the highest maturity level and securing eggs which is completely mature from the mothers, thereby being expected to be very useful for industry.

Description

북방전복 유래의 GnRH 유전자 및 이의 용도{GnRH gene from Haliotis discus hannai and uses thereof}GnRH gene derived from northern abalone and its use {GnRH gene from Haliotis discus hannai and uses thereof}

본 발명은 북방전복 유래의 GnRH 유전자 및 이의 용도에 관한 것이다.The present invention relates to a GnRH gene derived from northern abalone and its use.

척추동물에서는 성숙 관련 내분비 기구가 잘 연구되어 있고, 번식조절 관련 호르몬과 수용체 신호전달 체제는 비교적 상세히 밝혀져 있다. 생식관련 기능은 뇌의 시상하부(hypothalamus)-뇌하수체(pituitary)-생식선(gonad)(HPG) 축을 따라 이루어지며, 성숙촉진, 배란유도, 출산에 이르기까지 다양한 내분비성 호르몬들이 농수축산, 임상 목적으로서도 적절하게 활용되고 있다. 성숙 과정에 관여하는 호르몬과 신경 펩타이드류는 대표적으로 멜라토닌(melatonin), 키스펩틴(kisspeptin), 뉴로키닌 B(neurokinin B), 고나도트로핀 저해 호르몬(gonadotropin-inhibitory hormone, GnIH), 고나도트로핀 방출 호르몬(gonadotropin-releasing hormone, GnRH), 황체형성 호르몬(leteinizing hormone, LH), 난포자극 호르몬(follicle-stimulating hormone, FSH), 그리고 성장인자 인히빈(Inhibin) 등이 있다. 현재까지 전복류의 번식생리학적 성숙 및 신경내분비현상에 관련한 분자생물학적 연구는 열대전복(Haliotis asinina)의 성숙과 관련성이 높을 것으로 생각되는 신경펩타이드 4종(APGWamide, myomodulin, FMRFamide, shistomomin)의 발현변화에 대한 보고에 국한되어 있다.In vertebrates, mature-related endocrine mechanisms are well studied, and the hormonal and receptor signaling regimes associated with breeding control are relatively detailed. Reproductive functions occur along the hypothalamus-pituitary-gonad (HPG) axis of the brain and various endocrine hormones ranging from maturation promotion, ovulation induction, and birth are suitable for agriculture, . Hormones and neuropeptides involved in maturation are typically melatonin, kisspeptin, neurokinin B, gonadotropin-inhibitory hormone (GnIH), gonadotropin Luteinizing hormone (LH), follicle-stimulating hormone (FSH), and growth hormone (Inhibin). These hormones are also known as gonadotropin-releasing hormone (GnRH) To date, molecular biology studies related to reproductive physiological maturation and neuroendocrine development of the abalone have been reported in Haliotis asinina) they have been limited to the report on the expression of neuropeptide four kinds (APGWamide, myomodulin, FMRFamide, shistomomin ) that are considered higher the maturity and relevance.

한편, 전복의 성 성숙 발달지표의 개발은 "건강한 전복 치패 생산"을 위한 성적으로 건강한 어미 전복의 확보에 이용할 수 있다. 2014년 기준으로 우리나라 전복생산량은 비공식적으로 약 7,000억원 규모인데, 전복의 양식과정에서 치패의 사망으로 인한 손실액은 약 900-1,000억원에 이른다. 이러한 막대한 치패의 사망원인 가운데 하나는 전복의 치패가 건강하지 못하기 때문이다. 건강한 전복 치패를 생산하기 위해서는 우선 성숙한 어미로부터 완전히 성숙된 알을 확보해야 한다. 자연에서 전복의 주산란기는 초가을 (9월-10월)인데, 현재 전복 양식현장에서는 인위적인 방법으로 초봄 (3-4월)에 산란을 시킨다. 따라서 산란용 어미 전복은 초가을에 비해 초봄에 성숙도가 낮으며, 미성숙단계의 어미로부터 산란된 미성숙 상태의 알에서 건강하지 못한 치패가 생산되고 있는 실정이다.On the other hand, the development of gender maturity indicators of abalone can be used to secure sexually healthy offspring for "healthy abalone production". As of 2014, the amount of abalone production in Korea is about 700 billion won, which is about 900-100 billion won. One of the reasons for the death of this massive spore is that the spoil of abalone is not healthy. In order to produce a healthy rollover, first fully mature eggs must be obtained from mature mothers. The main spawning season of abalone in nature is the early autumn (September-October), and it is spawned in early spring (April to April) in an artificial way at abalone farming site. Therefore, the egg - laying for egg laying is less maturing in early spring compared with early fall, and unhealthy egg - laying eggs are produced in immature eggs laid out from the mother of immature stage.

한국등록특허 제0806208호에서는 '홍어과 또는 가오리류에 속하는 어류의 분류체계 결정 방법과 이와 관련된 폴리뉴클레오티드 프로브, DNA 칩 및 키트'가 개시되어 있고, 한국등록특허 제1211068호에서는 '대한민국 남해 어류의 종 판별 방법과 이에 따른 어류의 종 판별용 폴리뉴클레오티드 프로브, DNA 칩 및 키트'가 개시되어 있으나, 본 발명에서와 같이, 북방전복 유래의 GnRH 유전자 및 이의 용도에 대해서는 밝혀진 바가 전혀 없다.Korean Patent No. 0806208 discloses a method for determining the classification system of fishes belonging to the group of the sponges or the stigma, and related polynucleotide probes, DNA chips and kits. In Korean Patent No. 1211068, A polynucleotide probe, a DNA chip and a kit for discrimination of fish species have been disclosed. However, as in the present invention, the GnRH gene derived from northern abalone and its use have never been disclosed.

본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명에서는 전복의 성숙발달 지표자를 개발하고자 시도한 결과, 우선 북방전복의 성숙관련 유전자들 중 성선자극호르몬방출호르몬(GnRH, gonadotropin releasing hormone) 유전자를 새롭게 분리하였고, 상기 유전자를 검출할 수 있는 특이 프라이머 세트를 제작하여 신경절 조직들 (뇌신경절, 측족신경절 및 아가미신경절)과 생식소(난소 및 정소), 아가미, 혈구세포, 외투막, 패각근 및 내장조직들을 생식소 발달 단계(Stage I, 회복기 및 초기성장기; Stage II, 후기성장기; Stage III, 성숙기; Stage IV, 방란기/방정기; Stage V, 퇴행기; Stage VI, 부정형기)별로 샘플링하여 얻은 총 RNA을 대상으로 PCR을 수행한 결과, 암컷 북방전복의 경우, 성숙기 및 방란기(Stage III와 IV)에서 측족신경절과 아가미신경절에서 GnRH 전사체의 발현이 높게 나타났으며, 수컷 북방전복의 경우, 방정기(Stage IV)의 아가미신경절에서 GnRH 전사체의 발현이 현저하게 증가되는 것을 확인하였다. 이를 통해, 본원 발명에서 개발한 GnRH 특이 프라이머를 이용하여 전북의 성숙 발달 정도의 판별이 가능한 것을 확인함으로써, 본 발명을 완성하였다.As a result of attempting to develop a maturity indicator of abalone, the present invention has found that the gene for gonadotropin releasing hormone (GnRH) among the maturation-related genes of northern abalone (Ganglion ganglion, ganglion ganglion and gill ganglion), gonad (ovary and testis), gill, hematocyte, mantle, shell, and visceral tissue Were collected by sampling the gonads at the gonadal development stage (Stage I, recovery period and early growth stage; stage II, late stage; stage III, mature stage; Stage IV, . In the case of northern abalone of female, it was found that the expression of GnRH transcripts in the metatarsal ganglia and gill ganglia at the mature and diffusive stages (Stage III and IV) And the expression of GnRH transcript was significantly increased in the gill ganglia of Stage IV in male Northern abalone. Thus, the inventors of the present invention confirmed that the developmental status of Jeonbuk could be distinguished by using the GnRH specific primer developed in the present invention, thereby completing the present invention.

상기 과제를 해결하기 위해, 본 발명은 서열번호 2의 아미노산 서열로 이루어진, 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질을 제공한다.In order to solve the above-mentioned problems, the present invention relates to a method for producing an amino acid sequence of Haliotis discus hannai- derived gonadotropin releasing hormone (GnRH) protein.

또한, 본 발명은 상기 GnRH 단백질을 코딩하는 유전자를 제공한다.The present invention also provides a gene encoding the GnRH protein.

