KR20180021328A - Biomarkers for Predicting Breast cancer - Google Patents
Biomarkers for Predicting Breast cancer Download PDFInfo
- Publication number
- KR20180021328A KR20180021328A KR1020160105401A KR20160105401A KR20180021328A KR 20180021328 A KR20180021328 A KR 20180021328A KR 1020160105401 A KR1020160105401 A KR 1020160105401A KR 20160105401 A KR20160105401 A KR 20160105401A KR 20180021328 A KR20180021328 A KR 20180021328A
- Authority
- KR
- South Korea
- Prior art keywords
- breast cancer
- prognosis
- protein
- biomarker
- znf224
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
- G01N33/57415—Specifically defined cancers of breast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
Abstract
Description
본 발명은 유방암의 예후를 예측하기 위한 유전자 바이오마커, 상기 유전자 바이오마커의 mRNA 또는 단백질의 발현수준을 측정하는 제제를 포함하는 유방암 예후 예측용 조성물, 상기 조성물을 포함하는 유방암 예후 예측용 키트, 상기 키트를 이용하여 유방암의 예후를 예측하기 위한 정보제공방법, 상기 유전자 바이오마커를 이용하여 유방암의 예방 또는 치료용 물질을 스크리닝하는 시스템 및 상기 유전자 바이오마커를 타겟으로 하는 유방암의 예방 또는 치료용 약학적 조성물에 관한 것으로, 보다 상세하게는 유방암 환자에서 본 발명의 유전자 바이오마커의 mRNA 또는 단백질의 발현수준을 측정하여 유방암 환자의 예후를 예측할 수 있고, 예후 예측결과에 따라 유방암의 불량한 예후에 관여하는 해당 유전자 바이오마커의 발현을 억제할 수 있으므로, 유방암 환자를 보다 효과적으로 치료할 수 있다.The present invention relates to a composition for predicting breast cancer prognosis, which comprises a gene biomarker for predicting the prognosis of breast cancer, an agent for measuring the expression level of mRNA or protein of the gene biomarker, a kit for predicting breast cancer prognosis, A method for screening a substance for prevention or treatment of breast cancer using the gene biomarker, and a method for screening a substance for prevention or treatment of breast cancer targeting the gene biomarker More particularly, the present invention relates to a composition for measuring the expression level of mRNA or protein of a gene biomarker of the present invention in a breast cancer patient, and the prognosis of a breast cancer patient can be predicted. Because it can inhibit the expression of gene biomarkers It can more effectively treat patients with breast cancer.
전사인사(Transcription factor, TF)는 다양한 세포 공정 중에 그것의 DNA 결합 인자에 결합함으로써 표적 유전자의 전사를 억제 또는 활성화시킨다. KRAB-ZFPs(Kruppel-like associated box-zinc finger proteins)은 DNA 결합 패밀리 단백질(protein family)의 일원이다. KRAB-ZFPs는 N-말단 영역에 KRAB 도메인 및 C-말단 영역에 C2H2-타입 아연 집게 모티브를 보존하고 있다. KRAB-ZFPs는 하나 또는 이상의 KRAB A 박스, 및/또는 KRAB B 박스, 또는 SCAN-도메인, KRAB-ZFPs의 작은 부분집합(subset)에서 발견되는 루신-풍부영역(leucine-rich region)을 가지고 있다. 최근, ZNF의 KRAB 도메인은 표적 유전자의 전사 억제의 결과로, 단백질-단백질 상호작용을 통해 보조억제자 단백질 및/또는 TF에 결합하는 것으로 알려졌다. KRAB-ZFPs는 해당 DNA 공통서열에 결합하여 유전자 발현을 침묵시키는, 염색질(chromatin) 리모델링 복합체의 매개자뿐만 아니라 보조억제자 중 하나인, KRAB-관련 단백질 1(KAP1)과 복합체를 형성한다. Transcription factor (TF) inhibits or activates transcription of a target gene by binding to its DNA binding factor during various cellular processes. KRAB-ZFPs (Kruppel-like associated box-zinc finger proteins) are members of the DNA-binding family of proteins. KRAB-ZFPs preserve the KRAB domain at the N-terminal region and the C 2 H 2 -type zinc entanglement motif at the C-terminal region. KRAB-ZFPs have a leucine-rich region found in a small subset of one or more KRAB A box, and / or KRAB B box, or SCAN-domain, KRAB-ZFPs. Recently, the KRAB domain of ZNF is known to bind to the secondary inhibitor protein and / or TF through protein-protein interactions as a result of transcriptional repression of the target gene. KRAB-ZFPs complex with KRAB-related protein 1 (KAP1), which is one of the secondary inhibitors as well as a mediator of the chromatin remodeling complex that binds to the corresponding DNA common sequence and silences gene expression.
ZNF224는 N-말단 영역의 KARB A 도메인, KRAB B 도메인 및 19개의 종열적으로(tendemly) 반복된 C2H2-타입 아연집게 모티브로 구성된 전사인자이다. ZNF224의 대안적인 스플라이스(splice) 변이체인, ZNF225는 상기 KRAB 도메인이 결여되어 있으나, 19개의 아연집게 도메인을 포함하고 있다. 그것들은 배치(localization)에 다소 차이가 있다. ZNF225가 인(nucleoli)에 관련된 subnuclear 구조로 배치되어 있는 반면, ZNF224는 핵 안 및 또한 세포질 안에서 균일하게 분포되어 있다. ZNF224와 윌름 종양 억제 유전자(Wilms' tumor suppressor gene, WT1)의 상기 핵 상호작용은 WT1 표적 유전자의 발현을 증가시키는 반면, ZNF225는 WT1과 함께 RNA 성숙 및 가공에 주로 관여한다. ZNF224 is a transcription factor consisting of the KARB A domain of the N-terminal region, the KRAB B domain, and 19 longitudinally repeated C 2 H 2 -type zinc swarm motifs. ZNF225, an alternative splice variant of ZNF224, lacks the KRAB domain but contains 19 zinc titer domains. They are somewhat different in localization. ZNF225 is located in a subnuclear structure related to the nucleus, while ZNF224 is uniformly distributed in the nucleus and also in the cytoplasm. The nuclear interaction of ZNF224 and Wilms' tumor suppressor gene (WT1) increases expression of the WT1 target gene, while ZNF225 is primarily involved in RNA maturation and processing with WT1.
ZNF224는 Aldolase A 유전자의 전자 억제를 선도하면서, KAP1 및 타입 Ⅱ 단백질 아르기닌 메틸트렌스퍼레이즈(protein arginine methyltransferase, PRMT5)와 복합체를 형성함으로써, 전자 억제제로 기능한다. 뿐만 아니라, ZNF224는 미토콘드리아 시트르산 캐리어 유전자의 전사를 억제한다. 흥미롭게, ZNF224는 Bax, Bak, 비타민 D 수용체(Vitamin D receptor, VDR), bag3, 및 A1/Bfl1을 포함한 호세포사멸(proapoptotic) 및 항세포사멸(antiapoptotic) 유전자의 조절에 있어서 WT1의 보조 활성화제로서 역할을 한다. 더욱이, DEP 도메인 포함 1(DEP domain containing 1, DEPDC1)은 ZNF224에 의해 A20 전사를 억제한다. 그러나, ZNF224/DEPDC1 복합체의 중단 시, 상기 A20 mRNA 발현은 증가된다. 이러한 결과는 ZNF224가 단백질 의존적 또는 암 유형 의존적 상호작용에서 종양단백질(oncoprotein) 또는 종양 억제제로서 기능한다는 것을 암시한다.ZNF224 functions as an electronic inhibitor by forming a complex with KAP1 and type II protein arginine methyltransferase (PRMT5), leading to electronic inhibition of the Aldolase A gene. In addition, ZNF224 inhibits the transcription of the mitochondrial citrate carrier gene. Interestingly, ZNF224 is a co-activator of WT1 in the regulation of proapoptotic and antiapoptotic genes including Bax, Bak, Vitamin D receptor (VDR), bag3, and A1 / Bfl1 . Furthermore, the DEP domain containing 1 (DEPDC1) inhibits A20 transcription by ZNF224. However, upon termination of the ZNF224 / DEPDC1 complex, the A20 mRNA expression is increased. These results suggest that ZNF224 functions as a tumor protein (oncoprotein) or tumor suppressor in protein-dependent or cancer-type-dependent interactions.
본 발명자들은 ZNF224가 종양단백질(oncogenic protein)로써 기능할 수 있는지 여부를 첫번째로 결정했다. 뿐만 아니라, 본 발명자들은 표적 유전자 및 MCF-7 세포에서 ZNF224에 의해 인지되는 DNA 공통서열을 특정하기 위해 노력했다. 흥미롭게도, 본 발명자들은 ZNF224에 의해 인지되는 상기 공통서열이 miR-663a 프로모터의 -500bp 내에 존재한다는 것을 밝혀냈고 ZNF224가 miR-663a의 발현을 증가 또는 감소시키는지 여부를 조사했을 뿐만 아니라, 인간 유방암 세포를 이용하여 ZNF224 및 miR-663a의 발현을 평가함으로써 본 발명을 완성하였다.The inventors first determined whether ZNF224 could function as an oncogenic protein. In addition, the present inventors have sought to identify the target gene and the DNA common sequence recognized by ZNF224 in MCF-7 cells. Interestingly, we have found that the consensus sequence recognized by ZNF224 is within -500 bp of the miR-663a promoter and not only investigated whether ZNF224 increases or decreases the expression of miR-663a, Cells were used to evaluate the expression of ZNF224 and miR-663a, thereby completing the present invention.
이에 본 발명자들은 유방암 예후 예측을 위한 유전자를 밝혀내고자 노력하였다. 그 결과, ZNF224가 유방암 세포에서 특이적으로 발현이 증가하고, miR-663a의 발현을 증가시키며, 상기 miR-663a의 증가된 발현 수준은 불량한 예후와 관련이 있음을 규명하였다.Therefore, the present inventors have sought to identify a gene for prediction of breast cancer prognosis. As a result, it was found that ZNF224 specifically increases expression in breast cancer cells, increases miR-663a expression, and that the increased expression level of miR-663a is associated with a poor prognosis.
따라서, 본 발명의 목적은 상기와 같은 문제점을 해결하기 위해 안출된 것으로, ZNF224 유전자를 포함하는 유방암의 예후 예측용 바이오마커를 제공하는 것이다. Accordingly, it is an object of the present invention to provide a biomarker for prediction of prognosis of breast cancer including ZNF224 gene.
본 발명의 또 다른 목적은 본 발명의 바이오마커의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는 유방암 예후 예측용 조성물을 제공하는 것이다.It is still another object of the present invention to provide a composition for predicting breast cancer prognosis, which comprises an agent for measuring an expression level of mRNA or protein of a biomarker of the present invention.
본 발명의 또 다른 목적은 본 발명의 바이오마커의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는 유방암 예후 예측용 키트를 제공하는 것이다.It is still another object of the present invention to provide a kit for predicting breast cancer prognosis, which comprises an agent for measuring the expression level of mRNA or protein of the biomarker of the present invention.
본 발명의 또 다른 목적은 a) 유방암 환자에서 분리된 생물학적 시료로부터 제1항의 바이오마커의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴을 얻는 단계; 및 b) 상기 a) 단계에서 얻은 발현 수준 또는 발현 패턴을 예후가 알려진 유방암 환자의 해당 유전자의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴과 비교하는 단계를 포함하는 유방암 예후 예측을 위한 정보제공방법을 제공하는 것이다.Yet another object of the present invention is to provide a method for the diagnosis of breast cancer, comprising the steps of: a) obtaining a mRNA or protein expression level or an expression pattern of the biomarker of
본 발명의 또 다른 목적은 a) 유방암 환자에서 분리한 시료에 후보물질을 처리하는 단계; b) 후보물질이 처리된 유방암 환자의 시료에서 제1항에 따른 바이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 단계; 및 c) 상기 b) 단계의 mRNA 또는 단백질 발현 수준이 후보물질의 처리 전보다 낮은 경우, 후보물질을 유방암의 예방 또는 치료용 물질로 판단하는 단계; 를 포함하는 유방암 예방 또는 치료용 물질 스크리닝 시스템을 제공하는 것이다.Yet another object of the present invention is to provide a method for treating breast cancer, comprising the steps of: a) treating a candidate material from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of the step b) is lower than that of the candidate substance before treatment; And to provide a screening system for substances for preventing or treating breast cancer.
본 발명의 또 다른 목적은 a) 유방암 환자에서 분리한 시료에 후보물질을 처리하는 단계; 및 b) 후보물질이 처리된 유방암 환자의 시료에서 ZNF224와 CAGC를 포함하는 염기서열의 결합을 저해하는 것을 확인하는 단계;를 포함하는 항암제 스크리닝 방법을 제공하는 것이다. Yet another object of the present invention is to provide a method for treating breast cancer, comprising the steps of: a) treating a candidate material from a breast cancer patient; And b) confirming that the candidate substance inhibits the binding of the base sequence including ZNF224 and CAGC in the sample of the breast cancer patient treated.
본 발명의 또 다른 목적은 본 발명에 따른 바이오마커에 의해 코딩되는 단백질 발현 또는 활성을 억제하는 물질; 및 약학적으로 허용 가능한 담체를 포함하는 유방암 예방 또는 치료용 약학적 조성물을 제공하는 것이다.Yet another object of the present invention is to provide a biomarker comprising a substance which inhibits protein expression or activity which is encoded by the biomarker according to the present invention; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다. However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.
따라서, 본 발명은 ZNF224 유전자를 포함하는 유방암의 예후 예측용 바이오마커를 제공한다.Accordingly, the present invention provides a biomarker for predicting the prognosis of breast cancer comprising ZNF224 gene.
또한, 본 발명은 본 발명의 바이오마커의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는 것일 수 있다.In addition, the present invention may include an agent for measuring the expression level of the mRNA or protein of the biomarker of the present invention.
상기 본 발명의 바람직한 일실시예에 따르면, 상기 mRNA의 발현 수준을 측정하는 제제는 상기 바이오마커에 특이적으로 결합하는 프라이머 염기서열을 포함하는 것일 수 있다.According to a preferred embodiment of the present invention, the agent for measuring the expression level of the mRNA may include a primer sequence that specifically binds to the biomarker.
상기 본 발명이 바람직한 또 다른 일실시예에 따르면, 상기 바이오마커가 특이적으로 결합하는 결합자리(binding site)는 5'-CAGC-3'인 것일 수 있다.According to another embodiment of the present invention, the binding site specifically binding the biomarker may be 5'-CAGC-3 '.
또한, 본 발명은 본 발명의 바이오마커의 mRNA 또는 단백질의 발현 수준을 측정하는 제제를 포함하는 유방암 예후 예측용 키트를 제공한다.The present invention also provides a kit for predicting breast cancer prognosis, which comprises an agent for measuring the expression level of mRNA or protein of the biomarker of the present invention.
