KR20180009627A - Composition for improving male reproduction capability comprising anthocyanin nanocomplex - Google Patents

Abstract

The present invention relates to a composition for improving male reproduction capability comprising anthocyanin nanocomplex as an active ingredient. The composition increases expression of Nrf2, HO-1 or SOD in spermary cells in which oxidative stress is introduced and shows excellent spermary protective effects through antioxidation effects, thereby being usefully used for a pharmaceutical composition, a quasi-drug and a health functional food for improving male reproduction capability.

Description

TECHNICAL FIELD The present invention relates to a composition for improving male reproductive function comprising an anthocyanin nanocomposite as an active ingredient,

The present invention relates to a composition for improving male reproductive function comprising an anthocyanin nanocomposite as an active ingredient.

The reproductive function of modern males is decreasing due to overwork, drinking, stress, environmental pollution, and diseases caused by various males such as amenorrhea, infertility, sexual dysfunction, and menopausal period are spreading.

Male infertility accounted for more than half of all male infertility cases, accounting for 22% of spermatogenic disorders, 35% of sperm transport obstruction, 7% of seminal components, 1% of sexual intercourse, And endocrine abnormalities account for 2%. In particular, the reduction of the number of spermatozoa due to the accumulation of environmental pollutants in the body is becoming the biggest problem. This is caused by anxiety, stress, fatigue, frequency of marital relationship, smoking, environmental pollution due to changes in social structure and lifestyle . Oxidative stress plays an important role in the deterioration of reproductive capacity (Kang, HK, NO, JK , Gestational Diabetes Mellitus (DY), Kim, ND, Lee, KH, Kim, KW, Choi, WC, Lim, WK, Yu, BP and Ching, J. Gerontol, 7 (3): 92-97, 1997.).

Men do not experience a sudden decline in reproductive function like women's menopause, but as they get older they are known to experience a decrease in males and fertility due to a decrease in testosterone-producing male hormones.

HO-1 (Heme Oxygenase-1) is an isoform of HO that is induced in response to stresses such as oxidative stress, hypoxia, heavy metals, and cytokines. HO-1 gene expression is regulated by a variety of transcription factors, including Nrf2 (NF-E2-related factor-2). Nrf2 is a redox-sensitive transcription factor and is known to regulate the expression of various antioxidant enzymes. Nrf2 is normally present in the cytoplasm in an inactive complex with Keap1 but when activated it binds to the ARE (antioxidant response elemnet) to move into the nucleus, resulting in NQO1 (NAD (P) H: quinone oxidoreductase), glutathione S transferase ), G-glutamate cysteine ligase (GCL), and HO-1.

On the other hand, black rice is processed into various forms of food due to its unique color and flavor, and consumption is also increasing. Regarding the activity of anthocyanins derived from black rice, it is disclosed in Korean Patent No. 10-0905747 that black rice-derived anthocyanins are effective for the treatment of gastritis and gastric ulcer induced by non-steroidal anti-inflammatory drugs, and Korean Patent No. 10-1560575 , The effect of improving the skin anti-aging, whitening and wrinkles of black rice extract containing anthocyanin has been disclosed, but the effect of improving the male reproductive function of black rice-derived anthocyanin is not known.

Under these circumstances, the present inventors have searched for a substance capable of improving male reproductive function from natural products, and have completed the present invention by experimentally confirming that anthocyanin isolated from black rice extract improves male reproductive function.

It is an object of the present invention to provide a composition for improving male reproductive function.

Another object of the present invention is to provide a health functional food composition for improving male reproductive function.

In order to solve the above-mentioned problems, the present invention provides a composition for improving male reproductive function comprising an anthocyanin nanocomposite.

According to a preferred embodiment of the present invention, the anthocyanin nanocomposite may be one in which anthocyanin and chondroitin sulfate are ionically bound.

According to another preferred embodiment of the present invention, the anthocyanin and chondroitin sulfate may be mixed in a weight ratio of 0.1: 1 to 10: 1.

