KR20180020814A - Expression system for amylosucrase and production for turanose using the same - Google Patents

Abstract

The present invention relates to a gene expression system capable of producing amylosucrase in high expression rate, a generally recognized as safe (GRAS) microbe using the same, and a method for producing turanose using the transformed GRAS microbe or the obtained enzyme.

Description

Expression system for amylose sucrose enzyme and production of turanose using the expression system for amylose sucrose enzyme.

The present invention relates to an expression system capable of producing an amylose sucrose enzyme with high expression rate and stability, a GRAS (Generally Known as safe) microorganism using the same, and a method for producing turanose containing microorganisms and enzymes using the expression system will be.

A variety of biosynthetic products are produced in cells by natural processes and are used in a number of industries, including food, feed, cosmetics, food, food and pharmaceutical industries. These are most conveniently produced on a large scale by the growth of bacterial strains or other microorganisms that have been developed to produce and secrete large amounts of the specific substances required in each case. Corynebacterium glutamicum, which efficiently produces glutamic acid in the mid-1950s, has been found and industrialization has been made, and Corynebacterium glutamicum The amino acid is produced industrially through the fermentation process using the mutant strain of the nutrient requirement.

To engineer cells, it is necessary to control the degree of expression of various related genes, and this regulation of gene expression requires various efficient expression systems. Various components of the regulatory sequences of the cells are known to those skilled in the art. These include a binding site for a regulator, also referred to as an operator, a binding site for RNA polymerase proenzyme, referred to as the -35 and -10 domains, and a ribosome binding site or Shine-Dalgarno ) ≪ / RTI > sequence.

The selection of the promoter is most important for the development of the expression system because the promoter is involved in the degree of expression and regulation of the gene. Several promoters available in Corynebacterium glutamicum have been reported, mainly promoters derived from Corynebacterium or E. coli (J. Biotechnol., 104: 311-323, 2003).

However, the promoter derived from Escherichia coli exhibits relatively low activity in Corynebacterium because of low permeability of expression inducing factors and absence of gene expression inhibiting substance. Also, even with the same promoter, the expression efficiency varies depending on the gene encoding the target protein, and since the selectivity of the promoters usable in Corynebacterium is also small, it is not easy to produce an expression system suitable for the purpose. In particular, when the expression of various genes such as the establishment of a metabolic pathway is regulated together, it is a reality that Corynebacterium can not make various choices as in Escherichia coli.

Turanos is a reductant disaccharide that occurs naturally in bees. It has a sweet taste equivalent to about half of sucrose sweetness. It is an analogue of sucrose and has the chemical structure of 3-0-α-glucopyranyl-D-fructose. Turanose can be used as a calorie-free sweetener because it is not fermented by dental caries-inducing microorganisms and thus can play an important role in the food, cosmetic and pharmaceutical industries.

Thus, although Turanos can be useful in many industries, it belongs to rare groups rarely found in nature, so it is necessary to develop technologies that efficiently produce Turanos in large quantities for various industrial applications. In the conventional method for producing turanose, a method for producing turanose by an enzymatic method is known rather than chemical synthesis. In Korean Patent No. 10-177218, using transformed E. coli, Neisseria polysaccharea, Deinococcus geothermalis and Alteromonas macrolide, and macleodii, and then producing turanose from a substrate solution containing sucrose and fructose by using the produced enzyme .

The technology described in Korean Patent No. 10-177218 is expensive and time consuming in the process of purifying enzymes from microorganisms. It is difficult to cultivate Escherichia coli as a strain for industrial use, (GRAS, Generally Recognized As Safe), it is not suitable for use as a strain producing food materials.

Therefore, an expression system for producing a turanose-producing enzyme at a high yield in a GRAS strain, a method for producing an amylose sucrose enzyme using the same, and a method for producing a turanose using the produced enzyme or a transformed GRAS strain It is necessary.

An example of the present invention is to provide a transcriptional promoter capable of producing an amylose sucrose enzyme in a high yield in a GRAS strain.

Another example of the present invention is to provide a gene expression cassette comprising the coding sequence of an amylose sucrose enzyme and a transcriptional promoter for expression of the genus of genus Corynebacterium.

Another example of the present invention is to provide a vector comprising the expression cassette for a strain of genus Corynebacterium comprising the coding sequence of the transcriptional promoter for expression of the genus of genus Corynebacterium and the amylose sucrose enzyme.

Another example of the present invention provides a Corynebacteria genus host cell expressing an amylose sucrose enzyme transformed with the expression cassette or comprising the expression cassette.

Another example of the present invention is a composition comprising an amylose sucrose enzyme obtained by using the strain of genus Corynebacterium, a strain of the strain, a culture of the strain, a lysate of the strain, and an extract of the lysate or the culture Wherein the composition contains at least one selected from the group consisting of:

Another example is an amylose sucrose enzyme obtained by using the Corynebacterium sp. Strain, a strain of the strain, a culture of the strain, a lysate of the strain, and an extract of the lysate or the culture. The present invention provides a method for producing turanose from a fructose-containing raw material, using at least one species.

The present invention relates to an expression system capable of producing an amylose sucrose enzyme at a high expression rate, a method for producing an enzyme using a generically recognized as safe microorganism, a method for producing an enzyme using the transformed GRAS (Generally recognized as safe) microorganism, The present invention relates to a method for producing turanose containing microorganisms and enzymes using an expression system.

Escherichia coli-derived promoters exhibit relatively low activity in Corynebacterium sp. Strain due to low permeability of expression inducing factors and absence of gene expression inhibiting substance. In addition, the promoter derived from Corynebacterium sp. Lt; RTI ID = 0.0 > expression < / RTI >

The present invention provides a promoter capable of stably expressing an amylose sucrose enzyme at a high expression rate in a strain of the genus Corynebacterium and a gene expression cassette comprising the promoter, The sucrose enzyme can be stably produced in a large amount at a high expression rate. In order to mass-produce turanos applicable to foods, the present inventors have found that, in order to express a large amount of amylose sucrose enzyme having stable and high enzyme production activity in a GRAS (Generally recognized as safe) strain, To provide an amylose sucrose enzyme and its coding nucleic acid sequence exhibiting a better expression rate in combination.

The present invention is advantageous in that it can be expressed in a GRAS strain to provide a safe food raw material, and that a long-term reaction can be continuously performed with high reaction stability, which is very advantageous for industrial mass production.

As used herein, the term "promoter", "transcription promoter", "nucleic acid molecule having promoter activity" or "promoter sequence" refers to a nucleic acid that is functionally linked to a target nucleic acid sequence to be transcribed and regulates transcription of the target nucleic acid sequence do.

The nucleic acid sequence to be transcribed does not necessarily need to be directly linked to the promoter in the chemical sense, but may include additional gene control sequences and / or linker nucleic acid sequences. An arrangement in which the target nucleic acid sequence to be transcribed is located at the lower part of the promoter sequence (that is, at the 3 'end of the promoter sequence) is preferable. The distance between the promoter sequence and the nucleic acid sequence to be transcribed is preferably less than 200 bases, particularly preferably less than 100 bases.

The sequence of a "ribosomal binding site" (RBS) (also referred to as a Shine-Dalgano sequence) according to the present invention refers to an A / G-rich polynucleotide sequence.

As used herein, the term "regulatory sequence" refers to a nucleic acid that contains a promoter and is operatively linked to a nucleic acid sequence or gene to be expressed, and then has the expression activity of regulating expression of the nucleic acid or gene, i.e., transcription and translation. Thus, in this regard, the nucleic acid sequence is also referred to as a "regulatory nucleic acid sequence ".

"Expression cassette" means a regulatory sequence operatively linked to a nucleic acid sequence to be expressed, for example, a coding nucleic acid sequence of an amylose sucrose enzyme. Thus, unlike an expression unit, an expression cassette includes a nucleic acid sequence that is transcribed and expressed as a protein as a result of transcription and translation, as well as nucleic acid sequences that control transcription and translation.

All nucleic acid molecules according to the present invention are preferably nucleic acid molecules that are non-naturally occurring, in the form of isolated nucleic acid molecules or by synthetic or recombinant methods. An "isolated" nucleic acid molecule is removed from other nucleic acid molecules present in the natural source of the nucleic acid, and further, when produced by recombinant techniques, essentially no other cellular material or culture medium is present or chemically synthesized There may be no chemical precursors or other chemicals present.

An example of the present invention relates to a nucleic acid molecule of a transcriptional promoter for expression of a strain of genus Corynebacterium, which enables the production of an amylosucrase enzyme in a GRAS strain at a high yield.

Another embodiment of the present invention is directed to a nucleic acid sequence encoding an amylose sucrose enzyme and a nucleic acid sequence operably linked upstream thereof and regulating the expression of the amylose sucrose enzyme in a strain of the genus Corynebacterium A gene expression cassette expressing an amylose sucrose enzyme in a strain of the genus Corynebacterium which contains a regulatory sequence. The regulatory sequence according to the present invention comprises a transcriptional promoter that expresses a nucleic acid sequence encoding an amylose sucrose enzyme in a GRAS strain, for example, a Corynebacterium sp. Strain. In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding an amylose sucrose enzyme in a Corynebacterium sp. Strain, but may be an s1, t2, t1, or h1 promoter. The s1 promoter is derived from Corynebacterium glutamicum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The t2 promoter is derived from Corynebacterium glutamicum. The t1 promoter was an Escherichia coli-derived promoter, which was produced by a combination of trp promoter and lac UV5 promoter. The h1 promoter is derived from Corynebacterium glutamicum.

