KR20180023641A - Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation - Google Patents

Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation Download PDF

Info

Publication number
KR20180023641A
KR20180023641A KR1020160109308A KR20160109308A KR20180023641A KR 20180023641 A KR20180023641 A KR 20180023641A KR 1020160109308 A KR1020160109308 A KR 1020160109308A KR 20160109308 A KR20160109308 A KR 20160109308A KR 20180023641 A KR20180023641 A KR 20180023641A
Authority
KR
South Korea
Prior art keywords
cells
pluripotent stem
reprogramming
irradiation
stem cells
Prior art date
Application number
KR1020160109308A
Other languages
Korean (ko)
Other versions
KR101836860B1 (en
Inventor
이승범
박선후
한성훈
김민정
심세환
장원석
이선주
명재경
이승숙
진영우
Original Assignee
한국원자력의학원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국원자력의학원 filed Critical 한국원자력의학원
Priority to KR1020160109308A priority Critical patent/KR101836860B1/en
Publication of KR20180023641A publication Critical patent/KR20180023641A/en
Application granted granted Critical
Publication of KR101836860B1 publication Critical patent/KR101836860B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06Animal cells or tissues; Human cells or tissues
    • C12N5/0602Vertebrate cells
    • C12N5/0696Artificially induced pluripotent stem cells, e.g. iPS
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N13/00Treatment of microorganisms or enzymes with electrical or wave energy, e.g. magnetism, sonic waves
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/13Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells
    • C12N2506/1307Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from connective tissue cells, from mesenchymal cells from adult fibroblasts
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2523/00Culture process characterised by temperature

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Transplantation (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a method for promoting a reprogramming efficiency of induced pluripotent stem cells by long-term cell culture after irradiation. According to the present invention, the reprogramming efficiencies of induced pluripotent stem cells is investigated after culturing the irradiated cells for different number of days. A production of induced pluripotent stem cells decreases in the cells cultured for three days but remarkably increases in the cells cultured for 14 days. Moreover, long-term cultured cells after irradiation proves that reprogramming of the induced pluripotent stem cells is promoted to have high efficiency by confirming cells from the reprogrammed cells with high efficiency through the characteristic analysis. Therefore, the method for promoting reprogramming induced pluripotent stem cells by irradiation of the present invention can be utilized for research on the induced pluripotent stem cells generation efficiency promoting factor and mechanism.

Description

방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법{Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation}[0001] The present invention relates to a method for enhancing the efficiency of induced pluripotent stem cell reprogramming by inducing long-term cell culture after irradiation,

본 발명은 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법에 관한 것이다.The present invention relates to a method for promoting induced pluripotent stem cell reprogramming efficiency by long-term cell culture after irradiation.

분화가 끝난 체세포를 미분화 상태의 세포 (e.g., 줄기세포)로 되돌리는 과정을 리프로그래밍(reprogramming)으로 명명하고 있으며, 현재까지 체세포 핵 치환 (somatic cell nuclear transfer, SCNT), 유도만능줄기세포 리프로그래밍 (induced pluripotent stem cell reprogramming, iPS reprogramming), 세포융합 (cell fusion) 방법이 보고되고 있다. The process of returning differentiated somatic cells to undifferentiated cells (eg, stem cells) has been termed reprogramming. To date, somatic cell nuclear transfer (SCNT), induced pluripotent stem cell reprogramming induced pluripotent stem cell reprogramming (iPS) reprogramming, and cell fusion.

역분화줄기세포는 유도만능줄기세포로 지칭되며, 분화가 끝난 체세포에 역분화인자들을 삽입하여 분화이전의 세포단계로 되돌린 세포로 배아줄기세포처럼 자기재생 및 만능분화능을 가지고 있어 차세대 줄기세포치료제로서 급부상하고 있지만, 낮은 생성 효율로 인해 임상적용에 어려움을 겪고 있는 실정이다.Stem cells are called inducible pluripotent stem cells. They are cells that have been reintroduced into the cell stage prior to differentiation by inserting de-differentiation factors into the differentiated somatic cells. They have self-renewal and universal differentiation potentials like embryonic stem cells, , But the clinical application is difficult due to the low production efficiency.