According to another preferred embodiment of the present invention, the anthocyanin may be isolated from black rice extract.

According to another preferred embodiment of the present invention, the anthocyanin nanocomposite may increase the expression of Nrf2 (NF-E2-related factor-2), HO-1 (Heme oxygenase-1) or SOD (superoxide dismutase) .

The present invention also provides a health functional food composition for improving male reproductive function comprising the above-mentioned composition as an active ingredient.

According to a preferred embodiment of the present invention, the health functional food composition may be one selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

The composition comprising the anthocyanin nanocomposite of the present invention is safe and adverse to human health by using natural materials as a material and increases the expression of Nrf2, HO-1 or SOD in oxidative stress induced testicular cells, And exhibits excellent testis protection effect, it can be usefully used in pharmaceutical compositions for improving male reproductive function, quasi-drugs, and health functional foods.

FIG. 1 shows a graph of H ₂ O ₂ And the cell viability after treatment with anthocyanin nanocomposite in mouse Lydia TM3 cells induced by oxidative stress.
FIG. 2 shows a graphical representation of H ₂ O ₂ And anthocyanin monoclonal antibody treated with anthocyanin nanocomposite in mouse Lydia TM3 cells induced by oxidative stress.
Figure 3 is a graphical representation of H ₂ O ₂ The expression of Nrf2 and HO-1 protein in the oxidative stress-induced mouse Lydia TM3 cells treated with anthocyanin nanocomposite was determined by western blotting.
4 is a H ₂ O ₂ And HO-1 and SOD mRNA expression levels after treatment with anthocyanin nanocomposite in mouse Lydia TM3 cells induced by oxidative stress.

Hereinafter, the present invention will be described in more detail.

As described above, conventionally, there has been no known effect of improving the male reproductive function of black rice-derived anthocyanin. However, the present inventors searched for a substance capable of improving male reproductive function from natural products and found that anthocyanin isolated from black rice extract The present invention has been completed by experimentally confirming that the male reproductive function is improved. The composition comprising the anthocyanin nanocomposite of the present invention is safe and adverse to human health by using natural materials as a material and increases the expression of Nrf2, HO-1 or SOD in oxidative stress induced testicular cells, And exhibits excellent testis protection effect, it can be usefully used in pharmaceutical compositions for improving male reproductive function, quasi-drugs, and health functional foods.

In addition, the anthocyanin contained in the composition of the present invention is provided in the form of a nanocomposite, thereby enhancing the structural stability and antioxidant activity of anthocyanin.

The present invention provides a composition for improving male reproductive function comprising an anthocyanin nanocomposite.

In the composition of the present invention, the anthocyanin nanocomposite is an ion-bonded anthocyanin and a negatively charged polysaccharide, and the negatively charged polysaccharide is selected from the group consisting of hyaluronic acid, o-sulfated HA, dextran sulfate, chondroitin sulfate But are not limited to, chondroitin sulfate, keratin sulfate, keratin sulfate, heparin, heparin sulfate, fucoidan, alginic acid, and mixtures or complexes thereof. have. These polysaccharides are frequently used in foods and beverages, and are not only harmless to the human body but also have a strong negative charge in a neutral solution, so that they can effectively bind to anthocyanins in positive charge.

The anthocyanin nanocomposite may be anthocyanin and chondroitin sulfate mixed at a weight ratio of 0.1: 1 to 10: 1. Within the above range, the complex formed from the polysaccharide of the present invention is advantageous in enhancing the stability of anthocyanin and enhancing antioxidant activity Effect.

The anthocyanin used in the present invention may be isolated from a natural product containing anthocyanin, chemically synthesized using a known production method, or commercially available, and may be preferably isolated from black rice extract.

In one embodiment of the present invention, anthocyanin nanocomposites having a particle size of 100 to 200 nm were prepared using anthocyanin and chondroitin sulfate isolated from black rice extract at a weight ratio of 0.1: 1 to 10: 1.