Examples of the transcription promoter according to the present invention include a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: And a nucleic acid molecule including a nucleic acid sequence.

The regulatory sequence may further comprise at least one nucleic acid molecule selected from the group consisting of a ribosome binding site and a spacer. In addition to the transcriptional promoter in the regulatory sequence according to the present invention, the expression of the transuranosyltransferase may be enhanced by further including at least one member selected from the group consisting of RBS, spacer sequences and linker sequences. For example, the regulatory sequences according to the present invention may be composed of the following combinations, but are not limited thereto.

(1) those containing a promoter nucleic acid sequence,

(2) comprises a first linker sequence linked to the 3'-end of the promoter nucleic acid sequence (e.g., a promoter-first linker)

(3) a promoter comprising at least one ribosome binding region (for example, a promoter-first linker-ribosome binding region or a promoter-ribosome binding region) directly or via a first linker sequence to the 3'-end of the promoter nucleic acid sequence; ,

(4) a promoter comprising a ribosome binding region and a second linker sequence linked directly or through a first linker sequence to the 3'-end of the promoter nucleic acid sequence (e.g., promoter-first linker-ribosome binding region-second linker, Or a promoter-ribosome binding region-second linker),

(5) a promoter comprising a ribosome binding region and a spacer sequence (for example, a promoter-first linker-ribosome binding region-spacer, or a promoter-ribosome binding region- And (6) a ribosome binding region and a spacer sequence both repeatedly or directly linked to the 3'-end of the promoter nucleic acid sequence (for example, a promoter-first linker-ribosome binding region- (Spacer-ribosome binding region-spacer, or promoter-ribosome binding region-spacer-ribosome binding region-spacer), or further comprising a third linker between the spacer sequence and the ribosome binding region repeated two or more times , The promoter-first linker-ribosome binding domain-spacer-third linker sequence-ribosome binding domain-spacer, or promoter-ribosome binding domain-spacer-third linker sequence-ribosome binding domain - spacer).

The ribosome binding region may be chemically connected directly or indirectly through a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding site and the spacer sequence may include one oligonucleotide sequentially connected in the 5 'to 3' direction.

The ribosome binding region, the spacer sequence and the linker sequence may be selected from the group consisting of the same or different sequences in the regulatory sequence one or more times. For example, one selected from the group consisting of a ribosome binding region, a spacer sequence and a linker sequence may contain the same or different sequences repeatedly in the regulatory sequence one or more times, and the additional nucleic acid sequence may be chemically linked directly Lt; / RTI > can be indirectly linked via a linker nucleic acid sequence.

The first linker sequence, the second linker sequence, and the third linker sequence included in the regulatory sequence may be a nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases, A nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 17. The first linker sequence is connected to the 3'-end of the transcriptional promoter of the regulatory sequence and is linked to the 5'-end of the ribosome-binding region, and is a nucleic acid having 1 to 100 bases, for example, 5 to 80 bases And as a specific example, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 10 to SEQ ID NO: 11, and a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 14 to SEQ ID NO: 15 .

In one embodiment of the present invention, the spacer sequence included in the regulatory sequence is a nucleic acid molecule located between the ribosome binding region and the gene coding sequence, usually having 3 to 15 bases, and may be prepared in various types of bases and lengths, The spacer sequence can be included in the regulatory sequence to increase the expression efficiency of the gene located underneath. In addition, various types of nucleic acid compositions and sizes may be used in consideration of the coding sequence of the protein to be expressed and the kind of the host cell. An example of a spacer sequence according to the present invention is preferably but not limited to TTACAAA (SEQ ID NO: 21).

In the present invention, the promoter sequence comprises a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: And a nucleic acid molecule including a nucleic acid sequence. The term " transcription promoter "

In the present invention, there is provided an isolated nucleic acid molecule comprising a polynucleotide capable of effecting expression polynucleotide transcription. The isolated nucleic acid molecule comprises a nucleic acid molecule comprising the nucleic acid sequences of SEQ ID NOS: 1, 8, 12, and 16 and a polynucleotide selected from functional variants. In another example of the present invention, the functional variant has at least 90%, i.e., 99%, 98%, 97%, 96%, 95% or more of the sequence identity with the nucleic acid sequences of SEQ ID NOS: %, 94%, 93%, 92%, 91%, 90% or more.

The regulatory sequence comprising the promoter and the ribosome-binding region located under the promoter is a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 2 to SEQ ID NO: 7, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 9 to SEQ ID NO: 11, A nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 13 to SEQ ID NO: 15, and a nucleic acid molecule comprising SEQ ID NO: 17 to SEQ ID NO: 19.

The ribosome binding region according to one embodiment of the present invention may be a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 20 and the spacer sequence may be a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: The regulatory sequence may include a ribosomal binding region having a nucleic acid sequence of SEQ ID NO: 8 sequentially linked in the 5 'to 3' direction and an oligonucleotide comprising a spacer sequence having a nucleic acid sequence of SEQ ID NO: 9. Specifically, the regulatory sequence comprises a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 6 to SEQ ID NO: 7, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 11, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: And a nucleic acid molecule comprising the nucleic acid molecule.

Specific transcription promoters according to the present invention are exemplified in Table 1 below. A polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NOS: 1 to 21, and may be a transcriptional promoter that expresses an amylose sucrose enzyme in a strain of the genus Corynebacterium.

order
number Sequences (5 '-> 3') denomination One aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac S1 promoter (1) 2 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga S1 promoter
(2) 3 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga ttttttaccc S1 promoter
(3) 4 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac S1 promoter
(4) 5 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga S1 promoter
(5) 6 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga ttacaaa S1 promoter
(6) 7 tcagaattg gttaattgg ttgtaacac tggcagtga attctcaag tctccacacc accattcgaa acttacaagt gtgaactctg gcggatcaac tagtgaaaag cgtaactaca tggtccttct tgagtatcta ctacgcgtac tgggaacaat cactagtgaat tcgcggccgc gc
aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga ttacaaa S1 promoter
(7) 8 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta aggctc The t2 promoter (1) 9 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta aggctc
gaaagga t2 promoter
(2) 10 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta aggctc
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga t2 promoter
(3) 11 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta aggctc
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga ttacaaa t2 promoter
(4) 12 tgacaattaa tcatcggctc gtataatgt t1 promoter
(One) 13 tgacaattaa tcatcggctc gtataatgt
gaaagga t1 promoter
(2) 14 tgacaattaa tcatcggctc gtataatgt
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga t1 promoter
(3) 15 tgacaattaa tcatcggctc gtataatgt
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga ttacaaa t1 promoter
(4) 16 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt aacttaaagg aaca h1 promoter
(One) 17 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt aacttaaagg aaca
gaaagga h1 promoter
(2) 18 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt aacttaaagg aaca
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga h1 promoter
(3) 19 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt aacttaaagg aaca
gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga ttacaaa h1 promoter
(4) 20 gaaagga Ribosome binding site 21 ttacaaa Spacer sequence

The boxed portions in Table 1 indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like among the regulatory sequences.

The promoter for expressing the strain of genus Corynebacterium according to the present invention is to regulate the expression of the amylose sucrose enzyme linked to the lower part thereof in the strain of genus Corynebacterium. Escherichia coli-derived promoters exhibit relatively low activity in Corynebacterium because of low permeability of expression inducing factors and absence of gene expression inhibiting substances. Also, even with the same promoter, the expression efficiency differs depending on the gene encoding the target protein, and the selectivity of the promoters usable in Corynebacterium is also small, making it difficult to produce an expression system suitable for the purpose. Also, the transcriptional regulatory activity may be different depending on the specific target protein, even if it is a transcriptional promoter for Corynebacterium sp. Expression. Thus, the transcriptional promoter, regulatory sequence or gene expression cassette according to the present invention may be a Corynebacterium sp. Strain It is suitable to express the amylose sucrose enzyme.

The target protein may be directly connected to the 3 'end of the nucleic acid molecule for Corynebacterium spp. Expression, or may be linked through a linker.

The amylose sucrose enzyme according to the present invention is preferably excellent in enzyme expression and activity, and in the embodiment of the present invention, the transcriptional promoter or regulatory sequence is important in combination with a gene encoding an amylose sucrose enzyme And the s1, t2, t1 and h1 promoters can provide more than adequate protein expression with the amylose sucrose enzyme used in the present invention. Especially, in the case of the t2 and h1 promoters, the expression is almost the same as that of E. coli .

In one embodiment of the present invention, the amylose sucrose enzyme is Neisseria subflava or Neisseria sicca , preferably a Neisseria subflava comprising the amino acid sequence of SEQ ID NO: 22 Derived peptide, or an amylose sucrose enzyme comprising a peptide derived from Neisseria sicca comprising the amino acid sequence of SEQ ID NO: 24.

The amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 24 may be partially substituted, inserted and / or deleted so long as the amylose sucrose enzyme retains the turanose converting activity. For example, the protein may comprise an amino acid sequence having at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% homology with the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO:

The nucleic acid sequence coding for the amylose sucrose enzyme is Neisseria subflava or an encoded amino acid sequence of an amylose sucrose enzyme obtained from Neisseria sicca .

For example, the nucleic acid sequence encoding the amylose sucrase may be a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 22, or a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: Lt; / RTI > Specifically, the nucleic acid sequence encoding the amylose sucrase may be a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 23 and SEQ ID NO: 25. Or a sequence having substantial identity to the nucleic acid sequence. Said substantial identity is determined by aligning the nucleic acid sequence of SEQ ID NO: 23 or 25 with a maximum of correspondence to any other sequence, and analyzing the sequence so that said another sequence has 70% or more identity with the nucleic acid sequence of SEQ ID NO: 23 or 25, , 90% or more, or 98% or more.

In one embodiment of the present invention, the gene expression cassette is operably linked to a nucleic acid sequence encoding an amylose sucrose enzyme upstream thereof and is operably linked to the amylose sucrose enzyme in a strain of Corynebacterium sp. And the regulatory sequence may include the promoters s1, t2, t1, and h1. Specifically, the regulatory sequence may include a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 19 The nucleotide sequence encoding the amylose sucrose enzyme may be a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 24.

As an example, when the regulatory sequence comprises the s1 promoter, the gene expression cassette is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NOS: 1 to 7,

When the regulatory sequence comprises the t2 promoter, the gene expression cassette is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 8 to SEQ ID NO: 11,

When the regulatory sequence comprises the t1 promoter, the gene expression cassette is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 12 to SEQ ID NO: 15,

When the regulatory sequence comprises the h1 promoter, the gene expression cassette is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 16 to SEQ ID NO: 19.

An engineer skilled in the art can substitute, add or delete one or more bases of the nucleotide sequence of the polynucleotide using gene recombinant techniques known in the art, It will be easily understood that a polynucleotide encoding an enzyme protein having an activity can be produced. This comparison of homology can be performed by calculating the percentage homology between two or more sequences using a commercially available computer program.

In one example of the invention, Neisseria derived from a subflava , sucrose alone or a protein (NsAS) having an activity of producing turanose from a mixed raw material of sucrose and fructose is provided. For example, the protein may have an amino acid sequence of SEQ ID NO: 22 and may have sucrose alone or an activity of producing turanose from a mixture of sucrose and fructose. The nucleic acid sequence encoding the amylose sucrose enzyme may comprise a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 22, or a nucleic acid sequence of SEQ ID NO: 23.

The optimum temperature of the protein is not particularly limited as long as it does not deactivate the enzyme, but is preferably up to a temperature of about 40 ° C, preferably 20 to 40 ° C. The optimum pH of the protein may be about 6.0 to 9.0, but preferably 6.5 to 7.5. The reaction time during the enzyme reaction can be varied under enzyme reaction conditions, but can be selected from 24 to 120 hours when 100-400 units / L of purified amylose sucrase is used.

In one example of the invention, Neisseria From sicca , a protein (NsiAS) with activity to produce turanose from fructose is provided. For example, the protein may have an amino acid sequence of SEQ ID NO: 24 and may have sucrose alone or an activity of producing turanose from a mixture of sucrose and fructose.

The nucleic acid sequence encoding the amylose sucrose may include a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 24 or a nucleic acid sequence of SEQ ID NO: 25.

The expression cassette according to the present invention may further comprise at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site.

A further example of the present invention relates to a transcription promoter comprising a transcriptional promoter for expression of a genus of Corynebacterium sp. According to the present invention, a regulatory sequence comprising the regulatory sequence, or a polynucleotide encoding the regulatory sequence and the amylose sucrose enzyme Gene expression cassette for four bacterium sp. Strains.

The nucleic acid molecule for expressing the Corynebacterium sp. Strain, and the regulatory sequence and the amylose sucrose enzyme are as described above.

In one embodiment of the present invention, the expression cassette further comprises at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site as a polynucleotide sequence for expression can do. The invention also relates to an expression vector comprising said expression cassette of the invention.

The invention particularly preferably relates to a genetically modified microorganism, in particular a genus of the genus Corbicuterium, comprising a vector carrying at least one expression cassette of the invention, in particular a shuttle vector or a plasmid vector.

The recombinant vector can be constructed as a vector for cloning or as a vector for expression via methods well known in the art (Francois Baneyx, current Opinion Biotechnology 1999, 10: 411-421). The recombinant vector may be any vector that has been used for gene recombination. For example, the recombinant vector may be a plasmid expression vector, a virus expression vector (for example, replication defective retrovirus, adenovirus, and adeno-associated virus) A viral vector, and the like, but the present invention is not limited thereto.

For example, the recombinant vector may be one selected from the group consisting of pET, pKK223-3, pTrc99a, pKD, pXMJ19, pCES208 vector, and preferably E. coli-corynebacterium shuttle vector (pCES208, J. Microbiol Biotechnol., 18: 639-647, 2008).

The polynucleotide may be used as such, or in the form of a recombinant vector comprising the polynucleotide. The recombinant vector means a recombinant nucleic acid molecule capable of delivering a target polynucleotide operably linked thereto, and the polynucleotide of interest may be operably linked to one or more transcriptional regulatory elements such as a promoter and a transcription termination factor .

The transcription termination factor may be a terminator such as rrnB, rrnB_T1, rrnB_T2, T7, and preferably a PCR T7 transcription termination factor from the pET21a vector.

An example of the present invention may be a recombinant Corynebacterium genus host cell transformed with a vector containing the gene expression cassette or containing the expression cassette.

Methods for transforming the host cell with the recombinant vector can be selected and used without particular restriction on all transformation methods known in the art. For example, fusion of bacterial protoplasts, electroporation, projectile bombardment, Infection with a vector, or the like.

The transformed strain of the genus Corynebacterium according to the present invention has high stability, overexpresses the introduced amylose sucrose enzyme, and thus can provide stable high-turboswitching ability for a long period of time. Therefore, the transformed strain of the genus Corynebacterium can be advantageously applied to the production of turanos, and the production yield of turanos can be further improved.

Preferred strains of the genus Corbacterium are the genus Corynebacterium, especially Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium, Thermoaminogenes, Corynebacterium melassecola, and Corynebacterium efficiens are bacterial species.

The transformed recombinant Corynebacterium host cell according to the present invention may be a recombinant Corynebacterium glutamicum.

The cultivation of the Corynebacterium sp. Strain can be carried out in a suitable culture medium by various culture methods known in the art. Examples of the culture method include batch, continuous, and fed-batch cultivation. The fed-batch cultivation includes, but is not limited to, an implantation and a repeated implantation culture.

The media which can be used according to the present invention generally comprise at least one carbon source, a nitrogen source, inorganic salts, vitamins and / or trace elements. Preferred carbon sources are sugars such as monosaccharides, disaccharides or polysaccharides. The nitrogen source is generally an organic or inorganic nitrogen compound, or a material comprising these compounds. Examples of nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids, or complex nitrogen sources such as corn steep liquor, Yeast extract, and meat extract. The nitrogen source may be used alone or as a mixture. Inorganic salt compounds which may be present in the medium include chloride, phosphate or sulfate of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. As the phosphorus source, phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate, or the corresponding sodium-containing salts may be used. A chelating agent may be added to the medium to maintain metal ions in solution. All components of the medium are sterilized by heating (1.5 bar and 121 ° C for 20 minutes) or by sterile filtration. These ingredients can be sterilized together, or individually as needed. All components of the medium may be present at the start of the culture, or may optionally be added continuously or batchwise.

Another example of the present invention relates to a method for producing an amylose sucrose enzyme obtained by using an amylose sucrose enzyme obtained by using a strain of the genus transformed with Corynebacterium, a cell of the strain, a culture of the strain, a crushed product of the strain, And at least one selected from the group consisting of:

The present invention also relates to an amylose sucrose enzyme obtained by using a recombinant Corynebacterium genus host cell, a cell of the cell, a culture of the cell, a crushed product of the cell, and an extract of the crushed product or the culture , Or a mixture of sucrose and fructose, to produce turanose. The present invention also provides a method for producing turanose.

The culture includes an enzyme produced from the strain of genus Corynebacterium, and may include the strain of the strain or may be a cell-free form that does not include a strain. The lysate refers to a lysate obtained by disrupting the strain of the genus Corynebacterium or a supernatant obtained by centrifuging the lysate, and comprises the enzyme produced from the strain of genus Corynebacterium. In the present specification, unless otherwise stated, the strain of genus Corynebacterium used in the production of turanose contains at least one member selected from the group consisting of the strain of the strain, the culture of the strain and the lysate of the strain It is used to mean.

The method for producing turanose may comprise at least one selected from the group consisting of the amylose sucrose enzyme, the strain of the strain, the culture of the strain, the lysate of the strain, and the extract of the lysate or the culture, Or a mixture of sucrose and fructose mixtures.