이러한 낮은 유도만능줄기세포 리프로그래밍 효율을 높이기 위해 다양한 인자 등이 보고되었으나, 방사선 조사 후 (post-irradiation) 리프로그래밍 효율 증진에 대한 보고는 미비하다.Various factors have been reported to increase the efficiency of such low induced pluripotent stem cell reprogramming, but there is little report on post-irradiation reprogramming efficiency enhancement.

미국공개특허 US2010/0062533호(2010.03.11)U.S. Published patent application US2010 / 0062533 (2010.03.11)

본 발명의 목적은 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법을 제공하는데 있다.It is an object of the present invention to provide a method for promoting induced pluripotent stem cell reprogramming efficiency by long-term cell culture after irradiation.

본 발명은 (1) 섬유아세포에 방사선을 조사하는 단계; (2) 상기 방사선이 조사된 섬유아세포를 10 내지 25일 배양하는 단계; 및 (3) 상기 배양된 섬유아세포를 유도만능줄기세포로 리프로그래밍시키는 단계를 포함하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법을 제공한다.(1) irradiating fibroblasts with radiation; (2) culturing the irradiated fibroblasts for 10 to 25 days; And (3) reprogramming the cultured fibroblasts to inducible pluripotent stem cells. The present invention further provides a method for promoting induced pluripotent stem cell reprogramming.

본 발명은 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법을 제공한다. 본 발명에 따르면 방사선이 조사된 세포를 다양한 요일별로 배양 후 유도만능줄기세포로의 리프로그래밍 효율을 조사한 결과, 3일째 배양된 세포는 유도만능줄기세포 생성율이 감소한 반면 14일째 배양된 세포에서는 유도만능줄기세포 생성이 현저히 증가됨을 관찰할 수 있었다. 또한 고효율로 리프로그램된 세포들에서 줄기세포 특성 분석을 통해 유도만능줄기세포임을 확인하여 방사선 조사 후 장기배양된 세포는 유도만능줄기세포 리프로그래밍이 고효율로 증진됨을 증명하였다. 따라서, 본 발명에 적용된 방사선 조사에 의한 유도만능줄기세포 리프로그래밍 증진법은 유도만능줄기세포 생성 효율 증진인자 탐색 및 기전 연구에 활용될 수 있을 것이다.The present invention provides a method for promoting induced pluripotent stem cell reprogramming efficiency by long-term cell culture after irradiation. According to the present invention, the reprogramming efficiency of inducing pluripotent stem cells after culturing the irradiated cells by various days of days showed that induction of pluripotent stem cells was decreased in the cells cultured on day 3, And the production of stem cells was remarkably increased. In addition, we confirmed that the cells were induced pluripotent stem cells through the characterization of stem cells in high - reprogrammed cells. Thus, long - term cultured cells after irradiation showed that inducible pluripotent stem cell reprogramming was promoted with high efficiency. Therefore, the induced pluripotent stem cell reprogramming promoted by radiation irradiation applied to the present invention can be utilized for research on the inducible pluripotent stem cell production promoting factor and its mechanism.

도 1은 방사선 조사된 섬유아세포에서 유도만능줄기세포 리프로그래밍 실험 모식도(A) 및 섬유아세포에서 리프로그램된 세포(B)를 나타낸다.
도 2는 방사선 조사 후 장기배양된 섬유아세포에서 증가된 유도만능줄기세포 리프로그래밍 효율을 나타낸다.
도 3 및 도 4는 방사선 조사 후 장기배양된 세포로부터 리프로그램된 세포들의 만능줄기세포 특성 분석 결과를 나타낸다.
Figure 1 shows a schematic diagram (A) of induced pluripotent stem cell reprogramming in irradiated fibroblasts and a reprogrammed cell (B) in fibroblasts.
Fig. 2 shows the induced pluripotent stem cell reprogramming efficiency in fibroblasts cultured after irradiation.
FIG. 3 and FIG. 4 show the results of analysis of pluripotent stem cell characteristics of the reprogrammed cells from the cells cultured for a long time after irradiation.