As a result of treating oxidative stress-induced TM3 cells (testicular cells) of the anthocyanin nanocomposite prepared in the present invention, the expression of Nrf2, HO-1 or SOD was increased, thereby protecting the testicular cells from oxidative stress, And ultimately the male reproductive function was improved (Figs. 1 to 4).

Accordingly, the composition comprising the anthocyanin nanocomposite of the present invention can be prepared from a pharmaceutical composition for improving male reproductive function.

The pharmaceutical composition of the present invention contains anthocyanin nanocomposite as an active ingredient. The term 'comprising as an active ingredient' means an amount sufficient to achieve the intended effect or activity. The present invention relates to an anthocyanin isolated from a black rice extract of a natural material and a polysaccharide harmless to the human body as a nanocomposite which is used as an active ingredient and has no adverse effect on the human body even when it is administered in an excessive amount so that a quantitative upper limit included in a pharmaceutical composition You can choose within range.

The pharmaceutical composition of the present invention may comprise a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may contain a variety of ingredients such as buffer, injectable sterile water, normal saline or phosphate buffered saline, sucrose, histidine, salts and polysorbates.

The pharmaceutical composition of the present invention can be administered orally or parenterally, and can be administered in the form of a general pharmaceutical preparation, for example, various forms of oral and parenteral administration at the time of clinical administration. In the case of formulation, , An extender, a binder, a wetting agent, a disintegrant, a surfactant, and the like.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin, and the like.

In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Examples of the liquid preparation for oral use include suspensions, solutions, emulsions, and syrups. In addition to water and liquid paraffin, simple diluents commonly used, various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included .

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of suppository bases include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin, and the like.

A suitable dosage of the pharmaceutical composition of the present invention may be variously prescribed by such factors as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness . Typical dosages of the pharmaceutical compositions of this invention are in the range of 0.001-100 mg / kg on an adult basis.

The composition comprising the anthocyanin nanocomposite of the present invention can also be prepared from a quasi-product composition for improving male reproductive function.

The term "quasi-drug product" used in the present invention means products that are less active than drugs, among the products used for diagnosing, treating, improving, alleviating, treating or preventing diseases of human or animal. For example, Quasi-drugs are products that are used for the purpose of treating or preventing diseases of humans or animals, products that are mild or have no direct action on the human body.

The quasi-drug composition is used for the purpose of improving male reproductive function and is not particularly limited in its formulation. Examples thereof include soaps, cosmetics, wet tissues, tissue paper, shampoo, skin creams, , Perfume, sunscreen lotion, hair care product, air freshner gel or cleaning gel.

In each formulation, the quasi-drug composition may be blended with other components arbitrarily selected depending on the formulation of the other quasi-drugs, the purpose of use, and the like. The mixing amount of the active ingredient can be appropriately determined according to the intended use (inhibition or relaxation). For example, conventional adjuvants such as thickeners, stabilizers, solubilizers, vitamins, pigments and flavors, and carriers and the like.

In addition, in the quasi-drug composition of each formulation, components other than the above-mentioned essential components may be mixed and selected without difficulty by those skilled in the art depending on the formulation or purpose of use.

The composition comprising the anthocyanin nanocomposite of the present invention can also be manufactured from a health functional food composition for improving male reproductive function.

The term " health functional food " in the present invention refers to foods prepared and processed in the form of tablets, capsules, powders, granules, liquid solutions and rings using raw materials and components having useful functions in the human body. Here, 'functional' refers to the structure and function of the human body to obtain nutritional effects and obtain useful effects for health use such as physiological action. The health functional food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients that are conventionally added in the art. In addition, the formulations of the above health functional foods may also be manufactured without limitations as long as they are acceptable as health functional foods.

The health functional food composition according to the present invention may also be formulated in the form of a powder, a liquid, a tablet, a soft capsule, a granule, a tea bag, an instant tea or a drink. The content of the anthocyanin nanocomposite as the active ingredient can be appropriately determined depending on the intended use. Generally, the amount of the anthocyanin nanocomposite contained in the health functional food composition may be 0.1 to 90% by weight of the total food weight. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range.