In one embodiment, the step of reacting the strain of genus Corynebacterium with a substrate may be carried out by culturing the bacterium of the genus of genus Corynebacterium in a culture medium containing fructose. In another embodiment, the step of reacting the strain of the genus Corynebacterium with fructose comprises contacting the strain (fungus, culture of the strain, and / or strain of the strain) with fructose, for example, Mixing or contacting the substrate with the carrier on which the strain is immobilized. Thus, by reacting the strain of genus Corynebacterium with sucrose and a fructose solution, sucrose can be converted into turanose to produce turanose from sucrose.

The step of reacting the enzyme with the amylose sucrose enzyme comprises reacting at least one selected from the group consisting of the enzyme, the culture of the strain, the lysate of the strain, and the lysate or the culture, To be mixed with the raw material of the to-be mixed, or by bringing the raw material into contact with the carrier to which the enzyme is immobilized.

In the method for producing turanose according to the present invention, when sucrose alone is used as a substrate, the higher the concentration of the sucrose substrate is, the more favorable it is, considering the solubility of the sucrose, in consideration of the conversion rate and the amount of produced turanose . For example, in one embodiment of the present invention, the concentration of the sucrose substrate as the substrate may be in the range of 1.0M to 2.5M. When a mixed material of sucrose and fructose is used, a suitable concentration of sucrose is preferably from 1.5 M to 2.5 M, for example, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2.0M , 2.1 M, 2.2 M, 2.3 M, 2.4 M, and more preferably 2.0 M, and the fructose concentration is preferably 0.5 M to 1.5 M, such as 0.5 M, 0.6 M, 0.7 M , 0.8M, 0.9M, 1.0M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, and more preferably 0.75M. In a specific example of the present invention, a mixed material of sucrose and fructose is prepared by mixing a mixture of sucrose 2.5M stock 800ul and 5M fructose stock 150l, and then adding 50ul of enzyme to obtain total 1ml of the reaction mixture .

The mixing ratio of sucrose to fructose may preferably be 5: 1 to 1: 1 by weight, more preferably 3: 1 to 2: 1 by weight. If the mixing ratio of the fructose is lower than the above range, the byproducts other than the turanos may be overproduced. If the mixing ratio is higher than the above range, the byproducts other than the turanos may be overproduced. Do.

In the method for producing turanose, for the efficient production of turanose, the substrate to be used may be sucrose alone or may further be supplemented with fructose in the sucrose. The concentration of sucrose and fructose used is not particularly limited. For example, when acting on a 1.0 M or 2.5 M sucrose solution supplemented with 0.25 M or 0.75 M fructose as a substrate, the enzyme can also react to produce turanos. In addition, a solution with a significantly high substrate or an undissolved substrate may be used. The substrate solution may be used in the form of a solution dissolved in a buffer solution or water (for example, distilled water).

In the method for producing turanose, the reaction can be carried out under the conditions of pH 6.0 to 9.0, pH 6.0 to 8.0, or pH 8.0 to 9.0, but preferably 6.5 to 7.5. In addition, the reaction can be carried out at a temperature of 20 ° C or more, for example, 40 ° C or more. The reaction may be carried out at a temperature of 40 to 80 DEG C, for example, 50 to 75 DEG C, 60 to 75 DEG C, or 68 to 75 DEG C, since the browning of the substrate may occur as the temperature increases. Further, the longer the reaction time, the higher the conversion rate of the Turanoth. For example, the reaction time is preferably at least 24 hours, such as at least 48 hours, at least 72 hours, at least 96 hours and at least 120 hours. If the reaction time exceeds 144 hours, the increase rate of the Turanoth transition rate is small or rather decreases, so that the reaction time should not exceed 144 hours. The above condition is selected as a condition for maximizing the conversion efficiency of Turanoth.

(Dcw: dry cell weight) / ml or more, for example, 5 to 100 mg (dcw) / ml, 10 to 90 mg (dcw ) / ml, 20 to 80 mg (dcw) / ml, 30 to 70 mg (dcw) / ml, 40 to 60 mg (dcw) / ml or 45 to 55 mg (dcw) / ml. When the cell concentration is less than the above range, the activity of converting the turanos is low or almost not. When the cell concentration exceeds the above range, the cells become too large and the overall efficiency of the turanos conversion reaction becomes low.

The carrier may be an immobilized strain, or an environment in which the activity of the enzyme produced from the strain can be maintained for a long time, and may be any known carrier that can be used for enzyme immobilization. For example, sodium alginate (soduim alginate) may be used as the carrier. Sodium alginate is a natural colloidal polysaccharide abundantly present in the cell wall of seaweed. It is composed of mannuronic acid (β-D-mannuronic acid) and α-L-gluronic acid. Beta-1,4 bond, and the strains or enzymes are stably fixed, which can be advantageous to exhibit excellent turanose yield.

In one embodiment, a sodium alginate solution (e.g., sodium alginate solution) at a concentration of 1.5 to 4.0% (w / v), such as sodium alginate at a concentration of about 2.5% (w / v) The solution can be used to immobilize the strain. For example, the microorganism is cultured in a culture medium containing a microorganism, an enzyme produced by the microorganism, or an aqueous solution of sodium alginate in an amount of 1 to 2 times the volume of the microorganism, or a culture containing the enzyme produced by the microorganism, Or a lysate of the strain is added and mixed, and then the obtained mixed solution is dropped into a 0.2M calcium ion solution by using a syringe pump and a vacuum pump to produce beads. The bacteria of the strain are added to the sodium alginate carrier, A culture containing the produced enzyme, or a lysate of the strain may be immobilized. The enzyme may be purified from the strain, the strain culture or the disruption of the strain by a conventional method such as dialysis, precipitation, adsorption, electrophoresis, affinity chromatography, ion exchange chromatography and the like.

In one embodiment, the step of reacting the enzyme protein or the like with fructose may be performed by contacting the enzyme protein with fructose. In one embodiment, the step of contacting the enzyme protein or the like with fructose may be performed, for example, by mixing the enzyme protein or the like with a substrate or contacting the substrate with a carrier to which the enzyme protein or the like is immobilized have. In another embodiment, the step of reacting the enzyme protein with the substrate may be performed by reacting the cells of the recombinant strain with a substrate-containing starting material and reacting at an appropriate temperature. Thus, by reacting the enzyme protein or the like with sucrose alone or a mixed material of sucrose and fructose, sucrose can be converted into turanose to produce turanose from sucrose.

For efficient turanose production, the amount of enzyme protein used may be 100-400 units / L based on the total reactants. When the amount of the enzyme used is lower than the above-mentioned concentration, the conversion efficiency of the Turanose can be lowered, and if it is higher than the above-mentioned concentration, the economical efficiency in the industry is lowered.

For efficient turanose production, the solution used as the substrate may be a 1.0 M or 2.5 M sucrose solution fortified with 0.25 M or 0.75 M fructose. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

Taking into account the optimum conditions of the enzyme protein, the reaction pH, the reaction temperature and the concentration of the enzyme can be appropriately selected and performed. For example, when the reaction pH is 6 to 9 and the reaction temperature is higher than 60 ° C, browning of the substrate and inhibition of enzyme activity may occur. Therefore, the reaction temperature is preferably 20 ° C to 60 ° C, Lt; 0 > C. In addition, although it depends on the enzyme concentration, the longer the reaction time is, the higher the conversion rate of the Turanoth. For example, in consideration of thermal stability of the enzyme (for example, thermal stability at 35 캜), the reaction time is preferably 24 hours or longer. If the reaction time exceeds 144 hours, the increase rate of the Turanoth transition rate is small or rather decreases, so that the reaction time should not exceed 144 hours.

In the case of using the recombinant strain in the production of the turanos, the cell concentration of the strain used may be 0.1 mg (dcw: dry cell weight) / ml or more based on the total reactant.

In another embodiment, the method of producing turanose may comprise reacting a recombinant strain expressing an amylose sucrose enzyme or an enzyme protein separated from the recombinant strain with fructose. The method of producing turanose may further include a step of culturing and recovering a recombinant strain expressing an amylose sucrose enzyme prior to the reaction step.

Turanos obtained from sucrose by the method of the present invention can be purified by conventional methods, and these crystals belong to a technique common to those skilled in the art. For example, by one or more methods selected from the group consisting of centrifugation, filtration, crystallization, ion exchange chromatography, and combinations thereof.

The present invention relates to a method for producing a large amount of turanose using sucrose alone or a mixed material of sucrose and fructose, and using the same as a gene expressing an amylose sucrose enzyme in a strain of the genus Corynebacterium, which is a GRAS strain, An expression system, a recombinant vector containing the same, and a strain of the genus Corynebacterium, and using the gene encoding the amylose sucrose enzyme produced using the gene expression system, using sucrose alone or a mixed material of sucrose and fructose To produce Turanos.