본 발명은 (1) 섬유아세포에 방사선을 조사하는 단계; (2) 상기 방사선이 조사된 섬유아세포를 10 내지 25일 배양하는 단계; 및 (3) 상기 배양된 섬유아세포를 유도만능줄기세포로 리프로그래밍시키는 단계를 포함하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법을 제공한다. (1) irradiating fibroblasts with radiation; (2) culturing the irradiated fibroblasts for 10 to 25 days; And (3) reprogramming the cultured fibroblasts to inducible pluripotent stem cells. The present invention further provides a method for promoting induced pluripotent stem cell reprogramming.

바람직하게는, 상기 방사선 조사는 1 내지 5Gy 단일 방사선으로 조사할 수 있으나, 이에 한정되는 것은 아니다.Preferably, the radiation is irradiated by a single radiation of 1 to 5 Gy, but is not limited thereto.

바람직하게는, 상기 (2) 단계의 배양은 37℃에서 14일 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.Preferably, the culture in step (2) above can be cultured at 37 DEG C for 14 days, but is not limited thereto.

바람직하게는, 상기 (3) 단계 리프로그래밍은 섬유아세포에 리프로그래밍 인자인 Klf4, Oct4, Sox2 및 c-Myc를 도입할 수 있으나, 이에 한정되는 것은 아니다. Preferably, the step (3) reprogramming may include, but is not limited to, introducing fibroblast reprogramming factors Klf4, Oct4, Sox2 and c-Myc.

본 발명에 있어서, "리프로그래밍(reprogramming)"은 분화가 끝난 체세포를 미분화 상태의 세포 (e.g., 줄기세포)로 되돌리는 과정을 의미한다.In the present invention, "reprogramming" refers to a process of returning differentiated somatic cells to undifferentiated cells (e.g., stem cells).

본 발명에 있어서, "유도만능줄기세포(induced pluripotent stem cell; iPSC)"는 분화가 끝난 체세포에 역분화인자들을 삽입하여 분화 이전의 세포 단계로 되돌린 세포로 배아줄기세포처럼 자기재생과 만능분화능을 가진 줄기세포이다.In the present invention, "induced pluripotent stem cell (iPSC)" is a cell that has been transformed into a cell stage prior to differentiation by inserting dedifferentiation factors into the differentiated somatic cells. Like embryonic stem cells, .

이하에서는, 본 발명을 한정하지 않는 실시예에 따라 본 발명을 상세히 설명한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 따라서, 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. Hereinafter, the present invention will be described in detail with reference to embodiments which do not limit the present invention. It should be understood that the following embodiments of the present invention are only for embodying the present invention and do not limit or limit the scope of the present invention. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described herein.

<< 실험예Experimental Example >>

하기의 실험예들은 본 발명에 따른 각각의 실시예에 공통적으로 적용되는 실험예를 제공하기 위한 것이다.The following experimental examples are intended to provide experimental examples that are commonly applied to the respective embodiments according to the present invention.

1. 인체 섬유아세포 및 1. Human fibroblasts and 유도만능줄기세포Induced pluripotent stem cells 배양 culture