The health functional food composition formulated in the above-described form can be added directly to the food or can be used together with other food or food ingredients, and can be suitably used according to a conventional method. Examples of food products include dairy products including drinks, meat, sausage, bread, biscuits, rice cakes, chocolate, candies, snacks, confectionery, pizza, ramen, other noodles, gums, ice cream, soups, , Dairy products and dairy products, and all health functional foods in the ordinary sense are included.

When the health functional food composition of the present invention is a drink, the anthocyanin nanocomposite is contained as an essential ingredient in the indicated ratio. There are no particular restrictions on other ingredients used for the purpose of manufacturing other drink products, and various flavors Or natural carbohydrate as an additional ingredient. Examples of such natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose and the like; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. Natural flavors and synthetic flavors and the like can be used as the flavors other than those described above. The ratio of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition, the health functional food composition of the present invention can be used as a nutritional supplement, a vitamin, a mineral (electrolyte), a flavoring agent such as a synthetic flavor agent and a natural flavor agent, a coloring agent and a thickening agent (cheese, chocolate etc.) Alginic acid and its salts, organic acids, protective colloid thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks and the like. In addition, the inventive food composition of the present invention may contain natural fruit juice and pulp for the production of fruit juice drinks and vegetable drinks. These components may be used independently or in combination. The proportion of such an additive is not so important, but is generally selected in the range of 0.1 to about 20 parts by weight per 100 parts by weight of the anthocyanin nanocomposite of the present invention.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Preparation of anthocyanin nanocomposite

The anthocyanin used in this example was isolated from black rice extract, and the black rice extract was supplied from RDA. 2 mg of anthocyanin and 10 mg of chondroitin sulfate were each dissolved in 1 ml of pH 3.0 phosphate buffer, and then the two solutions were evenly stirred and stored at 4 ° C for 24 hours to prepare an anthocyanin-chondroitin sulfate complex. The resulting complex was centrifuged at 13000 rpm for 10 minutes to remove supernatant, and the remaining complex was again dispersed evenly in 2 ml of pH 7 phosphate buffer.

In vitro in vitro ) Cell viability test

The immature mouse L. difficile cell line TM3 cells were purchased from Korean Cell Line Bank (Seoul, Korea) and cultured in DMEM supplemented with 10% heat-inactivated FBS (Fetal Bovine Serum; GIBCO) modified Eagle's medium / F-12 medium (GIBCO, Life Technologies Co., USA) at 37 ° C. Cells (75,000 cells / mL medium / well) were plated on 24 well clustered dishes unless otherwise indicated. Inoculated the cells 1X10 ⁴ to 96 well plates in 10% FBS / DMEM / F- 12 , and then were grown for 24 hours. After 24 hours, anthocyanin and anthocyanin nanocomposite, which are the treatment materials, were dispensed in 100 ul each. Dissolve 100 μl of DMEM / F12 medium at the time of dispensation, 100 μl of medium diluted with 100 μM of H ₂ O ₂ in DMEM / F12 at 2 nd column, and dilute 10 ug of anthocyanin in DMEM / F12 100 μl of anthocyanin was diluted in 100 μl each of DMEM / F12 and DMEM / F12. Anthocyanin A was diluted 100 μl each in DMEM / F12 and 100 μl of anthocyanin diluted in DMEM / F12 The diluted medium was dispensed in 100 μl each. In the 7th column AH, 100 μl of 10 μg of nanoanthocyanin diluted in DMEM / F12 was dispensed. In the 8th column AH, 100 μl of a diluted solution of nanoanthocyanin in DMEM / F12 was dispensed in 100 μl. 100 ug of nano-anthocyanin diluted in DMEM / F12 was dispensed in 100 μl of the medium. In the 10-column AH, 250 ug of nano-anthocyanin diluted in DMEM / F12 was diluted with 100 μl of each medium. H ₂ O ₂ 100 nM.

Thereafter, the cells were cultured in a CO ₂ incubator for 24 hours. After 24 hours of culture, all the medium was removed, and the cells were washed with DPBS. After washing, 10 ul of DMEM / F12 90 ul MTT solution was added per well and incubated in a CO ₂ incubator for 2 hours. After the incubation, the luminescence was measured using a luminescence detection device to confirm the survival rate of anthocyanin (ATC) and anthocyanin nanocomplex (ATC nanocomplex).

As a result, as shown in Fig. 1, when the same amount was administered, the survival rate of cells treated with anthocyanin nanocomposite was higher than that of the case treated with anthocyanin, and in particular, the cell survival rate of the anthocyanin nanocomposite treated group was remarkable Respectively.

As shown in FIG. 2, the cell survival rate of the anthocyanin nanocomposite-treated group was higher than that of the anthocyanin-treated group at all times, and the anthocyanin nanocomposite was observed at all times, In the group treated with 100 ug or more, cell survival rate of 80% or more was confirmed even after 48 hours.

These results indicate that the anthocyanin nanocomposite of the present invention is more effective in protecting the male reproductive function because it effectively protects the testicular cells from oxidative stress over a long period of time and thus effectively promotes cell survival rate.

Western Blot  analysis

In this Example, the amount of expression of Nrf2 and HO-1 protein was confirmed by Western blotting in order to confirm whether the cell survival rate enhancement effect confirmed in Example 2 was due to the antioxidant activity of the anthocyanin nanocomposite.

Western blotting was performed by standard methods. The same amount of protein was separated by SDS-PAGE gel electrophoresis and electrophoresed on Immun-Blot PVDF membrane (0.2 M pore size, Bio-Rad). Membranes were incubated in Tris-buffered saline, 0.05% (v / v) Tween-20, 150 mM NaCl, and 5% (w / v) BSA (bovine serum albumin, Santa Cruz Biotechnology, Santa Cruz, Blocked overnight at 4 ° C and incubated with diluted primary antibody in the same buffer for 2 hours. Immunoblot analysis was performed with anti-Nrf2 (1/250) and anti-HO-1 (1/1000) polyclonal antibodies (Abcam Co., UK). After washing with TBS-T (TBS, 0.1% Tween 20), the membrane was incubated with anti-rabbit IgG AP-conjugated secondary antibody and then washed with the same buffer. Immunoblotted membranes were developed with BCIP / NBT color-developer. Blots of the same sample were quantified by density measurement analysis using PDQuest software (Version 7.0, Bio-Rad, Hercules, Calif., USA).

As a result, as shown in FIG. 3, the anthocyanin and anthocyanin nanocomposite treated groups showed an increase in Nrf2 and HO-1 protein expression compared with the H ₂ O ₂ treated group. In particular, the anthocyanin nanocomposite treated group showed anthocyanin treatment And that the expression of Nrf2 and HO-1 protein was significantly increased. Thus, it can be seen that the anthocyanin complex of the present invention has remarkably excellent testis protective effect than anthocyanin.

real time PCR  analysis

SOD is an enzyme that acts as an antioxidant in cells exposed to reactive oxygen species caused by oxidative stress. It catalyzes the extracellular release by converting superoxide anions, which are active oxygen, into hydrogen peroxide, But it prevents cell damage from toxic active oxygen. However, when the SOD activity is reduced, the protective ability against oxidative stress is reduced, and peroxidation substances such as lipid peroxides accumulate and damage the function.

Thus, in this example, mRNA expression levels of Nrf2, HO-1 and SOD were measured by real-time PCR analysis to further confirm whether the cell viability-enhancing effect confirmed in Example 2 was due to the antioxidant activity of the anthocyanin nanocomposite.

To extract mRNA, TM3 cells were homogenized with TRIzol reagent (Invitrogen, Carlsbad, CA, US) and cDNA was synthesized using SuperScript 3 First-Strand kit (Invitrogen, Carlsbad, Calif., USA) . Primer Version 5.0 was used to determine gene-specific primers based on the corresponding mRNA sequences, and the results are shown in Table 1 below.