또한, 본 발명은 서열번호 2의 아미노산 서열로 이루어진 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질을 코딩하는 유전자의 발현 수준을 측정하는 물질을 포함하는 북방전복의 성숙 발달 정도를 판별하기 위한 조성물을 제공한다.The invention also Northern abalone (Haliotis consisting of the amino acid sequence of SEQ ID NO: 2 discus The present invention provides a composition for discriminating the degree of maturation of northern abalone comprising a substance for measuring the expression level of a gene encoding hannai- derived gonadotropin releasing hormone (GnRH) protein.

또한, 본 발명은 북방전복(Haliotis discus hannai)으로부터 서열번호 2의 아미노산 서열로 이루어진 GnRH(gonadotropin releasing hormone) 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는 북방전복의 성숙 발달 정도를 판별하는 방법을 제공한다.The present invention also provides a method for determining the maturation development of Northern abalone comprising measuring the expression level of a gene encoding GnRH (gonadotropin releasing hormone) protein consisting of the amino acid sequence of SEQ ID NO: 2 from Haliotis discus hannai . ≪ / RTI >

본 발명에서는 북방전복의 성선자극호르몬방출호르몬(GnRH, gonadotropin releasing hormone) 유전자를 특이적으로 검출할 수 있는 특이 프라이머 세트를 이용하여 전복의 성숙 발달 정도의 판별이 가능한 것을 확인하였다. 따라서, 본 발명으로부터 확보된 전복의 성숙지표를 이용하여 종묘생산에 적합하며 최고의 성숙도에 달한 건강한 어미를 선별하고 이들로부터 완전히 성숙된 알을 확보함으로써 건강한 전복 치패의 대량 생산이 가능할 것으로 판단되어, 관련 산업에 매우 유용할 것으로 기대된다.In the present invention, it was confirmed that the degree of maturation of abalone could be discriminated by using a specific primer set capable of specifically detecting GnRH (gonadotropin releasing hormone) gene of northern abalone. Therefore, by using the maturation index of the abalone obtained from the present invention, it is judged that it is possible to mass-produce healthy abalone spots by selecting healthy moths which are suitable for seedling production and reaching the highest maturity and securing mature eggs completely from them. It is expected to be very useful for industry.

도 1은 북방전복의 신경절 (A) 및 생식소 (B)의 적출 및 신경절(CG, 뇌신경절; PPG, 측족신경절; BG, 아가미신경절)의 H-E 염색 (C)을 나타내는 것이다.
도 2는 Hdh - GnRH (prepro-Hdh - GnRH) cDNA의 염기서열과 예측된 아미노산 서열을 나타낸다. 잠정적인 시그널 펩티드(signal peptide) 서열은 실선 밑줄로 표시하였고, 성숙 GnRH 펩티드 영역은 진한 글자체로 네모 박스로 구분된다. RKR 3개의 염기성 아미노산 절단 부위는 이탤릭체로 나타내었고, GAP 서열은 파선형의 밑줄로 표시하였다. *는 종결코돈을 나타낸다. 3'-말단의 polyadenylation 부위는 굵은 실선 밑줄로 표시하였다.
도 3은 북방전복 난소의 성숙 단계별 H-E 염색을 나타내는 것이다. A, 회복기/초기성장기; B, 후기성장기, C, 성숙기; D, 방란기/방정기, E, 퇴행기; F, 부정형기
도 4는 북방전복 정소의 성숙 단계별 H-E 염색을 나타내는 것이다. A, 회복기/초기성장기; B, 후기성장기, C, 성숙기; D, 방란기/방정기, E, 퇴행기; F, 부정형기
도 5는 성숙 전복 난소 (A)와 정소 (B) 발달 단계 (Stage III와 IV)에서의 다양한 전복조직의 GnRH 유전자 발현 변화를 실시간중합효소반응법 (RT-PCR)으로 나타내는 것이다. cDNA 추출 조직의 보정을 목적으로 RPL5 유전자를 참고 유전자로 이용하였다. 각각의 수치는 평균±표준오차로 표시하였고 막대 위의 상이한 문자는 유의수준 0.05에서 통계적으로 차이가 있음을 의미한다. CG, 뇌신경절; PPG, 측족신경절, O, 난소; T, 정소; G, 아가미; I, 내장조직; H, 혈구세포; AM, 폐각근; M, 외투막.
도 6은 생식소 성숙 단계별 암컷 (A) 및 수컷 (B) 전복 신경절에서의 Hdh-GnRH 전사체의 발현 변화를 qRT-PCR로 나타낸 것이다. (CG, 뇌신경절; PPG, 측족신경절; BG, 아가미신경절). Stage I, 회복기 및 초기성장기; Stage II, 후기성장기; Stage III, 성숙기; Stage IV: 방란기/방정기; Stage V, 퇴행기; Stage VI, 부정형기
Figure 1 shows the HE staining (C) of the ganglion (A) and gonad (B) of the northern abalone and of the ganglion (CG, cranial nerve, PPG, BG, gill ganglion).
FIG. 2 shows the results of Hdh - GnRH (prepro- Hdh - GnRH ) The nucleotide sequence of the cDNA and the predicted amino acid sequence are shown. Prospective signal peptide sequences are indicated by a solid underline, and mature GnRH peptide regions are delineated into a dark box. The three basic amino acid cleavage sites of RKR are shown in italics, and the GAP sequence is indicated by a wavy line underlined. * Represents the termination codon. The polyadenylation site at the 3'-end is indicated by a bold solid underline.
Fig. 3 shows HE staining at the maturation stage of the northern abalone ovary. A, recovery / early growth; B, late growing stage, C, mature stage; D, scatterer / deflector, E, retrograde; F,
Fig. 4 shows HE staining at the maturation stage of northern abalone testis. A, recovery / early growth; B, late growing stage, C, mature stage; D, scatterer / deflector, E, retrograde; F,
FIG. 5 shows the results of various abalone tissues in the mature abalone ovary (A) and testis (B) development stages (Stage III and IV) GnRH gene expression by real-time PCR (RT-PCR). The RPL5 gene was used as a reference gene for the purpose of correcting the cDNA extracted tissue. Each figure is expressed as mean ± standard error and different letters on the bar mean statistically different at significance level 0.05. CG, cranial nerve; PPG, ovarian ganglia, O, ovary; T, testimony; G, gill; I, visceral tissue; H, hemocytes; AM; M, the mantle.
FIG. 6 shows the expression of Hdh- GnRH transcripts in female (A) and male (B) rolled ganglia at the gonadal maturation stage by qRT-PCR. (CG, cranial nerve; PPG, lateral ganglion; BG, gill ganglion). Stage I, recovery and early growth phase; Stage II, late growing season; Stage III, maturity; Stage IV: Spreader / deflector; Stage V, retrograde; Stage VI, Unsteady Period

본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 2의 아미노산 서열로 이루어진, 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질을 제공한다.In order to achieve the object of the present invention, the present invention provides a gonadotropin releasing hormone (GnRH) protein derived from Haliotis discus hannai comprising the amino acid sequence of SEQ ID NO: 2.

본 발명은 또한 상기 단백질의 단편, 유도체 및 유사체 (analogues)를 포함한다. 본원에 사용된, 용어 "단편", "유도체" 및 "유사체"는 본 발명의 단백질과 실질적으로 같은 생물학적 기능 또는 활성을 보유하는 폴리펩티드를 말한다. 본 발명의 단편, 유도체 및 유사체는 (i) 하나 이상의 보존적(conservative) 또는 비보존적 아미노산 잔기(바람직하게는 보존적 아미노산 잔기)가 치환된 폴리펩티드(상기 치환된 아미노산 잔기는 유전암호에 의해 암호화될 수도, 되지 않을 수도 있다) 또는 (ii) 하나 이상의 아미노산 잔기에서 치환기(들)를 가지는 폴리펩티드, 또는 (iii) 또 다른 화합물(폴리펩티드의 반감기를 연장할 수 있는 화합물, 예를 들면 폴리에틸렌 글리콜)과 결합된 성숙 폴리펩티드로부터 유래된 폴리펩티드, 또는 (iv) 부가적인 아미노산 서열(예를 들면, 선도 서열, 분비 서열, 상기 폴리펩티드를 정제하는데 사용된 서열, 프로테이노젠(proteinogen) 서열 또는 융합 단백질)과 결합된 상기 폴리펩티드로부터 유래된 폴리펩티드일 수 있다. 본원에 정의된 상기 단편, 유도체 및 유사체는 당업자에 잘 알려져 있다.The present invention also includes fragments, derivatives and analogues of such proteins. As used herein, the terms "fragments", "derivatives" and "analogs" refer to polypeptides having substantially the same biological function or activity as the protein of the invention. The fragments, derivatives, and analogs of the present invention may be used in conjunction with (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted (the substituted amino acid residues are encoded Or (ii) a polypeptide having substituent (s) at one or more amino acid residues, or (iii) another compound (a compound capable of extending the half-life of the polypeptide, such as polyethylene glycol) (Iv) an additional amino acid sequence (e. G., A leader sequence, a secretory sequence, a sequence used to purify the polypeptide, a proteinogen sequence or a fusion protein) and a polypeptide derived from the mature polypeptide Or a polypeptide derived from said polypeptide. Such fragments, derivatives and analogs as defined herein are well known to those skilled in the art.