상기 본 발명의 바람직한 일실시예에 따르면, 상기 키트는 RT-PCR 키트, 경쟁적 RT-PCR 키트, 실시간 RT-PCR 키트, 정량적 RT-PCR 키트, DNA 칩 키트 또는 단백질 칩 키트인 것일 수 있다.According to a preferred embodiment of the present invention, the kit may be an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a quantitative RT-PCR kit, a DNA chip kit or a protein chip kit.
또한, 본 발명은 a) 유방암 환자에서 분리된 생물학적 시료로부터 제1항의 바이오마커의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴을 얻는 단계; 및 b) 상기 a) 단계에서 얻은 발현 수준 또는 발현 패턴을 예후가 알려진 유방암 환자의 해당 유전자의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴과 비교하는 단계를 포함하는 유방암 예후 예측을 위한 정보제공방법을 제공한다.Also, the present invention provides a method for producing a biomarker comprising the steps of: a) obtaining the mRNA or protein expression level or expression pattern of the biomarker of
상기 본 발명의 바람직한 일실시예에 따르면, 상기 mRNA 수준을 측정하는 방법은 역전사효소 중합반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 역전사 효소 중합효소반응(real time quantitative RT-PCR), 정량적 중합효소반응(quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Nothern blotting) 또는 DNA 칩 방법(DNA chip technology)인 것일 수 있다. According to a preferred embodiment of the present invention, the mRNA level is measured by RT-PCR, competitive RT-PCR, real-time RT-PCR time quantitative RT-PCR, quantitative RT-PCR, RNase protection method, northern blotting or DNA chip technology.
상기 본 발명의 바람직한 다른 일실시예에 따르면, 상기 단백질의 수준을 측정하는 방법은 웨스턴 블랏팅(Western blotting), ELISA(enzyme linked immunosorbent assay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radical immunodiffusion), 오우크테로니면역 확산법(Ouchterlony immunodiffusion), 로케트 면역전기영동(rocket immunoeletrophoresis), 면역조직화학염색법(immunohistochemical staining), 면역침전분석법(immunoprecipitation assay), 보체 고정 분석법(complenent Fixation Assay), 면역형광법(immunofluorescence), 면역크로마토그래피법(immunochromatography), FACS 분석법(fluorescenceactivated cell sorter analysis) 또는 단백질 칩 방법(protein chip technology)인 것일 수 있다.According to another preferred embodiment of the present invention, the method for measuring the level of the protein may be Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) immunohistochemical staining, immunoprecipitation assay, complenent fixation assay, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, Immunofluorescence, immunochromatography, FACS (fluorescence activated cell sorter analysis), or protein chip technology.
또한, 본 발명은 a) 유방암 환자에서 분리한 시료에 후보물질을 처리하는 단계; b) 후보물질이 처리된 유방암 환자의 시료에서 제1항에 따른 바이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 단계; 및 c) 상기 b) 단계의 mRNA 또는 단백질 발현 수준이 후보물질의 처리 전보다 낮은 경우, 후보물질을 유방암의 예방 또는 치료용 물질로 판단하는 단계; 를 포함하는 유방암 예방 또는 치료용 물질 스크리닝 시스템을 제공한다.The present invention also relates to a method for treating breast cancer, comprising the steps of: a) treating a candidate substance isolated from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of the step b) is lower than that of the candidate substance before treatment; A screening system for preventing or treating breast cancer.
또한, 본 발명은 a) 유방암 환자에서 분리한 시료에 후보물질을 처리하는 단계; 및 b) 후보물질이 처리된 유방암 환자의 시료에서 ZNF224와 CAGC를 포함하는 염기서열의 결합을 저해하는 것을 확인하는 단계; 를 포함하는 항암제 스크리닝 방법을 제공한다. The present invention also relates to a method for treating breast cancer, comprising the steps of: a) treating a candidate substance isolated from a breast cancer patient; And b) confirming that the candidate substance inhibits binding of a base sequence comprising ZNF224 and CAGC in a sample of a breast cancer patient treated; An anticancer agent screening method.
상기 본 발명의 바람직한 일실시예에 따르면, 상기 항암제 스크리닝 방법은 c) 대조군 시료와 비교하여 miR-663a 발현량이 감소한 후보약물을 선별하는 단계를 더 포함하는 것일 수 있다. 또한, 본 발명은 상기 바이오마커에 의해 코딩되는 단백질 발현 또는 활성을 억제하는 물질; 및 약학적으로 허용 가능한 담체를 포함하는 유방암 예방 또는 치료용 약학적 조성물을 제공한다.According to a preferred embodiment of the present invention, the anticancer drug screening method may further comprise: c) selecting a candidate drug having a reduced amount of miR-663a expression compared to a control sample. The present invention also relates to a substance that inhibits the expression or activity of a protein encoded by the biomarker; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.
상기 본 발명의 바람직한 일실시예에 따르면, 상기 물질은 바이오마커에 대한 안티센스 올리고 뉴클레오티드, 앱타머(aptamer), siRNA 또는 shRNA인 것일 수 있다.According to a preferred embodiment of the present invention, the material may be an antisense oligonucleotide, an aptamer, siRNA or shRNA for a biomarker.
상기 본 발명의 바람직한 다른 일실시예에 따르면, 상기 바이오마커의 단백질 활성을 억제하는 항체 또는 그의 항원 결합 단편인 것일 수 있다.According to another preferred embodiment of the present invention, the antibody may be an antibody or an antigen-binding fragment thereof that inhibits the protein activity of the biomarker.
본 발명은 상기와 같은 문제점을 해결하기 위해 안출된 것으로, 본 발명의 ZNF224는 전사 활성화제로서 miR-663a를 통해 p53 및 p21의 발현을 감소시킴으로써 세포 생존 및 세포사멸 저항성을 유도한다는 점을 이용하여 ZNF224 유전자를 포함하는 유방암의 예후 예측용 바이오마커를 제공하고자 한다.Disclosure of the Invention The present invention has been conceived to solve the above-mentioned problems. The present invention utilizes that ZNF224 induces cell survival and apoptosis resistance by decreasing p53 and p21 expression through miR-663a as a transcription activator And to provide a biomarker for predicting the prognosis of breast cancer including ZNF224 gene.
따라서, 예측된 예후에 따라 적절한 치료방향을 결정할 수 있어 환자 맞춤별 치료방법의 제공이 가능하고, 불량한 예후의 유방암 환자의 유방암 재발 및 사망률을 감소시켜 유방암 환자를 더욱 효과적으로 치료할 수 있다. Therefore, appropriate treatment directions can be determined according to the predicted prognosis, and it is possible to provide customized treatment methods, and it is possible to treat breast cancer patients more effectively by reducing breast cancer recurrence and mortality in patients with poor prognosis.
도 1은 ZNF224의 MCF-7 세포에서의 콜로니 형성 능력 나타내는 그래프 및 RT-PCR, 웨스턴 블랏팅 결과를 나타내는 것이다.
도 2는 ZNF224 과발현 세포주 및 ZNF224 넉다운 세포주의 세포 생장 및 세포사멸 저항성을 나타내는 것이다.
도 3은 ZNF224 DNA가 결합하는 모티브 특성 및 ZNF224 농도에 따른 루시퍼라아제 활성 여부를 나타낸 결과이다.
도 4는 ZNF224와 결합하는 miR-663a 프로모터 영역의 염기서열 및 ZNF224 농도에 따른 miR-663a 전사 수준을 나타내는 그래프이다.
도 5는 ZNF224가 miR-663a를 통해 p21 및 p53의 프로모터 활성을 조절하는 것에 대한 결과를 나타낸 것이다.
도 6은 ZNF224가 miR-663a를 통해 p21 및 p53의 발현을 조절함으로써 세포 생장을 조절하는 것에 대한 결과는 나타낸 것이다.
도 7은 유방암 환자의 조직의 암 영역과 비-암영역을 항-ZNF224 항체를 사용하여 면역조직화학 및 H&E 염색한 결과 및 암 영역과 비-암영역으로부터 분리된 ZNF224 mRNA 발현, miR-663a 발현, p53 mRNA 발현량을 비교한 그래프이다.
도 8은 Chip-seq library에서 ZNF224 enriched region의 분포에 관한 결과를 나타낸 것이다.
도 9 내지 도 17은 Znf224 풍부 영역 근처(1<kb)를 포함하는 유전자 정보를 나타낸 것이다. Figure 1 shows a graph showing the ability of ZNF224 to form colonies in MCF-7 cells, and RT-PCR and Western blotting results.
2 shows cell growth and cell death resistance of ZNF224 over-expressing cell line and ZNF224 knockdown cell line.
FIG. 3 is a graph showing the motif binding characteristic of ZNF224 DNA and the activity of luciferase according to ZNF224 concentration.
4 is a graph showing the nucleotide sequence of the miR-663a promoter region binding to ZNF224 and miR-663a transcription level according to ZNF224 concentration.
Figure 5 shows the results of ZNF224 modulating the promoter activity of p21 and p53 via miR-663a.
Figure 6 shows the results of ZNF224 modulating cell growth by regulating p21 and p53 expression via miR-663a.
FIG. 7 shows immunohistochemical and H & E staining of cancerous and non-cancerous regions of breast cancer tissue and anti-ZNF224 antibody, and expression of ZNF224 mRNA and miR-663a expressed from cancerous and non-cancerous regions , and p53 mRNA expression levels.
Figure 8 shows the distribution of the ZNF224 enriched region in the chip-seq library.
Figs. 9 to 17 show gene information including near the Znf224 rich region (1 < kb).
이하, 본 발명을 보다 상세하게 설명한다.Hereinafter, the present invention will be described in more detail.
상술한 바와 같이, p53 및 p21은 세포 주기와 세포사멸을 조절하는 단백질로 암 발생과 깊은 관련이 있으며 유방암 세포에서 상기 p53과 p21의 발현을 조절하는 새로운 전사인자 ZNF224를 분자적 수준에서 분석함으로써 유방암 예후 예측 및 적절한 치료 방법에 대한 방향성을 제시하는 효과가 있다.As described above, p53 and p21 are proteins that regulate cell cycle and apoptosis and are closely related to cancer development. By analyzing molecular level of a novel transcription factor ZNF224 that regulates p53 and p21 expression in breast cancer cells, Prognosis, and direction of appropriate treatment.
본 발명은 ZNF224 유전자를 포함하는 유방암의 예후 예측용 바이오마커를 제공함으로써 상술한 문제의 해결방안을 모색하였다. 이를 이용해 유방암 환자의 예후를 예측하고, 예측된 예후에 따라 적절한 치료방향을 결정할 수 있어 환자 맞춤별 치료방법의 제공이 가능하고, 불량한 예후의 유방암 환자의 유방암 재발 및 사망률을 감소시켜 유방암 환자를 더욱 효과적으로 치료할 수 있다.The present invention solves the above-mentioned problem by providing a biomarker for prediction of prognosis of breast cancer including ZNF224 gene. In this study, we aimed to evaluate the prognosis of patients with breast cancer and determine the proper treatment direction according to the predicted prognosis. Therefore, it is possible to provide individualized treatment methods for patients and to decrease the recurrence and mortality of breast cancer in patients with poor prognosis. Can be effectively treated.
본 발명에서 유방암의 불량한 예후에 관여하는 유전자 ZNF224가 온코진(oncogene)으로서 기능하는지 여부를 결정하기 위해, ZNF224 유전자를 유방암 세포 주인 MCF-7 세포로 형질주입(transfection)시키고 콜로니 형성 분석을 실시하였다. 도 1A는 대조군과 ZNF224가 형질주입된 MCF-7의 콜로니 수를 비교한 그래프이고 도 1B는 RT-PCR 및 웨스턴 블랏팅을 통해 MCF-7에서의 ZNF224 단백질 발현 수준을 비교한 결과이다. 도 1A 및 도 1B를 통해 과발현되는 세포에서 세포 생장을 증가시키는 것을 확인하였다. In order to determine whether the gene ZNF224 involved in the poor prognosis of breast cancer functions as an oncogene in the present invention, the ZNF224 gene was transfected with MCF-7 cells, which is a breast cancer cell host, and colony formation analysis was performed . FIG. 1A is a graph comparing the number of colonies of MCF-7 transfected with control and ZNF224, and FIG. 1B is a comparison of ZNF224 protein expression levels in MCF-7 through RT-PCR and Western blotting. 1A and 1B to increase cell growth in the cells overexpressed.
또한, oncogene의 과발현이 세포사멸에 대한 저항성을 유도하기 때문에, 본 발명자들은 ZNF224가 과발현 세포주와 ZNF224 녹다운(knock-down) 세포주에 CPT처리를 하여 CPT에 대항한 세포 생존 및 세포 사멸 여부를 시험하였다. 그 결과, ZNF224 과발현된 세포주는 대조군에 비해 CPT에 대항하여 세포 생존력이 뛰어남을 확인 할 수 있었다(도 2A). In addition, since oncogene overexpression induces resistance to apoptosis, the present inventors tested whether ZNF224 overexpressed cell line and ZNF224 knock-down cell line were treated with CPT to observe cell survival and cell apoptosis against CPT . As a result, it was confirmed that the cell line overexpressing ZNF224 had better cell viability against CPT than the control group (Fig. 2A).
본 발명의 용어 "바이오마커"는 생물학적 현상의 존재와 정량적 또는 정성적으로 연관된 분자를 의미하여, 본 발명의 마커는 유방암 발명 이후 예후가 양호하거나 불량한 환자를 예측해내는 기준이 되는 유전자를 지칭한다. 마커는 게놈 뉴클레오티드 서열로부터 또는 발현된 뉴클레오티드 서열로부터(예를 들어, RNA, nRNA, mRNA, cDNA 등으로부터), 또는 코딩된 폴리펩티드로부터 유래될 수 있다. 이 용어는 마커 서열에 상보적이거나 이에 플랭킹된 핵산 서열, 예컨대 마커 서열을 증폭시킬 수 있는 프로브 또는 프라이머 쌍으로 사용된 핵산을 포함한다.The term "biomarker" of the present invention refers to a molecule quantitatively or qualitatively associated with the presence of a biological phenomenon, and the marker of the present invention refers to a gene which is a standard for predicting patients with good or poor prognosis after the invention of breast cancer. The marker may be derived from a genomic nucleotide sequence or from a nucleotide sequence expressed (e.g., from RNA, nRNA, mRNA, cDNA, etc.), or from a coded polypeptide. The term includes nucleic acid sequences that are complementary to or flanked in the marker sequence, such as a probe or a pair of primers that can amplify the marker sequence.