ATCC로부터 분양받은 NUFF (인체섬유아세포)을 10% 혈청이 함유된 DMEM (Giboco BRL., USA) 성장배지에 넣고 37℃, 5% CO2 incubator에서 배양하였다. 배지는 3일에 1번 교체하였으며, 세포 밀도가 80% 되었을 때 계대 배양하였다. 섬유아세포에 5Gy 단일 방사선 조사하였다. 생성된 유도만능줄기세포는 matrigel coated plate에 1:6로 분주후 10μM ROCK 저해제가 함유된 mTeSR1 medium (Stemcell Technology Inc., USA) 첨가하고 37℃, 5% CO2 조건하에서 배양하였다. 다음 날 배지를 교환 후 2일에 한 번씩 배지를 교체해준다.NUFF (human fibroblast) from ATCC was cultured in DMEM (Gibco BRL, USA) containing 10% serum at 37 ° C and 5% CO 2 incubator. The medium was changed once every 3 days and subcultured when cell density was 80%. Fibroblasts were irradiated with 5Gy single radiation. The resulting induced pluripotent stem cells were mixed with matrigel coated plates at a ratio of 1: 6, and then mTeSR1 medium (Stemcell Technology Inc., USA) containing 10 μM ROCK inhibitor was added and cultured at 37 ° C and 5% CO 2 . Replace the medium the next day and replace the medium once every two days.

2. 2. 리프로그래밍인자Reprogramming factor 레트로 바이러스Retrovirus 생성  produce

gp293 (Clontec Inc., USA) 세포를 100mm dish에 6x106으로 분주하여 5% CO2 incubator에서 24시간 배양하였다. 다음 날, gp293세포에 lipofectamin 2000 kit 매뉴얼에 따라, 각각의 1㎍/ml 리프로그래밍인자들 (Klf4, Oct4, Sox2, c-Myc) 과 0.5㎍/ml VSVG (바이러스 envelope vector) 와 co-transfection하고 37℃, 5% CO2 incubator에서 24시간 배양한 후 10% DMEM으로 교체하였다. 배양 2일차 및 3일차에 상등액을 모아 0.45mm filter로 여과하여 리프로그래밍 인자들이 함유된 바이러스를 생산하였다.gp293 (Clontec Inc., USA) cells were seeded in a 100 mm dish at 6 × 10 6 and cultured in a 5% CO 2 incubator for 24 hours. The next day, gp293 cells were co-transfected with 1 μg / ml reprogramming factors (Klf4, Oct4, Sox2, c-Myc) and 0.5 μg / ml VSVG (viral envelope vector) according to the lipofectamine 2000 kit manual After incubation for 24 h at 37 ° C in a 5% CO 2 incubator, the cells were replaced with 10% DMEM. On the 2nd and 3rd day of culture, the supernatant was collected and filtered with a 0.45 mm filter to produce a virus containing reprogramming factors.

3. 방사선조사 후 배양된 3. After irradiation, 인체섬유아세포에서In human fibroblasts 유도만능줄기세포로의Induced pluripotent stem cells 리프로그래밍Reprogramming

바이러스 생성 하루 전 대조군 또는 실험군 섬유아세포 (방사선 조사 후 표시된 요일 동안 배양된 세포)를 5x104cells/well (6 well plate)로 부착 후 리프로그래밍인자 바이러스 와 5㎍/㎖ polybrene이 첨가된 배지로 배양하였다. 5일 동안 형질 전환된 섬유아세포를 1x104cell/well이 되게 Matrigel coated plate에 분주하고 5% CO2 incubator에서 24시간 배양하였다. 다음날, human iPS cell (TeSR-E7 media, Stemcell Technology Inc.) 유도 배지로 교체해주고, 만능줄기세포인 배아줄기세포 유사 콜로니 (hES-like coloies)가 나타날 때 까지 매일 배지를 교체해주었다.Cells were incubated with 5 × 10 4 cells / well (6-well plates) in a control or experimental group of fibroblasts (cells cultured for the days indicated after irradiation), and then cultured in media supplemented with reprogramming factor virus and 5 μg / ml polybrene Respectively. Transfected fibroblasts were plated on Matrigel coated plates at 1 × 10 4 cells / well for 5 days and cultured in a 5% CO 2 incubator for 24 hours. The next day, the medium was replaced with a human iPS cell (TeSR-E7 media, Stemcell Technology Inc.) induction medium and the medium was changed daily until the expression of pluripotent embryonic stem cells (hES-like coloies).