서열번호 2로 표시되는 아미노산 서열을 갖는 단백질을 암호화하는 폴리뉴클레오티드는 오직 성숙 폴리펩티드만을 암호화하는 코딩 서열; 성숙 폴리펩티드 및 다양한 부가적인 코딩 서열을 암호화하는 서열; 성숙 폴리펩티드(및 임의의 부가적인 코딩 서열) 및 넌코딩 서열을 암호화하는 서열을 포함한다.A polynucleotide encoding a protein having an amino acid sequence represented by SEQ ID NO: 2 comprises a coding sequence which encodes only a mature polypeptide; Sequences encoding mature polypeptides and various additional coding sequences; Mature polypeptides (and any additional coding sequences) and sequences coding for noncoding sequences.

용어 "폴리펩티드를 암호화하는 폴리뉴클레오티드"는 폴리펩티드를 암호화하는 폴리뉴클레오티드, 또는 부가적인 코딩 및/또는 넌코딩 서열을 더 포함하는 폴리뉴클레오티드를 말한다.The term "polynucleotide encoding a polypeptide" refers to a polynucleotide encoding a polypeptide, or a polynucleotide further comprising additional coding and / or noncoding sequences.

또한, 본 발명은 본원에 기재된 것과 동일한 아미노산 서열, 또는 이의 단편, 유사체, 및 유도체를 포함하는 폴리펩티드를 암호화하는 상기 폴리뉴클레오티드의 변이체에 관한 것이다. 폴리뉴클레오티드 변이체는 자연적으로 발생하는 대립유전자 변이체 또는 비자연적으로 발생하는 변이체일 수 있다. 상기 뉴클레오티드 변이체는 치환 변이체, 결실 변이체, 및 삽입 변이체를 포함한다. 당업계에 공지된 바와 같이, 대립유전자 변이체는 폴리뉴클레오티드의 대안(alternative)이며, 이는 하나 이상의 치환, 결실 또는 삽입된 뉴클레오티드를 포함할 수 있으며, 변이체에 의해 암호화된 폴리펩티드에서 실질적인 기능 변화를 초래하지는 않는다.The invention also relates to variants of said polynucleotides encoding polypeptides comprising the same amino acid sequences as described herein, or fragments, analogs, and derivatives thereof. Polynucleotide variants can be naturally occurring allelic variants or non-naturally occurring variants. The nucleotide mutant includes a substitution mutant, a deletion mutant, and an insertion mutant. As is known in the art, an allelic variant is an alternative to a polynucleotide, which may comprise one or more substituted, deleted or inserted nucleotides and which does not result in a substantial functional change in the polypeptide encoded by the variant Do not.

본 발명의 GnRH 단백질은 서열번호 2로 표시되는 아미노산 서열을 갖는 단백질 및 상기 단백질의 기능적 동등물을 포함한다. "기능적 동등물"이란 아미노산의 부가, 치환 또는 결실의 결과, 상기 서열번호 2로 표시되는 아미노산 서열과 적어도 70% 이상, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 더 더욱 바람직하게는 95% 이상의 서열 상동성을 갖는 것으로, 서열번호 2로 표시되는 단백질과 실질적으로 동질의 생리활성을 나타내는 단백질을 말한다. "실질적으로 동질의 생리활성"이란 북방전복에서 성선자극호르몬방출호르몬(GnRH, gonadotropin releasing hormone)으로서의 활성을 의미한다.The GnRH protein of the present invention includes a protein having an amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means activity as gonadotropin releasing hormone (GnRH) in northern abalone.

또한, 본 발명은 상기 GnRH 단백질을 코딩하는 유전자를 제공한다. 바람직하게는, 본 발명의 상기 유전자는 서열번호 1의 염기서열을 포함할 수 있다. 또한, 상기 염기 서열의 상동체가 본 발명의 범위 내에 포함된다. 구체적으로, 상기 유전자는 서열번호 1의 염기 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기 서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.The present invention also provides a gene encoding the GnRH protein. Preferably, the gene of the present invention may comprise the nucleotide sequence of SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

또한, 본 발명은 상기 기재된 서열번호 1의 염기서열과 적어도 50%, 바람직하게는 적어도 70%, 더욱 바람직하게는 적어도 80%의 동일성을 가지는 서열과 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명은 특히, 스트린전트 조건하에 본원에 기재된 폴리뉴클레오티드에 혼성화하는 폴리뉴클레오티드에 관한 것이다. 본 발명에서, "스트린전트 조건"은 (1) 0.2 × SSC, 0.1% SDS, 60℃와 같은 더 낮은 이온강도 및 더 높은 온도하에서의 혼성화 및 세척; 또는 (2) 50%(v/v) 포름아미드, 0.1% 소혈청/0.1% Ficoll 및 42℃ 등과 같은 변성제의 존재하에 혼성화; 또는 (3) 적어도 80%, 바람직하게는 적어도 90%, 더욱 바람직하게는 95% 이상의 동일성을 가지는 단지 2개의 서열 사이에서 발생하는 혼성화를 말한다. 게다가, 혼성화가 가능한 폴리뉴클레오티드에 의해 암호화된 폴리펩티드의 생물학적 기능 및 활성은 서열번호 2 표시되는 성숙 폴리펩티드의 생물학적 기능 및 활성과 동일하다.The present invention also relates to a polynucleotide which hybridizes with a sequence having at least 50%, preferably at least 70%, more preferably at least 80% identity with the nucleotide sequence of SEQ ID NO: 1 described above. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides described herein under stringent conditions. In the present invention, "stringent conditions" means (1) hybridization and washing under lower ionic strength and higher temperature such as 0.2 x SSC, 0.1% SDS, 60 ° C; Or (2) in the presence of a denaturant such as 50% (v / v) formamide, 0.1% bovine serum / 0.1% Ficoll and 42 ° C; Or (3) at least 80%, preferably at least 90%, more preferably at least 95%. In addition, the biological function and activity of the polypeptide encoded by the hybridizable polynucleotide is the same as the biological function and activity of the mature polypeptide represented by SEQ ID NO: 2.

본 발명의 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질 코딩 유전자는 본 발명을 통해 처음으로 분리되었고, 북방전복의 성숙 발달 정도의 판별에 대한 연관성은 전혀 알려지지 않았다.The gonadotropin releasing hormone (GnRH) protein coding gene derived from Haliotis discus hannai of the present invention was isolated for the first time through the present invention, and no relation to the discrimination of maturation development of northern abalone was known at all.

본 발명자는 다음과 같은 입증을 통하여 GnRH 단백질 코딩 유전자가 북방전복의 성숙 발달 정도를 판별하기 위한 마커로 이용될 수 있음을 규명하였다.The present inventors have established that the GnRH protein coding gene can be used as a marker for determining the maturation development of northern abalone through the following proofs.

구체적으로, 북방전복의 성숙관련 유전자들 중 성선자극호르몬방출호르몬(GnRH, gonadotropin releasing hormone) 유전자를 새롭게 분리하였고, 상기 유전자를 검출할 수 있는 특이 프라이머 세트를 제작하여 신경절 조직들 (뇌신경절, 측족신경절 및 아가미신경절)과 생식소(난소 및 정소), 아가미, 혈구세포, 외투막, 패각근 및 내장조직들을 생식소 발달 단계(Stage I, 회복기 및 초기성장기; Stage II, 후기성장기; Stage III, 성숙기; Stage IV, 방란기/방정기; Stage V, 퇴행기; Stage VI, 부정형기)별로 샘플링하여 얻은 총 RNA을 대상으로 PCR을 수행한 결과, 암컷 북방전복의 경우, 성숙기 및 방란기(Stage III와 IV)에서 측족신경절과 아가미신경절에서 GnRH 전사체의 발현이 높게 나타났으며, 수컷 북방전복의 경우, 방정기 (Stage IV)의 아가미신경절에서 GnRH 전사체의 발현이 현저하게 증가되는 것을 확인하였다. Specifically, a gene for GnRH (gonadotropin releasing hormone) gene was newly isolated from the maturation-related genes of northern abalone, and a specific primer set capable of detecting the gene was prepared, and ganglion tissues (cranial nerves, (Ganglia and gill ganglia), gonads (ovaries and testes), gills, hematocytes, mantle cells, shellfishes and visceral tissues were divided into gonadal development stages (Stage I, (Stage III and IV) in the case of northern abalone of female, as a result of PCR on the total RNAs obtained by sampling each strain (Stage V, IV, Strain V, Stage V, , The expression of GnRH transcripts was high in ovarian ganglia and gill nerve ganglia, and in GnRH transcripts of male northern abalone, GnRH transcripts were remarkably expressed in gill ganglia of Stage IV Respectively.