본 발명에 있어서, 용어 "예후"는 의학적 귀추(예컨대, 장기 생존 가능성, 무병생존율 등)에 대한 예상을 의미하여, 양성적 예후(긍정적 예후) 또는 음성적 예후(부정적 예후)를 포함하며, 상기 음성적 예후는 재발, 종양 성장, 전이, 약물 저항성 등의 병의 진행 또는 치명성(mortality)을 포함하고, 양성적 예후는 질병이 없는 상태 등의 질병의 차도, 종양 퇴행 등의 질병의 개선 또는 안정화(stabilization)를 포함한다. In the present invention, the term "prognosis" refers to a prediction of a medical cause (e.g., long-term viability, disease-free survival rate, etc.) and includes a positive prognosis (positive prognosis) or a negative prognosis Prognosis includes the progression or mortality of recurrence, tumor growth, metastasis, drug resistance, etc., and the positive prognosis may include disease progression such as a disease-free condition, improvement or stabilization of diseases such as tumor regression stabilization.
본 발명에 있어서, 용어 "예측"은 의학적 귀추에 대하여 미리 헤아려 짐작하는 것을 의미하며, 본 발명의 목적상 유방암으로 진단받은 환자의 병의 경과(병의 진행, 개선, 유방암의 재발, 종양 성장, 약물 저항성)를 미리 짐작하는 것을 의미한다.For purposes of the present invention, the term "prediction" in the present invention refers to predicting a medical condition, and for the purpose of the present invention, Drug resistance) in advance.
본 발명은 또한, 본 발명의 마이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 제제를 포함하는 유방암 예후 예측용 조성물을 제공한다. The present invention also provides a composition for predicting breast cancer prognosis, which comprises an agent for measuring mRNA or protein expression level of a myoma marker of the present invention.
본 발명에서 용어 "바이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 제제"란 본 발명의 바이오마커 유전자 또는 이들 유전자에 의해 코딩된 단백질의 발현 수준을 확인하기 위하여 사용될 수 있는 분자를 의미하며, 바람직하게는 상기 바이오마커에 특이적으로 결합하는 프라이머쌍, 프로브 또는 안티센스 뉴클레오티드이거나, 또는 상기 바이오마커 유전자에 의해 코딩되는 단백질에 특이적인 항체일 수 있다.The term "agent for measuring mRNA or protein expression level of biomarker" in the present invention means a molecule that can be used for confirming the expression level of a biomarker gene of the present invention or a protein encoded by these genes, May be a primer pair, a probe, or an antisense nucleotide that specifically binds to the biomarker, or may be an antibody specific to a protein encoded by the biomarker gene.
본 발명에서 용어, "항체"란 당해 분야에서 공지된 용어로서 항원성 부위에 대하여 지시되는 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 본 발명의 마커에 특이적인 단백질 분자를 의미한다. 본 발명의 목적상, 항체는 본 발명의 마커에 대해 특이적으로 결합하는 항체를 의미하며, 이러한 항체는 각 유전자를 통상적인 방법에 따라 발현벡터에 클로닝하여 상기 마커 유전자에 의해 코딩되는 단백질을 얻고, 얻어진 단백질로부터 통상적인 방법에 의해 제조될 수 있다. 본 발명의 항체의 형태는 특별히 제한되지 않으며 폴리클로날 항체, 모노클로날 항체 또는 항원 결합성을 갖는 것이면 그의 일부도 본 발명의 항체에 포함되고 모든 면역 글로불린 항체가 포함된다. 나아가, 본 발명의 항체에는 인간화 항체 등의 특수 항체도 포함된다. 이러한 본 발명의 바이오마커 유전자에 의해 코딩되는 단백질에 대한 항체는 당업계의 공지된 방법으로 제조될 수 있는 모든 항체가 될 수 있다. 예를 들어, 본 발명의 암 진단 마커의 검출에 사용되는 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 완전한 형태뿐만 아니라 항체 분자의 기능적인 단편을 포함할 수 있다. 상기 항체 분자의 기능적인 단편이란 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2, Fv 등이 될 수 있으나, 특별히 이에 제한되지는 않는다.As used herein, the term "antibody" refers to a specific protein molecule that is directed against an antigenic site as known in the art. For purposes of the present invention, an antibody refers to a protein molecule specific to the marker of the present invention. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker of the present invention, which clones each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene , And can be prepared from the obtained protein by a conventional method. The form of the antibody of the present invention is not particularly limited and any part thereof having a polyclonal antibody, a monoclonal antibody or an antigen-binding property is included in the antibody of the present invention and includes all the immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies. The antibody against the protein encoded by the biomarker gene of the present invention may be any antibody that can be produced by a method known in the art. For example, an antibody used in the detection of a cancer diagnostic marker of the invention may comprise a complete form having two full-length light chains and two full-length heavy chains as well as a functional fragment of an antibody molecule. The functional fragment of the antibody molecule refers to a fragment having at least an antigen binding function and may be Fab, F (ab ') 2, F (ab') 2, Fv or the like, but is not particularly limited thereto.
본 발명에서 용어, "프라이머"는 짧은 자유 3 말단 수산화기(free 3` hydroxyl group)을 가지는 핵산 서열로 상보적인 주형(template)과 염기쌍(base pair)을 형성할 수 있고 주형의 복사를 위한 시작지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 본 발명에서는 본 발명 마커 폴리뉴클레오티드의 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 원하는 생성물의 생성 여부를 통해 유방암의 예후를 예측할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.The term "primer" in the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template, and a starting point for copying the template ≪ / RTI > In the present invention, PCR amplification using the sense and antisense primers of the marker polynucleotide of the present invention can predict the prognosis of breast cancer through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.
본 발명의 일실시예에서, ZNF224가 miR-663a의 프로모터에 결합하는 염기서열을 밝히기 위해서 ChIp-시퀀싱을 실시하였다. 도 3에서 나타난 바와 같이, 5'-CAGC-3' 염기서열을 포함하는 헤어핀 루프(hair-pin loop) 구조를 확인하였고(도 3B), 상기 서열은 miR-663a의 -500bp 내 두 영역에 존재함을 확인하였다(도 4A). 따라서, 상기 서열에 ZNF224가 결합함으로써 농도 의존적으로 miR-663a의 전사물 수준(transcript level)이 증가함을 확인할 수 있었다(도 4D).In one embodiment of the invention, ChIp-sequencing was performed to reveal the base sequence in which ZNF224 binds to the promoter of miR-663a. As shown in FIG. 3, a hair-pin loop structure including a 5'-CAGC-3 'nucleotide sequence was confirmed (FIG. 3B), and the sequence was present in two regions within -500 bp of miR-663a (Fig. 4A). Therefore, it was confirmed that the transcript level of miR-663a was increased in a concentration-dependent manner by binding ZNF224 to the above sequence (FIG. 4D).
본 발명에서 용어, "프로브(probe)" 란 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며, 표지(labeling)되어 있어서 특정 mRNA의 존재 유무를 확인할 수 있다. 프로브는 올리고 뉴클레오티드 프로브, 단일 사슬 DNA(single stranded DNA) 프로브, 이중 사슬 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 본 발명에서는 본 발명의 마커 폴리뉴클레오티드와 상보적인 프로브를 이용하여 혼성화를 실시하여, 혼성화 여부를 통해 유방암의 예후를 예측할 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다. The term "probe" in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a few bases or hundreds of bases that can specifically bind to mRNA and is labeled The presence or absence of a specific mRNA can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, the hybridization using the probe complementary to the marker polynucleotide of the present invention can predict the prognosis of breast cancer through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.
본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환, 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
본 발명은 또한, 전술한 유방암 예후 예측용 조성물을 포함하는 유방암 예후 예측용 키트를 제공한다.The present invention also provides a kit for predicting breast cancer prognosis, which comprises the composition for predicting the prognosis of breast cancer.
본 발명의 키트는 상기 유방암 예후 예측용 바이오마커 유전자의 mRNA 발현 수준 또는 이들 유전자에 의해 코딩되는 단백질의 발현수준을 확인함으로써 유방암의 예후를 예측하는데 사용할 수 있다.The kit of the present invention can be used to predict the prognosis of breast cancer by confirming the mRNA expression level of the biomarker gene for prediction of breast cancer prognosis or the expression level of the protein encoded by these genes.
본 발명의 일 구현예에 따르면, 상기 바이오마커 유전자들의 mRNA 발현수준을 측정하기 위한 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-중합효소 및 역전사효소, DNase, RNase 억제제, DEPC-물(DEPC-water), 멸균수 등을 포함할 수 있다.According to an embodiment of the present invention, the kit for measuring the mRNA expression level of the biomarker genes may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits can be used to detect and isolate specific primer pairs specific to the marker gene, including test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- DEPC-water, sterile water, and the like.
본 발명의 다른 구현예에 따르면, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 유방암의 예후 예측용 바이오마커를 검출하기 위한 키트일 수 있다. DNA 칩 키트는 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판을 포함하고 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다.According to another embodiment of the present invention, the kit of the present invention may be a kit for detecting a biomarker for predicting the prognosis of breast cancer, which includes essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof.
본 발명의 또 다른 구현예에 따르면, 본 발명에서 상기 바이오마커 유전자들에 의해 코딩된 단백질의 발현수준을 측정하기 위한 키트는 항체의 면역학적 검출을 위하여 기질, 적당한 완충용액, 발색 효소 또는 형광물질로 표지된 2차 항체 및 발색 기질 등을 포함할 수 있다. 상기에서 기질은 니트로셀룰로오스 막, 폴리비닐 수지로 합성된 96 웰 플레이트, 폴리스틸렌 수지로 합성된 96 웰 플레이트 및 유리로 된 슬라이드 글라스 등이 이용될 수 있고, 발색효소는 퍼옥시다아제(peroxidase), 알칼라인 포스파타아제(alkaline phosphatase)가 사용될 수 있고, 형광물질은 FITC, RITC 등이 사용될 수 있으며, 발색기질액은 ABTS(2,2'-아지노-비스-(3-에틸벤조티아졸린-6-설폰산)) 또는 OPD(o-페닐렌디아민), TMB(테트라메틸 벤지딘) 등이 사용될 수 있다.According to another embodiment of the present invention, a kit for measuring the expression level of a protein encoded by the biomarker genes according to the present invention comprises a substrate, a suitable buffer solution, a chromogenic enzyme or a fluorescent substance And secondary antibody and chromogenic substrate. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a slide glass made of glass, etc. The chromogenic enzyme may be peroxidase, Alkaline phosphatase can be used, and fluorescent materials such as FITC, RITC and the like can be used. The coloring substrate liquid is ABTS (2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid ) Or OPD (o-phenylenediamine), TMB (tetramethylbenzidine) and the like can be used.
본 발명은 또한, a) 유방암 환자에서 분리된 생물학적 시료로부터 상기 바이오마커의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴을 얻는 단계; 및 b) 상기 a) 단계에서 얻은 발현 수준 또는 발현 패턴을 예후가 알려진 유방암 환자의 해당 유전자의 mRNA 또는 이의 단백질 발현 수준, 또는 발현 패턴과 비교하는 단계를 포함하는 유방암의 예후 예측을 위한 정보제공방법을 제공한다.The present invention also relates to a method for the treatment of breast cancer, comprising the steps of: a) obtaining the mRNA or protein expression level, or expression pattern, of said biomarker from a biological sample isolated from a breast cancer patient; And b) comparing the expression level or expression pattern obtained in step a) with the expression level or expression pattern of mRNA or a protein of the gene of interest in a breast cancer patient whose prognosis is known, to provide information for prediction of prognosis of breast cancer .
본 발명에 있어서, 용어, "mRNA 발현수준 측정"이란 유방암의 예후를 예측하기 위하여 생물학적 시료에서 바이오마커 유전자의 mRNA 존재 여부와 발현 정도를 확인하는 과정으로 mRNA의 양을 측정함으로써 알 수 있다. 이를 위한 분석 방법으로는 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), 정량적 RT-PCR(quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(northern blotting) 또는 DNA 칩(DNA chip technology) 등이 있으나, 이에 제한되는 것은 아니다.In the present invention, the term "measurement of mRNA expression level" can be determined by measuring the amount of mRNA in the biological sample by confirming the presence or absence of the mRNA and the expression level of the biomarker gene in the biological sample to predict the prognosis of breast cancer. RT-PCR, competitive RT-PCR, real-time RT-PCR, quantitative RT-PCR, RNase protection assay protection method, northern blotting or DNA chip technology, but the present invention is not limited thereto.
본 발명에 있어서, 용어, "단백질 발현수준 측정"이란 유방암의 예후를 예측하기 위하여 생물학적 시료에서의 마커 유전자에서 발현된 단백질의 존재 여부와 발현 정도를 확인하는 과정으로, 상기 유전자에서 발현된 단백질에 대하여 특이적으로 결합하는 항체를 이용하여 단백질의 양을 확인할 수 있다. 이를 위한 분석 방법으로는 웨스턴 블랏(western blotting), ELISA(enzyme linked immunosorbentassay), 방사선면역분석(RIA: radioimmunoassay), 방사 면역 확산법(radial immunodiffusion), 오우크테로니면역 확산법(Ouchterlony immunodiffusion), 로케트 면역전기영동(rocket immunoelectrophoresis), 면역조직 화학염색법(immunohistochemical staining), 면역침전분석법(immunoprecipitation assay), 보체 고정 분석법(complement Fixation Assay), 면역형광법(immunofluorescence), 면역크로마토그래피법(immunochromatography), FACS 분석법(fluorescenceactivated cell sorter analysis) 또는 단백질 칩 방법(protein chip technology) 등이 있으나, 이에 제한되는 것은 아니다.In the present invention, the term "measurement of protein expression level" refers to a process of confirming the presence and expression level of a protein expressed in a marker gene in a biological sample to predict the prognosis of breast cancer, The amount of the protein can be confirmed by using an antibody specifically binding to the protein. Analysis methods include western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radial immunodiffusion, Ouchterlony immunodiffusion, rocket immunization Immunohistochemical staining, immunoprecipitation assays, complement fixation assays, immunofluorescence, immunochromatography, FACS (Immunohistochemical staining), immunofluorescence (immunohistochemical staining), immunoprecipitation assays fluorescence activated cell sorter analysis, or protein chip technology, but the present invention is not limited thereto.
본 발명에서 용어, "유방암 환자에서 분리된 생물학적 시료"란 이에 제한되는 것은 아니나, 유방암 환자의 유방 유래의 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨일 수 있으며, 바람직하게는 유방 종양 조직일 수 있다.The term "biological sample isolated from a breast cancer patient" in the present invention includes, but is not limited to, breast-derived tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine of a breast cancer patient, It may be a breast tumor tissue.