4. 4. 인체섬유아세포의Human fibroblast 리프로그래밍Reprogramming 효율 분석 Efficiency analysis

리프로그램된 세포를 R-phycoerythrin (R-PE)이 결합된 SSEA4 (1:500 dilution, Stemgent, USA) 와 fluorescein isothiocyanate (FITC)이 결합된 Tra1-81 (1:100 dilution, stemgent, USA)가 포함된 배양 배지에서 37℃, 5% CO2 incubator에서 1시간 염색 후 형광현미경으로 관찰하였다. SSEA4는 red color로 관찰하였으며, Tra1-81은 green color로 관찰하고 염색된 콜로니 수를 카운터하여 정량화 하였다. 또한 Alkaline Phosphatase Staining kit 매뉴얼에 따라 (System Biosciences, USA), 리프로그램된 세포를 PBS로 2회 세척하고, 4% paraformaldehyde로 고정한 후, Blue-color AP 용액으로 염색하고 PBS로 2회 세척한 후 콜로니 염색 여부를 광학현미경 아래서 관찰하였다. 염색된 콜로니 수를 카운터하여 정량화 하였다. (1: 100 dilution, stemgent, USA) in which R-phycoerythrin (R-PE) conjugated SSEA4 (1: 500 dilution, Stemgent, USA) and fluorescein isothiocyanate Were stained in a 5% CO 2 incubator at 37 ° C for 1 hour and then observed with a fluorescence microscope. SSEA4 was observed in red color, Tra1-81 was observed in green color, and the number of stained colonies was counted and quantified. In addition, the reprogrammed cells were washed twice with PBS, fixed with 4% paraformaldehyde, stained with Blue-color AP solution, washed twice with PBS according to the Alkaline Phosphatase Staining kit manual (System Biosciences, USA) Dyeing was observed under an optical microscope. The number of stained colonies was counted and quantified.

5. 면역염색5. Immunostaining

리프로그램된 세포들을 4% paraformaldehyde로 상온에서 20min 고정한다. 고정된 세포를 1% BSA 및 0.5% Triton X-100인 함유된 PBS로 상온에서 1시간 반응시킨 후 각각의 일차 항체들 Oct4 (1:100, SantaCruz, CA, USA), Sox2 (1:100, Cell Signalling, Danvers, MA, USA), Nanog (1:200, Cosmo Bio, Koto-Ku, Japan) 처리하고, FITC-conjugated goat anti-rabbit IgG 또는 anti-mouse IgG (1:100, Invitrogen, Carlsbad, CA)를 이차항체로 반응하였다. 형광이미지는 형광현미경 (Olympus, Shinjuku, Tokyo, Japan)으로 분석하였다. DAPI를 핵염색 용액으로 사용하였다. Reprogrammed cells are fixed with 4% paraformaldehyde at room temperature for 20 min. The immobilized cells were incubated with PBS containing 1% BSA and 0.5% Triton X-100 for 1 hour at room temperature. Each primary antibody, Oct4 (1: 100, SantaCruz, CA, USA), Sox2 Conjugated goat anti-rabbit IgG or anti-mouse IgG (1: 100, Invitrogen, Carlsbad, CA), Nanog (1: 200, Cosmo Bio, Koto- CA) were reacted with secondary antibodies. Fluorescence images were analyzed by fluorescence microscopy (Olympus, Shinjuku, Tokyo, Japan). DAPI was used as a nuclear staining solution.

6. 6. qPCRqPCR

섬유아세포와 리프로그램된 세포에서 RNA minikit (Qiagen, Inc.)를 이용해 total RNA를 추출한 다음 Accupower RT mix reagent (Bioneer Corp., Seoul,Korea)를 사용해 cDNA로 만들었다. 실시간 PCR (Real-time PCR) FastStart Essential DNA Green Master (Roche, Indianapolis, IN, USA)를 사용하여 수행하였다. 본 발명에 사용된 프라이머 서열은 표 1과 같다.Total RNA was extracted from fibroblasts and reprogrammed cells using RNA minikit (Qiagen, Inc.) and then made into cDNA using Accupower RT mix reagent (Bioneer Corp., Seoul, Korea). Real-time PCR was performed using FastStart Essential DNA Green Master (Roche, Indianapolis, IN, USA). The primer sequences used in the present invention are shown in Table 1.

GeneGene Primer sequence (5'-3')Primer sequence (5'-3 ') hOct4-FhOct4-F GATGTGGTCCGAGTGTGGTTGATGTGGTCCGAGTGTGGTT hOct4-RhOct4-R AGCCTGGGGTACCAAAATGGAGCCTGGGGTACCAAAATGG hSox2-FhSox2-F GCCCTGCAGTACAACTCCATGCCCTGCAGTACAACTCCAT hSox2-RhSox2-R GACTTGACCACCGAACCCATGACTTGACCACCGAACCCAT hNanog-FhNanog-F AAGGCCTCAGCACCTACCTAAAGGCCTCAGCACCTACCTA hNanog-RhNanog-R TGCACCAGGTCTGAGTGTTCTGCACCAGGTCTGAGTGTTC GAPDH-FGAPDH-F GGACTCATGACCACAGTCCATGCCGGACTCATGACCACAGTCCATGCC GAPDH-RGAPDH-R TCAGGGATGACCTTGCCCACAGTCAGGGATGACCTTGCCCACAG

<< 실시예Example 1> 방사선 조사 후 장기 배양된 섬유아세포에서  1> Long-term culture of fibroblasts after irradiation 증가된Increased 유도만능줄Guidewire 기세포 리프로그래밍 효율 확인Checking programming efficiency

방사선 조사된 섬유아세포에서 유도만능줄기세포 리프로그래밍 실험 모식도를 도 1A에 나타냈다. 대조군과 방사선 조사된 처리군을 리프로그래밍 전사인자들을 이용하여 리프로그램 후 시간에 따른 배아줄기세포세포 유사 콜로니 모양 및 줄기세포 특이적 표면마커 (SSEA4 및 Tra1-81)을 2주째부터 관찰할 수 있었다(도 1B).A schematic diagram of an induced pluripotent stem cell reprogramming experiment in irradiated fibroblasts is shown in Fig. 1A. Using the reprogramming transcription factors in the control and irradiated groups, embryonic stem cell-like colony shape and stem cell specific surface markers (SSEA4 and Tra1-81) were observed from the 2nd week after reprogramming (Fig. 1B).

5Gy 방사선을 조사 후 3일, 7일 및 14일 배양된 세포에 리프로그래밍 인자들을 형질도입 후 배아줄기세포 유사 콜로니 형태로 Tra1-81 (유도만능줄기세포 표면마커) 항체가 염색된 콜로니 개수를 counting 결과 방사선 조사 후 장기배양된 세포에서 약 2배이상 리프로그래밍 효율이 증가됨을 관찰할수 있었다(도 2A). 이러한 현상을 유도만능줄기세포에서 특이적 활성을 보이는 알칼린포스타제 염색법을 통하여 더 확인할 수 있었다(도 2B).After transfection of reprogramming factors into cells cultured on days 3, 7, and 14 after irradiation with 5Gy radiation, Tra1-81 (induced pluripotent stem cell surface marker) antibody was counted in the form of embryonic stem cell-like colony counting the number of colonies stained As a result, it was observed that the reprogramming efficiency was increased by about 2 times in the long-term cultured cells after irradiation (FIG. 2A). This phenomenon was further confirmed by an alkaline phosphatase staining method showing specific activity in induced pluripotent stem cells (Fig. 2B).

<< 실시예Example 2> 방사선 조사 후 장기배양된 세포로부터 리프로그램된 세포들의 만능줄기세포 특성 분석 2> Characterization of pluripotent stem cells from reprogrammed cells from long-term cultured cells after irradiation

리프로그램된 세포에서 만능줄기세포의 형태학적 특징, 알칼린포스타제 활성도 및 만능줄기세포 마커 단백질들 (Nanog, Oct4 및 Sox2) 발현을 면역염색을 통해 확인하였다(도 3).The morphological characteristics of the pluripotent stem cells, alkaline phosphatase activity and the expression of the pluripotent stem cell marker proteins (Nanog, Oct4 and Sox2) in the reprogrammed cells were confirmed by immunostaining (Fig. 3).

리프로그램된 세포에서 만능줄기세포 마커 유전자들 (Nanog, Oct4 및 Sox2) 발현을 real-time PCR을 통해 확인하였다(도 4).The expression of pluripotent stem cell marker genes (Nanog, Oct4 and Sox2) in reprogrammed cells was confirmed by real-time PCR (Fig. 4).

결론적으로, 방사선 전조사는 (pre-irradiation) 유도만능줄기세포 리프로그래밍을 저해하지만, 방사선 조사 후 (post-irradiation)은 유도만능줄기세포 리프로그래밍 촉진을 확인할 수 있었다. 또한, 만능줄기세포 특성 분석을 통해 방사선 조사 후에 의해 고효율로 리프로그램된 세포들이 유도만능줄기세포임을 증명하였다. 따라서, 이러한 결과는 방사선 조사 후 활성화된 인자들이 유도만능줄기세포 리프로그래밍 증진에 관여함을 시사하고 있다.In conclusion, pre-irradiation inhibits inducible pluripotent stem cell reprogramming, but post-irradiation promotes inducible pluripotent stem cell reprogramming. In addition, by analyzing the characteristics of the pluripotent stem cells, it was proved that highly reprogrammed cells were induced pluripotent stem cells after irradiation. Thus, these results suggest that activated factors after irradiation may be involved in promoting induced pluripotent stem cell reprogramming.

상기와 같은 결과는 유도만능줄기세포 리프로그래밍 효율증진 인자 탐색 및 기전 연구에 활용 될수 있을 것으로 기대된다.These results are expected to be useful for the investigation of the inducible pluripotent stem cell reprogramming efficiency factor and its mechanism.

Claims (4)

(1) 섬유아세포에 방사선을 조사하는 단계;
(2) 상기 방사선이 조사된 섬유아세포를 10 내지 25일 배양하는 단계; 및
(3) 상기 배양된 섬유아세포를 유도만능줄기세포로 리프로그래밍시키는 단계를 포함하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법.
(1) irradiating fibroblasts with radiation;
(2) culturing the irradiated fibroblasts for 10 to 25 days; And
(3) Reprogramming the cultured fibroblasts to inducible pluripotent stem cells. The method of promoting induced pluripotent stem cell reprogramming by long-term cell culture after irradiation.
제1항에 있어서, 상기 방사선 조사는 1 내지 5Gy 단일 방사선을 조사하는 것을 특징으로 하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법.2. The method according to claim 1, wherein the radiation is irradiated with a single radiation of 1 to 5 Gy. 제1항에 있어서, 상기 (2) 단계의 배양은 37℃에서 14일 동안 배양하는 것을 특징으로 하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법.The method according to claim 1, wherein the culture in step (2) is cultured at 37 占 폚 for 14 days. 제1항에 있어서, 상기 (3) 단계 리프로그래밍은 섬유아세포에 리프로그래밍 인자인 Klf4, Oct4, Sox2 및 c-Myc를 도입하는 것을 특징으로 하는 방사선 조사 후 장기 세포배양에 의한 유도만능줄기세포 리프로그래밍 효율 증진 방법.2. The method according to claim 1, wherein the step (3) reprogramming comprises introducing fibroblast reprogramming factors Klf4, Oct4, Sox2 and c-Myc. How to improve programming efficiency.
KR1020160109308A 2016-08-26 2016-08-26 Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation KR101836860B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160109308A KR101836860B1 (en) 2016-08-26 2016-08-26 Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160109308A KR101836860B1 (en) 2016-08-26 2016-08-26 Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation

Publications (2)

Publication Number Publication Date
KR20180023641A true KR20180023641A (en) 2018-03-07
KR101836860B1 KR101836860B1 (en) 2018-03-09

Family

ID=61688810

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160109308A KR101836860B1 (en) 2016-08-26 2016-08-26 Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation

Country Status (1)

Country Link
KR (1) KR101836860B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113607626A (en) * 2021-07-12 2021-11-05 四川大学 Research method for cancer promotion and radiation resistance of oral cancer-related fibroblasts

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113607626A (en) * 2021-07-12 2021-11-05 四川大学 Research method for cancer promotion and radiation resistance of oral cancer-related fibroblasts
CN113607626B (en) * 2021-07-12 2022-06-14 四川大学 Research method for cancer promotion and radiation resistance of oral cancer-related fibroblasts

Also Published As

Publication number Publication date
KR101836860B1 (en) 2018-03-09

Similar Documents

Publication Publication Date Title
US20240158757A1 (en) Novel and efficient method for reprogramming immortalized lymphoblastoid cell lines to induced pluripotent stem cells
Lin et al. A chemical platform for improved induction of human iPSCs
Haase et al. Generation of non-transgenic iPS cells from human cord blood CD34+ cells under animal component-free conditions
US20200332316A1 (en) Generation of induced pluripotent stem cells from normal human mammary epithelial cells
Montserrat et al. Generation of pig iPS cells: a model for cell therapy
CA2732401C (en) Efficient method for establishing induced pluripotent stem cells
Wen et al. Enhanced generation of integration-free iPSCs from human adult peripheral blood mononuclear cells with an optimal combination of episomal vectors
Jiao et al. Promoting reprogramming by FGF2 reveals that the extracellular matrix is a barrier for reprogramming fibroblasts to pluripotency
Bhise et al. Evaluating the potential of poly (beta-amino ester) nanoparticles for reprogramming human fibroblasts to become induced pluripotent stem cells
CN105802917A (en) Pluripotent stem cells obtained by non-viral reprogramming
CN102144027B (en) Produce the method for multipotential stem cell
CN102844428A (en) Ets2 and mesp1 generate cardiac progenitors from fibroblasts
Mehta et al. A systemic evaluation of cardiac differentiation from mRNA reprogrammed human induced pluripotent stem cells
KR101836860B1 (en) Method for enhancing reprogramming efficiency of induced plutipotent stem cells from somatic cells by long term cell culture post-irradiation
Kamada et al. Reversible transformation and de-differentiation of human cells derived from induced pluripotent stem cell teratomas
CN101684455A (en) Application of vitamin C in preparation of induced multi-potent stem cells and culture of embryonic stem cells
WO2016204298A1 (en) METHOD FOR PRODUCING CANINE iPS CELLS
Koide et al. Establishment and optimal culture conditions of microrna-induced pluripotent stem cells generated from HEK293 cells via transfection of microrna-302s expression vector
Groβ et al. Improved generation of patient-specific induced pluripotent stem cells using a chemically-defined and matrigel-based approach
CN108265025A (en) A kind of reprogramming culture medium of mankind&#39;s induced multi-potent stem cell
EP3041928B1 (en) Compositions comprising a mitofusin inhibitor for promoting cell reprogramming and a use thereof
Pomeroy et al. Stem cell surface marker expression defines late stages of reprogramming to pluripotency in human fibroblasts
JP2014217344A (en) Composition for producing induced pluripotent stem cell, and method for producing induced pluripotent stem cell
KR101743284B1 (en) Method for enhancing direct reprogramming efficiency from somatic cells to hepatocyte-like cells using small molecules
US20230220352A1 (en) Method for direct transdifferentiation of somatic cell

Legal Events

Date Code Title Description
E701 Decision to grant or registration of patent right
GRNT Written decision to grant