따라서, 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질 코딩 유전자를 본 발명자들이 고안한 프라이머를 사용하여 역전사 중합효소반응을 실시함으로써 북방전복의 성숙 발달 정도를 판별할 수 있었다.Therefore, the developmental status of northern abalone could be determined by carrying out reverse transcription polymerase chain reaction (PCR) using a primer designed by the inventors of GnRH (gonadotropin releasing hormone) protein coding gene derived from Haliotis discus hannai .

본 발명에서, 용어 "북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질 코딩 유전자의 발현 수준을 측정하는 물질"란 상기와 같이 북방전복의 성숙 발달 정도를 판별하기 위한 마커인 GnRH 단백질 코딩 유전자의 발현 수준을 확인함으로써 마커의 검출에 사용될 수 있는 분자를 의미하며, 바람직하게는 마커에 특이적인 프라이머를 말한다.In the present invention, the term "substance for measuring the expression level of GnRH (gonadotropin releasing hormone) protein coding gene derived from Haliotis discus hannai " refers to a substance which is a marker for determining the maturation development of northern abalone Refers to a molecule that can be used for the detection of a marker by confirming the expression level of the coding gene, and preferably refers to a marker-specific primer.

GnRH 단백질 코딩 유전자의 발현 수준은 GnRH 단백질 코딩 유전자의 mRNA의 발현 수준을 확인함으로써 알 수 있다. 본 발명에서 "mRNA 발현 수준 측정"이란 북방전복의 성숙 발달 정도를 판별하기 위하여 생물학적 시료에서 GnRH 단백질 코딩 유전자의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로, mRNA의 양을 측정함으로써 알 수 있다. 이를 위한 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 및 DNA 칩 등이 있으나, 이에 제한되는 것은 아니다.The expression level of the GnRH protein coding gene can be determined by confirming the expression level of the mRNA of the GnRH protein coding gene. In the present invention, "measurement of mRNA expression level" is a process of determining the presence and expression level of a GnRH protein coding gene in a biological sample in order to determine the degree of maturation of northern abalone by measuring the amount of mRNA. RT-PCR, Competitive RT-PCR, Real-time RT-PCR, RNase protection assay (RPA), Northern blotting (Northern blotting) blotting, and DNA chips, but are not limited thereto.

본 발명에서, 용어 "프라이머"는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 중합효소 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 본 발명에서는 GnRH 단백질 코딩 폴리뉴클레오티드의 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 원하는 생성물의 생성 여부를 통해 북방전복의 성숙 발달 정도를 판별할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다. In the present invention, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, capable of forming a base pair with a complementary template and having a starting point for template strand copying ≪ / RTI > The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In the present invention, PCR amplification using a sense and antisense primer of GnRH protein coding polynucleotide can be used to determine the degree of maturation of northern abalone through the production of a desired product. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

본 발명의 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

본 발명의 구체적인 실시예에 따르면, 상기 북방전복의 성숙 발달 정도 판별용 조성물은 GnRH 단백질 코딩 유전자에 대하여 특이적인 각각의 프라이머 쌍을 포함한다. 구체적으로는, GnRH 단백질 코딩 유전자는 서열번호 8 및 9로 표시되는 프라이머이다.According to a specific embodiment of the present invention, the composition for determining the maturation development degree of northern abalone comprises respective primer pairs specific for the GnRH protein coding gene. Specifically, the GnRH protein coding gene is a primer represented by SEQ ID NOs: 8 and 9.

또 하나의 양태로서, 본 발명은 북방전복으로부터 서열번호 2의 아미노산 서열로 이루어진 GnRH 단백질 코딩 유전자의 발현 수준을 측정하는 단계를 포함하는 북방전복의 성숙 발달 정도를 판별하는 방법을 제공한다.In another aspect, the present invention provides a method for determining the degree of maturation of northern abalone comprising measuring the expression level of a GnRH protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2 from northern abalone.

본 발명의 GnRH 단백질 코딩 유전자의 발현 수준은 GnRH 단백질 코딩 유전자의 mRNA의 발현 수준을 확인함으로써 알 수 있다.The expression level of the GnRH protein coding gene of the present invention can be determined by confirming the expression level of the mRNA of the GnRH protein coding gene.

생물학적 시료에서 mRNA를 분리하는 과정은 공지의 공정을 이용하여 수행할 수 있으며 mRNA 수준은 다양한 방법으로 측정할 수 있다.The process of separating mRNA from a biological sample can be carried out using known processes, and the level of mRNA can be measured by various methods.

mRNA 수준을 측정하기 위한 분석 방법으로는 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블랏팅, DNA 칩 등이 있으나, 이에 제한되는 것은 아니다.Methods for measuring mRNA levels include, but are not limited to, reverse transcriptase polymerase, competitive reverse transcriptase polymerase, real-time reverse transcriptase polymerase, RNase protection assay, northern blotting, and DNA chip.

상기 검출 방법들을 통하여, 북방전복 시료에서의 GnRH 단백질 코딩 유전자의 mRNA 발현을 조사하여 북방전복의 성숙 발달 정도를 판별할 수 있다.Through the above detection methods, mRNA expression of the GnRH protein coding gene in northern abalone samples can be examined to determine the degree of maturation of northern abalone.

mRNA 발현수준 측정은 바람직하게는, 북방전복의 성숙 발달 정도 판별용 마커로 사용되는 유전자에 특이적인 프라이머를 이용하는 역전사효소 중합효소반응법 또는 DNA 칩을 이용하는 것이다.The measurement of the mRNA expression level is preferably performed using a reverse transcriptase polymerase reaction method or a DNA chip using a primer specific to a gene used as a marker for determining the maturation development degree of northern abalone.

본 발명의 일 구현 예에 따른 방법은 상기 GnRH 단백질을 코딩하는 유전자의 발현 수준을 측정하여 북방전복의 암컷 및 수컷의 아가미신경절에서 가장 높은 경우 산란기로 판별하는 것일 수 있고, 바람직하게는 북방전복의 암컷의 측족신경절과 아가미신경절에서 가장 높은 경우 성숙기 및 방란기로 판별하고, 북방전복의 수컷의 아가미신경절에서 가장 높은 경우 방정기로 판별하는 것일 수 있으나, 이에 제한되지 않는다.
The method according to one embodiment of the present invention may be a method of determining the expression level of the gene encoding the GnRH protein and determining the highest level in the gill ganglia of female and male of the Northern abalone as a spawner season, The highest level in the females and the gill ganglia of the female are identified as mature and diffuse, and the highest in the gills of the northern abalone is determined as the ganglia.

이하, 본 발명을 실시 예에 의해 상세히 설명한다. 단, 하기 실시 예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시 예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

재료 및 방법Materials and methods

생식소Gonorrhea 및 신경절 해부 및 적출 And ganglion dissection and extraction

성숙 단계의 암/수 전복의 생식소 조직을 적출하고, 신경절 조직에 해당되는 1쌍의 뇌신경절 (CG) 및 측족신경절 (PPG)을 적출한 후, RNA 추출 전까지 -80℃에서 보관하였고, 적출한 조직의 파라핀 섹션을 제작한 후 H/E 염색을 실시하여 조직의 적합성 여부를 판단하였다.
The gonad tissues of the mature male / female abalone were removed and a pair of cranial nerve (CG) and metatarsal ganglion (PPG) corresponding to ganglion tissues were extracted and stored at -80 ° C until RNA extraction. The paraffin sections of the tissues were prepared and then subjected to H / E staining to determine the suitability of the tissues.

mRNAmRNA 추출 및 cDNA 합성 Extraction and cDNA synthesis

신경절 조직, 즉 CG 및 PPG를 대상으로 RNeasy Mini Kit (Qiagen, USA)를 이용하여 총 RNA를 추출하였다. 성숙 관련 호르몬을 암호화하는 유전자의 클로닝을 위해 SMART RACE(rapid amplification of cDNA ends) cDNA 증폭 키트 (Clontech, USA)를 사용하여 추출된 총 RNA로부터 첫번째 가닥 cDNA를 합성하였다.
Total RNA was extracted using RNeasy Mini Kit (Qiagen, USA) for ganglion tissues, CG and PPG. First strand cDNA was synthesized from total RNA extracted using the SMART RACE (rapid amplification of cDNA ends) cDNA amplification kit (Clontech, USA) for the cloning of genes coding for maturation related hormones.