Figures 1A-1D, or 2a-2d, show that the amylose sucrose enzyme protein of one embodiment of the present invention is conjugated to corynebacterium a cleavage map of a recombinant vector for expression in glutamicum, Figure 1a is a recombinant vector (pCES_s1NsAS), Figure 1b is a recombinant vector (pCES_t2NsAS), Figure 1c is a recombinant vector (pCES_t1NsAS), Figure 1d is a recombinant vector (pCES_h1NsAS), Figure 2a 2C shows the recombination vector (pCES_t1NsiAS), and Fig. 2D shows the recombination vector (pCES_h1NsiAS). Fig. 2B shows the recombination vector (pCES_t1NsiAS)
FIG. 3 is a photograph comparing the amount of protein expressed by SDS-PAGE after lysing cells cultured using Bead beater of one embodiment.

Hereinafter, the present invention will be described in more detail by way of specific examples. However, the present invention is not limited to the following examples.

Example  1. Preparation of plasmid

Example  1-1: s1  Vector Production Using Promoter

Neisseria The coding gene for the amylose sucrose enzyme derived from subflava was synthesized and named NsAS. The T7 terminator obtained from the synthetic gene NsAS and pET21a vector was obtained as a template through PCR and ligated into a template by overlap PCR and PCR was performed using T-vector cloning to obtain pGEM T- and the sequence of the polynucleotide was confirmed. Specifically, the polynucleotide includes the NsAS sequence of SEQ ID NO: 23 and the T7 terminator.

The whole confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes BglII and SalI (NEB) to obtain a recombinant vector pCES208 / Amylose sucrose enzyme (pCES_s1NsAS) was prepared. The cleavage map of the prepared recombinant vector (pCES_s1NsAS) is shown in Fig.

Example  1-2: t2  Vector Production Using Promoter

The following plasmids were also prepared for cloning to compare the expression and activity of the target proteins other than pCES_s1NsAS:

(Insert-SEQ ID NO: 8) was obtained by PCR using the t2 promoter using Corynebacterium gDNA (genomic DNA) as a template, and cloned into pCES_s1NsAS in XbaI and BglII sites obtained in Example 1 to prepare pCES_t2NsAS Respectively. The cleavage map of the prepared recombinant vector (pCES_t2NsAS) is shown in Fig. 1B.

Example  1-3: t1  Vector Production Using Promoter

pCES_t1NsAS was prepared by cloning the pCES_s1NsAS obtained in Example 1 into XbaI and BglII sites by securing a gene insert (insert-SEQ ID NO: 12) by PCR using the pKK223-3 vector as a template. The cleavage map of the prepared recombinant vector (pCES_t1NsAS) is shown in Fig. 1C.

Example  1-4: Vector Production Using h1 Promoter

PCES_h1NsAS was prepared by cloning the pCES_s1NsAS obtained in Example 1 into XbaI and BglII sites by secreting a gene insert (insert-SEQ ID NO: 16) by PCR using h1 promoter using Corynebacterium gDNA as a template. The cleavage map of the prepared recombinant vector (pCES_h1NsAS) is shown in Fig. 1D.

Example  2. Preparation of plasmid

Example  2-1: s1  Vector Production Using Promoter

Neisseria The coding gene for the amylose sucrose enzyme derived from sicca was synthesized and named NsiAS. The T7 terminator obtained from the synthetic gene NsiAS and pET21a vector was obtained as a template through PCR and ligated into a template by overlap PCR. PCR was performed using T-vector cloning to construct a pGEM T-easy vector Cloning was performed to confirm the sequence of the polynucleotide. Specifically, the polynucleotide includes the NsiAS sequence of SEQ ID NO: 25 and the T7 terminator.

.

The whole confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes BglII and SalI (NEB) to obtain a recombinant vector pCES208 / Amylose sucrose enzyme (pCES_s1NsiAS) was prepared. A cleavage map of the prepared recombinant vector (pCES_s1NsiAS) is shown in Fig. 2A.

Example  2-2: t2  Vector Production Using Promoter

The following plasmids were also prepared for cloning to compare expression and activity of target proteins other than pCES_s1NsiAS:

Using the corynebacterium gDNA as a template, the t2 promoter was inserted into the pCES_s1NsiAS obtained by PCR (SEQ ID NO: 8) and cloned into XbaI and BglII sites to prepare pCES_t2NsiAS. A cleavage map of the prepared recombinant vector (pCES_t2NsiAS) is shown in Fig. 2B.

Example  2-3: t1  Vector Production Using Promoter

pCES_t1NsiAS was prepared by cloning the pCES_s1NsiAS obtained in Example 1 into XbaI and BglII sites by inserting the t1 promoter with PCR using the pKK223-3 vector as a template (SEQ ID NO: 12). The cleavage map of the prepared recombinant vector (pCES_t1NsiAS) is shown in Fig. 2C.

Example  2-4: Vector Production Using h1 Promoter

Using the corynebacterium gDNA as a template, h1 promoter was inserted by PCR (SEQ ID NO: 16), and pCES_s1NsiAS obtained in Example 1 was cloned into XbaI and BglII sites to prepare pCES_h1NsiAS. The cleavage map of the prepared recombinant vector (pCES_h1NsiAS) is shown in Fig. 2d.

Example  3. Host cell transformation

Eight kinds of plasmids prepared in Examples 1 and 2 were transformed with Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And 250 rpm for about 16 hours.

Then, 1 ml of the above culture was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml kanamycin, and the culturing was continued for 16 hours or more.

Example  4. Target protein  Confirmation of expression

After lysing the cells cultured using a homogenizer (Beadbeater), only the supernatant is obtained, mixed with the sample buffer in a volume ratio of 1: 1, and then heated at 100 ° C for 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H ₂ O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8), 100 μl 10% SDS, , 4 μl TEMED / stacking gel - 1.4 ml H ₂ O, 0.33 ml 30% acrylamide, 0.25 ml 1.0 M Tris buffer (pH 6.8), 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) The protein expression is confirmed by electrophoresis for about 50 minutes. The results are shown in Fig. FIG. 3 is a photograph showing a comparison of the amount of protein expressed by SDS-PAGE after lysing cells cultured using a bead beater of one embodiment.

After confirming the expression of NsAS and NsiAS on SDS-PAGE gel, the His-tag purification was proceeded with Ni-NTA resin to determine the exact expression level. The expression (%) = (Purified protein (mg) (mg)) * 100), and the expression ratios are shown in Table 2 below. In Table 2, the total protein in the strain is the total protein contained in the Corynebacterium strain expressing the amylose sucrose enzyme, and the amylose sucrose enzyme was purified only from the amylose sucrose enzyme . Therefore, the expression rate is a value calculated as to how much the target protein is expressed in the total protein present in the Corynebacterium strain.

Target protein Promoter Origin Whole in the strain
Protein (mg) Amylose sucrase
Enzyme (mg) Expression rate (%) NsAS s1 9.54 0.93 9.7 t2 8.55 1.91 22.3 t1 9.81 2.27 23.1 h1 7.53 1.67 22.1 Nsias s1 8.42 0.47 5.54 t2 9.43 1.28 13.63 t1 8.95 1.15 12.84 h1 8.51 1.18 13.85

Example  5. Cells Crush  Used Turanos  production

Cells expressing pCES_hlNsiAS in the amylose sucrose enzyme expressing cells obtained in Example 3 were suspended in 50 mM Tris-HCl at a concentration of 2 mg / ml in a stock solution containing 2 M sucrose and 0.75 M fructose Cells cultured using a homogenizer were lysed, and only the supernatant was collected. After the reaction was performed at 35 ° C, the reaction was stopped by boiling at 100 ° C for 5 minutes. The conversion of each cell supernatant was carried out under the above conditions, and the production of turanose was confirmed after sampling at each reaction time.

To confirm the obtained product, the peaks of the substrate (sucrose, fructose) and the produced material (turanose) were confirmed by liquid chromatography (LC) analysis. The liquid chromatography analysis was carried out using an HPLC (Agilent, USA) Refractive Index Detector (Agilent 1260 RID) equipped with an Aminex HPX-87C column (BIO-RAD). The mobile phase solvent was water, and the temperature was 80 ° C and the flow rate was 0.6 ml / min.

Table 3 shows the results of analyzing samples by reaction time.

Reaction time
(hr) Sugar composition (%) Sucrose Turanos Trehalulose Fructose Other sugars 24 78.3 - 1.7 18.9 1.1 48 59.3 14.8 3.3 19.7 2.9 72 37.7 29.5 4.3 20.9 7.6 96 18.7 43.2 4.9 22.3 10.9 192 - 54.5 5.8 25.1 14.6

As shown in Table 3 above, it can be seen that as the time passes, the number of sucrose used as a substrate decreases and the amount of turanose increases as a product. In addition, when the supernatant was reacted as shown in Table 3, the 'reaction stability' was high. Therefore, the present invention is not only capable of expressing Turanos in the GRAS strain and providing it as a safe food material, but also being capable of continuously reacting for a long time with high reaction stability is very advantageous for industrial mass production.