Gene GeneBank accession number
Sequence (5'3 ') DNA
Product length
(bp) Beta-actin NM_007393 F: CTGTCCCTGTATGCCTCTG
R: ATGTCACGCACGATTTCC 218 Nuclear factor erythroid 2-related factor 2
NM_010902 F: CAGTGCTCCTATGCGTGAA
R: GCGGCTTGAATGTTTGTC
109 Heme oxygenase-1 NM_010442 F: ACAGATGGCGTCACTTCG
R: TGAGGACCCACTGGAGGA 128 Superoxide dismutase NM_011434 F: AAGGCCGTGTGCGTGCTGAA
R: CAGGTCTCCAACATGCCTCT 80

PCR amplification of the cDNA was performed in a real-time PCR machine on plus (Applied Biosystems) with SYBR Green PCR Master Mix (Invitrogen) as indicated: 2 min at 50 ° C for dUTP activity, After 10 minutes at 95 캜, each cycle consisting of 15 seconds denaturation at 95 캜 and 60 seconds at 60 캜 for primer annealing and chain extension was performed for 40 cycles.

As a result, as shown in FIG. 4, the levels of mRNA transcripts of Nrf2, HO-1 and SOD were increased in TM3 cells treated with anthocyanin and anthocyanin nanocomposite. Especially, anthocyanin nanocomposite was treated with anthocyanin And the levels of mRNA transcripts of Nrf2, HO-1 and SOD were significantly increased.

3 and 4 show that the anthocyanin nanocomposite enhances the antioxidant defense system in the oxidative stress induced TM3 cells through activation of Nrf2 and upregulation of antioxidant enzyme activity.

As described above, the anthocyanin nanocomposite of the present invention is excellent in the effect of alleviating the oxidative stress in the testicular cells induced by oxidative stress and exhibits excellent testis protection effect. Therefore, the pharmaceutical composition for improving male reproductive function and the health functional food Can be usefully used.

[ Manufacturing example  1] Manufacture of health functional foods

1-1. Manufacture of Health Functional Foods

A health functional food containing the anthocyanin nanocomposite was prepared with the composition shown in Table 2 below.

Furtherance Manufacturing example  1-1 Anthocyanin chondroitin
Sulfate nanocomposite 1000 mg Vitamin mixture Suitable amount Vitamin A acetate 1.0 mg Vitamin E 0.13 mg Vitamin B1 0.15 mg Vitamin B2 0.5 mg Vitamin B6 0.2 [mu] g Vitamin B12 10 mg Vitamin C 10 [mu] g Biotin 1.7 mg Nicotinic acid amide 50 [mu] g Folic acid 0.5 mg Calcium pantothenate Suitable amount Mineral mixture Suitable amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium monophosphate 15 mg Dibasic potassium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a component suitable for a health functional food as a preferred embodiment, the compounding ratio may be arbitrarily modified, and the above components may be mixed The granules can then be prepared and used in the manufacture of a health functional food composition according to conventional methods.

1-2. Manufacture of health drinks

Health drinks containing anthocyanin nanocomposites were prepared with the compositions shown in Table 3 below.

Furtherance Manufacturing example  1-2 (mg) Anthocyanin chondroitin sulfate nanocomposite 1000 mg Citric acid 1000 mg oligosaccharide 100 g Plum concentrate 2 g Taurine 1 g Purified water Suitable amount

The above components were mixed according to a conventional health drink manufacturing method, and the resulting solution was stirred and heated at 85 DEG C for about 1 hour. The resulting solution was filtered and sterilized in 21 containers for sterilization, Used in the manufacture of health beverage compositions. Although the composition ratio is a mixture of the components suitable for the preferred beverage as a preferred embodiment, the compounding ratio may be arbitrarily varied depending on the regional and national preferences such as the demand level, the demanding country, and the intended use.

1-3. Manufacture of tablets

Tablets containing the anthocyanin nanocomposite were prepared according to the conventional tablet preparation method with the composition shown in Table 4 below.

Furtherance Manufacturing example  1-3 (mg) Anthocyanin chondroitin sulfate nanocomposite 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

1-4. Preparation of capsules

The composition of Table 5 was filled in gelatin capsules according to the conventional capsule preparation method to prepare capsules containing the anthocyanin nanocomposite.

Furtherance Manufacturing example  1-4 (mg) Anthocyanin chondroitin sulfate nanocomposite 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

1-5. Manufacture of rings

In the composition shown in the following Table 6, a ring was prepared so as to be 4 g per one ring according to a conventional ring production method.

Furtherance Manufacturing example  1-5 (mg) Anthocyanin chondroitin sulfate nanocomposite 1 g Lactose 1.5 g glycerin 1 g Xylitol 0.5 g

1-6. Manufacture of granules

In the composition shown in Table 7 below, 100 mg of 30% ethanol was added and the mixture was dried at 60 ° C to form granules, and the granules were filled in vials.

Furtherance Manufacturing example  1-6 (mg) Anthocyanin chondroitin sulfate nanocomposite 150 mg Soybean extract 50 mg glucose 200 mg Starch 600 mg

[ Manufacturing example  2] Manufacture of quasi-drugs

2-1. Manufacture of cream

A cream containing the anthocyanin nanocomposite was prepared with the composition shown in Table 8 below.

Furtherance Manufacturing example  2-1 (% by weight) Anthocyanin chondroitin sulfate nanocomposite 0.2 Stearic acid 15.0 Cetanol 1.0 Potassium hydroxide 0.7 glycerin 5.0 Propylene glycol 3.0 antiseptic Suitable amount incense Suitable amount Purified water to 100

2-2. Manufacture of cleaning agent

A cleaning agent containing the anthocyanin nanocomposite was prepared with the composition shown in Table 9 below.

Furtherance Manufacturing example  2-2 ( weight% ) Anthocyanin chondroitin sulfate nanocomposite 5.0 Triethanolamine 10.0 Myristic acid 9.0 Lauric acid 5.0 Triethanolamine cocoyl glutamate 7.0 Spices Suitable amount Preservatives, antioxidants Suitable amount glycerin 3.0 Purified water to 100

<110> THE CATHOLIC UNIVERSITY OF KOREA INDUSTRY-ACADEMIC COOPERATION FOUNDATION <120> Composition for improving male reproduction          anthocyanin nanocomplex <130> 1061058 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Beta-actin forward primer <400> 1 ctgtccctgt atgcctctg 19 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Beta-actin reverse primer <400> 2 atgtcacgca cgatttcc 18 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Nuclear factor erythroid 2-related factor 2 forward primer <400> 3 cagtgctcct atgcgtgaa 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Nuclear factor erythroid 2-related factor 2 reverse primer <400> 4 gcggcttgaa tgtttgtc 18 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Heme oxygenase-1 forward primer <400> 5 acagatggcg tcacttcg 18 <210> 6 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Heme oxygenase-1 reverse primer <400> 6 tgaggaccca ctggagga 18 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Superoxide dismutase forward primer <400> 7 aaggccgtgt gcgtgctgaa 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Superoxide dismutase reverse primer <400> 8 caggtctcca acatgcctct 20

Claims (7)

A composition for improving male reproductive function comprising an anthocyanin nanocomposite. The composition of claim 1, wherein the anthocyanin nanocomposite is an anthocyanin and chondroitin sulfate ion-bound. 3. The composition of claim 2, wherein the anthocyanin and chondroitin sulfate are mixed in a weight ratio of 0.1: 1 to 10: 1. 3. The composition of claim 2, wherein the anthocyanin is isolated from a black rice extract. 2. The composition of claim 1, wherein the anthocyanin nanocomposite increases the expression of NF2 (NF-E2-related factor-2), HO-1 (Heme oxygenase-1) or SOD (superoxide dismutase). A health functional food composition for improving male reproductive function comprising the composition of claim 1 as an active ingredient. The health functional food composition according to claim 6, wherein the health functional food composition is one selected from the group consisting of tablets, granules, powders, capsules, liquid solutions and rings.

Images