본 발명에서 용어, "예후가 알려진 유방암 환자"는 유방암으로 진단받은 환자 중에서 병의 진행 경과가 밝혀진 환자를 의미하며, 예컨대 유방암으로 인한 외과 수술을 받은 후 36개월 안에 재발하여 불량한 예후를 가진 것으로 확정된 환자 또는 유방암으로 인한 외과 수술을 받은 후 36개월 이후 재발하지 않고 생존하거나 완치되어 양호한 예후를 가진 것으로 확정된 환자 등이며, 이들 환자로부터 채취한 시료와 예후를 알고자 하는 환자로부터 채취한 시료에서 유전자 발현 수준 또는 발현 패턴을 수득하고, 비교함으로써 예후를 알고자 하는 환자의 예후를 정확하게 예측할 수 있다.In the present invention, the term "breast cancer patient whose prognosis is known" refers to a patient who has been diagnosed with breast cancer and has been diagnosed to have a poor prognosis by recurrence within 36 months after surgery, for example, Or patients who were confirmed to have a good prognosis after survival or cure without recurrence after 36 months of surgical operation due to breast cancer. Samples collected from these patients and those obtained from patients who want to know the prognosis By obtaining and comparing gene expression levels or expression patterns, it is possible to accurately predict the prognosis of a patient to know the prognosis.
본 발명의 일 구현예에 따르면, 다수의 유방암 환자로부터 마커 유전자의 발현 수준 또는 발현 패턴을 측정하고, 측정된 값을 이들 환자의 예후와 함께 데이터베이스화한 후, 예후를 알고자 하는 환자의 발현 수준 또는 발현 패턴을 상기 데이터베이스에 입력하여 예후를 예측할 수 있다. 이 경우, 발현 수준 또는 발현 패턴을 비교하기 위한 공지의 알고리즘, 통계분석 프로그램 등을 사용할 수 있다. 또한, 상기 데이터베이스는 위암 환자를 병리학적 병기, 치료받은 치료법 등으로 더욱 세분화될 수 있다.According to one embodiment of the present invention, the expression level or expression pattern of a marker gene is measured from a plurality of breast cancer patients, the measured value is databaseed with the prognosis of these patients, and the expression level Or an expression pattern may be input to the database to predict a prognosis. In this case, known algorithms and statistical analysis programs for comparing the expression levels or expression patterns can be used. Further, the database may be further subdivided into pathologic stage, treated therapy, and the like.
본 발명의 유방암의 예후 예측을 위한 정보제공방법에 있어서, 상기 바이오마커 유전자의 발현 수준을 mRNA 수준 또는 단백질 수준에서 측정할 수 있고, 생물학적 시료에서 mRNA 또는 단백질의 분리는 공지의 공정을 이용하여 수행할 수 있다. mRNA 수준을 측정하기 위한 분석 방법 및 단백질 수준을 측정하기 위한 분석 방법은 상기에서 설명한 바와 같다.In the method for predicting the prognosis of breast cancer according to the present invention, the expression level of the biomarker gene may be measured at an mRNA level or a protein level, and the mRNA or protein may be separated from the biological sample using a known process can do. The analysis method for measuring the mRNA level and the assay method for measuring the protein level are as described above.
상기 분석방법들을 통하여, 예후가 알려진 유방암 환자의 시료로부터 측정한 유방암 바이오마커 유전자의 발현량과 예후를 알고자 하는 환자의 시료로부터 측정한 유방암 바이오마커 유전자의 발현량을 비교할 수 있고, 발현량의 증감 여부를 판단하여 유방암의 예후를 예측할 수 있다. 즉, 발현량을 비교한 결과, 예후를 알고자 하는 환자의 샘플이 예후가 알려진 환자의 샘플과 비슷한 발현량 또는 발현 패턴을 나타내었다면, 이는 양호한 예후를 가질 것이라고 판단할 수 있고, 반대로 불량한 예후로 알려진 환자의 샘플과 비슷한 발현량 또는 발현 패턴을 나타내었다면, 이는 불량한 예후를 가질 것이라고 판단할 수 있다.Through the above-described analysis methods, it is possible to compare the expression amount of breast cancer biomarker gene measured from a sample of a breast cancer patient whose prognosis is known, and the expression amount of a breast cancer biomarker gene measured from a sample of a patient to know the prognosis, And the prognosis of breast cancer can be predicted. That is, as a result of comparing the expression levels, it can be judged that a sample of a patient to know a prognosis shows a similar prognosis or a pattern of expression similar to that of a sample of a patient whose prognosis is known. On the contrary, It may be judged that it will have a poor prognosis if it exhibits a similar expression level or expression pattern as a sample of a known patient.
따라서, 본 발명에 의하면 유방암의 예후를 정확하게 예측할 수 있고, 예측된 예후에 따라 적절한 치료계획을 세울 수 있는 이점을 얻을 수 있다. 예컨대, 양호한 예후를 가질 것이라고 판단된 환자에 대해서는 표준 치료 또는 덜 침범적인 치료(invasive treatment) 옵션을 추구하도록 결정할 수 있고, 불량한 예후를 가질 것이라고 판단된 환자에 대해서는 상위 단계의 병기 위암 환자에게 사용하는 치료방법 또는 매우 공격적이거나 실험적인 치료를 추구하도록 결정할 수 있다.Therefore, according to the present invention, the prognosis of breast cancer can be accurately predicted, and an appropriate treatment plan can be established according to the predicted prognosis. For example, patients who are determined to have a good prognosis can be determined to seek standard therapy or less invasive treatment options, and patients who are deemed to have a poor prognosis are eligible for upper stage staging for gastric cancer patients You can decide to pursue a treatment method or very aggressive or experimental treatment.
본 발명은 또한, a) 유방암 환자에서 분리된 생물학적 시료에 후보물질을 처리하는 단계; b) 후보물질이 처리된 유방암 환자의 시료에서 제1항에 따른 바이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 단계; 및 c) 상기 b) 단계의 mRNA 또는 이의 단백질 발현 수준이 후보물질의 처리 전보다 낮은 경우, 후보물질을 유방암의 예방 또는 치료용 물질로 판단하는 단계; 를 포함하는 유방암 예방 또는 치료용 물질 스크리닝 시스템을 제공한다.The present invention also relates to a method of treating cancer, comprising the steps of: a) treating a candidate substance in a biological sample separated from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to
본 발명은 또한, 본 발명의 바이오마커에 의해 코딩되는 단백질의 발현 또는 활성을 억제하는 물질; 및 약학적으로 허용 가능한 담체를 포함하는 유방암 예방 또는 치료용 약학적 조성물을 제공한다.The present invention also relates to a substance which inhibits the expression or activity of a protein encoded by the biomarker of the present invention; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.
본 발명의 일실시예에서는, 본 발명에서 선별된 바이오마커 유전자의 siRNA를 이용하여 유방암 환자의 치료가능성을 확인하기 위해 ZNF224로 형질 주입된 MCF-7 세포주에 siRNA를 처리하였으며, 사용된 예들은 다음과 같다; 5'-CUC AAG ACU UGG UGA UAA ATT-3', 5'-CGA UGU GAU ACG UGU GAU ATT-3', 5'-GGA AAG GGC UAC AAU AGU ATT-3′'(Santa Cruz Biotechnology). In one embodiment of the present invention, siRNAs were treated with ZNF224-transfected MCF-7 cell lines in order to confirm the therapeutic potential of breast cancer patients using siRNA of the biomarker gene selected in the present invention. Is the same as; 5'-CUC AAG ACU UGG UGA UAA ATT-3 ', 5'-CGA UGU GAU ACG UGU GAU ATT-3', 5'-GGA AAG GGC UAC AAU AGU ATT-3 '(Santa Cruz Biotechnology).
상기 siRNA를 이용하여 ZNF224 유전자를 넉 다운(knock-down)시킨 후, 세포 생존율을 측정하였다. 그 결과, 대조군에 비해 ZNF224로 형질주입된 세포주에서 ZNF224 유전자의 siRNA에 의한 우수한 세포사멸 효과가 관찰되었다(도 1C). 이를 통해, 본 발명에서 선별된 바이오마커 유전자를 타겟으로 한 치료가 실제로 유방암 환자에서 효과를 나타낸다는 것을 확인할 수 있으며, 본 발명의 ZNF224 바이오마커 유전자가 유방암 환자를 치료하는데 유용하다는 것을 확인할 수 있다. The siRNA was used to knock-down the ZNF224 gene, and cell viability was measured. As a result, an excellent cell killing effect of siRNA of ZNF224 gene was observed in the cell line transfected with ZNF224 as compared to the control group (Fig. 1C). Thus, it can be confirmed that the treatment targeted to the selected biomarker gene of the present invention is actually effective in patients with breast cancer, and it can be confirmed that the ZNF224 biomarker gene of the present invention is useful for treating breast cancer patients.
상기 바이오마커에 의해 코딩되는 단백질의 발현을 억제하는 물질은 특별히 이에 제한되지 않으나, 바람직하게는 바이오마커 유전자에 대한 안티센스 올리고 뉴클레오티드(antisense oligonucleotide), 앱타머(aptamer), siRNA 또는 shRNA 등이 될 수 있다.The substance that inhibits the expression of the protein encoded by the biomarker is not particularly limited, but may be an antisense oligonucleotide, an aptamer, an siRNA, or a shRNA for the biomarker gene. have.
본 발명은 또한 a) 유방암 환자에서 분리한 시료에 후보물질을 처리하는 단계; 및 b) 후보물질이 처리된 유방암 환자의 시료에서 ZNF224와 CAGC를 포함하는 염기서열의 결합을 저해하는 것을 확인하는 단계;를 포함하는 항암제 스크리닝 방법을 제공한다. The present invention also provides a method of treating cancer, comprising the steps of: a) treating a candidate sample from a breast cancer patient; And b) confirming that the candidate substance inhibits the binding of the base sequence including ZNF224 and CAGC in the sample of the breast cancer patient treated with the cancer substance.
본 발명의 일실시예에서, 상기 ZNF224가 miR-663a의 프로모터에 결합함으로써 농도 의존적으로 miR-663a의 전사물 수준(transcription level)을 증가시키는 것을 확인할 수 있었으며, miR-663a의 프로모터에 특이적으로 결합하는 결합자리(binding site)는 5'-CAGC-3'인 것을 miR-663a의 증가된 전사물 수준(transcription level)을 통해 확인할 수 있다. 본 발명의 일실시예에서, ChIp-시퀀싱을 통하여 상기 ZNF224가 miR-663a의 프로모터에 특이적으로 결합하는 결합자리를 밝혀냈고, 대조군 또는 mutant oligo DNAs와 비교하였을 때 상기 서열을 포함하는 프로모터에 ZNF224가 더 높은 결합친화성(binding affinity)를 가지는 것을 확인할 수 있었다.In one embodiment of the present invention, it was confirmed that the ZNF224 binds to the promoter of miR-663a to increase the transcription level of miR-663a in a concentration-dependent manner, and specifically to the promoter of miR-663a The binding site that binds is 5'-CAGC-3 ', which can be confirmed by the increased transcription level of miR-663a. In one embodiment of the invention, ZNF224 was identified through ChIp-sequencing to bind specifically to the promoter of miR-663a, and ZNF224 was introduced into the promoter containing the sequence when compared to the control or mutant oligo DNAs Was found to have a higher binding affinity.
항암제 스크리닝 방법은 c) 대조군 시료와 비교하여 miR-663a 발현량이 감소한 후보약물을 선별하는 단계를 더 포함하는 것일 수 있다. The anticancer drug screening method may further comprise the step of c) selecting a candidate drug having decreased miR-663a expression level as compared with the control sample.
상기 c) 단계는 대조군 시료와 비교하여 상기 ZNF 및 miR-663a 결합 정도는 발현되는 miR-663a의 전사물 수준(transcription level)을 측정함으로써 확인할 수 있으며, 상기 전사물 수준(transcription level)의 측정은 RT-PCR, 경쟁적 RT-PCR(competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), 정량적 RT-PCR(quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(northern blotting) 또는 DNA 칩(DNA chip technology) 등이 있으나, 이에 제한되는 것은 아니다.The above step c) can be confirmed by measuring the transcription level of miR-663a expressing the degree of binding of ZNF and miR-663a in comparison with the control sample, and the measurement of the transcription level (RT-PCR), competitive RT-PCR, real-time RT-PCR, quantitative RT-PCR, RNase protection method, Northern blotting, or DNA chip technology, but are not limited thereto.
본 발명의 용어 "siRNA(small interfering RNA)"란, RNA 간섭 또는 유전자 사일런싱(silencing)을 매개할 수 있는 약 20 뉴클레오티드 크기의 작은 핵산 분자를 의미하며, siRNA가 세포 내에 도입되면, 다이서(dicer) 단백질에 의해 인지되어 상기 바이오마커 유전자를 분해하여, 결국 유전자의 발현을 저해하게 된다. 이러한 siRNA는 공지된 siRNA를 직접 화학적으로 합성하는 방법(Sui G 등, (2002) Proc Natl Acad Sci USA 99:5515-5520), 실험실적 환경에서 전사를 이용한 siRNA의 합성법(Brummelkamp TR 등, (2002) Science 296:550-553) 등에 의해 제조될 수 있으나, 특별히 이에 제한되지는 않는다.The term "siRNA (small interfering RNA) " of the present invention means a small nucleic acid molecule of about 20 nucleotides in size that can mediate RNA interference or gene silencing. When siRNA is introduced into a cell, dicer protein and degrades the biomarker gene, thereby inhibiting gene expression. Such siRNA may be prepared by a direct chemical synthesis of known siRNAs (Sui G et al., (2002) Proc Natl Acad Sci USA 99: 5515-5520), a synthetic method of siRNA using transcription in laboratory conditions (Brummelkamp TR et al., 2002 ) Science 296: 550-553), but the present invention is not particularly limited thereto.
본 발명의 용어 "shRNA(short hairpin RNA)"란, siRNA 타겟 서열의 센스 및 안티센스 서열이 5-9개의 염기로 구성된 루프(loop)를 사이에 두고 위치한 짧은 헤어핀 RNA(short hairpin RNA)를 의미한다. 상기 shRNA는 siRNA의 고가의 생합성 비용, 낮은 세포 형질감염 효율로 인한 RNA 간섭 효과의 단시간 유지 등의 단점을 극복하기 위한 것으로 RNA 중합효소 Ⅲ의 프로모터로부터 아데노 바이러스, 렌티 바이러스 및 플라스미드 발현 벡터 시스템을 이용하여 이를 세포 내로 도입하여 발현시킬 수 있으며, 이러한 shRNA는 세포 내에 존재하는 siRNA 프로세싱 효소(Dicer or Rnase Ⅲ)에 의해 정확한 구조를 갖는 siRNA로 전환되어 목적 유전자의 사일런싱을 유도 하는데 사용될 수 있다.The term "shRNA (short hairpin RNA)" of the present invention means a short hairpin RNA having a sense and antisense sequence of siRNA target sequence located between loops composed of 5-9 bases . The shRNA is used to overcome the disadvantages of high cost biosynthesis cost of siRNA, short time maintenance of RNA interference effect due to low cell transfection efficiency, and use of adenovirus, lentivirus and plasmid expression vector system from RNA polymerase III promoter The shRNA can be used to induce silencing of the target gene by converting it into an siRNA having the correct structure by the siRNA processing enzyme (Dicer or Rnase III) present in the cell.
본 발명의 용어 "앱타머(aptamer)"란, 작은 RNA 조각을 의미하며, 20 내지 60 nt 정도의 크기를 가지는 올리고머 분자를 의미하는데, 서열에 따라 다양한 3차원 구조를 가질 수 있으며, 특정 물질과 높은 친화력을 가질 수 있어 목적하는 타겟 서열과 반응하여 효과적으로 억제가 가능하다.The term "aptamer " of the present invention refers to a small RNA fragment, which means an oligomer molecule having a size of about 20 to 60 nt. Depending on the sequence, it may have various three- It can have a high affinity and can be effectively inhibited by reacting with a target sequence of interest.
본 발명의 용어 "안티센스"란, 안티센스 올리고머라고도 하고, 왓슨-크릭 염기쌍 형성에 의해 RNA 내의 표적 서열과 혼성화되어 표적 서열 내에서 mRNA와 RNA:올리고머 헤테로이중체를 형성할 수 있는 뉴클레오티드 염기의 서열 및 서브유닛간 백본을 갖는 올리고머를 의미한다. 상기 안티센스는 표적 서열에 대한 정확한 서열 상보성 또는 근사 상보성을 가질 수 있고, mRNA의 번역을 차단 또는 저해하며, mRNA의 스플라이스 변이체를 생산하는 mRNA의 프로세싱 과정을 변화시킬 수 있다. 따라서, 본 발명의 안티센스는 바람직하게는 본 발명의 바이오마커 유전자의 폴리뉴클레오티드에 상보적인 안티센스 올리고머가 될 수 있다. 상기 안티센스는 통상적인 방법으로 개체에 투여함으로써 발암 유전자의 발현을 예방 또는 억제시키는 방식으로 사용될 수 있다. 예를 들면, 안티센스 올리고디옥시뉴클레오티드를 폴리-L-라이신 유도체와 정전기적 인력에 의해 혼합시키고, 상기 혼합체를 개체의 정맥에 투여하는 방법(J.S. kim et al., J controlled Release 53, 175-182, 1998)이 사용될 수 있으나, 특별히 이에 제한되지는 않는다. The term "antisense" of the present invention is also referred to as an antisense oligomer, and includes a sequence of a nucleotide base capable of hybridizing with a target sequence in RNA by Watson-Crick base pair formation to form mRNA and RNA: oligomer heterodimers in the target sequence, Means an oligomer having a backbone between subunits. The antisense can have an exact sequence complement or approximate complement to the target sequence, block or inhibit the translation of the mRNA, and alter the processing of the mRNA producing splice variants of the mRNA. Thus, the antisense of the present invention may preferably be an antisense oligomer complementary to the polynucleotide of the biomarker gene of the present invention. The antisense can be used in a manner that prevents or suppresses the expression of a carcinogen gene by administration to a subject in a conventional manner. For example, a method of mixing an antisense oligodeoxynucleotide with a poly-L-lysine derivative by electrostatic attraction and administering the mixture to a vein of a subject (JS Kim et al., J controlled Release 53, 175-182 , 1998) may be used but are not particularly limited thereto.
아울러, 상기 바이오마커에 의해 코딩되는 단백질의 발현을 억제하는 물질로는 단백질의 활성을 억제하는 항체 또는 그의 항원 결합 단편 등이 될 수 있다. 이때, 상기 항체는 특별히 이에 제한되지 않으나, 본 발명의 바이오마커에 의해 코딩되는 단백질에 특이적으로 결합할 수 있는 모든 항체가 될 수 있고, 바람직하게는 단일클론항체, 카이메릭 항체(chimeric antibody), 인간화 항체(humanized antibody), 인간 항체(human antibody) 등이 될 수 있을 뿐만 아니라, 상기 항체의 기능적인 단편이 될 수도 있다 모두 포함한다. 또한 상기 항체는 본 발명의 바이오마커에 의해 코딩되는 단백질을 특이적으로 인식하는 결합의 특성을 갖는 한, 2개의 중쇄(heavy chain)와 2개의 경쇄(light chain)의 전체 길이를 가지는 완전한 형태뿐만 아니라, 항체 분자의 기능적인 단편을 포함한다. 항체의 분자의 기능적인 단편이란, 적어도 항원 결합 기능을 보유하고 있는 단편을 뜻하며, Fab, F(ab'), F(ab')2 및 Fv 등이 있다.In addition, the substance that inhibits the expression of the protein encoded by the biomarker may be an antibody that inhibits the activity of the protein, an antigen-binding fragment thereof, or the like. The antibody may be any antibody capable of specifically binding to a protein encoded by the biomarker of the present invention, preferably a monoclonal antibody, a chimeric antibody, A humanized antibody, a human antibody, and the like, as well as functional fragments of the antibody. In addition, the antibody may be a complete form having the full length of two heavy chains and two light chains, as long as it has the property of binding specifically recognizing the protein encoded by the biomarker of the present invention But includes functional fragments of the antibody molecule. The functional fragment of the molecule of the antibody refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.
본 발명에서 제공하는 약학적 조성물은 유효성분으로 사용되는 상기 바이오마커에 의해 코딩되는 단백질 발현 또는 활성을 억제하는 올리고 뉴클레오티드 또는 항체 이외에, 암치료 활성을 나타내는 치료제를 추가로 포함할 수 있다. 이 때, 상기 공지의 치료제는 특별히 이에 제한되지 않으나, 바람직하게는 방사성 핵종, 약제, 림포카인, 독서, 이중특이적 항체 등이 될 수 있다.The pharmaceutical composition provided in the present invention may further comprise a therapeutic agent exhibiting cancer therapeutic activity, in addition to an oligonucleotide or an antibody that inhibits protein expression or activity that is encoded by the biomarker used as an active ingredient. At this time, the known therapeutic agent is not particularly limited, but may preferably be a radionuclide, a drug, a lymphocaine, a reading, a bispecific antibody, or the like.
한편, 본 발명의 조성물은 투여 방식에 따라 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 추가로 포함할 수 있다. 구체적으로, 식염수, 멸균수, 링거액, 완충 식염수, 덱스트로즈 용액, 말토덱스트린 용액, 글리세롤, 에탄올, 리포좀 및 상기 성분들 중 어느 하나의 이상의 성분을 혼합하여 사용할 수 있으며, 필요에 따라 항산화제, 완충액 등 통상적으로 사용되는 다른 첨가제를 추가적으로 포함할 수 있다. 또한 투여 목적에 따라 희석제, 분산제, 계면활성제, 결합제 및 윤활제를 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제로 제제화할 수 있고, 표적 기관에 특이적으로 작용할 수 있도록 표적 기관 또는 조직 특이적 항체 또는 기타 리간드를 상기 담체와 결합시켜 사용할 수 있다. 상기와 같은 담체, 부형제 또는 첨가제의 종류는 당업계의 통상적인 제제를 모두 포함하며, 상기 예에 의해 사용가능한 담체, 부형제 또는 첨가제의 종류가 제한되는 것은 아니다.Meanwhile, the composition of the present invention may further comprise a pharmaceutically acceptable carrier, excipient or diluent depending on the administration mode. Specifically, it is possible to use a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and any of the above components, And other additives conventionally used, such as buffers. In addition, depending on the purpose of administration, diluents, dispersants, surfactants, binders, and lubricants can be added to formulate into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets, A target organ or tissue specific antibody or other ligand can be used in combination with the carrier. The carrier, excipient, or additive may be any conventional formulation, and the carrier, excipient, or additive is not limited by the above examples.
상기와 같은 조성물 또는 혼합물은 목적 또는 필요에 따라 당업계에서 사용되는 통상적인 방법, 투여 경로, 투여량에 따라 적절하게 개체에 투여될 수 있다. 투여 경로의 예로는 경구, 비 경구, 피하, 복강 내, 폐 내, 및 비강 내로 투여될 수 있고, 국부적 면역억제 치료를 위해, 필요하다면 병변 내 투여를 포함하는 적합한 방법에 의해 투여된다. 비 경구 주입에는 근육 내, 정맥 내, 동맥 내, 복강 내 또는 피하투여가 포함된다. 또한 당업계에 공지된 방법에 따라 적절한 투여량 및 투여 횟수가 선택될 수 있으며, 실제로 투여되는 본 발명의 안티센스 올리고뉴클레오티드, siRNA 또는 shRNA를 포함하는 조성물의 양 및 투여 횟수는 예방 또는 치료하고자 하는 증상의 종류, 투여 경로, 성별, 건강 상태, 식이, 개체의 연령 및 체중, 및 질환의 중증도와 같은 다양한 인자에 의해 적절하게 결정될 수 있다.Such a composition or mixture may be appropriately administered to a subject according to the purpose or necessity, depending on the conventional methods used in the art, the route of administration, and the dosage. Examples of routes of administration may be oral, non-oral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal, and for localized immunosuppressive treatment, by a suitable method including, if necessary, intralesional administration. Non-oral injections include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Appropriate dosages and times of administration may be selected according to methods known in the art, and the amount and the number of administrations of the composition comprising the antisense oligonucleotide, siRNA or shRNA of the present invention to be actually administered will depend on the symptom The route of administration, sex, state of health, diet, age and weight of the individual, and severity of the disease.
이하, 본 발명을 실시예에 의해 상세히 설명하기로 한다. 그러나 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.
실시예Example
실시예Example 1. 세포배양 1. Cell culture
37℃ humidified 5% CO2 incubator 에서 HEK293 (Human embryonic kidney cell line) 및 MCF-7 (Human adenoma breast cancer cell line) cells을 10% fetal bovine serum (FBS, Hyclone), 1% penicillin/streptomycin (Hyclone, Utah, USA)이 보충된 Dulbecco's modified Eagle's medium (DMEM, Hyclone, Utah, USA)에서 배양하였다. Transfection을 위해, 제조사의 프로토콜에 따라 plasmid DNA constructs가 polyethylenimine (PEI, Polysciences, Inc., PA, USA)에 의해 cell로 transfection되었다. 과발현된 ZNF224 안정한 클론을 얻기 위해, 본 발명자들은 MCF-7 cells을 Dr. Paola 10 Costanzo (University of Naples Federico II, Italy) 에 의해 제공된 CMV 3XFlag-ZNF224 G418-selectable plasmid로 transfection하였다. Transfected cells은 G418 (Duchefa, Haarlem, Netherlands) 80 μg/ml으로 보충된 배지에서 자라고 선택되었다. 안정하게 CMV 3xFLAG-ZNF224을 과발현하는 MCF-7 cell은 anti-FLAG M2 antibody (Sigma Aldrich, MO, USA)을 이용하여 Western blot에 의해 측정되었다. ZNF224 knock-down stable cell line을 생성하기 위해, 본 발명자들은 MCF-7 cells을 ZNF224 shRNA plasmid(Santa Cruz Biotechnology, CA, USA)로 transfection 하였다. 상기 transfected Cells은 10 μg/ml puromycin (Sigma Aldrich, MO, USA)을 포함하는 배지에서 자라고 선택되었다. 상기 ZNF224의 stable knock-down을 Western blot 및 quantitative RT-PCR로 확인하였다. 도 1에 나타난 바와 같이, E.V로 형질 주입된 MCF-7세포에 비해 ZNF224로 형질 주입된 MCF-7세포의 콜로니 수가 2배 이상 많이 존재함을 확인할 수 있었고(도 1C), ZNF224 넉다운(knock-down)의 경우 대조군에 비해 콜로니가 약 1/3배 적게 존재함을 확인할 수 있었다(도 1C).Human embryonic kidney cell line (HEK293) and human adenoma breast cancer cell line (MCF-7) cells were cultured in a humidified 5% CO 2 incubator at 37 ° C in a 10% fetal bovine serum (FBS, Hyclone), 1% penicillin / streptomycin (Hyclone, Utah, USA) supplemented with Dulbecco's modified Eagle's medium (DMEM, Hyclone, Utah, USA). For transfection, plasmid DNA constructs were transfected into cells by polyethylenimine (PEI, Polysciences, Inc., PA, USA) according to the manufacturer's protocol. To obtain an overexpressed ZNF224 stable clone, the present inventors used MCF-7 cells as a < RTI ID = 0.0 > Were transfected with the CMV 3XFlag-ZNF224 G418-selectable plasmid provided by
실시예Example 2. 2. RNAiRNAi studystudy
MCF-7 cells을 20 nM ZNF224 si-RNA mixture (#1 5'-CUC AAG ACU UGG UGA UAA ATT-3', #2 5′'-CGA UGU GAU ACG UGU GAU ATT-3', #3 5′'-GGA AAG GGC UAC AAU AGU ATT-3′', Santa Cruz Biotechnology)로 48시간 또는 72시간 동안 transfection하였고, 제조사의 프로토콜에 따라 Lipofectamine 2000 (Invitrogen, Paisley, UK)을 이용하여 47시간 또는 72시간 동안, 50 nM miR-663a antagonist (Bioneer, Korea)로 transfection하였다.MCF-7 cells were cultured in 20 nM ZNF224 siRNA mixture (# 1 5'-CUC AAG ACU UGG UGA UAA ATT-3 ', # 2 5' '- CGA UGU GAU ACG UGU GAU ATT- (Invitrogen, Paisley, UK) in accordance with the manufacturer's protocol for 47 hours or 72 hours, respectively, according to the protocol of the manufacturer. , And transfected with 50 nM miR-663a antagonist (Bioneer, Korea).
실시예Example 3. 3. 웨스턴Western 블랏Blat (( WesternWestern blotblot ))
Immunoblot을 위해, 세포를 lysis buffer(50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3)로 용해하였다. 전체 cell lysates (30 μg)는 SDS-PAGE로 실시하였고 polyvinyldene fluoride membrane (PVDF, Millipore, MA, USA)으로 transfer하였다. 상기 membrane은 ZNF224 specific antibody (1:1000, Abcam, Cambridge, UK), M2 anti-FLAG (1:3,000, Sigma Aldrich, MO, USA), anti-p21 (1:1,000, Santa Cruz Biotechnology, CA, USA), anti-p53 (1:1,000, Santa Cruz Biotechnology, CA, USA), anti-PARP1 (1:1,000, Santa Cruz Biotechnology, CA, USA) 및 anti-alpha-tubulin antibody (1:20,000)로 incubation한 것에 이어, 5% skim milk 및 0.2% Tween-20을 포함하는 TBS (20 mM Tris-HCl, pH 7.4, 150 mM NaCl)로 1시간 동안 block되었다. 두번째 항체들은 antimouse IgG HRP (1:25,000, Thermo Scientific, MA, USA) 또는 anti-rabbit IgG HRP (1:30,000, Thermo Scientific, MA, USA)이었다. 상기 membrane은 enhanced chmiluminescence (ECL) solution (Abclon, Korea)을 이용하여 전개시켰다. For immunoblot, cells were lysed with lysis buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3) Lt; / RTI > All cell lysates (30 μg) were performed by SDS-PAGE and transferred to a polyvinyldene fluoride membrane (PVDF, Millipore, MA, USA). The membrane was incubated with anti-p21 (1: 1,000, Santa Cruz Biotechnology, CA, USA), ZNF224 specific antibody (1: 1000, Abcam, Cambridge, UK), M2 anti-FLAG (1: 3,000, Sigma Aldrich, ), anti-p53 (1: 1,000, Santa Cruz Biotechnology, CA, USA), anti-PARP1 (1: 1,000, Santa Cruz Biotechnology, CA) and anti-alpha-tubulin antibody Followed by blocking with TBS (20 mM Tris-HCl, pH 7.4, 150 mM NaCl) containing 5% skim milk and 0.2% Tween-20 for 1 hour. The second antibodies were anti-mouse IgG HRP (1: 25,000, Thermo Scientific, MA, USA) or anti-rabbit IgG HRP (1: 30,000, Thermo Scientific, MA, USA). The membranes were developed using an enhanced chlmiluminescence (ECL) solution (Abclon, Korea).