<110> SAMYANG GENEX CORPORATION <120> Expression system for amylosucrase and production for turanose          using the same <130> DPP20163019KR <160> 25 <170> Kopatentin 1.71 <210> 1 <211> 283 <212> DNA <213> Artificial Sequence <220> The s1 promoter (1) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac 283 <210> 2 <211> 290 <212> DNA <213> Artificial Sequence <220> <223> s1 promoter (2) <400> 2 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga 290 <210> 3 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> s1 promoter (3) <400> 3 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300                                                                          300 <210> 4 <211> 342 <212> DNA <213> Artificial Sequence <220> <223> s1 promoter (4) <400> 4 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg ac 342 <210> 5 <211> 349 <212> DNA <213> Artificial Sequence <220> The s1 promoter (5) <400> 5 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaagga 349 <210> 6 <211> 356 <212> DNA <213> Artificial Sequence <220> The s1 promoter (6) <400> 6 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 7 <211> 534 <212> DNA <213> Artificial Sequence <220> The s1 promoter (7) <400> 7 tcagaattgg ttaattggtt gtaacactgg cagtgaattc tcaagtctcc acaccaccat 60 tcgaaactta caagtgtgaa ctctggcgga tcaactagtg aaaagcgtaa ctacatggtc 120 cttcttgagt atctactacg cgtactggga acaatcacta gtgaattcgc ggccgcgcaa 180 gcgcctcatc agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa 240 tgttcctttc gaaaattgag gaagccttat gcccttcaac cctacttagc tgccaattat 300 tccgggcttg tgacccgcta cccgataaat aggtcggctg aaaaatttcg ttgcaatatc 360 aacaaaaagg cctatcattg ggaggtgtcg caccaagtac ttttgcgaag cgccatctga 420 cggattttca aaagatgtat atgctcggtg cggaaaccta cgaaaggatt ttttacccat 480 ggctgtatac gaactcccag aactcgacta cgcatacgac gaaaggatta caaa 534 <210> 8 <211> 186 <212> DNA <213> Artificial Sequence <220> The t2 promoter (1) <400> 8 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac 60 ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg 120 gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta 180 aggctc 186 <210> 9 <211> 193 <212> DNA <213> Artificial Sequence <220> The t2 promoter (2) <400> 9 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac 60 ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg 120 gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta 180 aggctcgaaa gga 193 <210> 10 <211> 243 <212> DNA <213> Artificial Sequence <220> The t2 promoter (3) <400> 10 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac 60 ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg 120 gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta 180 aggctcgtgg aattgtgagc ggataacaat ttcacacagg aaacagaatt cccggggaaa 240 gga 243 <210> 11 <211> 250 <212> DNA <213> Artificial Sequence <220> The t2 promoter (4) <400> 11 gagcctgcgg aaactacgca agaacccaaa aatgattaat aattgagaca agcttcccac 60 ttatgtgata aagtcccatt ttgtgaataa ctcttgtctc agtcaaagca cccagtggtg 120 gtgacgcgct aactaagcga cctgacacct caagttgttt tcactttgat gaatttttta 180 aggctcgtgg aattgtgagc ggataacaat ttcacacagg aaacagaatt cccggggaaa 240 ggattacaaa 250 <210> 12 <211> 29 <212> DNA <213> Artificial Sequence <220> The t1 promoter (1) <400> 12 tgacaattaa tcatcggctc gtataatgt 29 <210> 13 <211> 36 <212> DNA <213> Artificial Sequence <220> The t1 promoter (2) <400> 13 tgacaattaa tcatcggctc gtataatgtg aaagga 36 <210> 14 <211> 84 <212> DNA <213> Artificial Sequence <220> The t1 promoter (3) <400> 14 tgacaattaa tcatcggctc gtataatgtg tggaattgtg agcggataac aatcacacag 62 gaaacagaat tcccggggaa agga 84 <210> 15 <211> 91 <212> DNA <213> Artificial Sequence <220> The t1 promoter (4) <400> 15 tgacaattaa tcatcggctc gtataatgtg tggaattgtg agcggataac aatcacacag 62 gaaacagaat tcccggggaa aggattacaa a 93 <210> 16 <211> 254 <212> DNA <213> Artificial Sequence <220> H1 promoter (1) <400> 16 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga 60 ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt 120 ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac 180 ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt 240 aacttaaagg aaca 254 <210> 17 <211> 261 <212> DNA <213> Artificial Sequence <220> The h1 promoter (2) <400> 17 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga 60 ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt 120 ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac 180 ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt 240 aacttaaagg aacagaaagg a 261 <210> 18 <211> 311 <212> DNA <213> Artificial Sequence <220> The h1 promoter (3) <400> 18 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga 60 ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt 120 ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac 180 ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt 240 aacttaaagg aacagtggaa ttgtgagcgg ataacaattt cacacaggaa acagaattcc 300 cggggaaagg a 311 <210> 19 <211> 325 <212> DNA <213> Artificial Sequence <220> The h1 promoter (4) <400> 19 aggataagga ttcttagtgt cggtgcactt ttactgatgt ttcactgtgg aggtcaacga 60 ctcaaagtcg agaattggtg gcgcgtgtca ctggaattga cgcgtgaatg gggtggaagt 120 ggacgtcgaa aagcattttt gagacgttta tgtgagcaat gtcccatttt ccctgctcac 180 ctgtatgggc acccgcggcg gaagtggaat tgcatatgga gttttgatga tatttagcgt 240 aacttaaagg aacagtggaa ttgtgagcgg ataacaattt cacacaggaa acagaattcc 300 cggggaaagg agaaaggatt acaaa 325 <210> 20 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding site <400> 20 gaaagga 7 <210> 21 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 21 ttacaaa 7 <210> 22 <211> 636 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of amyloscurase from Neisseria subflava <400> 22 Met Leu Thr Gln Thr Gln Gln Val Asp Leu Thr Leu His His Leu Lys   1 5 10 15 Glu Arg Thr Leu Ser Ile Tyr Thr Pro Glu Gln Arg Ala Ser Ile Glu              20 25 30 Thr Ser Glu Asp Trp Lys Gln Phe Asp Arg Arg Leu Glu Glu His Phe          35 40 45 Pro Lys Leu Met His Glu Leu Asp Asn Val Tyr Asn Asn Asn Glu Ala      50 55 60 Val Leu Pro Met Leu Glu Gln Leu Ile Ala Gln Ala Trp Gln Ser Tyr  65 70 75 80 Ser Gln Arg Asn Ser Ser Leu Lys Asp Ile Asp Ile Ala Arg Glu Asn                  85 90 95 Asp Pro Asp Trp Ile Leu Ser Asn Lys Gln Val Gly Gly Gly Cys Tyr             100 105 110 Val Asp Leu Phe Ala Gly Asp Leu Gln Gly Leu Lys Ala Lys Ile Pro         115 120 125 Tyr Phe Gln Glu Leu Gly Leu Thr Tyr Leu His Leu Met Pro Leu Phe     130 135 140 Lys Cys Pro Glu Gly Lys Ser Asp Gly Gly Tyr Ala Val Ser Ser Tyr 145 150 155 160 Arg Asp Val Asn Pro Ala Leu Gly Thr Ile Asp Asp Leu Arg Asp Val                 165 170 175 Ile Ala Ala Leu His Glu Ala Gly Ile Ser Ala Val Val Asp Phe Ile             180 185 190 Phe Asn His Thr Ser Asn Glu His Glu Trp Ala Lys Arg Cys Ala Ala         195 200 205 Gly Asp Pro Leu Tyr Asp Asn Phe Tyr Tyr Ile Phe Pro Asp Arg Trp     210 215 220 Met Pro Asp Gln Tyr Asp Arg Thr Leu Arg Glu Ile Phe Pro Asp Gln 225 230 235 240 His Pro Gly Gly Phe Ser Gln Leu Glu Asp Gly Arg Trp Val Trp Thr                 245 250 255 Thr Phe Asn Ser Phe Gln Trp Asp Leu Asn Tyr Ser Asn Pro Trp Val             260 265 270 Phe Arg Ala Met Ala Gly Glu Met Met Phe Leu Ala Asn Leu Gly Val         275 280 285 Asp Ile Leu Arg Met Asp Ala Val Ala Phe Ile Trp Lys Gln Met Gly     290 295 300 Thr Ser Cys Glu Asn Leu Pro Gln Ala His Ala Leu Ile Arg Ala Phe 305 310 315 320 Asn Ser Val Met Arg Ile Ala Ala Pro Ala Val Phe Phe Lys Ser Glu                 325 330 335 Ala Ile Val His Pro Asp Gln Val Val Gln Tyr Ile Ser Gln Asp Glu             340 345 350 Cys Gln Ile Gly Tyr Asn Pro Leu Gln Met Ala Leu Leu Trp Asn Thr         355 360 365 Leu Ala Thr Arg Glu Val Asn Leu Leu His Gln Ala Leu Thr Tyr Arg     370 375 380 His Asn Leu Pro Asp His Thr Ala Trp Val Asn Tyr Val Arg Ser His 385 390 395 400 Asp Asp Ile Gly Trp Thr Phe Ala Asp Glu Asp Ala Ser Gln Phe Gly                 405 410 415 Ile His Gly Tyr Asp His Arg Gln Phe Leu Asn Arg Phe Phe Val Asn             420 425 430 His Phe Asp Gly Ser Phe Ala Arg Gly Val Pro Phe Gln Tyr Asn Pro         435 440 445 Ser Thr Gly Asp Cys Arg Val Ser Gly Thr Ala Ala Leu Val Gly     450 455 460 Leu Ala Gln Asn Asp Pro His Ala Val Asp Arg Ile Lys Leu Leu Tyr 465 470 475 480 Ser Ile Leu Ser Thr Gly Gly Leu Pro Leu Ile Tyr Leu Gly Asp                 485 490 495 Glu Val Gly Thr Leu Asn Asp Asp Asp Trp Ser Gln Asp Ser Asn Lys             500 505 510 Ser Asp Asp Ser Arg Trp Ala His Arg Pro Arg Tyr Asn Glu Glu Leu         515 520 525 Tyr Asn Gln Arg His His Ser Ser Thr Thr Ala Gly Gln Ile Phe Gln     530 535 540 Gly Leu Arg His Met Ile Ser Ile Arg Gln Ser Asn Pro Arg Phe Asn 545 550 555 560 Gly Gly Arg Leu Val Thr Phe Asn Thr Asn Asn Lys His Ile Ile Gly                 565 570 575 Tyr Met Arg Asn Asn Ala Leu Leu Val Phe Gly Asn Phe Ser Glu His             580 585 590 Ala Gln Thr Ile Ser Ala His Thr Leu Gln Ala Met Pro Phe Lys Ala         595 600 605 His Asp Leu Ile Ser Gly Gln Thr Val Ser Leu Asn Gln Asp Leu Val     610 615 620 Leu Gln Pro Tyr Gln Val Met Trp Leu Glu Ile Ala 625 630 635 <210> 23 <211> 1911 <212> DNA <213> Artificial Sequence <220> The nucleic acid sequence of the enzyme protein of SEQ ID NO: 22 <400> 23 atgttgaccc agactcaaca ggttgatttg accttgcatc accttaaaga acgcacccta 60 tcgatttata cccccgaaca gcgtgcaagt atcgagacat ctgaagactg gaaacagttt 120 gacagacgac ttgaggaaca cttcccaaaa ctgatgcacg agctggacaa tgtttacaac 180 aacaacgaag ccgtcctccc catgctggag caactgattg cccaagcatg gcaaagctat 240 tcccaacgca actcatcctt aaaagatatc gatatcgcgc gcgaaaacga tcctgactgg 300 attttgtcca acaaacaggt tggcggcggg tgctacgtcg atttgttcgc aggcgatctg 360 caagggttga aagccaaaat cccttatttc caagaattgg gcctgaccta tctgcacctg 420 atgcccctgt ttaaatgtcc tgaaggcaaa agcgacggcg gctatgcggt cagcagctac 480 cgcgatgtca atccagcact gggtacaata gacgacttgc gcgatgtcat tgccgccttg 540 cacgaagcag gcatttccgc cgttgtcgat ttcatcttca accacacttc caacgaacac 600 gaatgggcaa aacgctgcgc tgccggcgat ccactctacg acaacttcta ctatattttc 660 cctgaccgct ggatgcccga ccaatacgac cgcaccctgc gtgaaatctt ccctgaccaa 720 catccgggcg gcttctccca actggaagac ggacgctggg tatggacgac gttcaactcc 780 ttccaatggg acttaaatta cagcaacccg tgggtattcc gtgccatggc aggcgaaatg 840 atgttccttg ccaacttggg cgttgatatt ctgcgcatgg atgccgttgc ctttatttgg 900 aagcaaatgg gcacaagctg cgaaaacctg cctcaggcac acgccctgat tcgcgcgttt 960 aactctgtaa tgcgtatcgc agcgccagcc gtgttcttca aatccgaagc catcgtccac 1020 cctgaccaag ttgtccaata catcagccaa gacgaatgtc aaatcggcta caaccctctg 1080 caaatggcat tgttgtggaa caccctcgcc acacgcgaag tcaacctgct ccatcaagca 1140 ctgacctacc gtcacaacct gcccgaccac acagcatggg tcaactacgt ccgcagccat 1200 gacgacatcg gctggacgtt tgccgacgaa gacgcatcgc aattcggcat ccacggctac 1260 gaccaccgcc aattcctcaa ccgcttcttc gtcaaccatt ttgacggcag cttcgcgcgt 1320 ggcgtaccat tccaatacaa cccaagcaca ggtgactgcc gtgtcagtgg tacagcagca 1380 gcattggtcg gcttggctca aaacgatccg catgccgttg accgcatcaa acttttgtac 1440 agcattgctt tgagtaccgg cggcctgccg ctgatttacc taggcgacga agtgggtacg 1500 ctcaatgacg atgactggtc tcaagacagc aacaagagcg atgacagccg ctgggcacac 1560 cgtcctcgtt acaatgagga gttgtacaac caacgccatg acagctcgac cactgccggt 1620 caaatcttcc aaggtttacg ccatatgatt tccatccgcc aaagcaatcc gcgctttaat 1680 ggcggcaggt tggttacctt caacaccaac aacaaacaca tcatcggcta tatgcgcaac 1740 aacgcgcttt tggtattcgg caacttcagc gaacatgcgc aaaccatcag tgcgcacacc 1800 ctgcaggcca tgccgtttaa agcgcacgat ttgatcagcg gtcaaaccgt ttctctgaat 1860 caggacttgg tactgcaacc ctatcaagtc atgtggcttg aaattgcata a 1911 <210> 24 <211> 636 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of amyloscurase from Neisseria sicca <400> 24 Met Leu Thr Gln Thr Gln Gln Val Asp Leu Thr Leu His His Leu Lys   1 5 10 15 Glu Arg Ala Leu Ala Glu Tyr Ser Pro Gln Gln Arg Ala Thr Val Glu              20 25 30 Ala Ser Glu Asp Trp Lys Gln Phe Asp Arg Arg Leu Asn Glu His Phe          35 40 45 Pro Lys Leu Met His Glu Leu Asp Asn Val Tyr Asn Asp Asn Glu Ala      50 55 60 Val Leu Pro Met Leu Glu Gln Leu Ile Ala Gln Ala Trp Gln Ser Tyr  65 70 75 80 Ser Gln Arg Asp Lys Ser Leu Lys Ala Ile Asp Ala Ala Arg Glu Asn                  85 90 95 Asp Pro Asp Trp Ile Leu Ser Asn Lys Gln Val Gly Gly Val Cys Tyr             100 105 110 Val Asp Leu Phe Ala Gly Asp Leu Lys Gly Leu Lys Ala Lys Ile Pro         115 120 125 Tyr Phe Gln Glu Leu Gly Leu Thr Tyr Leu His Met Met Pro Leu Phe     130 135 140 Lys Cys Pro Glu Gly Lys Ser Asp Gly Gly Tyr Ala Val Ser Ser Tyr 145 150 155 160 Arg Asp Val Asn Pro Ala Leu Gly Thr Ile Asp Asp Leu Arg Asp Val                 165 170 175 Ile Ala Ala Leu His Glu Val Gly Ile Ser Ala Val Val Asp Phe Ile             180 185 190 Phe Asn His Thr Ser Asn Glu His Glu Trp Ala Lys Arg Cys Ala Ser         195 200 205 Gly Asp Pro Leu Tyr Asp Asn Phe Tyr Tyr Ile Phe Pro Asp Arg Trp     210 215 220 Met Pro Asp Gln Tyr Asp Arg Thr Leu Arg Glu Ile Phe Pro Asp Gln 225 230 235 240 His Pro Gly Gly Phe Ser Gln Leu Glu Asp Gly Arg Trp Ile Trp Thr                 245 250 255 Thr Phe Asn Ser Phe Gln Trp Asp Leu Asn Tyr Ser Asn Pro Trp Val             260 265 270 Phe Arg Ala Met Ala Gly Glu Met Met Phe Leu Ala Asn Leu Gly Val         275 280 285 Asp Ile Leu Arg Met Asp Ala Val Ala Phe Ile Trp Lys Gln Met Gly     290 295 300 Thr Asp Cys Glu Asn Leu Pro Gln Ala His Ala Leu Ile Arg Ala Phe 305 310 315 320 Asn Ala Val Met Arg Ile Ala Ala Pro Ala Val Phe Phe Lys Ser Glu                 325 330 335 Ala Ile Val His Pro Asp Gln Val Val Gln Tyr Ile Ala Gln Asp Glu             340 345 350 Cys Gln Ile Gly Tyr Asn Pro Leu Gln Met Ala Leu Leu Trp Asn Thr         355 360 365 Leu Ala Thr Arg Glu Val Asn Leu Leu His Gln Ala Leu Ser Tyr Arg     370 375 380 His Asn Leu Pro Asp His Thr Ala Trp Val Asn Tyr Val Arg Ser His 385 390 395 400 Asp Asp Ile Gly Trp Thr Phe Ala Asp Glu Asp Ala Trp Gln Phe Gly                 405 410 415 Ile His Gly Tyr Asp His Arg Gln Phe Leu Asn Arg Phe Phe Val Asn             420 425 430 His Phe Asp Gly Ser Phe Ala Arg Gly Val Pro Phe Gln Tyr Asn Pro         435 440 445 Asn Thr Gly Asp Cys Arg Val Ser Gly Thr Ala Ala Ala Leu Ala Gly     450 455 460 Leu Ala Gln His Asp Pro His Ala Val Asp Arg Ile Lys Leu Leu Tyr 465 470 475 480 Ser Ile Leu Ser Thr Gly Gly Leu Pro Leu Ile Tyr Leu Gly Asp                 485 490 495 Glu Val Gly Thr Leu Asn Asp Asp Asp Trp Ser Asn Asp Ser Asn Lys             500 505 510 Ser Asp Asp Ser Arg Trp Ala His Arg Pro Arg Tyr Asn Ala Glu Leu         515 520 525 Tyr Glu Gln Arg His Asp Pro Ser Thr Ala Ala Gly Gln Ile Tyr Gln     530 535 540 Gly Leu Arg His Met Ile Asp Ile Arg Gln Asn Asn Pro Arg Leu Asn 545 550 555 560 Gly Gly Arg Leu Val Thr Phe Asn Thr Asn Asn Lys His Ile Ile Gly                 565 570 575 Tyr Ile Arg Asn Asn Ala Leu Leu Ala Phe Gly Asn Phe Ser Glu His             580 585 590 Pro Gln Thr Ile Ser Ala His Thr Leu Gln Ala Met Pro Ala Arg Ala         595 600 605 Lys Asp Leu Ile Ser Gly Glu Thr Val Ala Leu Asn Gln Asp Leu Val     610 615 620 Leu Arg Pro Tyr Gln Val Met Trp Leu Glu Ile Ala 625 630 635 <210> 25 <211> 1911 <212> DNA <213> Artificial Sequence <220> The nucleic acid sequence of the enzyme protein of SEQ ID NO: 24 <400> 25 atgttgaccc agacccaaca ggtcgatttg accctgcatc atctcaaaga gcgcgccttg 60 gcagaatata gcccccaaca gcgtgcgacc gtcgaagctt ccgaagactg gaaacagttt 120 gacagacgtt tgaacgagca tttccccaag ctgatgcacg agctggacaa cgtttacaac 180 gacaacgaag ccgtcctgcc catgctggaa caactgattg cacaagcatg gcaaagctat 240 tcccaacgcg acaagtctct gaaagccatc gatgccgcgc gtgagaatga ccccgattgg 300 attttgtcca ataaacaggt cggcggcgtg tgttatgtcg atttgttcgc aggcgatttg 360 aaaggcttga aagccaaaat cccttatttt caagagctgg ggctaaccta tctgcacatg 420 atgcccctgt ttaaatgccc tgaaggcaaa agcgacggcg gctatgcggt cagcagctac 480 cgcgacgtca atccggcttt gggtacgata gacgacttgc gcgatgtcat tgccgcgctg 540 cacgaagtgg gcatttccgc cgtcgtcgat ttcatcttca accacacgtc caacgaacac 600 gaatgggcga aacgctgcgc ctccggcgac ccgctttacg acaattttta ctatattttc 660 cccgaccgct ggatgcccga ccaatacgac cgcaccctgc gcgaaatctt ccccgaccag 720 catccgggcg gcttctcaca attagaagac ggacgctgga tatggacgac attcaattcc 780 ttccaatggg atttgaatta cagcaatcct tgggtgttcc gcgccatggc gggcgaaatg 840 atgttccttg ccaatttggg cgttgacatc ctgcgtatgg acgccgttgc ctttatttgg 900 aaacaaatgg gtacggattg cgaaaacctg ccgcaagccc atgccttaat ccgcgcattc 960 aacgccgtca tgcgcatcgc cgcacctgcc gtgttcttca aatccgaagc catcgtccac 1020 cccgaccaag tcgtacaata catcgcacaa gacgaatgcc aaatcggtta caacccgctg 1080 caaatggcat tgttgtggaa caccctcgcc acccgcgaag tcaacctgct ccaccaagcc 1140 ctctcctacc gccacaacct gcccgaccat accgcatggg tcaactacgt ccgcagccat 1200 gacgacatcg gctggacgtt tgccgacgaa gacgcatggc agttcggcat ccacggctac 1260 gaccaccgcc aattcctcaa ccgctttttc gtcaaccatt tcgacggcag cttcgcgcgc 1320 ggcgtccctt tccaatacaa ccccaacacc ggcgactgcc gcgtcagcgg tactgccgcc 1380 gccctggcag gtttggcgca acatgacccc cacgccgttg accgcatcaa acttttgtac 1440 agcatcgccc tgagtaccgg cggcctgccc ctgatttatc tcggcgacga agtcggcacg 1500 ctcaacgacg acgactggtc gaacgacagc aacaagagcg acgacagccg ctgggcgcac 1560 cgtccgcgtt acaacgccga gttgtacgaa cagcgccacg acccgtcaac cgcggcagga 1620 caaatctatc aaggcctgcg ccacatgata gatatccgcc aaaacaaccc gcgcttgaac 1680 ggcggccgtc tggttacctt caacaccaac aacaaacaca tcatcggcta catccgaaac 1740 aatgcgctgt tggcgttcgg caacttcagc gaacacccgc aaaccatcag cgcgcatacc 1800 ctgcaagcca tgcccgcccg cgccaaagac ctcatcagcg gcgaaaccgt ggcactgaat 1860 caggatttgg tgctgcgccc ctaccaagtg atgtggctcg aaatcgcctg a 1911

Claims (17)

A nucleic acid sequence encoding an amylose sucrose enzyme and a control sequence operably linked upstream thereof and regulating the expression of the amylose sucrose enzyme in a strain of the genus Corynebacterium,
Wherein the regulatory sequence comprises a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 12, A gene expression cassette expressing an amylose sucrose enzyme in a strain of the genus Corynebacterium, which comprises a transcription promoter selected from the group consisting of a nucleic acid molecule. 2. The gene expression cassette of claim 1, wherein the regulatory sequence further comprises a ribosome binding site comprising the nucleic acid sequence of SEQ ID NO: 20. 3. The method according to claim 2, wherein the regulatory sequence further comprises an oligonucleotide consisting of a ribosomal binding region having a nucleic acid sequence of SEQ ID NO: 20 sequentially linked in the 5 'to 3' direction and a spacer sequence having a nucleic acid sequence of SEQ ID NO: 21 Gene expression cassette. 3. The gene expression cassette of claim 2, wherein the regulatory sequence further comprises a first linker sequence of between one and 100 base sizes located between the transcriptional promoter and the ribosome binding region. [Claim 3] The method according to claim 2, wherein the regulatory sequence comprises a transcriptional promoter and a ribosome binding region sequentially located in the 5 'to 3' direction, and is linked to the 3 'end of the ribosome binding region, Of the first linker polynucleotide. The nucleic acid molecule according to claim 2, wherein the regulatory sequence comprises a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 2 to SEQ ID NO: 7, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 9 to SEQ ID NO: A nucleic acid molecule comprising a nucleic acid sequence, and a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 17 to SEQ ID NO: 19. 4. The method according to claim 3, wherein the regulatory sequence is selected from the group consisting of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 6 to SEQ ID NO: 7, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 11 and a nucleic acid molecule comprising SEQ ID NO: A gene expression cassette that is selected. The method of claim 4, wherein the regulatory sequence comprises a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 10 to SEQ ID NO: 11, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 14 to SEQ ID NO: A gene expression cassette selected from the group consisting of nucleic acid molecules comprising a nucleic acid sequence. The method of claim 1, wherein the amylose sucrose enzyme is Neisseria subflava or Neisseria sicca . 10. The nucleic acid sequence according to claim 9, wherein the nucleic acid sequence encoding the amylose sucrase enzyme comprises a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 22 or a peptide comprising the amino acid sequence of SEQ ID NO: A gene expression cassette which is a nucleic acid sequence. 11. The gene expression cassette according to claim 10, wherein the nucleic acid sequence coding for the amylose sucrose enzyme is a nucleic acid molecule comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 23 and SEQ ID NO: The nucleic acid sequence according to claim 1, wherein the regulatory sequence is a polynucleotide selected from the group consisting of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 19, and the nucleic acid sequence encoding the amylose sucrose enzyme is SEQ ID NO: Or a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 24. 13. The method of claim 12, wherein the regulatory sequence is a polynucleotide selected from the group consisting of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1 to SEQ ID NO: 7, and the nucleic acid sequence encoding the amylose sucrose enzyme is SEQ ID NO: Or a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 24. The method according to claim 1, wherein the Corynebacterium sp. Strain is selected from the group consisting of Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, A gene expression cassette comprising at least one member selected from the group consisting of thermoaminogenes, corynebacterium melassecola, and corynebacterium eficiens. The gene expression cassette according to claim 1, wherein the expression cassette further comprises at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site. A transcription promoter comprising a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NOS: 1 to 19, and expressing the amylose sucrose enzyme in a strain of the genus Corynebacterium. 16. A vector comprising a gene expression cassette according to any one of claims 1 to 15.

Images