성숙관련 호르몬 분자 Mature Hormone Molecules 클로닝Cloning

전복이 속하는 복족류의 성숙관련 유전자들 중 성선자극호르몬방출호르몬(GnRH, gonadotropin releasing hormone) 유전자의 총 서열의 길이를 밝히고자, 북방전복 (Haliotis discus hannai)과 동종인 H. laevigata (GenBank accession No. KP719129)의 이미 알려져 있는 GnRH mRNA 부분 서열을 기반으로 정방향 (F) 및 역방향 (R) 프라이머를 제작하였고, CG 및 PPG 첫번째 가닥 cDNA을 주형으로 LA Taq DNA 중합효소 (Takara Bio, Japan)로 PCR 반응을 실시하여 북방전복의 GnRH 유전자의 부분 염기 서열을 확인하였다. 이 서열을 기반으로 유전자 특이적 F/R 프라이머를 제작하고 Universal Primer A Mix (UPM; Clontech)와 함께 CG 및 PPG의 첫번째 가닥 cDNA를 주형으로 5'-/3'-RACE PCR를 실시하였다. 그 결과 총 868 뉴클레오티드 (nt) (poly(A)-tail은 포함되지 않음)의 GnRH를 암호화하고 있는 cDNA를 밝혀내었다. 총 길이 GnRH cDNA에는 75 nt의 5'-비번역 영역 (UTR), 306nt의 코딩 서열 (101개의 아미노산에 해당)와 487nt의 3'-UTR이 포함되어 있음을 확인하였다.
To elucidate the length of the total sequence of gonadotropin releasing hormone (GnRH) genes among the maturation related genes of gastropods belonging to abalone, H. laevigata (GenBank accession No. KP719129), which is homologous with Haliotis discus hannai (F) and reverse (R) primers were constructed based on the previously known partial sequence of GnRH mRNA and PCR was performed with LA Taq DNA polymerase (Takara Bio, Japan) using CG and PPG first strand cDNA as a template The partial nucleotide sequence of the GnRH gene of northern abalone was confirmed. Based on this sequence, 5'- / 3'-RACE PCR was performed using the first strand cDNA of CG and PPG as a template together with Universal Primer A Mix (UPM; Clontech). As a result, a cDNA encoding GnRH of 868 nucleotides (nt) (poly (A) -tail not included) was identified. The total length of the GnRH cDNA was found to contain 75 nt of 5'-untranslated region (UTR), 306 nt of coding sequence (corresponding to 101 amino acids) and 487 nt of 3'-UTR.

연체동물 DB 활용 및 검색Utilization and search of mollusc DB

북방전복의 GnRH와 유사한 서열을 가지는 생물군을 확인하기 위해, NCBI 데이터베이스를 대상으로 BLAST 검색을 실시하고, CLUSTALW 프로그램을 이용하여 북방전복의 GnRH를 암호화하고 있는 cDNA의 ORF(open reading frame)과 BLAST 검색을 통해 유사성이 높은 생물군의 GnRH-ORF와 비교분석을 통해 계통수를 조사하고자 하였다. 또한 NeuroPred, SignalIP 프로그램을 이용하여 GnRH neuropeptide의 번역 후의 프로세싱(post-translational processing)에 대한 예측도 병행하였다.
In order to identify a group with a sequence similar to that of GnRH of northern abalone, BLAST search was performed on the NCBI database and the ORF (open reading frame) of cDNA encoding GnRH of northern abalone using the CLUSTALW program and BLAST In order to investigate the phylogenetic tree through comparison with the GnRH-ORF of the highly similar biota. The prediction of post-translational processing of the GnRH neuropeptide was also performed using the NeuroPred, SignalIP program.

성숙 단계별 전복 시료 확보Acquisition of abalone samples per mature stage

성숙 단계별 전복 확보를 위해 강원도 양양군 기사문리 지역에서 매달 채집된 전복을 대상으로 생식소에 대한 H-E 염색을 실시하여 생식소 발달 단계별로 6개의 단계로 분류하였다. Stage I, 회복기 및 초기성장기 (1월~3월); Stage II, 후기성장기 (3월~5월); Stage III, 성숙기 (6월~8월); Stage IV, 방란기/방정기 (9월~10월); Stage V, 퇴행기 (10월~11월); Stage VI, 부정형기 (11월~2월)(Najmudeen 2007, Molluscan Res 27(3): 140-146).In order to secure the abalone for maturation stage, H-E staining of the gonads was carried out on abalone collected monthly in the Koguryo area of Yangyang, Gangwon-do, and classified into 6 stages according to gonadal development stages. Stage I, recovery and early growth phase (January-March); Stage II, late growing (March to May); Stage III, maturity (June - August); Stage IV, Spreader / Spreader (September to October); Stage V, retrograde (October to November); Stage VI, unsteady period (November to February) (Najmudeen 2007, Molluscan Res 27 (3): 140-146).

성숙기 (Stage III과 Stage IV)에 속하는 전복에 대해서 조직별 GnRH mRNA의 발현을 확인하기 위해 신경절 조직들 (뇌신경절, 측족신경절)과 생식소, 아가미, 혈구세포, 외투막, 패각근, 내장 조직을 적출한 후 RNA 추출 전까지 -80℃에서 보관하였다. 또한 GnRH mRNA의 주요한 발현 조직인 신경절 조직들 (뇌신경절(CG), 측족신경절(PPG), 아가미신경절(BG))에서의 생식소 발달 단계별 발현 양상을 확인하기 위해 각 단계별 신경절 조직들을 적출하였다.
In order to confirm the expression of GnRH mRNA in the tissues of the stages of maturation (Stage III and Stage IV), ganglion tissues (cranial nerves, osteophyte ganglia) and gonads, gills, hematocytes, mantle, And stored at -80 ° C until RNA extraction. The ganglion tissues of each stage were extracted to identify gingival developmental stages in the ganglion tissues (cranial nerves (CG), proximal ganglia (PPG), and gill ganglia (BG)), the main expression machinery of GnRH mRNA.

GnRHGnRH 올리고  Oligo 프라이머primer 제작 및  Production and 프라이머primer 특이성 확인 Identification of specificity

Primer Express v3.0 Software (Applied Biosystems)를 이용하여 동정된 북방전복의 GnRH cDNA을 대상으로 북방전복 특이적인 GnRH 올리고 프라이머(Hdh-GnRH-F3와 R3, 표 1)를 제작하였다. 프라이머 선정 기준은 다음과 같다: 프라이머 길이, 18~25bp; 녹는점 (Tm) 63℃; 정방향 및 역방향 프라이머 간의 Tm 차이는 1℃ ; 증폭 길이는 75~250 bp; GC 함량은 40~60%.
GnRH of northern abalone identified using Primer Express v3.0 Software (Applied Biosystems) GnRH oligonucleotide primers (Hdh-GnRH-F3 and R3, Table 1) specific for northern abalone were prepared. The primer selection criteria are as follows: primer length, 18-25 bp; Melting point (Tm) 63 캜; The Tm difference between the forward and reverse primers was 1 [deg.] C; Amplification length is 75-250 bp; GC content is 40-60%.

참고 유전자(Reference gene) 선정Reference gene selection

각 조직에서 추출된 cDNA 레벨의 보정을 위하여 참고 유전자로 전복의 RPL5 유전자를 선정하여 프라이머(Hdh-RPL5-F와 Hdh-RPL5-R, 표 1)를 제작하였다.
Primers (Hdh-RPL5-F and Hdh-RPL5-R, Table 1) were prepared by selecting the abalone RPL5 gene as a reference gene for the correction of the cDNA level extracted from each tissue.