실시예Example 4. 세포 성장 및 약물 저항성 분석 4. Cell growth and drug resistance analysis
Cell growth 및 drug resistance을 분석하기 위해, 안정적인 클론 (5×104 cells) 의 각각에 8-E plate(ACEA, CA, USA)을 접종하고 humidified 5% CO2 incubator에서 배양하였다. 10시간 후, 세포들은 DMSO 또는 0.1μM CPT로 처리하였고 24시간 동안 더 배양하였다. Cell culture하는 동안, cell growth는 iCelligence system(ACEA, CA, USA)을 이용하여 실시간으로 관찰하였다. 그 결과, 도 2A에 나타난 바와 같이, ZNF224 과발현 세포주는 대조군(E.V)에 비해 CPT 에 대한 세포 생존 저항성에서 유의적 차이를 보임을 확인할 수 있었다.To analyze cell growth and drug resistance, 8-E plates (ACEA, CA, USA) were inoculated into each of the stable clones (5 × 104 cells) and cultured in a humidified 5% CO 2 incubator. After 10 hours, the cells were treated with DMSO or 0.1 [mu] M CPT and further cultured for 24 hours. During cell culture, cell growth was monitored in real time using an iCelligence system (ACEA, CA, USA). As a result, as shown in FIG. 2A, it was confirmed that the ZNF224 overexpressing cell line showed a significant difference in cell survival resistance to CPT as compared with the control (EV).
실시예Example 5. 5. 유세포Flow cell 분석( analysis( FlowFlow cytometrycytometry ))
CPT에 의한 세포사멸은 flow cytometry에 의해 측정되었다. Cells (2.5×106)을 100 mm dish에 접종하고 24시간 동안 배양하였다. 그 다음, DMSO 또는 CPT (0.1 μM)를 세포의 각 그룹에 첨가하였다. 24시간 후, cell을 수확하고 cold 70% ethanol로 16시간 동안 고정하였다. 1x cold PBS로 rehydration한 후, cell을 RNaseA (50μg/ml, Roche, Mannheim, Germany) 및 propidium iodide (100 μg/ml, Sigma Aldrich, MO, USA)로 처리하였다. 상기 DNA contents는 flow cytometry (CUBE6, PARTEC, Germany)에 의해 측정되었다.Cell death by CPT was measured by flow cytometry. Cells (2.5 x 10 6) were inoculated into 100 mm dish and cultured for 24 hours. DMSO or CPT (0.1 [mu] M) was then added to each group of cells. After 24 hours, the cells were harvested and fixed with cold 70% ethanol for 16 hours. After rehydration with 1 × cold PBS, cells were treated with RNaseA (50 μg / ml, Roche, Mannheim, Germany) and propidium iodide (100 μg / ml, Sigma Aldrich, MO, USA). The DNA contents were measured by flow cytometry (CUBE6, PARTEC, Germany).
실시예Example 6. 6. 크로마틴면역침강반응Chromatin immune response 분석 및 시퀀싱( Analysis and sequencing ( ChromatinChromatin immunoprecipitationimmunoprecipitation assay assay andand sequencingsequencing ))
HEK293 cell을 CMV 3xFLAG-ZNF224 plasmid (6 μg)로 transfection 하였다. 이전에 기술된 바와 같이 Chromatin immunoprecipitation을 수행하였다. 간략하게, cell은 실온에서 10분 동안 1% formaldehyde로 crosslink되도록 하였다. 상기 cell 플레이트는 sonication buffer (50 mM HEPES, pH 7.9, 140 mM NaCl, 1 mM EDTA, 0.1% Na-deoxycholate, 0.1% SDS, 1% Triton X-100 and PIC) 200ul에서 incubation하였다. 상기 cell lysate는 70초 (10 초 정지 및 60 초 휴식)동안 sonication되었고 DNA 길이는 200 내지 1,000bp로 공유되었다. Protein A and G agarose bead mixture (Invitrogen, Paisley, UK)를 이용하여 immunoprecipitation한 것에 이어, 상기 핵산 및 단백질 혼합물을 M2 anti-FLAG antibody (Sigma Aldrich, MO, USA) 또는 normal mouse IgG antibody (Santa Cruz Biotechnology, CA, USA)로 incubation 하였다. 상기 단백질-DNA complex는 elution buffer (50 mM Tris- HCl, pH 8.0, 1 mM EDTA, 1% SDS, 50 mM NaHCO3)에 의해 상기 beads로부터 분리되었고, 상기 formaldehyde crosslink에 전환하기 위해 65℃ 에서 5시간 동안 protease K로 가열하였다. 최종적으로, 상기 DNA는 PCR Clean-up Kit (Promega, WI, USA)로 정제하였다. ChIPed DNA는 또한 일부 modifications과 sequencing library를 준비하기 위해 처리되었다. DNA fragment는 end-repaired, dA-tailed이었고 Illumina사에서 제공하는 Genomic DNA Adapters 와 ligation하였다. Adapter-ligated DNA fragments는 정제되었고 PCR 20 사이클로 증폭시켰다. PCR 산물의 200-400bp를 isolation 하기 위해 Gel extraction이 수행되었다. Illumina Genome Analyzer IIx에 의해 Libraries가 시퀀싱되었다. Illumina's CASAVA pipeline (v1.8.2)을 사용하여 sequences reads의 Alignment를 수행하였다. 추가적인 분석을 위해 2 mismatches를 허용하는 고유 정렬 태그를 사용하였다. Raw sequencing reads는 FASTQC tool을 사용하여 품질 조사를 하였다. 상기 reads는 기본매개변수 CASAVA v1.6.0을 사용하여 인간 genome build hg18에 정렬되었다. ZNF224 총 매핑 태그 수는 4,090,000이었다. 상기 시퀀싱 데이터는 National Center for Biotechnical Information(NCBI)의 Gene Expression Omnibus (GEO)에 기탁되었다(GSE73947). FLAG-ZNF224가 풍부한 피크를 확인하기 위하여, MACS(Model-based Analysis for ChIP-Seq) ver. 1.4.0 은 하기와 같은 옵션이 사용되었다; tsize=36 --pvalue=1e-4--mfold=30 --bw=100. 또한, HOMER(Hypergeometric Optimization of Motif EnRichment) ver. 4.1은 하기와 같은 옵션이 사용되었다; -frag Length 200 -gsize 2700000000 -center. Genome의 annotating peaks는 HOMER로 수행되었다. 히스토그램은 각각 50bps의 개별 transcription start site (TSS)주위의 read densities 계산에 의해 만들었다. DAVID는 그것의 TSSs에서 1kb 내의 모든 피크를 포함하여 gene이 풍부한 Gene Ontology terms을 조사하기 위해서 사용되었다. HOMER로 피크의 모티브 발견을 수행하였다. HOMER을 이용하여, HEK293에서 ZNF224의 10,185개의 피크를 확인했고, 주위 클러스터에 transcriptional start site (TSS)의 5' 유전자 경계의 1kb 이내인 ZNF224 풍부한 영역에 대한 경향이 있었다 (도 8A). HEK293 cells were transfected with the CMV 3xFLAG-ZNF224 plasmid (6 μg). Chromatin immunoprecipitation was performed as previously described. Briefly, the cells were crosslinked with 1% formaldehyde for 10 min at room temperature. The cell plate was incubated with 200 ul of sonication buffer (50 mM HEPES, pH 7.9, 140 mM NaCl, 1 mM EDTA, 0.1% Na-deoxycholate, 0.1% SDS, 1% Triton X-100 and PIC). The cell lysate was sonicated for 70 sec (10 sec stop and 60 sec rest) and the DNA length was shared between 200 and 1,000 bp. FLAG antibody (Sigma Aldrich, MO, USA) or normal mouse IgG antibody (Santa Cruz Biotechnology, USA) following immunoprecipitation using Protein A and G agarose bead mixture (Invitrogen, Paisley, UK) , CA, USA). The protein-DNA complex was separated from the beads by elution buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% SDS, 50 mM NaHCO 3) Gt; protease < / RTI > K. Finally, the DNA was purified with PCR Clean-up Kit (Promega, Wis., USA). ChIPed DNA was also processed to prepare some modifications and sequencing libraries. DNA fragments were end-repaired, dA-tailed and ligation with Genomic DNA Adapters from Illumina. Adapter-ligated DNA fragments were purified and amplified with 20 cycles of PCR. Gel extraction was performed to isolate 200-400 bp of the PCR product. Libraries were sequenced by the Illumina Genome Analyzer IIx. Alignment of sequences reads was performed using Illumina's CASAVA pipeline (v1.8.2). For further analysis, we used a unique alignment tag that allows for 2 mismatches. Raw sequencing reads were performed using the FASTQC tool. The reads were sorted into the human genome build hg18 using the default parameter CASAVA v1.6.0. The total number of ZNF224 mapping tags was 4,090,000. The sequencing data was deposited with the Gene Expression Omnibus (GEO) of the National Center for Biotechnical Information (NCBI) (GSE73947). In order to confirm the rich peak of FLAG-ZNF224, MACS (Model-based Analysis for ChIP-Seq) ver. 1.4.0 the following options were used; tsize = 36 --pvalue = 1e-4 - mfold = 30 --bw = 100. Also, HOMER (Hypergeometric Optimization of Motif Enrichment) ver. 4.1 The following options were used; -frag Length 200 -gsize 2700000000 -center. Annotating peaks of the genome were performed with HOMER. Histograms were generated by calculating read densities around individual transcription start sites (TSS) of 50 bps each. DAVID was used to investigate gene-rich Gene Ontology terms, including all peaks within 1 kb in its TSSs. HOMER performed the peak motif discovery. Using HOMER, we identified 10,185 peaks of ZNF224 in HEK293 and there was a tendency for ZNF224 rich regions within the surrounding cluster to be within 1 kb of the 5 'gene boundary of the transcriptional start site (TSS) (Fig. 8A).
Znf224 풍부 영역 근처(1<kb)를 포함하는 유전자 정보는 도 9 내지 도 17에 나타냈다. 또한, 도 8B에서와 같이, 상기 ZNF224 signal는 상기 TSS의 1kb upstream 및 downstream을 포함하는 프로모터에서 HEK293 총 피크의 약 12%를 차지한다. ZNF224에 의해 인지되는 상기 DNA consensus sequence를 결정하기 위해, MACS 프로그램에 의해 확인된 13,561개의 피크를 HOMER을 이용해 분석하고 Structural Time series Analyser, Modeller and Predictor (STAMP)를 이용하여 추가 처리하였다. 그 결과, 본 발명자들은 도 3A에서 보여지는 바와 같이 sequence 5'-CAGC-3' 을 포함하는 putative motif를 밝혀냈다.Genetic information including near the Znf224 rich region (1 < kb) is shown in Figs. 9 to 17. Also, as shown in FIG. 8B, the ZNF224 signal occupies about 12% of the total peak of HEK293 in the promoter including 1 kb upstream and downstream of the TSS. To determine the DNA consensus sequence recognized by ZNF224, 13,561 peaks identified by the MACS program were analyzed using HOMER and further processed using Structural Time Series Analyzer, Modeller and Predictor (STAMP). As a result, the present inventors have found a putative motif comprising sequence 5'-CAGC-3 'as shown in FIG. 3A.
실시예Example 7. 7. HEK293으로부터From HEK293 ZNF224의ZNF224 정제 refine
HEK293 cells은 CMV 3xFLAG-ZNF224 plasmid와 함께 transfection되었다. 36시간 후, 단백질 추출물은 lysis buffer (50 mM Tris-HCl, pH7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3)와 함께 준비되었다. 상기 단백질 추출물 (10 mg)은 anti-FLAG M2 magnetic bead (Sigma Aldrich, MO, USA)와 함께 4℃에서 incubation하였다. 침전된 bead-protein complex는 1 mM PMSF을 포함하는 1X cold PBS로 세척되었고 elution buffer (0.1 M glycin, pH 2.5)로 용출하였다. 정제 후, FLAG-ZNF224 proteins은 1x PBS에 대항하여 투석하였고, -70℃에서 저장하였다. 그 결과, 정제된 FLAG-ZNF224는 약 100kDa의 크기 인 것을 확인할 수 있었다. 도 3C에서 나타난 바와 같이, 5'-CAGC-3'을 포함하는 상기 sequence는 대조군 또는 mutant oligo DNAs에 비해 더 높은 binding affinity을 보였다. HEK293 cells were transfected with the CMV 3xFLAG-ZNF224 plasmid. After 36 hours, the protein extract was washed with lysis buffer (50 mM Tris-HCl, pH7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3) ≪ / RTI > The protein extract (10 mg) was incubated with anti-FLAG M2 magnetic bead (Sigma Aldrich, MO, USA) at 4 ° C. The precipitated bead-protein complex was washed with 1 × cold PBS containing 1 mM PMSF and eluted with elution buffer (0.1 M glycin, pH 2.5). After purification, FLAG-ZNF224 proteins were dialyzed against 1x PBS and stored at -70 ° C. As a result, it was confirmed that the purified FLAG-ZNF224 was about 100 kDa in size. As shown in Figure 3C, the sequence containing 5'-CAGC-3 'showed a higher binding affinity than the control or mutant oligo DNAs.
실시예Example 8. 효소면역분석법( 8. Enzyme immunoassay ( enzymeenzyme -- linkedlinked immunosorbent immunosorbent assayassay , ELISA), ELISA)
ZNF224에 의해 인지되는 DNA consensus sequence를 결정하기 위하여, streptavidin로 코딩된 플레이트 (Thermo Scientific, MA, USA)를 wash buffer(25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% BSA, 0.05% Tween-20) 200ul로 세척하였고, 그 다음 각각의 well에 5'-biotinylated oligo DNA (5 μM) 100ul을 첨가하였다. 20% 글리세롤을 포함하는 1X PBS에서 정제된 FLAG-ZNF224 proteins 50ng을 각각의 well에 첨가하였고, RT에서 2시간 동안 incubation하였으며, 플레이트를 wash buffer로 3차례 세척하였다. Wash burffer에서 희석된 Anti-FLAG antibody (1 μg/ml)를 각각의 well (100 μl/well)에 첨가하고 RT 에서 2시간동안 더 incubation하였다. 세척한 후, 25 mM Tris-HCl, pH7.6, 150 mM NaCl, 0.5% BSA, 0.05% Tween-20에서 희석된 상기 horseradish peroxidatse (HRP)-conjugated goat antimouse IgG (1:5,000)를 각각의 well에 첨가하고 30분 동안 더 incubation 하였다. Washing buffer로 상기 플레이트를 세척한 후에, 3, 3', 5, 5′' -tetramethylbenzidine solution을 15분 동안 첨가하였다. 상기 signal은 450nm (BMG Labtech, Ortenberg,Germay)에서 측정되었다. To determine the DNA consensus sequence recognized by ZNF224, streptavidin-coded plates (Thermo Scientific, MA, USA) were washed with wash buffer (25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% BSA, 0.05% Tween -20), and then 100 μl of 5'-biotinylated oligo DNA (5 μM) was added to each well. 50 ng of purified FLAG-ZNF224 proteins in 1X PBS containing 20% glycerol were added to each well, incubated for 2 hours at RT, and the plate was washed three times with wash buffer. Anti-FLAG antibody (1 μg / ml) diluted in wash buffer was added to each well (100 μl / well) and further incubated at RT for 2 hours. After washing, the horseradish peroxidate (HRP) -conjugated goat antimouse IgG (1: 5,000) diluted in 25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.5% BSA and 0.05% Tween- And incubated for another 30 min. After washing the plate with washing buffer, 3,3 ', 5,5'-tetramethylbenzidine solution was added for 15 minutes. The signal was measured at 450 nm (BMG Labtech, Ortenberg, Germay).
실시예Example 9. 루시페라아제 활성 분석( 9. Luciferase activity assay ( LuciferaseLuciferase activityactivity assayassay ))
MCF-7 cells (2.5×105)을 12-well plates에 접종하고 Renilla vector (100 ng)의 CAGCTTC sequence의 triple repeat을 포함하는 pGL3-basic luciferase reporter vectors (200 ng)와 FLAG-ZNF224 (200 ng)의 존재 또는 부재 하에서 24시간 동안 배양하면서 transfection시켰다. ZNF224 및 miR-663a의 효과를 조사하기 위하여, MCF-7 cell을 Renilla vector (200 ng)의 p21 3' UTR 또는 p53 3' UTR을 포함하는 psiCHECK™ vectors (200 ng)로 FLAG-ZNF224 (200 ng) 또는 miR-663a의 존재 하에서 24시간 동안 (20 nM)transfection 시켰다(도 5A). 그 다음 세포를 miR-663a inhibitor(50nM, Bioneer, Korea)로 48시간 동안 처리하였다. Luciferase activity는 Dual-Luciferase Reporter Assay System(Promega, WI, USA)로 측정되었고 제조사의 지시에 따라 GloMax®(Promega, WI, USA)를 이용하여 정량화하였다. 그 결과, 도 5B에서 나타난 바와 같이 miR-663a는 p53-3' UTR-wild type 및 p21-3' UTR-wild type의 luciferase activity를 감소시킴을 확인할 수 있었으나, p53-3' UTR-mutant, 및 p21-3' UTR-mutant에서는 감소시키지 않음을 확인할 수 있었다. 또한, miR-663a antagonist는 miR-663a에 의해 luciferase activity의 감소를 억제함을 확인하였다. 또한, ZNF224는 용량 의존적으로 p53-3' UTR-wild type, 및 p21-3' UTR-wild type의 luciferase activity를 감소시켰으며, p53-3' UTR-mutant, 및 p21-3' UTR-mutant (도 5C)에서는 감소시키지 않음을 확인할 수 있었다. p53-3' UTR 및 p21-3' UTR의 감소된 luciferase activity 확인 여부는 ZNF224를 통해 miR-663a에 의해 매개되었다. 본 발명자들은 ZNF224 및 miR-663a antagonist의 transfection이후 luciferase activity를 시험했다. ZNF224의 과발현은 p53-3' UTR-wild type, 및 p21-3' UTR-wild type의 luciferase activity를 현저하게 감소시켰으나, p53-3' UTR-mutant, 및 p21-3' UTR-mutant에서는 감소시키지 않음을 확인할 수 있었다(도 5D). 또한, 이는 ZNF224가 miR-663a의 전사가 증가함으로써 p53 및 p21의 발현을 down-regulate시킬수 있다는 것을 시사하였고, miR-663a antagonist는 ZNF224에 의한 luciferase activity의 감소를 현저하게 억제시킴을 확인할 수 있었다. (200 ng) and FLAG-ZNF224 (200 ng) containing a triple repeat of the CAGCTTC sequence of the Renilla vector (100 ng) were inoculated into 12-well plates of MCF-7 cells Lt; / RTI > for 24 hours. To investigate the effects of ZNF224 and miR-663a, MCF-7 cells were transfected with 200 ng pNACHECK ™ vectors (200 ng) containing p21 3 'UTR or p53 3' UTR with 200 ng of FLAG-ZNF224 ) Or miR-663a for 24 h (20 nM) (Fig. 5A). Cells were then treated with miR-663a inhibitor (50 nM, Bioneer, Korea) for 48 h. Luciferase activity was measured by Dual-Luciferase Reporter Assay System (Promega, Wis., USA) and quantified using GloMax® (Promega, WI, USA) according to the manufacturer's instructions. As a result, as shown in FIG. 5B, it was confirmed that miR-663a decreased the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type, but the p53-3 'UTR mutant and p21-3 'UTR-mutant. In addition, miR-663a antagonist inhibited the decrease of luciferase activity by miR-663a. In addition, ZNF224 decreased the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type in a dose-dependent manner and p53-3 'UTR mutant and p21-3' UTR mutant 5C). ≪ / RTI > The confirmation of reduced luciferase activity of p53-3 'UTR and p21-3' UTR was mediated by miR-663a through ZNF224. We tested the luciferase activity after transfection of ZNF224 and miR-663a antagonist. Overexpression of ZNF224 significantly reduced the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type, but decreased p53-3 'UTR mutant and p21-3' UTR mutant (Fig. 5D). In addition, this suggests that ZNF224 can down-regulate p53 and p21 expression by increasing miR-663a transcription, and miR-663a antagonist significantly inhibits the decrease of luciferase activity by ZNF224.
실시예Example 10. 표면 10. Surface 플라스몬Plasmon 공명 분석( Resonance analysis SurfaceSurface plasmonplasmon resonanceresonance ( ( SPRSPR ) ) analysis분석 ))
oligo DNA와 ZNF224의 결합을 확인하기 위해, SPR 분석을 수행하였다. Surface plasmon resonance (SPR) analysis는 SR7500DC (Reichert, NY, USA)를 이용하여 수행하였다. FLAG-ZNF224 proteins (50 μg)을 제조사의 프로토콜에 따라 CMDH chips (Reichert, NY, USA)으로 고정하였다. Oligo DNA (0, 0.625 μM, 1.25μM, 2.5 μM, 5.0 μM, and 10 μM)를 1X PBS에서 분석물로 통과시시켰다. KD값을 Scrubber2 software을 사용하여 측정하였다. mutant sequence을 포함하는 oligo DNA가 어떠한 binding affinity도 보여주지 않는 반면, 5'-CAGC- 3'을 포함하는 oligo DNA와 ZNF224의 binding affinity의 정량은 ZNF224가 CAGCTTC (KD= 1.25±0.06x10-6 M), CAGCGTC (KD=2.0±0.1x10-6 M), and GCAGCAA (KD=0.42±0.03x10-6 M)에 결합한다는 것을 보여주었다. 5'-CAGC- 3'을 포함하는 oligo DNA가 프로모터로 기능할 수 있는 지 여부를 결정하기 위해, 본 발명자들은 대표적인 프로모터에 5'-CAGCGTC-3′' sequence를 포함하는 luciferase vector 구축하였다. 도 3D에서 나타난 바와 같이, ZNF224는 프로모터에서 ZNF224를 인지하는 DNA consensus sequence로서 기능하는 5'-CAGC-3′'을 포함하는 DNA sequence를 확인하는, dose-dependent manner에서 luciferase activity가 증가함을 확인할 수 있었다.To confirm the binding of oligo DNA to ZNF224, SPR analysis was performed. Surface plasmon resonance (SPR) analysis was performed using SR7500DC (Reichert, NY, USA). FLAG-ZNF224 proteins (50 μg) were fixed with CMDH chips (Reichert, NY, USA) according to the manufacturer's protocol. Oligo DNA (0, 0.625 μM, 1.25 μM, 2.5 μM, 5.0 μM, and 10 μM) was passed through the assay in 1 × PBS. K D values were measured using Scrubber2 software. Mutant sequence-containing oligo DNA showed no binding affinity, whereas the quantification of the binding affinity of oligo DNA and ZNF224 containing 5'-CAGC-3 'showed that ZNF224 inhibited CAGCTTC (KD = 1.25 ± 0.06 × 10 -6 M ), CAGCGTC (KD = 2.0 ± 0.1 × 10 -6 M), and GCAGCAA (KD = 0.42 ± 0.03 × 10 -6 M). To determine whether oligo DNA containing 5'-CAGC-3 'could function as a promoter, we constructed a luciferase vector containing a 5'-CAGCGTC-3''sequence in a representative promoter. As shown in Figure 3D, ZNF224 confirms an increase in luciferase activity in a dose-dependent manner, confirming a DNA sequence containing 5'-CAGC-3 '' functioning as a DNA consensus sequence recognizing ZNF224 in the promoter I could.
실시예Example 11. 정량적 11. Quantitative 중합연쇄반응Polymerization chain reaction (( QuantitativeQuantitative RT- RT- PCRPCR ))
유전자 발현을 분석하기 위해서, total RNA를 제조업체의 프로토콜에 따라 TRIzol reagent (Invitrogen, Paisley, UK)를 사용하여 추출하였다. Total RNA의 500ng을 역전사에 의해 cDNA를 제조하였고, 각각의 gene transcript를 특정 프라이머와 PCR에 의해 증폭시켰으며, 사용된 프라이머를 하기 표 1에 나타냈다. Quantitative RT-PCR은 Power SYBR Green PCR Master Mix® (ABI, CA, USA)및 StepOne 48 well real time PCR system (ABI, CA, USA)으로 수행하였다. 또한 ChIP sequencing결과를 확인하기 위해, Re-ChIP을 수행하였고, ChIPed DNA를 특정 프라이머와 PCR에 의해 증폭시켰으며, 사용된 프라이머를 하기 표 2에 나타냈다). 각각의 Ct value는 입력 샘플 ΔCt[Ct(IP) - Ct(Input)] 로 정규화 하였다. ChIP signals을 상기 입력 2-[컴Ct] 배의 값으로 계산하였다. 각각의 ChIP assay를 적어도 3번 반복하였다. To analyze gene expression, total RNA was extracted using TRIzol reagent (Invitrogen, Paisley, UK) according to the manufacturer's protocol. CDNA was prepared by reverse transcription of 500 ng of total RNA, and each gene transcript was amplified by specific primers and PCR, and the primers used were shown in Table 1 below. Quantitative RT-PCR was performed using Power SYBR Green PCR Master Mix® (ABI, CA, USA) and
R: 5‘-TGTGGTCATGAGTCCTTCCA-3’F: 5'-CGAGATCCCTCCAAAATCAA-3 '
R: 5'-TGTGGTCATGAGTCCTTCCA-3 '
R: 5'-GTCCTTCCACGATACCAAAGTTG-3‘F: 5'-GGGTGTGAACCATGAGAAGTATG-3 '
R: 5'-GTCCTTCCACGATACCAAAGTTG-3 '
R: 5‘-CCCGTGTGGACCATATGATGC-3‘F: 5'-CAGAGAGTCCACATGGGAGAG-3 '
R: 5'-CCCGTGTGGACCATATGATGC-3 '
R: 5‘-CCCAGCCAAAACTCTTCCCA-3’F: 5'-CACCAGAAGGTCCACACAGG-3 '
R: 5'-CCCAGCCAAAACTCTTCCCA-3 '
R: 5‘-GGATTAGGGCTTCCTCTTGGA-3’F: 5'-GCAGACCAGCATGACAGATTT-3 '
R: 5'-GGATTAGGGCTTCCTCTTGGA-3 '
R: 5‘-GGCATTCTGGGAGCTTCATCT-3’F: 5'-CCCAAGCAATGGATGATTTGA-3 '
R: 5'-GGCATTCTGGGAGCTTCATCT-3 '
R: 5‘-CGCTTCACGAATTTGCGTGTCAT-3’F: 5'-GCTTCGGCAGCACATATACTAAA-3 '
R: 5'-CGCTTCACGAATTTGCGTGTCAT-3 '
R: 5‘-CTCGCTTGCAGAGGAACCCTC-3’F: 5'-AGCCGCGTCCCAACCCGCTAG-3 '
R: 5'-CTCGCTTGCAGAGGAACCCTC-3 '
R: 5‘-TGGACTCTCTCAGGTTGAACG-3’F: 5'-AGATTTTCTGCCTTGGCACC-3 '
R: 5'-TGGACTCTCTCAGGTTGAACG-3 '
R: 5‘- ACTCGCTTGCAGAGGAACCC -3‘F: 5'- GCCGCGTCCCAACCCGCTAG -3 '
R: 5'-ACTCGCTTGCAGAGGAACAC-3 '
R: 5‘-TTCATCAGTGCGGCTTTCAA-3’F: 5'-GCACTGGAAAACCGATCGTC-3 '
R: 5'-TTCATCAGTGCGGCTTTCAA-3 '
R: 5‘-ACGGAGAACTTCCCTGTATGG-3’F: 5'-CCACAGAGGTAGGATGAGCC-3 '
R: 5'-ACGGAGAACTTCCCTGTATGG-3 '
R: 5‘-CAACCGACATTGCTGTTGCT-3‘F: 5'-AGGGAGCACATTTACAGGATGG-3 '
R: 5'-CAACCGACATTGCTGTTGCT-3 '
R: 5‘-TCAGGGTCCCCTCCGGCCCCG-3‘F: 5'-GTAAACGTCCGTGGGGAGAA-3 '
R: 5'-TCAGGGTCCCCTCCGGCCCCG-3 '
R: 5‘-CTGCTGTTGCTGCTGCTGTCG-3’F: 5'-AGCGAGAGTGCCGAGCAGC-3 '
R: 5'-CTGCTGTTGCTGCTGCTGTCG-3 '
R: 5‘-CGGGCCACCAGGAAAACA-3‘F: 5'-CTTCCGGCGTCCCAGG-3 '
R: 5'-CGGGCCACCAGGAAAACA-3 '
R: 5‘-GATGTGAGGAAGGCTCAGTGG-3‘F: 5'-CAGGCTGGTCTCAAAACTCCT-3 '
R: 5'-GATGTGAGGAAGGCTCAGTGG-3 '
R: 5‘-ATGGAGTTGGGGAGGAGGGTA-3‘F: 5'-CATCAAGCCCTAGGGCTCCTC-3 '
R: 5'-ATGGAGTTGGGGAGGAGGGTA-3 '
실시예Example 12. 면역 조직화학적 염색( 12. Immunohistochemical staining ( ImmunohistochemicalImmunohistochemical stainingstaining ))
유방암 환자로부터 서면동의서를 얻었고, 본 연구는 연세대학교 세브란스 병원(4-2015-0168)의 임상심사위원회에 의해 승인되었다. 표본은 단계 1과 2사이의 유관암(ductal carcinoma)이었다. 면역조직화학 염색은 전술한 바와 같이 수행하였다. 섹션(5um)을 항-p53및 1/50로 희석한 항-ZNF224 항체로 1시간 동안 RT에서 염색하였다. 염색은 제조업체의 지시에 따라 Ultra View universal DAB detection kit (Ventana, AZ, USA)로 detection하였다. 핵을 Mayer's haematoxylin(Dako, Glostrup, Denmark)으로 대조하였다. H&E 및 immunohistochemical staining은 ZNF224 발현 수준이 비-암 영역에 비해 암 영역(18건 중 15건)에서 증가하였음을 보여준다(도 7A 및 7B), 반면, ZNF224 mRNA 발현은 18건 중에 오직 8건 만이 증가하였다(도 7c). 또한, miR-663a transcript 수준은 14건 중에 7건이 증가하였고, p21 mRNA가 detection되지 않은 반면, p53 mRNA 수준은 16 case 중에 8 건이 감소하였다(도 7D 및 7E). 상기 테스트된 조직 중에, 3건(16.6%)은 ZNF224 transcript 수준의 증가는 증가된 miR-663a RNA (rs = -0.4862, p=0.0389) 및 감소된 p53 mRNA (rs = -0.3446, p=0.046)와 연관이 있음을 나타냈다.Written consent was obtained from breast cancer patients and this study was approved by the clinical review committee of Yonsei University Severance Hospital (4-2015-0168). The specimen was ductal carcinoma between
실시예Example 13. P21 및 p53의 13. P21 and p53 tanscripttanscript 및 단백질 수준 확인 And protein levels
본 발명자들은 ZNF224가 miR-663a를 통해 p53 및 p21의 transcript 및 단백질 수준을 감소시킬 수 있는지 여부를 시험했다. miR-663a transfection은 p21 및 p53의 transcript 수준뿐만 아니라 단백질 수준을 효과적으로 감소시켰다(도 6A 및 6B). 또한, miR-663a는 miR-663a antagonist가 p21 및 p53의 발현을 감소시키는 반면, MCF-7 cell의 콜로니 형성 가능성을 증가시켰고(도 6C) 증가된 콜로니 형성은 miR-663a에 의해 유도됨을 확인할 수 있었다(도 6A 내지 6C). p21 및 p53의 감소된 발현 수준이 세포사멸 저항을 유도하기 때문에, 세포성장 및 세포 사멸은 CPT의 처리 이후에 분석하였다. miR-663a antagonist의 transfection시와 반대로, miR-663a transfection은 MCF-7 cell의 세포성장을 증가시키고 CPT에 의한 세포사멸의 저항이 유도하였다(도 6D). 또한, ZNF224의 transfection은 p21 및 p53의 mRNA 수준뿐만 아니라 그것의 단백질 수준도 감소시킴을 확인할 수 있었다. 그리고 miR-663a의 transcript 수준은 증가했다. 반면, ZNF224에 의한 p21 및 p53의 상기 감소된 발연은 miR-663a에 의해 매개된다는 것을 시사하면서, miR-663a antagonist는 ZNF224의 효과를 억제했다 (도 6E 및 6F). 또한, ZNF224에 의해 유도된 콜로니 형성 능력 및 세포 성장의 증가는 miR-663a antagonist의 transfection에 의해 억제되었다. 뿐만 아니라 miR-663a antagonist는 세포사멸 저항의 민감성을 이끌면서, ZNF224 과발현에 의해 유도된 enhanced cell growth를 억제했다(도 6H). ZNF224 의 si-RNA transfection은 miR-663a 전사 수준이 아니라, p21 및 p53의 transcript 수준을 증가시켰다(도 6I). Western blot analysis는 si-RNA를 이용한 ZNF224 knock-down이 p21이 아닌, p53의 발현 수준을 증가시킨다는 것을 보여주었다(도 6J).We tested whether ZNF224 could reduce the transcript and protein levels of p53 and p21 through miR-663a. miR-663a transfection effectively reduced the transcript level as well as the protein level of p21 and p53 (Figs. 6A and 6B). In addition, miR-663a showed that miR-663a antagonist reduced the expression of p21 and p53, while increased the possibility of colonization of MCF-7 cells (Fig. 6C) and increased colony formation was induced by miR-663a (Figs. 6A to 6C). Since reduced expression levels of p21 and p53 lead to apoptosis resistance, cell growth and apoptosis were analyzed following treatment with CPT. In contrast to the transfection of the miR-663a antagonist, miR-663a transfection increased cell growth of MCF-7 cells and induced apoptosis by CPT (Fig. 6D). In addition, transfection of ZNF224 also confirmed that the mRNA levels of p21 and p53 as well as their protein levels were reduced. And transcript levels of miR-663a increased. On the other hand, the miR-663a antagonist inhibited the effect of ZNF224 (Fig. 6E and 6F), suggesting that the reduced fuming of p21 and p53 by ZNF224 is mediated by miR-663a. In addition, the ability of ZNF224-induced colony formation and cell growth was inhibited by transfection of miR-663a antagonist. In addition, the miR-663a antagonist inhibited enhanced cell growth induced by ZNF224 overexpression, leading to susceptibility to apoptosis resistance (FIG. 6H). SiRNA transfection of ZNF224 increased transcript levels of p21 and p53, but not miR-663a transcription level (Fig. 6I). Western blot analysis showed that ZNF224 knock-down using si-RNA increased the expression level of p53, but not p21 (Fig. 6J).
실시예Example 14. 통계적 분석 14. Statistical analysis
상기 결과는 평균±S.D 또는 평균±SEM으로 표현하였다. 상기 student's t test는 모든 수행 실험 그룹의 통계적 중요성을 결정하기 위해서 수행되었고 P<0.05는 통계적으로 유의한 것으로 간주하였다. The results are expressed as mean ± SD or mean ± SEM. The student's t test was performed to determine the statistical significance of all performance test groups and P <0.05 was considered statistically significant.
Claims (15)
Biomarkers for prediction of prognosis of breast cancer including ZNF224 gene.
A composition for predicting breast cancer prognosis, comprising an agent for measuring an expression level of mRNA or protein of the biomarker of claim 1.
[Claim 3] The composition for predicting breast cancer according to claim 2, wherein the agent for measuring the expression level of the mRNA comprises a primer base sequence that specifically binds to the biomarker.
3. The composition for predicting breast cancer according to claim 2, wherein the binding site to which the biomarker specifically binds is 5'-CAGC-3 '.
A kit for predicting breast cancer prognosis, comprising an agent for measuring an expression level of mRNA or protein of a biomarker according to any one of claims 2 to 4.
6. The kit for predicting breast cancer prognosis according to claim 5, wherein the kit is an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a quantitative RT-PCR kit, a DNA chip kit or a protein chip kit.
b) 상기 a) 단계에서 얻은 발현 수준 또는 발현 패턴을 예후가 알려진 유방암 환자의 해당 유전자의 mRNA 또는 단백질 발현 수준, 또는 발현 패턴과 비교하는 단계를 포함하는 유방암 예후 예측을 위한 정보제공방법.
a) obtaining a mRNA or protein expression level or expression pattern of the biomarker of claim 1 from a biological sample isolated from a breast cancer patient; And
b) comparing the expression level or expression pattern obtained in step a) with the mRNA or protein expression level or expression pattern of the gene of interest in a breast cancer patient whose prognosis is known.
The method according to claim 7, wherein the mRNA level is measured by RT-PCR, competitive RT-PCR, real-time quantitative RT-PCR ), Quantitative RT-PCR, RNase protection method, northern blotting, or DNA chip technology, for the prediction of prognosis of breast cancer .
The method according to claim 7, wherein the level of the protein is measured by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radical immunodiffusion, Immunohistochemical staining, immunoprecipitation assay, complenent fixation assay, immunofluorescence, immunofluorescence, immunohistochemistry, immunohistochemistry, immunohistochemistry, immunohistochemical staining, immunohistochemical staining, Wherein the method is immunochromatography, fluorescence activated cell sorter analysis, or protein chip technology.
b) 후보물질이 처리된 유방암 환자의 시료에서 제1항에 따른 바이오마커의 mRNA 또는 단백질 발현 수준을 측정하는 단계; 및
c) 상기 b) 단계의 mRNA 또는 단백질 발현 수준이 후보물질의 처리 전보다 낮은 경우, 후보물질을 유방암의 예방 또는 치료용 물질로 판단하는 단계; 를 포함하는 유방암 예방 또는 치료용 물질 스크리닝 시스템.
a) treating the candidate material from the breast cancer patient sample;
b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And
c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of step b) is lower than that of the candidate substance before treatment; Wherein the mammal is a mammal.
b) 후보물질이 처리된 유방암 환자의 시료에서 ZNF224와 CAGC를 포함하는 염기서열의 결합을 저해하는 것을 확인하는 단계; 를 포함하는 항암제 스크리닝 방법.
a) treating the candidate material from the breast cancer patient sample; And
b) confirming that the candidate substance inhibits the binding of the base sequence comprising ZNF224 and CAGC in a sample of breast cancer patients treated; Wherein the method comprises the steps of:
12. The method according to claim 11, wherein the anticancer agent screening method further comprises the step of: c) selecting a candidate drug having a decreased expression level of miR-663a as compared with a control sample.
A substance that inhibits protein expression or activity that is encoded by the biomarker of claim 1; ≪ / RTI > and a pharmaceutically acceptable carrier.
14. The pharmaceutical composition according to claim 13, wherein the substance is an antisense oligonucleotide, an aptamer, siRNA or shRNA for a biomarker.
14. The pharmaceutical composition according to claim 13, wherein the substance is an antibody or an antigen-binding fragment thereof that inhibits the protein activity of the biomarker.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020160105401A KR101943157B1 (en) | 2016-08-19 | 2016-08-19 | Biomarkers for Predicting Breast cancer |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020160105401A KR101943157B1 (en) | 2016-08-19 | 2016-08-19 | Biomarkers for Predicting Breast cancer |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20180021328A true KR20180021328A (en) | 2018-03-02 |
KR101943157B1 KR101943157B1 (en) | 2019-01-29 |
Family
ID=61729255
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020160105401A KR101943157B1 (en) | 2016-08-19 | 2016-08-19 | Biomarkers for Predicting Breast cancer |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR101943157B1 (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN110923317A (en) * | 2019-11-27 | 2020-03-27 | 福建省立医院 | Method for breast cancer prognosis prediction and primer group thereof |
KR20200089378A (en) | 2019-01-16 | 2020-07-27 | 동국대학교 산학협력단 | Use of SARNP in breast cancer |
-
2016
- 2016-08-19 KR KR1020160105401A patent/KR101943157B1/en active IP Right Grant
Non-Patent Citations (4)
Title |
---|
Breast Cancer Res Treat. 2014 Jun,145(2):295-305 * |
Int J Oncol. 2014 Jun, 44(6):2025-33 * |
PLoS One. 2014 Mar 14, 9(3):e91884 * |
PLoS One. 2014 Mar 5, 9(3):e90642 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20200089378A (en) | 2019-01-16 | 2020-07-27 | 동국대학교 산학협력단 | Use of SARNP in breast cancer |
CN110923317A (en) * | 2019-11-27 | 2020-03-27 | 福建省立医院 | Method for breast cancer prognosis prediction and primer group thereof |
Also Published As
Publication number | Publication date |
---|---|
KR101943157B1 (en) | 2019-01-29 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sandoval et al. | Binding of TMPRSS2-ERG to BAF chromatin remodeling complexes mediates prostate oncogenesis | |
Zheng et al. | PKD1 phosphorylation-dependent degradation of SNAIL by SCF-FBXO11 regulates epithelial-mesenchymal transition and metastasis | |
US20120004289A1 (en) | Annexin a11 and associated genes as biomarkers for cancer | |
Yalim‐Camci et al. | ETS1 is coexpressed with ZEB2 and mediates ZEB2‐induced epithelial‐mesenchymal transition in human tumors | |
KR101966493B1 (en) | Biomarkers for Predicting Triple Negative Breast Cancer Prognostication | |
Liu et al. | Long non-coding RNA CCAL promotes hepatocellular carcinoma progression by regulating AP-2α and Wnt/β-catenin pathway | |
EP3336548B1 (en) | Method for providing information on chronic myeloid leukemia | |
US20170081723A1 (en) | Fusion Genes in Cancer | |
Zhao et al. | LncRNA TMPO‐AS1 promotes LCN2 transcriptional activity and exerts oncogenic functions in ovarian cancer | |
Gu et al. | HOXA13 promotes colon cancer progression through β-catenin-dependent WNT pathway | |
Von Roemeling et al. | Functional genomics identifies novel genes essential for clear cell renal cell carcinoma tumor cell proliferation and migration | |
KR101943157B1 (en) | Biomarkers for Predicting Breast cancer | |
KR101133243B1 (en) | Use of eIF3m for the Diagnosis and Treatment of Cancer | |
KR20190114298A (en) | Biomarkers for Predicting gastric cancer prognostication or drug reactivity | |
JP7281833B2 (en) | A novel pancreatic cancer epithelial-mesenchymal transition marker | |
CN112011614A (en) | Application of KMT5A in regulation and control of glioma stem cell characteristics and glioma diagnosis and treatment | |
JP7167263B2 (en) | Biomarker composition for diagnosing radiation-resistant cancer or predicting radiotherapy prognosis containing PMVK as an active ingredient | |
JP7249044B2 (en) | Tumor cell malignant transformation inhibitor and antitumor agent | |
KR20200000969A (en) | Composition for diagnosing or treating pancreatic cancer | |
JP2014095643A (en) | Screening method for inflammatory disease therapeutic agent, and treatment and inspection of inflammatory disease | |
Zhang et al. | Coronin 6 promotes hepatocellular carcinoma progression by enhancing canonical Wnt/beta-catenin signaling pathway | |
KR101612356B1 (en) | Use of HOXB5 for diagnosis and treatment of breast cancer | |
KR102027248B1 (en) | Biomarker for detecting breast cancer stem cell(BCSC) and use thereof | |
EP2754713B1 (en) | ANTIBODY AGAINST MUTANT alpha-ACTININ-4 | |
KR20160029053A (en) | Use of HOXB5 for diagnosis and treatment of breast cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
A302 | Request for accelerated examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |