KR20180021328A - Biomarkers for Predicting Breast cancer - Google Patents

Abstract

The present invention relates to a gene biomarker for predicting a prognosis of breast cancer; a composition for predicting a breast cancer prognosis, wherein the composition includes a formulation for measuring an expression level of mRNA or protein of the gene biomarker; a kit for predicting a breast cancer prognosis, wherein the kit includes the composition; an information providing method for predicting a prognosis of breast cancer by using the kit; a system for screening a material for preventing or treating breast cancer by using the gene biomarker; and a pharmaceutical composition for preventing or treating breast cancer, wherein the pharmaceutical composition targets the gene biomarker. More specifically, by measuring an expression level of mRNA or protein of a gene biomarker of the present invention in a breast cancer patient, a prognosis of the breast cancer patient can be predicted, and expression of a corresponding gene biomarker in charge of a refractory prognosis of breast cancer can be suppressed in accordance with a prognosis prediction result. Thus, the breast cancer patient can be more effectively treated.

Description

{Biomarkers for Predicting Breast cancer}

The present invention relates to a composition for predicting breast cancer prognosis, which comprises a gene biomarker for predicting the prognosis of breast cancer, an agent for measuring the expression level of mRNA or protein of the gene biomarker, a kit for predicting breast cancer prognosis, A method for screening a substance for prevention or treatment of breast cancer using the gene biomarker, and a method for screening a substance for prevention or treatment of breast cancer targeting the gene biomarker More particularly, the present invention relates to a composition for measuring the expression level of mRNA or protein of a gene biomarker of the present invention in a breast cancer patient, and the prognosis of a breast cancer patient can be predicted. Because it can inhibit the expression of gene biomarkers It can more effectively treat patients with breast cancer.

Transcription factor (TF) inhibits or activates transcription of a target gene by binding to its DNA binding factor during various cellular processes. KRAB-ZFPs (Kruppel-like associated box-zinc finger proteins) are members of the DNA-binding family of proteins. KRAB-ZFPs preserve the KRAB domain at the N-terminal region and the C ₂ H ₂ -type zinc entanglement motif at the C-terminal region. KRAB-ZFPs have a leucine-rich region found in a small subset of one or more KRAB A box, and / or KRAB B box, or SCAN-domain, KRAB-ZFPs. Recently, the KRAB domain of ZNF is known to bind to the secondary inhibitor protein and / or TF through protein-protein interactions as a result of transcriptional repression of the target gene. KRAB-ZFPs complex with KRAB-related protein 1 (KAP1), which is one of the secondary inhibitors as well as a mediator of the chromatin remodeling complex that binds to the corresponding DNA common sequence and silences gene expression.

ZNF224 is a transcription factor consisting of the KARB A domain of the N-terminal region, the KRAB B domain, and 19 longitudinally repeated C ₂ H ₂ -type zinc swarm motifs. ZNF225, an alternative splice variant of ZNF224, lacks the KRAB domain but contains 19 zinc titer domains. They are somewhat different in localization. ZNF225 is located in a subnuclear structure related to the nucleus, while ZNF224 is uniformly distributed in the nucleus and also in the cytoplasm. The nuclear interaction of ZNF224 and Wilms' tumor suppressor gene (WT1) increases expression of the WT1 target gene, while ZNF225 is primarily involved in RNA maturation and processing with WT1.

ZNF224 functions as an electronic inhibitor by forming a complex with KAP1 and type II protein arginine methyltransferase (PRMT5), leading to electronic inhibition of the Aldolase A gene. In addition, ZNF224 inhibits the transcription of the mitochondrial citrate carrier gene. Interestingly, ZNF224 is a co-activator of WT1 in the regulation of proapoptotic and antiapoptotic genes including Bax, Bak, Vitamin D receptor (VDR), bag3, and A1 / Bfl1 . Furthermore, the DEP domain containing 1 (DEPDC1) inhibits A20 transcription by ZNF224. However, upon termination of the ZNF224 / DEPDC1 complex, the A20 mRNA expression is increased. These results suggest that ZNF224 functions as a tumor protein (oncoprotein) or tumor suppressor in protein-dependent or cancer-type-dependent interactions.

The inventors first determined whether ZNF224 could function as an oncogenic protein. In addition, the present inventors have sought to identify the target gene and the DNA common sequence recognized by ZNF224 in MCF-7 cells. Interestingly, we have found that the consensus sequence recognized by ZNF224 is within -500 bp of the miR-663a promoter and not only investigated whether ZNF224 increases or decreases the expression of miR-663a, Cells were used to evaluate the expression of ZNF224 and miR-663a, thereby completing the present invention.

Therefore, the present inventors have sought to identify a gene for prediction of breast cancer prognosis. As a result, it was found that ZNF224 specifically increases expression in breast cancer cells, increases miR-663a expression, and that the increased expression level of miR-663a is associated with a poor prognosis.

Accordingly, it is an object of the present invention to provide a biomarker for prediction of prognosis of breast cancer including ZNF224 gene.

It is still another object of the present invention to provide a composition for predicting breast cancer prognosis, which comprises an agent for measuring an expression level of mRNA or protein of a biomarker of the present invention.

It is still another object of the present invention to provide a kit for predicting breast cancer prognosis, which comprises an agent for measuring the expression level of mRNA or protein of the biomarker of the present invention.

Yet another object of the present invention is to provide a method for the diagnosis of breast cancer, comprising the steps of: a) obtaining a mRNA or protein expression level or an expression pattern of the biomarker of claim 1 from a biological sample isolated from a breast cancer patient; And b) comparing the expression level or the expression pattern obtained in the step a) with the mRNA or protein expression level or expression pattern of the gene of interest in a breast cancer patient whose prognosis is known, to provide an information providing method for prediction of breast cancer prognosis .

Yet another object of the present invention is to provide a method for treating breast cancer, comprising the steps of: a) treating a candidate material from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of the step b) is lower than that of the candidate substance before treatment; And to provide a screening system for substances for preventing or treating breast cancer.

Yet another object of the present invention is to provide a method for treating breast cancer, comprising the steps of: a) treating a candidate material from a breast cancer patient; And b) confirming that the candidate substance inhibits the binding of the base sequence including ZNF224 and CAGC in the sample of the breast cancer patient treated.

Yet another object of the present invention is to provide a biomarker comprising a substance which inhibits protein expression or activity which is encoded by the biomarker according to the present invention; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

Accordingly, the present invention provides a biomarker for predicting the prognosis of breast cancer comprising ZNF224 gene.

In addition, the present invention may include an agent for measuring the expression level of the mRNA or protein of the biomarker of the present invention.

According to a preferred embodiment of the present invention, the agent for measuring the expression level of the mRNA may include a primer sequence that specifically binds to the biomarker.

According to another embodiment of the present invention, the binding site specifically binding the biomarker may be 5'-CAGC-3 '.

The present invention also provides a kit for predicting breast cancer prognosis, which comprises an agent for measuring the expression level of mRNA or protein of the biomarker of the present invention.

According to a preferred embodiment of the present invention, the kit may be an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a quantitative RT-PCR kit, a DNA chip kit or a protein chip kit.

Also, the present invention provides a method for producing a biomarker comprising the steps of: a) obtaining the mRNA or protein expression level or expression pattern of the biomarker of claim 1 from a biological sample isolated from a breast cancer patient; And b) comparing the expression level or the expression pattern obtained in the step a) with the mRNA or protein expression level or expression pattern of the gene of interest in a breast cancer patient whose prognosis is known, to provide an information providing method for prediction of breast cancer prognosis do.

According to a preferred embodiment of the present invention, the mRNA level is measured by RT-PCR, competitive RT-PCR, real-time RT-PCR time quantitative RT-PCR, quantitative RT-PCR, RNase protection method, northern blotting or DNA chip technology.

According to another preferred embodiment of the present invention, the method for measuring the level of the protein may be Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA) immunohistochemical staining, immunoprecipitation assay, complenent fixation assay, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, immunohistochemical staining, Immunofluorescence, immunochromatography, FACS (fluorescence activated cell sorter analysis), or protein chip technology.

The present invention also relates to a method for treating breast cancer, comprising the steps of: a) treating a candidate substance isolated from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of the step b) is lower than that of the candidate substance before treatment; A screening system for preventing or treating breast cancer.

The present invention also relates to a method for treating breast cancer, comprising the steps of: a) treating a candidate substance isolated from a breast cancer patient; And b) confirming that the candidate substance inhibits binding of a base sequence comprising ZNF224 and CAGC in a sample of a breast cancer patient treated; An anticancer agent screening method.

According to a preferred embodiment of the present invention, the anticancer drug screening method may further comprise: c) selecting a candidate drug having a reduced amount of miR-663a expression compared to a control sample. The present invention also relates to a substance that inhibits the expression or activity of a protein encoded by the biomarker; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.

According to a preferred embodiment of the present invention, the material may be an antisense oligonucleotide, an aptamer, siRNA or shRNA for a biomarker.

According to another preferred embodiment of the present invention, the antibody may be an antibody or an antigen-binding fragment thereof that inhibits the protein activity of the biomarker.

Disclosure of the Invention The present invention has been conceived to solve the above-mentioned problems. The present invention utilizes that ZNF224 induces cell survival and apoptosis resistance by decreasing p53 and p21 expression through miR-663a as a transcription activator And to provide a biomarker for predicting the prognosis of breast cancer including ZNF224 gene.

 Therefore, appropriate treatment directions can be determined according to the predicted prognosis, and it is possible to provide customized treatment methods, and it is possible to treat breast cancer patients more effectively by reducing breast cancer recurrence and mortality in patients with poor prognosis.

Figure 1 shows a graph showing the ability of ZNF224 to form colonies in MCF-7 cells, and RT-PCR and Western blotting results.
2 shows cell growth and cell death resistance of ZNF224 over-expressing cell line and ZNF224 knockdown cell line.
FIG. 3 is a graph showing the motif binding characteristic of ZNF224 DNA and the activity of luciferase according to ZNF224 concentration.
4 is a graph showing the nucleotide sequence of the miR-663a promoter region binding to ZNF224 and miR-663a transcription level according to ZNF224 concentration.
Figure 5 shows the results of ZNF224 modulating the promoter activity of p21 and p53 via miR-663a.
Figure 6 shows the results of ZNF224 modulating cell growth by regulating p21 and p53 expression via miR-663a.
FIG. 7 shows immunohistochemical and H & E staining of cancerous and non-cancerous regions of breast cancer tissue and anti-ZNF224 antibody, and expression of ZNF224 mRNA and miR-663a expressed from cancerous and non-cancerous regions , and p53 mRNA expression levels.
Figure 8 shows the distribution of the ZNF224 enriched region in the chip-seq library.
Figs. 9 to 17 show gene information including near the Znf224 rich region (1 < kb).

Hereinafter, the present invention will be described in more detail.

As described above, p53 and p21 are proteins that regulate cell cycle and apoptosis and are closely related to cancer development. By analyzing molecular level of a novel transcription factor ZNF224 that regulates p53 and p21 expression in breast cancer cells, Prognosis, and direction of appropriate treatment.

The present invention solves the above-mentioned problem by providing a biomarker for prediction of prognosis of breast cancer including ZNF224 gene. In this study, we aimed to evaluate the prognosis of patients with breast cancer and determine the proper treatment direction according to the predicted prognosis. Therefore, it is possible to provide individualized treatment methods for patients and to decrease the recurrence and mortality of breast cancer in patients with poor prognosis. Can be effectively treated.

In order to determine whether the gene ZNF224 involved in the poor prognosis of breast cancer functions as an oncogene in the present invention, the ZNF224 gene was transfected with MCF-7 cells, which is a breast cancer cell host, and colony formation analysis was performed . FIG. 1A is a graph comparing the number of colonies of MCF-7 transfected with control and ZNF224, and FIG. 1B is a comparison of ZNF224 protein expression levels in MCF-7 through RT-PCR and Western blotting. 1A and 1B to increase cell growth in the cells overexpressed.

In addition, since oncogene overexpression induces resistance to apoptosis, the present inventors tested whether ZNF224 overexpressed cell line and ZNF224 knock-down cell line were treated with CPT to observe cell survival and cell apoptosis against CPT . As a result, it was confirmed that the cell line overexpressing ZNF224 had better cell viability against CPT than the control group (Fig. 2A).

The term "biomarker" of the present invention refers to a molecule quantitatively or qualitatively associated with the presence of a biological phenomenon, and the marker of the present invention refers to a gene which is a standard for predicting patients with good or poor prognosis after the invention of breast cancer. The marker may be derived from a genomic nucleotide sequence or from a nucleotide sequence expressed (e.g., from RNA, nRNA, mRNA, cDNA, etc.), or from a coded polypeptide. The term includes nucleic acid sequences that are complementary to or flanked in the marker sequence, such as a probe or a pair of primers that can amplify the marker sequence.

In the present invention, the term "prognosis" refers to a prediction of a medical cause (e.g., long-term viability, disease-free survival rate, etc.) and includes a positive prognosis (positive prognosis) or a negative prognosis Prognosis includes the progression or mortality of recurrence, tumor growth, metastasis, drug resistance, etc., and the positive prognosis may include disease progression such as a disease-free condition, improvement or stabilization of diseases such as tumor regression stabilization.

For purposes of the present invention, the term "prediction" in the present invention refers to predicting a medical condition, and for the purpose of the present invention, Drug resistance) in advance.

The present invention also provides a composition for predicting breast cancer prognosis, which comprises an agent for measuring mRNA or protein expression level of a myoma marker of the present invention.

The term "agent for measuring mRNA or protein expression level of biomarker" in the present invention means a molecule that can be used for confirming the expression level of a biomarker gene of the present invention or a protein encoded by these genes, May be a primer pair, a probe, or an antisense nucleotide that specifically binds to the biomarker, or may be an antibody specific to a protein encoded by the biomarker gene.

As used herein, the term "antibody" refers to a specific protein molecule that is directed against an antigenic site as known in the art. For purposes of the present invention, an antibody refers to a protein molecule specific to the marker of the present invention. For the purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker of the present invention, which clones each gene into an expression vector according to a conventional method to obtain a protein encoded by the marker gene , And can be prepared from the obtained protein by a conventional method. The form of the antibody of the present invention is not particularly limited and any part thereof having a polyclonal antibody, a monoclonal antibody or an antigen-binding property is included in the antibody of the present invention and includes all the immunoglobulin antibodies. Furthermore, the antibodies of the present invention include special antibodies such as humanized antibodies. The antibody against the protein encoded by the biomarker gene of the present invention may be any antibody that can be produced by a method known in the art. For example, an antibody used in the detection of a cancer diagnostic marker of the invention may comprise a complete form having two full-length light chains and two full-length heavy chains as well as a functional fragment of an antibody molecule. The functional fragment of the antibody molecule refers to a fragment having at least an antigen binding function and may be Fab, F (ab ') 2, F (ab') 2, Fv or the like, but is not particularly limited thereto.

The term "primer" in the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group and can form a base pair with a complementary template, and a starting point for copying the template &Lt; / RTI &gt; In the present invention, PCR amplification using the sense and antisense primers of the marker polynucleotide of the present invention can predict the prognosis of breast cancer through the production of desired products. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

In one embodiment of the invention, ChIp-sequencing was performed to reveal the base sequence in which ZNF224 binds to the promoter of miR-663a. As shown in FIG. 3, a hair-pin loop structure including a 5'-CAGC-3 'nucleotide sequence was confirmed (FIG. 3B), and the sequence was present in two regions within -500 bp of miR-663a (Fig. 4A). Therefore, it was confirmed that the transcript level of miR-663a was increased in a concentration-dependent manner by binding ZNF224 to the above sequence (FIG. 4D).

The term "probe" in the present invention means a nucleic acid fragment such as RNA or DNA corresponding to a few bases or hundreds of bases that can specifically bind to mRNA and is labeled The presence or absence of a specific mRNA can be confirmed. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. In the present invention, the hybridization using the probe complementary to the marker polynucleotide of the present invention can predict the prognosis of breast cancer through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution with one or more of the natural nucleotide analogs, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, Amidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

The present invention also provides a kit for predicting breast cancer prognosis, which comprises the composition for predicting the prognosis of breast cancer.

The kit of the present invention can be used to predict the prognosis of breast cancer by confirming the mRNA expression level of the biomarker gene for prediction of breast cancer prognosis or the expression level of the protein encoded by these genes.

According to an embodiment of the present invention, the kit for measuring the mRNA expression level of the biomarker genes may be a kit containing essential elements necessary for performing RT-PCR. RT-PCR kits can be used to detect and isolate specific primer pairs specific to the marker gene, including test tubes or other appropriate containers, reaction buffers, deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC- DEPC-water, sterile water, and the like.

According to another embodiment of the present invention, the kit of the present invention may be a kit for detecting a biomarker for predicting the prognosis of breast cancer, which includes essential elements necessary for performing a DNA chip. The DNA chip kit may include a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative control gene or a fragment thereof.

According to another embodiment of the present invention, a kit for measuring the expression level of a protein encoded by the biomarker genes according to the present invention comprises a substrate, a suitable buffer solution, a chromogenic enzyme or a fluorescent substance And secondary antibody and chromogenic substrate. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a slide glass made of glass, etc. The chromogenic enzyme may be peroxidase, Alkaline phosphatase can be used, and fluorescent materials such as FITC, RITC and the like can be used. The coloring substrate liquid is ABTS (2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid ) Or OPD (o-phenylenediamine), TMB (tetramethylbenzidine) and the like can be used.

The present invention also relates to a method for the treatment of breast cancer, comprising the steps of: a) obtaining the mRNA or protein expression level, or expression pattern, of said biomarker from a biological sample isolated from a breast cancer patient; And b) comparing the expression level or expression pattern obtained in step a) with the expression level or expression pattern of mRNA or a protein of the gene of interest in a breast cancer patient whose prognosis is known, to provide information for prediction of prognosis of breast cancer .

In the present invention, the term "measurement of mRNA expression level" can be determined by measuring the amount of mRNA in the biological sample by confirming the presence or absence of the mRNA and the expression level of the biomarker gene in the biological sample to predict the prognosis of breast cancer. RT-PCR, competitive RT-PCR, real-time RT-PCR, quantitative RT-PCR, RNase protection assay protection method, northern blotting or DNA chip technology, but the present invention is not limited thereto.

In the present invention, the term "measurement of protein expression level" refers to a process of confirming the presence and expression level of a protein expressed in a marker gene in a biological sample to predict the prognosis of breast cancer, The amount of the protein can be confirmed by using an antibody specifically binding to the protein. Analysis methods include western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radial immunodiffusion, Ouchterlony immunodiffusion, rocket immunization Immunohistochemical staining, immunoprecipitation assays, complement fixation assays, immunofluorescence, immunochromatography, FACS (Immunohistochemical staining), immunofluorescence (immunohistochemical staining), immunoprecipitation assays fluorescence activated cell sorter analysis, or protein chip technology, but the present invention is not limited thereto.

The term "biological sample isolated from a breast cancer patient" in the present invention includes, but is not limited to, breast-derived tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine of a breast cancer patient, It may be a breast tumor tissue.

In the present invention, the term "breast cancer patient whose prognosis is known" refers to a patient who has been diagnosed with breast cancer and has been diagnosed to have a poor prognosis by recurrence within 36 months after surgery, for example, Or patients who were confirmed to have a good prognosis after survival or cure without recurrence after 36 months of surgical operation due to breast cancer. Samples collected from these patients and those obtained from patients who want to know the prognosis By obtaining and comparing gene expression levels or expression patterns, it is possible to accurately predict the prognosis of a patient to know the prognosis.

According to one embodiment of the present invention, the expression level or expression pattern of a marker gene is measured from a plurality of breast cancer patients, the measured value is databaseed with the prognosis of these patients, and the expression level Or an expression pattern may be input to the database to predict a prognosis. In this case, known algorithms and statistical analysis programs for comparing the expression levels or expression patterns can be used. Further, the database may be further subdivided into pathologic stage, treated therapy, and the like.

In the method for predicting the prognosis of breast cancer according to the present invention, the expression level of the biomarker gene may be measured at an mRNA level or a protein level, and the mRNA or protein may be separated from the biological sample using a known process can do. The analysis method for measuring the mRNA level and the assay method for measuring the protein level are as described above.

Through the above-described analysis methods, it is possible to compare the expression amount of breast cancer biomarker gene measured from a sample of a breast cancer patient whose prognosis is known, and the expression amount of a breast cancer biomarker gene measured from a sample of a patient to know the prognosis, And the prognosis of breast cancer can be predicted. That is, as a result of comparing the expression levels, it can be judged that a sample of a patient to know a prognosis shows a similar prognosis or a pattern of expression similar to that of a sample of a patient whose prognosis is known. On the contrary, It may be judged that it will have a poor prognosis if it exhibits a similar expression level or expression pattern as a sample of a known patient.

Therefore, according to the present invention, the prognosis of breast cancer can be accurately predicted, and an appropriate treatment plan can be established according to the predicted prognosis. For example, patients who are determined to have a good prognosis can be determined to seek standard therapy or less invasive treatment options, and patients who are deemed to have a poor prognosis are eligible for upper stage staging for gastric cancer patients You can decide to pursue a treatment method or very aggressive or experimental treatment.

The present invention also relates to a method of treating cancer, comprising the steps of: a) treating a candidate substance in a biological sample separated from a breast cancer patient; b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And c) judging the candidate substance as a substance for the prophylaxis or treatment of breast cancer when the mRNA or the protein expression level thereof in step b) is lower than that before the treatment with the candidate substance; A screening system for preventing or treating breast cancer.

The present invention also relates to a substance which inhibits the expression or activity of a protein encoded by the biomarker of the present invention; And a pharmaceutically acceptable carrier. The present invention also provides a pharmaceutical composition for preventing or treating breast cancer.

In one embodiment of the present invention, siRNAs were treated with ZNF224-transfected MCF-7 cell lines in order to confirm the therapeutic potential of breast cancer patients using siRNA of the biomarker gene selected in the present invention. Is the same as; 5'-CUC AAG ACU UGG UGA UAA ATT-3 ', 5'-CGA UGU GAU ACG UGU GAU ATT-3', 5'-GGA AAG GGC UAC AAU AGU ATT-3 '(Santa Cruz Biotechnology).

The siRNA was used to knock-down the ZNF224 gene, and cell viability was measured. As a result, an excellent cell killing effect of siRNA of ZNF224 gene was observed in the cell line transfected with ZNF224 as compared to the control group (Fig. 1C). Thus, it can be confirmed that the treatment targeted to the selected biomarker gene of the present invention is actually effective in patients with breast cancer, and it can be confirmed that the ZNF224 biomarker gene of the present invention is useful for treating breast cancer patients.

The substance that inhibits the expression of the protein encoded by the biomarker is not particularly limited, but may be an antisense oligonucleotide, an aptamer, an siRNA, or a shRNA for the biomarker gene. have.

The present invention also provides a method of treating cancer, comprising the steps of: a) treating a candidate sample from a breast cancer patient; And b) confirming that the candidate substance inhibits the binding of the base sequence including ZNF224 and CAGC in the sample of the breast cancer patient treated with the cancer substance.

In one embodiment of the present invention, it was confirmed that the ZNF224 binds to the promoter of miR-663a to increase the transcription level of miR-663a in a concentration-dependent manner, and specifically to the promoter of miR-663a The binding site that binds is 5'-CAGC-3 ', which can be confirmed by the increased transcription level of miR-663a. In one embodiment of the invention, ZNF224 was identified through ChIp-sequencing to bind specifically to the promoter of miR-663a, and ZNF224 was introduced into the promoter containing the sequence when compared to the control or mutant oligo DNAs Was found to have a higher binding affinity.

The anticancer drug screening method may further comprise the step of c) selecting a candidate drug having decreased miR-663a expression level as compared with the control sample.

The above step c) can be confirmed by measuring the transcription level of miR-663a expressing the degree of binding of ZNF and miR-663a in comparison with the control sample, and the measurement of the transcription level (RT-PCR), competitive RT-PCR, real-time RT-PCR, quantitative RT-PCR, RNase protection method, Northern blotting, or DNA chip technology, but are not limited thereto.

The term "siRNA (small interfering RNA) " of the present invention means a small nucleic acid molecule of about 20 nucleotides in size that can mediate RNA interference or gene silencing. When siRNA is introduced into a cell, dicer protein and degrades the biomarker gene, thereby inhibiting gene expression. Such siRNA may be prepared by a direct chemical synthesis of known siRNAs (Sui G et al., (2002) Proc Natl Acad Sci USA 99: 5515-5520), a synthetic method of siRNA using transcription in laboratory conditions (Brummelkamp TR et al., 2002 ) Science 296: 550-553), but the present invention is not particularly limited thereto.

The term "shRNA (short hairpin RNA)" of the present invention means a short hairpin RNA having a sense and antisense sequence of siRNA target sequence located between loops composed of 5-9 bases . The shRNA is used to overcome the disadvantages of high cost biosynthesis cost of siRNA, short time maintenance of RNA interference effect due to low cell transfection efficiency, and use of adenovirus, lentivirus and plasmid expression vector system from RNA polymerase III promoter The shRNA can be used to induce silencing of the target gene by converting it into an siRNA having the correct structure by the siRNA processing enzyme (Dicer or Rnase III) present in the cell.

The term "aptamer " of the present invention refers to a small RNA fragment, which means an oligomer molecule having a size of about 20 to 60 nt. Depending on the sequence, it may have various three- It can have a high affinity and can be effectively inhibited by reacting with a target sequence of interest.

The term "antisense" of the present invention is also referred to as an antisense oligomer, and includes a sequence of a nucleotide base capable of hybridizing with a target sequence in RNA by Watson-Crick base pair formation to form mRNA and RNA: oligomer heterodimers in the target sequence, Means an oligomer having a backbone between subunits. The antisense can have an exact sequence complement or approximate complement to the target sequence, block or inhibit the translation of the mRNA, and alter the processing of the mRNA producing splice variants of the mRNA. Thus, the antisense of the present invention may preferably be an antisense oligomer complementary to the polynucleotide of the biomarker gene of the present invention. The antisense can be used in a manner that prevents or suppresses the expression of a carcinogen gene by administration to a subject in a conventional manner. For example, a method of mixing an antisense oligodeoxynucleotide with a poly-L-lysine derivative by electrostatic attraction and administering the mixture to a vein of a subject (JS Kim et al., J controlled Release 53, 175-182 , 1998) may be used but are not particularly limited thereto.

In addition, the substance that inhibits the expression of the protein encoded by the biomarker may be an antibody that inhibits the activity of the protein, an antigen-binding fragment thereof, or the like. The antibody may be any antibody capable of specifically binding to a protein encoded by the biomarker of the present invention, preferably a monoclonal antibody, a chimeric antibody, A humanized antibody, a human antibody, and the like, as well as functional fragments of the antibody. In addition, the antibody may be a complete form having the full length of two heavy chains and two light chains, as long as it has the property of binding specifically recognizing the protein encoded by the biomarker of the present invention But includes functional fragments of the antibody molecule. The functional fragment of the molecule of the antibody refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

The pharmaceutical composition provided in the present invention may further comprise a therapeutic agent exhibiting cancer therapeutic activity, in addition to an oligonucleotide or an antibody that inhibits protein expression or activity that is encoded by the biomarker used as an active ingredient. At this time, the known therapeutic agent is not particularly limited, but may preferably be a radionuclide, a drug, a lymphocaine, a reading, a bispecific antibody, or the like.

Meanwhile, the composition of the present invention may further comprise a pharmaceutically acceptable carrier, excipient or diluent depending on the administration mode. Specifically, it is possible to use a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and any of the above components, And other additives conventionally used, such as buffers. In addition, depending on the purpose of administration, diluents, dispersants, surfactants, binders, and lubricants can be added to formulate into injectable formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, granules or tablets, A target organ or tissue specific antibody or other ligand can be used in combination with the carrier. The carrier, excipient, or additive may be any conventional formulation, and the carrier, excipient, or additive is not limited by the above examples.

Such a composition or mixture may be appropriately administered to a subject according to the purpose or necessity, depending on the conventional methods used in the art, the route of administration, and the dosage. Examples of routes of administration may be oral, non-oral, subcutaneous, intraperitoneal, intrapulmonary, and intranasal, and for localized immunosuppressive treatment, by a suitable method including, if necessary, intralesional administration. Non-oral injections include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. Appropriate dosages and times of administration may be selected according to methods known in the art, and the amount and the number of administrations of the composition comprising the antisense oligonucleotide, siRNA or shRNA of the present invention to be actually administered will depend on the symptom The route of administration, sex, state of health, diet, age and weight of the individual, and severity of the disease.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

Example

Example  1. Cell culture

Human embryonic kidney cell line (HEK293) and human adenoma breast cancer cell line (MCF-7) cells were cultured in a humidified 5% CO ₂ incubator at 37 ° C in a 10% fetal bovine serum (FBS, Hyclone), 1% penicillin / streptomycin (Hyclone, Utah, USA) supplemented with Dulbecco's modified Eagle's medium (DMEM, Hyclone, Utah, USA). For transfection, plasmid DNA constructs were transfected into cells by polyethylenimine (PEI, Polysciences, Inc., PA, USA) according to the manufacturer's protocol. To obtain an overexpressed ZNF224 stable clone, the present inventors used MCF-7 cells as a &lt; RTI ID = 0.0 &gt; Were transfected with the CMV 3XFlag-ZNF224 G418-selectable plasmid provided by Paola 10 Costanzo (University of Naples Federico II, Italy). Transfected cells were grown in medium supplemented with 80 μg / ml G418 (Duchefa, Haarlem, Netherlands). MCF-7 cells stably overexpressing CMV 3xFLAG-ZNF224 were measured by Western blot using anti-FLAG M2 antibody (Sigma Aldrich, MO, USA). To generate the ZNF224 knock-down stable cell line, we transfected MCF-7 cells with the ZNF224 shRNA plasmid (Santa Cruz Biotechnology, CA, USA). The transfected cells were grown in media containing 10 μg / ml puromycin (Sigma Aldrich, MO, USA). The stable knock-down of the ZNF224 was confirmed by Western blot and quantitative RT-PCR. As shown in FIG. 1, it was confirmed that the number of colonies of MCF-7 cells transfected with ZNF224 was more than twice as much as that of MCF-7 cells transduced with EV (FIG. 1C), and ZNF224 knock- down) was about 1/3 times smaller than that of the control group (Fig. 1C).

Example  2. RNAi study

MCF-7 cells were cultured in 20 nM ZNF224 siRNA mixture (# 1 5'-CUC AAG ACU UGG UGA UAA ATT-3 ', # 2 5' '- CGA UGU GAU ACG UGU GAU ATT- (Invitrogen, Paisley, UK) in accordance with the manufacturer's protocol for 47 hours or 72 hours, respectively, according to the protocol of the manufacturer. , And transfected with 50 nM miR-663a antagonist (Bioneer, Korea).

Example  3. Western Blat ( Western blot )

For immunoblot, cells were lysed with lysis buffer (50 mM Tris-HCl, pH 7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3) Lt; / RTI &gt; All cell lysates (30 μg) were performed by SDS-PAGE and transferred to a polyvinyldene fluoride membrane (PVDF, Millipore, MA, USA). The membrane was incubated with anti-p21 (1: 1,000, Santa Cruz Biotechnology, CA, USA), ZNF224 specific antibody (1: 1000, Abcam, Cambridge, UK), M2 anti-FLAG (1: 3,000, Sigma Aldrich, ), anti-p53 (1: 1,000, Santa Cruz Biotechnology, CA, USA), anti-PARP1 (1: 1,000, Santa Cruz Biotechnology, CA) and anti-alpha-tubulin antibody Followed by blocking with TBS (20 mM Tris-HCl, pH 7.4, 150 mM NaCl) containing 5% skim milk and 0.2% Tween-20 for 1 hour. The second antibodies were anti-mouse IgG HRP (1: 25,000, Thermo Scientific, MA, USA) or anti-rabbit IgG HRP (1: 30,000, Thermo Scientific, MA, USA). The membranes were developed using an enhanced chlmiluminescence (ECL) solution (Abclon, Korea).

Example  4. Cell growth and drug resistance analysis

To analyze cell growth and drug resistance, 8-E plates (ACEA, CA, USA) were inoculated into each of the stable clones (5 × 104 cells) and cultured in a humidified 5% CO ₂ incubator. After 10 hours, the cells were treated with DMSO or 0.1 [mu] M CPT and further cultured for 24 hours. During cell culture, cell growth was monitored in real time using an iCelligence system (ACEA, CA, USA). As a result, as shown in FIG. 2A, it was confirmed that the ZNF224 overexpressing cell line showed a significant difference in cell survival resistance to CPT as compared with the control (EV).

Example  5. Flow cell  analysis( Flow cytometry )

Cell death by CPT was measured by flow cytometry. Cells (2.5 x 10 6) were inoculated into 100 mm dish and cultured for 24 hours. DMSO or CPT (0.1 [mu] M) was then added to each group of cells. After 24 hours, the cells were harvested and fixed with cold 70% ethanol for 16 hours. After rehydration with 1 × cold PBS, cells were treated with RNaseA (50 μg / ml, Roche, Mannheim, Germany) and propidium iodide (100 μg / ml, Sigma Aldrich, MO, USA). The DNA contents were measured by flow cytometry (CUBE6, PARTEC, Germany).

Example  6. Chromatin immune response  Analysis and sequencing ( Chromatin immunoprecipitation  assay and sequencing )

HEK293 cells were transfected with the CMV 3xFLAG-ZNF224 plasmid (6 μg). Chromatin immunoprecipitation was performed as previously described. Briefly, the cells were crosslinked with 1% formaldehyde for 10 min at room temperature. The cell plate was incubated with 200 ul of sonication buffer (50 mM HEPES, pH 7.9, 140 mM NaCl, 1 mM EDTA, 0.1% Na-deoxycholate, 0.1% SDS, 1% Triton X-100 and PIC). The cell lysate was sonicated for 70 sec (10 sec stop and 60 sec rest) and the DNA length was shared between 200 and 1,000 bp. FLAG antibody (Sigma Aldrich, MO, USA) or normal mouse IgG antibody (Santa Cruz Biotechnology, USA) following immunoprecipitation using Protein A and G agarose bead mixture (Invitrogen, Paisley, UK) , CA, USA). The protein-DNA complex was separated from the beads by elution buffer (50 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1% SDS, 50 mM NaHCO 3) Gt; protease &lt; / RTI &gt; K. Finally, the DNA was purified with PCR Clean-up Kit (Promega, Wis., USA). ChIPed DNA was also processed to prepare some modifications and sequencing libraries. DNA fragments were end-repaired, dA-tailed and ligation with Genomic DNA Adapters from Illumina. Adapter-ligated DNA fragments were purified and amplified with 20 cycles of PCR. Gel extraction was performed to isolate 200-400 bp of the PCR product. Libraries were sequenced by the Illumina Genome Analyzer IIx. Alignment of sequences reads was performed using Illumina's CASAVA pipeline (v1.8.2). For further analysis, we used a unique alignment tag that allows for 2 mismatches. Raw sequencing reads were performed using the FASTQC tool. The reads were sorted into the human genome build hg18 using the default parameter CASAVA v1.6.0. The total number of ZNF224 mapping tags was 4,090,000. The sequencing data was deposited with the Gene Expression Omnibus (GEO) of the National Center for Biotechnical Information (NCBI) (GSE73947). In order to confirm the rich peak of FLAG-ZNF224, MACS (Model-based Analysis for ChIP-Seq) ver. 1.4.0 the following options were used; tsize = 36 --pvalue = 1e-4 - mfold = 30 --bw = 100. Also, HOMER (Hypergeometric Optimization of Motif Enrichment) ver. 4.1 The following options were used; -frag Length 200 -gsize 2700000000 -center. Annotating peaks of the genome were performed with HOMER. Histograms were generated by calculating read densities around individual transcription start sites (TSS) of 50 bps each. DAVID was used to investigate gene-rich Gene Ontology terms, including all peaks within 1 kb in its TSSs. HOMER performed the peak motif discovery. Using HOMER, we identified 10,185 peaks of ZNF224 in HEK293 and there was a tendency for ZNF224 rich regions within the surrounding cluster to be within 1 kb of the 5 'gene boundary of the transcriptional start site (TSS) (Fig. 8A).

Genetic information including near the Znf224 rich region (1 < kb) is shown in Figs. 9 to 17. Also, as shown in FIG. 8B, the ZNF224 signal occupies about 12% of the total peak of HEK293 in the promoter including 1 kb upstream and downstream of the TSS. To determine the DNA consensus sequence recognized by ZNF224, 13,561 peaks identified by the MACS program were analyzed using HOMER and further processed using Structural Time Series Analyzer, Modeller and Predictor (STAMP). As a result, the present inventors have found a putative motif comprising sequence 5'-CAGC-3 'as shown in FIG. 3A.

Example  7. From HEK293 ZNF224  refine

HEK293 cells were transfected with the CMV 3xFLAG-ZNF224 plasmid. After 36 hours, the protein extract was washed with lysis buffer (50 mM Tris-HCl, pH7.6, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 10 mM NaF, 0.1 mM NaVO3) &Lt; / RTI &gt; The protein extract (10 mg) was incubated with anti-FLAG M2 magnetic bead (Sigma Aldrich, MO, USA) at 4 ° C. The precipitated bead-protein complex was washed with 1 × cold PBS containing 1 mM PMSF and eluted with elution buffer (0.1 M glycin, pH 2.5). After purification, FLAG-ZNF224 proteins were dialyzed against 1x PBS and stored at -70 ° C. As a result, it was confirmed that the purified FLAG-ZNF224 was about 100 kDa in size. As shown in Figure 3C, the sequence containing 5'-CAGC-3 'showed a higher binding affinity than the control or mutant oligo DNAs.

Example  8. Enzyme immunoassay ( enzyme - linked  immunosorbent assay , ELISA)

To determine the DNA consensus sequence recognized by ZNF224, streptavidin-coded plates (Thermo Scientific, MA, USA) were washed with wash buffer (25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.1% BSA, 0.05% Tween -20), and then 100 μl of 5'-biotinylated oligo DNA (5 μM) was added to each well. 50 ng of purified FLAG-ZNF224 proteins in 1X PBS containing 20% glycerol were added to each well, incubated for 2 hours at RT, and the plate was washed three times with wash buffer. Anti-FLAG antibody (1 μg / ml) diluted in wash buffer was added to each well (100 μl / well) and further incubated at RT for 2 hours. After washing, the horseradish peroxidate (HRP) -conjugated goat antimouse IgG (1: 5,000) diluted in 25 mM Tris-HCl, pH 7.6, 150 mM NaCl, 0.5% BSA and 0.05% Tween- And incubated for another 30 min. After washing the plate with washing buffer, 3,3 ', 5,5'-tetramethylbenzidine solution was added for 15 minutes. The signal was measured at 450 nm (BMG Labtech, Ortenberg, Germay).

Example  9. Luciferase activity assay ( Luciferase activity assay )

(200 ng) and FLAG-ZNF224 (200 ng) containing a triple repeat of the CAGCTTC sequence of the Renilla vector (100 ng) were inoculated into 12-well plates of MCF-7 cells Lt; / RTI &gt; for 24 hours. To investigate the effects of ZNF224 and miR-663a, MCF-7 cells were transfected with 200 ng pNACHECK ™ vectors (200 ng) containing p21 3 'UTR or p53 3' UTR with 200 ng of FLAG-ZNF224 ) Or miR-663a for 24 h (20 nM) (Fig. 5A). Cells were then treated with miR-663a inhibitor (50 nM, Bioneer, Korea) for 48 h. Luciferase activity was measured by Dual-Luciferase Reporter Assay System (Promega, Wis., USA) and quantified using GloMax® (Promega, WI, USA) according to the manufacturer's instructions. As a result, as shown in FIG. 5B, it was confirmed that miR-663a decreased the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type, but the p53-3 'UTR mutant and p21-3 'UTR-mutant. In addition, miR-663a antagonist inhibited the decrease of luciferase activity by miR-663a. In addition, ZNF224 decreased the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type in a dose-dependent manner and p53-3 'UTR mutant and p21-3' UTR mutant 5C). &Lt; / RTI &gt; The confirmation of reduced luciferase activity of p53-3 'UTR and p21-3' UTR was mediated by miR-663a through ZNF224. We tested the luciferase activity after transfection of ZNF224 and miR-663a antagonist. Overexpression of ZNF224 significantly reduced the luciferase activity of p53-3 'UTR-wild type and p21-3' UTR-wild type, but decreased p53-3 'UTR mutant and p21-3' UTR mutant (Fig. 5D). In addition, this suggests that ZNF224 can down-regulate p53 and p21 expression by increasing miR-663a transcription, and miR-663a antagonist significantly inhibits the decrease of luciferase activity by ZNF224.

Example  10. Surface Plasmon  Resonance analysis Surface plasmon resonance  ( SPR ) 분석 )

To confirm the binding of oligo DNA to ZNF224, SPR analysis was performed. Surface plasmon resonance (SPR) analysis was performed using SR7500DC (Reichert, NY, USA). FLAG-ZNF224 proteins (50 μg) were fixed with CMDH chips (Reichert, NY, USA) according to the manufacturer's protocol. Oligo DNA (0, 0.625 μM, 1.25 μM, 2.5 μM, 5.0 μM, and 10 μM) was passed through the assay in 1 × PBS. K _D values were measured using Scrubber2 software. Mutant sequence-containing oligo DNA showed no binding affinity, whereas the quantification of the binding affinity of oligo DNA and ZNF224 containing 5'-CAGC-3 'showed that ZNF224 inhibited CAGCTTC (KD = 1.25 ± 0.06 × 10 -6 M ), CAGCGTC (KD = 2.0 ± 0.1 × 10 -6 M), and GCAGCAA (KD = 0.42 ± 0.03 × 10 -6 M). To determine whether oligo DNA containing 5'-CAGC-3 'could function as a promoter, we constructed a luciferase vector containing a 5'-CAGCGTC-3''sequence in a representative promoter. As shown in Figure 3D, ZNF224 confirms an increase in luciferase activity in a dose-dependent manner, confirming a DNA sequence containing 5'-CAGC-3 '' functioning as a DNA consensus sequence recognizing ZNF224 in the promoter I could.

Example  11. Quantitative Polymerization chain reaction ( Quantitative  RT- PCR )

To analyze gene expression, total RNA was extracted using TRIzol reagent (Invitrogen, Paisley, UK) according to the manufacturer's protocol. CDNA was prepared by reverse transcription of 500 ng of total RNA, and each gene transcript was amplified by specific primers and PCR, and the primers used were shown in Table 1 below. Quantitative RT-PCR was performed using Power SYBR Green PCR Master Mix® (ABI, CA, USA) and StepOne 48 well real time PCR system (ABI, CA, USA). In order to confirm the results of ChIP sequencing, Re-ChIP was performed and ChIPed DNA was amplified by specific primers and PCR, and used primers were shown in Table 2 below. Each Ct value is normalized to an input sample [Delta] Ct [Ct (IP) - Ct (Input)]. ChIP signals were calculated as the input 2 ^{- [Com Ct]} times. Each ChIP assay was repeated at least 3 times.

primer Base sequence GAPDH F: 5'-CGAGATCCCTCCAAAATCAA-3 '
R: 5'-TGTGGTCATGAGTCCTTCCA-3 ' GAPDH F: 5'-GGGTGTGAACCATGAGAAGTATG-3 '
R: 5'-GTCCTTCCACGATACCAAAGTTG-3 ' ZNF224 F: 5'-CAGAGAGTCCACATGGGAGAG-3 '
R: 5'-CCCGTGTGGACCATATGATGC-3 ' ZNF224 F: 5'-CACCAGAAGGTCCACACAGG-3 '
R: 5'-CCCAGCCAAAACTCTTCCCA-3 ' P21 F: 5'-GCAGACCAGCATGACAGATTT-3 '
R: 5'-GGATTAGGGCTTCCTCTTGGA-3 ' P53 F: 5'-CCCAAGCAATGGATGATTTGA-3 '
R: 5'-GGCATTCTGGGAGCTTCATCT-3 ' U6 F: 5'-GCTTCGGCAGCACATATACTAAA-3 '
R: 5'-CGCTTCACGAATTTGCGTGTCAT-3 ' miR-663a F: 5'-AGCCGCGTCCCAACCCGCTAG-3 '
R: 5'-CTCGCTTGCAGAGGAACCCTC-3 '

primer Base sequence LOC284801 F: 5'-AGATTTTCTGCCTTGGCACC-3 '
R: 5'-TGGACTCTCTCAGGTTGAACG-3 ' miR-663a F: 5'- GCCGCGTCCCAACCCGCTAG -3 '
R: 5'-ACTCGCTTGCAGAGGAACAC-3 ' ROCK1P1 F: 5'-GCACTGGAAAACCGATCGTC-3 '
R: 5'-TTCATCAGTGCGGCTTTCAA-3 ' SCML1 F: 5'-CCACAGAGGTAGGATGAGCC-3 '
R: 5'-ACGGAGAACTTCCCTGTATGG-3 ' PPP1R15B F: 5'-AGGGAGCACATTTACAGGATGG-3 '
R: 5'-CAACCGACATTGCTGTTGCT-3 ' ZDHHC14 F: 5'-GTAAACGTCCGTGGGGAGAA-3 '
R: 5'-TCAGGGTCCCCTCCGGCCCCG-3 ' miR-3621 F: 5'-AGCGAGAGTGCCGAGCAGC-3 '
R: 5'-CTGCTGTTGCTGCTGCTGTCG-3 ' miR-663a F: 5'-CTTCCGGCGTCCCAGG-3 '
R: 5'-CGGGCCACCAGGAAAACA-3 ' P21 F: 5'-CAGGCTGGTCTCAAAACTCCT-3 '
R: 5'-GATGTGAGGAAGGCTCAGTGG-3 ' P53 F: 5'-CATCAAGCCCTAGGGCTCCTC-3 '
R: 5'-ATGGAGTTGGGGAGGAGGGTA-3 '

Example  12. Immunohistochemical staining ( Immunohistochemical staining )

Written consent was obtained from breast cancer patients and this study was approved by the clinical review committee of Yonsei University Severance Hospital (4-2015-0168). The specimen was ductal carcinoma between stages 1 and 2. Immunohistochemical staining was performed as described above. Sections (5 um) were stained with anti-p53 and anti-ZNF224 antibodies diluted 1/50 at RT for 1 hour. Dyeing was detected by UltraView universal DAB detection kit (Ventana, AZ, USA) according to the manufacturer's instructions. Nuclei were compared with Mayer's haematoxylin (Dako, Glostrup, Denmark). H & E and immunohistochemical staining showed that ZNF224 expression levels were increased in the dark area (15 out of 18) compared to non-cancerous areas (FIGS. 7A and 7B), whereas ZNF224 mRNA expression increased only 8 out of 18 (Fig. 7C). In addition, miR-663a transcript levels increased by 7 out of 14 and p21 mRNA was not detected, while p53 mRNA levels decreased by 8 out of 16 cases (FIGS. 7D and 7E). Of the tested tissues, three (16.6%) showed increased levels of ZNF224 transcript, increased miR-663a RNA (rs = -0.4862, p = 0.0389) and reduced p53 mRNA (rs = -0.3446, p = 0.046) .

Example  13. P21 and p53 tanscript  And protein levels

We tested whether ZNF224 could reduce the transcript and protein levels of p53 and p21 through miR-663a. miR-663a transfection effectively reduced the transcript level as well as the protein level of p21 and p53 (Figs. 6A and 6B). In addition, miR-663a showed that miR-663a antagonist reduced the expression of p21 and p53, while increased the possibility of colonization of MCF-7 cells (Fig. 6C) and increased colony formation was induced by miR-663a (Figs. 6A to 6C). Since reduced expression levels of p21 and p53 lead to apoptosis resistance, cell growth and apoptosis were analyzed following treatment with CPT. In contrast to the transfection of the miR-663a antagonist, miR-663a transfection increased cell growth of MCF-7 cells and induced apoptosis by CPT (Fig. 6D). In addition, transfection of ZNF224 also confirmed that the mRNA levels of p21 and p53 as well as their protein levels were reduced. And transcript levels of miR-663a increased. On the other hand, the miR-663a antagonist inhibited the effect of ZNF224 (Fig. 6E and 6F), suggesting that the reduced fuming of p21 and p53 by ZNF224 is mediated by miR-663a. In addition, the ability of ZNF224-induced colony formation and cell growth was inhibited by transfection of miR-663a antagonist. In addition, the miR-663a antagonist inhibited enhanced cell growth induced by ZNF224 overexpression, leading to susceptibility to apoptosis resistance (FIG. 6H). SiRNA transfection of ZNF224 increased transcript levels of p21 and p53, but not miR-663a transcription level (Fig. 6I). Western blot analysis showed that ZNF224 knock-down using si-RNA increased the expression level of p53, but not p21 (Fig. 6J).

Example  14. Statistical analysis

The results are expressed as mean ± SD or mean ± SEM. The student's t test was performed to determine the statistical significance of all performance test groups and P <0.05 was considered statistically significant.

Claims (15)

Biomarkers for prediction of prognosis of breast cancer including ZNF224 gene.
A composition for predicting breast cancer prognosis, comprising an agent for measuring an expression level of mRNA or protein of the biomarker of claim 1.
[Claim 3] The composition for predicting breast cancer according to claim 2, wherein the agent for measuring the expression level of the mRNA comprises a primer base sequence that specifically binds to the biomarker.
3. The composition for predicting breast cancer according to claim 2, wherein the binding site to which the biomarker specifically binds is 5'-CAGC-3 '.
A kit for predicting breast cancer prognosis, comprising an agent for measuring an expression level of mRNA or protein of a biomarker according to any one of claims 2 to 4.
6. The kit for predicting breast cancer prognosis according to claim 5, wherein the kit is an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a quantitative RT-PCR kit, a DNA chip kit or a protein chip kit.
a) obtaining a mRNA or protein expression level or expression pattern of the biomarker of claim 1 from a biological sample isolated from a breast cancer patient; And
b) comparing the expression level or expression pattern obtained in step a) with the mRNA or protein expression level or expression pattern of the gene of interest in a breast cancer patient whose prognosis is known.
The method according to claim 7, wherein the mRNA level is measured by RT-PCR, competitive RT-PCR, real-time quantitative RT-PCR ), Quantitative RT-PCR, RNase protection method, northern blotting, or DNA chip technology, for the prediction of prognosis of breast cancer .
The method according to claim 7, wherein the level of the protein is measured by Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radical immunodiffusion, Immunohistochemical staining, immunoprecipitation assay, complenent fixation assay, immunofluorescence, immunofluorescence, immunohistochemistry, immunohistochemistry, immunohistochemistry, immunohistochemical staining, immunohistochemical staining, Wherein the method is immunochromatography, fluorescence activated cell sorter analysis, or protein chip technology.
a) treating the candidate material from the breast cancer patient sample;
b) measuring the mRNA or protein expression level of the biomarker according to claim 1 in a sample of a breast cancer patient treated with the candidate substance; And
c) judging the candidate substance as a substance for prevention or treatment of breast cancer when the mRNA or protein expression level of step b) is lower than that of the candidate substance before treatment; Wherein the mammal is a mammal.
a) treating the candidate material from the breast cancer patient sample; And
b) confirming that the candidate substance inhibits the binding of the base sequence comprising ZNF224 and CAGC in a sample of breast cancer patients treated; Wherein the method comprises the steps of:
12. The method according to claim 11, wherein the anticancer agent screening method further comprises the step of: c) selecting a candidate drug having a decreased expression level of miR-663a as compared with a control sample.
A substance that inhibits protein expression or activity that is encoded by the biomarker of claim 1; &Lt; / RTI &gt; and a pharmaceutically acceptable carrier.
14. The pharmaceutical composition according to claim 13, wherein the substance is an antisense oligonucleotide, an aptamer, siRNA or shRNA for a biomarker.
14. The pharmaceutical composition according to claim 13, wherein the substance is an antibody or an antigen-binding fragment thereof that inhibits the protein activity of the biomarker.

Images