실시간중합효소반응 (real-time Real-time polymerase chain reaction (real-time PCRPCR ) 분석) analysis

성숙 관련 GnRH 유전자의 mRNA 발현 양상을 조직별, 성숙단계별로 확인하기 위해 실시간중합효소반응법 (quantitative real time PCR, qRT-PCR)을 실시하였다. RNeasy Kit (QIAGEN, Valencia, CA, USA)를 이용하여 뇌신경절, 측족신경절, 아가미신경절, 생식소, 아가미, 혈구세포, 외투막, 폐각근, 내장조직으로부터 총 RNA를 추출하였다. 게놈 DNA를 제거하기 위해 5X gDNA Eraser Buffer를 42℃에서 2분간 처리하였다. 첫번째 가닥 cDNA 합성은 PrimeScript RT reagent Kit (TaKaRa Bio, Shiga, Japan)를 사용하여 37℃에서 15분간 실시하였다. 실시간중합효소반응은 7500 Real-Time PCR Instrument System (AppliedBiosystem, Boston, USA)을 이용하여 수행하였으며, 반응액 20℃에는 합성된 cDNA (10ng, each), 2x SYBR Premix Ex Taq, 50x Reference Dye II (TaKaRa Bio. Japan) 및 10uM GnRH 올리고 프라이머 세트가 포함되어 있다. PCR은 two-step PCR법을 사용하였고, 50℃에서 2분, 95℃에서 10분 이후, 95℃ 15초, 60℃ 1분간 40회 증폭하였다.
Quantitative real-time PCR (qRT-PCR) was performed to identify mRNA expression patterns of maturation-related GnRH genes by tissue and maturation stages. Total RNA was extracted from cranial nerves, medial ganglia, gill ganglia, gonads, gills, hematopoietic cells, mantle membrane, excisional muscle and visceral tissue using RNeasy Kit (QIAGEN, Valencia, CA, USA). To remove genomic DNA, 5X gDNA Eraser Buffer was treated at 42 ° C for 2 minutes. First strand cDNA synthesis was carried out at 37 ° C for 15 minutes using PrimeScript RT reagent Kit (TaKaRa Bio, Shiga, Japan). Real-time PCR was performed using 7500 Real-Time PCR Instrument System (Applied Biosystem, Boston, USA). The reaction mixture was incubated at 20 ° C with 10 ng of each synthesized cDNA, 2x SYBR Premix Ex Taq and 50x Reference Dye II TaKaRa Bio. Japan) and a set of 10 uM GnRH oligopeptide primers. Two-step PCR was used for PCR, and the amplification was performed for 2 minutes at 50 ° C, 10 minutes at 95 ° C, 40 seconds at 95 ° C for 15 seconds, and 60 ° C for 1 minute.

실시예Example 1. 전복(학명:  1. Abalone (Scientific name: HaliotisHaliotis discus  discus hannaihannai ) ) GnRHGnRH (( gonadotropingonadotropin -releasing hormone) cDNA 분리-releasing hormone) cDNA separation

1-1. 1-1. 생식소Gonorrhea /신경절 해부 및 적출/ Ganglion dissection and extraction

북방전복의 신경계는 신경세포가 모인 다수의 신경절을 이루며, 뇌신경절, 측족신경절, 내장신경절 등으로 구성되어 있다. 적출한 뇌신경절과 측족신경절 및 아가미 신경절의 조직 절편을 만들어 hematoxyline-eosin으로 염색하여 광학현미경으로 관찰하였다(도 1A와 도 1C).
The nervous system of the northern abalone is composed of a number of ganglia with nerve cells, including the cranial nerves, the medial ganglia, and the ganglia. Tissue sections of extracted cranial nerve, metatarsal ganglia and gill ganglia were stained with hematoxyline-eosin and observed under an optical microscope (Fig. 1A and Fig. 1C).

1-2. 1-2. HdhHdh -- GnRHGnRH cDNA  cDNA 클로닝Cloning

5'과 3'-RACE PCR 방법으로 성숙한 북방전복의 측족신경절에서 prepro-Hdh - GnRH cDNA를 동정하였다. 북방전복의 prepro- Hdh - GnRH cDNA를 Hdh - GnRH로 명명하며, Hdh - GnRH는 전장 길이 868 뉴클레이티드 (nt)의 염기로 이루어져 있고, NCBI의 ORF finder tool를 이용하여 번역부위 (CDS, coding DNA sequence)를 예측한 결과, 75 nt의 5' 비번역 영역 (untranslated region, UTR)과 306 nt의 번역 영역 (101개의 아미노산들에 해당됨 : 서열번호 2), 그리고 487 nt로 이루어진 3' 비번역 영역(poly A 말단부위는 제외)을 포함하고 있었다(도 2). SinalP 4.1 server와 NeuroPred 프로그램을 이용하여 Hdh - GnRH 유전 정보에서 예상되는 아미노산 서열을 분석한 결과, 알려진 GnRH 전구체와 유사하게 북방전복의 GnRH 단백질 전구체에는 한 개의 시그널 신호 영역(signal peptide)과 한 개의 GnRH 펩티드 (12개의 아미노산으로 구성)와 한군데의 프로세싱 영역, 한 개의 GnRH-associated peptide (GAP) 영역을 포함되어 있을 것으로 추정되었다.
The 5 'and 3'-RACE PCR method was used to identify prepro - Hdh -GnRH cDNA in the metatarsal ganglia of mature northern abalone. The north upset prepro - Hdh - and named GnRH, Hdh - - a GnRH cDNA Hdh GnRH overall length of length 868 consisting of a base of the new clay lactide (nt), by using the ORF finder tool of the NCBI translated region (CDS, coding As a result of the prediction of the DNA sequence, a 75 nt 5 'untranslated region (UTR), a 306 nt translation region (corresponding to 101 amino acids: SEQ ID NO: 2) Region (except for the poly A terminal region) (Fig. 2). Using the SinalP 4.1 server and the NeuroPred program, the Hdh - GnRH Analysis of the amino acid sequence predicted from the genetic information revealed that GnRH protein precursors of northern abalone, similar to known GnRH precursors, had one signal peptide, one GnRH peptide (consisting of 12 amino acids) and one processing Region, and one GnRH-associated peptide (GAP) region.

실시예Example 2. 실시간중합효소반응법(real-time  2. Real-time polymerase chain reaction (real-time PCRPCR )을 이용한 전복 ) Abalone GnRHGnRH (gonadotropin-releasing hormone) (gonadotropin-releasing hormone) mRNAmRNA 발현 조사를 위한  For expression studies GnRHGnRH 특이적  Specific 프라이Fry 머 제작Merge production

2-1. 성숙 단계별 전복 시료 확보2-1. Acquisition of abalone samples per mature stage

생식소에 대한 H-E 염색을 실시하여 생식소 발달 단계에 따라 연속적인 6단계 (Stage I~VI)로 분류하였다. 성숙기군 (Stage III과 Stage IV)에 속하는 전복에 대해서 조직별 GnRH mRNA의 발현을 확인하기 위해 신경절 조직들 (뇌신경절, 측족신경절)과 생식소, 아가미, 혈구세포, 외투막, 패각근, 내장 조직을 적출한 후 RNA 추출 전까지 -80℃에서 보관하였다. 또한 GnRH mRNA의 주요한 발현 조직인 신경절 조직들에서의 생식소 발달 단계별 발현 양상을 확인하기 위해 각 단계별 신경절 조직들 (뇌신경절, 측족신경절, 아가미신경절)을 적출하였다.H-E staining of the gonads was performed and classified into six consecutive stages (Stage I to VI) according to gonadal developmental stage. In order to confirm the expression of GnRH mRNA in tissues belonging to the mature stage (Stage III and Stage IV), ganglion tissues (cranial nerves, gyro ganglia) and gonads, gills, hematocytes, mantle, And then stored at -80 ° C until RNA extraction. In addition, ganglion tissues (cranial nerve, medial ganglia, and gill ganglion) at each stage were extracted to identify the gestational developmental stage of gonadal development in the ganglia tissues, the main expression machinery of GnRH mRNA.

전복 생식소 발달 단계를 연속적인 6단계로 분류하였으며, 난소 및 정소의 조직 절편을 제작한 후 H-E 염색을 실시한 후 광학현미경으로 관찰하였다. 생식소 발달 단계는 Najmudeen (Najmudeen 2007, Molluscan Res 27(3): 140-146)의 방법을 기준으로 생식세포 형성과정, 생식상피 조직상의 형태 변화, 생식소 내강에 존재하는 미분화 간충직 조직 그리고 생식소 결합조직과 생식상피에 존재하는 황색 과립세포의 출현 빈도 등에 따라 회복기/초기성장기, 후기성장기, 성숙기, 방란기/방정기, 퇴행기, 부정형기로 구분하였다(도 3 및 도 4).
Abnormal gonadal development stages were classified into 6 consecutive stages. Tissue sections of ovary and testes were prepared and HE stained and examined by optical microscope. The gonadal developmental stage was based on the method of Najmudeen (Najmudeen 2007, Molluscan Res 27 (3): 140-146), the germ cell formation process, morphological changes in reproductive epithelium, undifferentiated hepatic tissue in gonadal lumen, (Fig. 3 and Fig. 4). These cells were classified into the convalescent / early growth phase, late growth phase, mature phase, diffusive / irregular phase, retrograde phase and irregular phase depending on the appearance frequency of yellow granular cells present in the reproductive epithelium.

2-2. 북방전복 2-2. Northern abalone GnRHGnRH 전사체의Transpositional 조직별 발현 양상 Expression Patterns by Organization

실시간중합효소반응법 (qRT-PCR)으로 성숙기 (Stage III와 IV)의 암컷 및 수컷 전복에서의 대표 조직들 (뇌신경절, 생식소, 아가미, 내장조직, 혈구세포, 폐각근, 외투막)에서의 Hdh - GnRH 전사체의 발현 양상을 조사한 결과, 신경절 조직에서의 발현율이 높았고(도 5), 특히 측족신경절에서 높게 발현되었다(도 6).
The expression of Hdh -1 in the representative tissues (cranial nerves, gonads, gills, visceral cells, hematopoietic cells, osteoblasts , and endothelium ) in female and male abalones of the mature stages (Stage III and IV) The expression pattern of GnRH transcript was highly expressed in ganglion tissues (FIG. 5), particularly in the lateral ganglion (FIG. 6).

2-3. 번식 단계별 북방전복 2-3. Northern abalone by breeding step GnRHGnRH 전사체의Transpositional 발현 양상 Expression pattern

qRT-PCR법으로 전복 생식소 발달 단계별 GnRH 전사체의 신경절에서의 발현 변화를 조사하였다. 암컷 전복에서는 특히, 성숙기 및 방란기(Stage III와 IV)에서 측족신경절과 아가미신경절에서 GnRH 전사체의 발현이 높게 나타났으며, 암수 전복의 뇌신경절에서는 발현 변화가 뚜렷하지 않았다(도 6). 흥미롭게도, 방정기 (Stage IV)의 수컷 전복 아가미신경절에서의 GnRH 전사체의 발현이 현저하게 증가되었다. 이러한 결과로부터 전복의 GnRH 전사체는 생식소의 발달 단계 중 특히, 성숙 단계의 신경절 조직에서의 발현이 크게 증가됨이 확인되었고, 향후 전복의 성숙 발달 지표로서의 전복의 GnRH의 활용이 가능할 것으로 판단된다.
qRT-PCR method GnRH The changes of expression in ganglia of transcripts were examined. In female abalone, in particular, in maturation and egg layers (Stage III and IV), GnRH Expression of the transcript was high, and expression in the cranial nerve of the abdomen was not clear (Fig. 6). Interestingly, the expression of GnRH transcripts in the male abalone gillet of Stage IV was significantly increased. These results suggest that GnRH transcripts of abalone are highly expressed in the ganglion tissues during the developmental stage of gonad, especially at the maturation stage. GnRH abortion can be utilized as an indicator of maturation development of abalone in the future.

PCRPCR 과 실시간중합효소반응법(And real-time PCR qRTqRT -- PCRPCR )에 이용한 올리고 ), 프라이머primer PrimerPrimer Sequence(5'- 3')(서열번호)Sequence (5'- 3 ') (SEQ ID NO) ApplicationApplication Hdh-GnRH-F1Hdh-GnRH-F1 GCTGCTGCTCACGGTACATG(3)GCTGCTGCTCACGGTACATG (3) Partial PCRPartial PCR Hdh-GnRH-R1Hdh-GnRH-R1 CTGCATTCTGGCAGCGATGG(4) CTGCATTCTGGCAGCGATGG (4) Hdh-GnRH-F2Hdh-GnRH-F2 GGAATCATCTCGTGTGGCCCATCGCTGC(5)GGAATCATCTCGTGTGGCCCATCGCTGC (5) RACE PCRRACE PCR Hdh-GnRH-R2Hdh-GnRH-R2 CTGGCAGCGATGGGCCACACGAGATG(6)CTGGCAGCGATGGGCCACACGAGATG (6) UPM(F/R)UPM (F / R) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT(7)CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT (7) Hdh-GnRH-F3Hdh-GnRH-F3 CATACGCACCAAACCACAGAA(8)CATACGCACCAAACCACAGAA (8) Quantitative Real-time PCR (qPCR)Quantitative Real-time PCR (qPCR) Hdh-GnRH-R3Hdh-GnRH-R3 CGTGCCAGCCGTTGCT(9)CGTGCCAGCCGTTGCT (9) Hdh-RPL5-FHdh-RPL5-F TCACCAACAAGGACATCATTTGTC(10)TCACCAACAAGGACATCATTTGTC (10) Hdh-RPL5-RHdh-RPL5-R CAGGAGGAGTCCAGTGCAGTATG(11)CAGGAGGAGTCCAGTGCAGTATG (11) Note. F, forward; R, reverse; UPM, universal primer A mix Note. F, forward; R, reverse; UPM, universal primer mix

본 발명을 통해, 전복의 성숙 발달 단계별로 GnRH 유전자의 발현양상을 조사함으로써, 전복의 성숙 발달 지표로 활용할 수 있다. 전복의 성 성숙 발달지표의 개발은 "건강한 전복 치패 생산" 위한 성숙 상태가 완전하여 양질의 배우자 생산에 적합한 건강한 어미 전복의 확보에 이용할 수 있다. Through the present invention, by examining the expression pattern of GnRH gene in the stages of maturation of abalone, it can be utilized as an indicator of maturation development of abalone. The development of gender maturation indicators of abalone can be used to secure a healthy mother abductor suitable for the production of high quality spouses because the mature state for "healthy abalone production" is complete.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> GnRH gene from Haliotis discus hannai and uses thereof <130> PN16104 <160> 11 <170> KopatentIn 2.0 <210> 1 <211> 306 <212> DNA <213> Haliotis discus hannai <400> 1 atgtcagtac tatcaagaca aggggtgact gtgtcggtgc tgctgctgct gctcacagta 60 cacgctgttg gaggccagaa ctaccacttc agcaacggct ggcacgcagg caggaaacgt 120 ggcggggaca gcaccagctg cgtcttcagg aaagacatcc tcatgcttgt caacaaactg 180 atcatggagg aatcatctcg tgtggcccat cgctgccaga acggagtgcc gcacatggac 240 ttcacagagc ctgacacagt tgaagctgat tctgccaacc agctgacaga caagcgatgg 300 aagtga 306 <210> 2 <211> 101 <212> PRT <213> Haliotis discus hannai <400> 2 Met Ser Val Leu Ser Arg Gln Gly Val Thr Val Ser Val Leu Leu Leu 1 5 10 15 Leu Leu Thr Val His Ala Val Gly Gly Gln Asn Tyr His Phe Ser Asn 20 25 30 Gly Trp His Ala Gly Arg Lys Arg Gly Gly Asp Ser Thr Ser Cys Val 35 40 45 Phe Arg Lys Asp Ile Leu Met Leu Val Asn Lys Leu Ile Met Glu Glu 50 55 60 Ser Ser Arg Val Ala His Arg Cys Gln Asn Gly Val Pro His Met Asp 65 70 75 80 Phe Thr Glu Pro Asp Thr Val Glu Ala Asp Ser Ala Asn Gln Leu Thr 85 90 95 Asp Lys Arg Trp Lys 100 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gctgctgctc acggtacatg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctgcattctg gcagcgatgg 20 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggaatcatct cgtgtggccc atcgctgc 28 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctggcagcga tgggccacac gagatg 26 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 catacgcacc aaaccacaga a 21 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cgtgccagcc gttgct 16 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tcaccaacaa ggacatcatt tgtc 24 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 caggaggagt ccagtgcagt atg 23 <110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> GnRH gene from Haliotis discus hannai and uses thereof <130> PN16104 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 306 <212> DNA <213> Haliotis discus hannai <400> 1 atgtcagtac tatcaagaca aggggtgact gtgtcggtgc tgctgctgct gctcacagta 60 cacgctgttg gaggccagaa ctaccacttc agcaacggct ggcacgcagg caggaaacgt 120 ggcggggaca gcaccagctg cgtcttcagg aaagacatcc tcatgcttgt caacaaactg 180 atcatggagg aatcatctcg tgtggcccat cgctgccaga acggagtgcc gcacatggac 240 ttcacagagc ctgacacagt tgaagctgat tctgccaacc agctgacaga caagcgatgg 300 aagtga 306 <210> 2 <211> 101 <212> PRT <213> Haliotis discus hannai <400> 2 Met Ser Val Leu Ser Arg Gln Gly Val Thr Val Ser Val Leu Leu Leu   1 5 10 15 Leu Leu Thr Val His Ala Val Gly Gly Gln Asn Tyr His Phe Ser Asn              20 25 30 Gly Trp His Ala Gly Arg Lys Arg Gly Gly Asp Ser Thr Ser Cys Val          35 40 45 Phe Arg Lys Asp Ile Leu Met Leu Val Asn Lys Leu Ile Met Glu Glu      50 55 60 Ser Ser Arg Val Ala His Arg Cys Gln Asn Gly Val Pro His Met Asp  65 70 75 80 Phe Thr Glu Pro Asp Thr Val Glu Ala Asp Ser Ala Asn Gln Leu Thr                  85 90 95 Asp Lys Arg Trp Lys             100 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 gctgctgctc acggtacatg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ctgcattctg gcagcgatgg 20 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggaatcatct cgtgtggccc atcgctgc 28 <210> 6 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ctggcagcga tgggccacac gagatg 26 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 catacgcacc aaaccacaga a 21 <210> 9 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cgtgccagcc gttgct 16 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tcaccaacaa ggacatcatt tgtc 24 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 caggaggagt ccagtgcagt atg 23

Claims (9)

서열번호 2의 아미노산 서열로 이루어진, 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질.2, which consists of the amino acid sequence of SEQ ID NO: 2 ( Haliotis gonadotropin releasing hormone (GnRH) protein derived from the discus hannai . 제1항의 GnRH 단백질을 코딩하는 유전자.A gene encoding the GnRH protein of claim 1. 제2항에 있어서, 서열번호 1로 표시되는 염기서열로 이루어진 것을 특징으로 하는 유전자.3. The gene according to claim 2, wherein the gene consists of the nucleotide sequence shown in SEQ ID NO: 1. 서열번호 2의 아미노산 서열로 이루어진 북방전복(Haliotis discus hannai) 유래의 GnRH(gonadotropin releasing hormone) 단백질을 코딩하는 유전자의 발현 수준을 측정하는 물질을 포함하는 북방전복의 성숙 발달 정도를 판별하기 위한 조성물.A Northern Abalone ( Haliotis) consisting of the amino acid sequence of SEQ ID NO: 2 A composition for discriminating the degree of maturation of Northern abalone comprising a substance for measuring the expression level of a gene encoding a gonadotropin releasing hormone (GnRH) protein derived from a discus hannai . 제1항에 있어서, 상기 유전자의 발현 수준을 측정하는 물질은 상기 GnRH 단백질을 코딩하는 유전자에 특이적으로 결합하는 프라이머 세트인 것을 특징으로 하는 조성물.The composition according to claim 1, wherein the substance for measuring the expression level of the gene is a primer set that specifically binds to the gene encoding the GnRH protein. 제5항에 있어서, 상기 프라이머 세트는 서열번호 8 및 9의 올리고뉴클레오티드 프라이머 세트인 것을 특징으로 하는 조성물.6. The composition of claim 5, wherein the primer set is a set of oligonucleotide primers of SEQ ID NOS: 8 and 9. 북방전복(Haliotis discus hannai)으로부터 서열번호 2의 아미노산 서열로 이루어진 GnRH(gonadotropin releasing hormone) 단백질을 코딩하는 유전자의 발현 수준을 측정하는 단계를 포함하는 북방전복의 성숙 발달 정도를 판별하는 방법.Northern abalone ( Haliotis discus determining the level of expression of a gene encoding a gonadotropin releasing hormone (GnRH) protein consisting of the amino acid sequence of SEQ ID NO: 2 from hannai . 제7항에 있어서, 상기 유전자의 발현 수준을 측정하는 방법은 역전사효소 중합효소반응, 경쟁적 역전사효소 중합효소반응, 실시간 역전사효소 중합효소반응, RNase 보호 분석법, 노던 블랏팅 또는 DNA 칩에 의해 수행되는 것을 특징으로 하는 북방전복의 성숙 발달 정도를 판별하는 방법.The method according to claim 7, wherein the expression level of the gene is measured by a reverse transcriptase polymerase, a competitive reverse transcriptase polymerase, a real-time reverse transcriptase polymerase, an RNase protection assay, a Northern blotting or a DNA chip A method of determining the degree of maturation development of northern abalone characterized by. 제7항에 있어서, 상기 GnRH 단백질을 코딩하는 유전자의 발현 수준을 측정하여 북방전복의 암컷의 측족신경절과 아가미신경절에서 발현 수준이 가장 높은 경우 성숙기 및 방란기로 판별하고, 북방전복의 수컷의 아가미신경절에서 발현 수준이 가장 높은 경우 방정기로 판별하는 것을 특징으로 하는 북방전복의 성숙 발달 정도를 판별하는 방법.[Claim 7] The method according to claim 7, wherein the expression level of the gene coding for the GnRH protein is measured to determine that the expression level is highest in the ovarian ganglia and gill ganglia of the female of the Northern Abalone, In which the expression level is the highest, is identified as a reporter.
KR1020160109871A 2016-08-29 2016-08-29 GnRH gene from Haliotis discus hannai and uses thereof KR101864704B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160109871A KR101864704B1 (en) 2016-08-29 2016-08-29 GnRH gene from Haliotis discus hannai and uses thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160109871A KR101864704B1 (en) 2016-08-29 2016-08-29 GnRH gene from Haliotis discus hannai and uses thereof

Publications (2)

Publication Number Publication Date
KR20180024184A true KR20180024184A (en) 2018-03-08
KR101864704B1 KR101864704B1 (en) 2018-06-05

Family

ID=61726518

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160109871A KR101864704B1 (en) 2016-08-29 2016-08-29 GnRH gene from Haliotis discus hannai and uses thereof

Country Status (1)

Country Link
KR (1) KR101864704B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112481196A (en) * 2020-12-17 2021-03-12 中国海洋大学 Method for separating and primary culturing Haliotis discus hannai hepatopancreas cells
KR20220085633A (en) * 2020-12-15 2022-06-22 전남대학교산학협력단 Composition for oviposition induction of Gastropoda comprising LFRFamide peptide as effective component

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102117391B1 (en) 2019-03-22 2020-06-01 경희대학교 산학협력단 Multiplex pcr primers for detection of shellfishes causing allergy, and uses thereof
KR102701904B1 (en) * 2020-09-03 2024-09-03 성균관대학교산학협력단 Peptides specifically binding to filamentous fungus spore

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Aquaculture, vol.450, pp.116-122(2015)* *
손영창 등,"무지개송어 뇌, 뇌하수체 및 간의 성성숙호르몬 유전자를 활용한 성숙시기 조절법에 관한 연구" 과제 최종보고서. 강릉대학교 (2008.01.)* *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220085633A (en) * 2020-12-15 2022-06-22 전남대학교산학협력단 Composition for oviposition induction of Gastropoda comprising LFRFamide peptide as effective component
CN112481196A (en) * 2020-12-17 2021-03-12 中国海洋大学 Method for separating and primary culturing Haliotis discus hannai hepatopancreas cells
CN112481196B (en) * 2020-12-17 2022-09-13 中国海洋大学 Method for separating and primary culturing Haliotis discus hannai hepatopancreas cells

Also Published As

Publication number Publication date
KR101864704B1 (en) 2018-06-05

Similar Documents

Publication Publication Date Title
KR101864704B1 (en) GnRH gene from Haliotis discus hannai and uses thereof
Tchoudakova et al. Molecular cloning of an estrogen receptor β subtype from the goldfish, Carassius auratus
Keeney et al. A mouse homolog of the Saccharomyces cerevisiae meiotic recombination DNA transesterase Spo11p
Forgacs et al. Mutation analysis of the PTEN/MMAC1 gene in lung cancer
Aplan et al. Structural characterization of SIL, a gene frequently disrupted in T-cell acute lymphoblastic leukemia
Smith et al. In trypanosomes the homolog of the largest subunit of RNA polymerase II is encoded by two genes and has a highly unusual C-terminal domain structure
US6268221B1 (en) Melanocyte stimulating hormone receptor and uses
EP1309679A2 (en) Human genes and gene expression products
Machado et al. QTL affecting body weight in a candidate region of cattle chromosome 5
JP2004502406A (en) Human genes and human gene expression products
CN112522290B (en) Sea island cotton fiber quality related calcineurin B-like interaction protein kinase gene
Armstrong et al. Genetic diversity analysis of the Uruguayan Creole cattle breed using microsatellites and mtDNA markers
Wilkerson et al. Gene discovery and comparative analysis of X-degenerate genes from the domestic cat Y chromosome
WO2003100000A2 (en) Amplification and overexpression of oncogenes
Dalla Valle et al. β‐Keratins of the Crocodilian epidermis: Composition, structure, and phylogenetic relationships
KR101941857B1 (en) Kit for discriminating sexual developmental stage of Haliotis discus hannai
Etheridge et al. Characterization of ATDRG1, a member of a new class of GTP-binding proteins in plants
Kottler et al. Tissue-specific pattern of variant transcripts of the human gonadotropin-releasing hormone receptor gene
Lindersson et al. Mapping of serum amylase-1 and quantitative trait loci for milk production traits to cattle chromosome 4
Lozano et al. Molecular cloning, gene localization, and structure of human cyclin B3
Katsanis et al. Isolation of a paralog of the Doyne honeycomb retinal dystrophy gene from the multiple retinopathy critical region on 11q13
Yu et al. Evolution of the DAZ gene and the AZFc region on primate Y chromosomes
EP1195382B1 (en) Testis-specific gene
Huang et al. A newly formed telomere in Ascaris suum does not exert a telomere position effect on a nearby gene
Alvarez et al. Growth hormone locus expands and diverges after the separation of New and Old World Monkeys

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant