KR20180007918A - Insulin receptor-specific DNA aptamer and uses thereof - Google Patents

Abstract

The present invention relates to an insulin receptor-specific DNA aptamer and to uses thereof. The DNA aptamer of the present invention specifically binds to and activates an insulin receptor, thereby inducing a signal transduction process for cell growth and division, thereby promoting the growth and division of animal cells. Therefore, the DNA aptamer of the present invention can be used as a culture medium for animal cells or as a raw material for functional cosmetics and the like.

Description

DNA aptamers that specifically bind to insulin receptors and uses thereof < RTI ID = 0.0 >

The present invention relates to a DNA aptamer that specifically binds to an insulin receptor and uses thereof.

The way to produce protein products using life forms has long been used by mankind, but the modern concept of biotechnology is usually associated with genetic engineering and recombinant DNA technology. The development of biopharmaceuticals began with the universalization of gene recombination techniques in the 1970s, and recombinant human insulin for the treatment of diabetes using E. coli is a typical example. Diagnosis and treatment of disease are the focus of the biotechnology industry and biotechnologists are using biological systems to produce these products. For the production of biopharmaceuticals, conventional microbial cultures were mainly used at the early stage. However, certain proteins may not show biological activity when they are produced from microorganisms. Therefore, post-translational modification after protein production or proper protein folding Eukaryotic cells need to be used for the production of biologically active proteins.

It is known that the post-translational modifications of medicinal proteins have important effects on therapeutic efficacy, stability in the body, and immune side effects, so that the development of a technology capable of producing a protein having the same or higher quality than the circular protein It is becoming important. As a result, animal cell culture technology has been started as a part of biopharmaceutical development since the mid 1980's and has been used to develop various kinds of new drugs. Currently, it has succeeded in industrialization and commercialized biopharmaceuticals using animal cell culture technology · It is being sold.

Since in vitro animal cell culture systems have been established, sera have been used extensively in the survival and proliferation of primary cells and established cell lines. Serum is an essential component for culturing animal cells. Serum containing various substances contains not only unknown components, but also the content of constituents is significantly different depending on the sex, age, and nutritional status of the feed animals, Because the serum is taken from the fetus, the quality of the product may vary according to the level of the equipment and technology of the supplier. Since the components of serum are not the same depending on the production period, a series of experiments Or that the lot number should be the same for the production of biotechnology products, ie the sera produced simultaneously.

There are insulin, hormones and growth factors such as EGF and PDGF in the serum, and insulin plays an important role in controlling glucose homeostasis and metabolism. The insulin receptor is one of the receptors fixed on the cell surface and is involved in the absorption of insulin into the body. When the insulin is bound to the insulin receptor, the insulin receptor itself is autophosphorylated, and the phosphorylated amino acids phosphorylate the other amino acids in the periphery, resulting in a cascade of signal transduction processes, which can lead to cell growth and metabolic regulation, Cell division and so on.

Thus, the present inventors have completed the present invention by selecting a DNA aptamer that specifically binds to an insulin receptor protein as a functional material that can be added in place of serum required for animal cell culture.

Korean Patent No. 10-1457509 Korean Patent No. 10-1602689

Accordingly, an object of the present invention is to provide a DNA aptamer that specifically binds to an insulin receptor and a method for producing the same.

Another object of the present invention is to provide an animal cell culture medium containing the DNA aptamer.

It is still another object of the present invention to provide a functional cosmetic composition comprising the DNA aptamer.

In order to attain the above object, the present invention provides a DNA aptamer which specifically binds to an insulin receptor protein having a nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 10 do.

In one embodiment of the present invention, the DNA aptamer may further include a labeling substance. Examples of the labeling substance include, but are not limited to, a fluorescent substance, an amine group, a biotin, and a thiol group. In one embodiment of the present invention, the labeling substance may be labeled at the 5 'end or the 3' end of the DNA aptamer.

In one embodiment of the present invention, the DNA aptamer is selected from the group consisting of a hydrogen atom, a fluorine atom, -OR, -COOR, and an amino group, wherein the hydroxy group of the ribose 2 'position of the at least one nucleotide constituting the DNA aptamer And may be substituted with any one of them.

In one embodiment of the present invention, the insulin receptor protein may be a human insulin receptor protein (SEQ ID NO: 15) or a His-fused insulin receptor protein.

Also, the present invention provides an animal cell culture medium comprising at least one DNA aptamer selected from oligonucleotides consisting of SEQ ID NO: 1 to SEQ ID NO: 10. In one embodiment of the present invention, the medium is preferably a serum-free or low serum medium. In one embodiment of the present invention, the DNA aptamer is used to replace insulin.

The present invention also provides a functional cosmetic composition comprising at least one DNA aptamer selected from oligonucleotides consisting of SEQ ID NO: 1 to SEQ ID NO: 10 as an active ingredient. In one embodiment of the present invention, the composition is characterized in promoting the growth or division of skin cells.

(A) amplifying a random DNA aptamer pool using a PCR technique; (b) preparing ssDNA using heat-cooling technique and streptavidin; (c) mixing the IR protein or His-fused IR protein with the aptamer pool; (d) reacting the IR protein or His fusion IR protein and aptamer pool mixture with a pre-activated Ni-NTA agarose; (e) removing a DNA aptamer that does not bind specifically to the IR protein or the His fusion IR protein; And (f) recovering a DNA aptamer that specifically binds to an IR protein or a His fusion IR protein, wherein the DNA aptamer specifically binds to an insulin receptor protein.

In one embodiment of the present invention, the preparation method is a step of selecting a DNA aptamer that specifically binds to an IR protein or a His fusion IR protein and includes a real-time PCR step for SELEX round selection with optimal affinity ; PCR and cloning steps for selection of IR protein or His fusion IR protein binding DNA aptamer candidates in the optimal SELEX round; Measuring the affinity of the IR protein or His fusion IR protein binding DNA aptamer candidate group to the IR protein or His fusion IR protein; And determining the DNA sequence of the selected IR protein or His fusion IR protein-binding DNA aptamer candidate group. The method may further comprise the step of selecting a DNA aptamer that specifically binds to an IR protein or a His fusion IR protein have.

The DNA aptamer of the present invention specifically binds to an insulin receptor and activates it, thereby inducing a signal transduction process for cell growth and division, thereby promoting the growth and division of animal cells. Therefore, the DNA aptamer of the present invention can be used as a culture medium for animal cells or a raw material for functional cosmetics. In particular, the DNA aptamer of the present invention is expected to replace the insulin in the serum and solve the supply and price instability which is a problem of animal cell culturing currently used for production of medical proteins and antibodies.

1 is a schematic diagram showing a signal transduction pathway in which insulin is bound to an insulin receptor.
2 is a schematic diagram of a SELEX process for screening for an aptamer that specifically binds to an insulin receptor.
FIG. 3 shows the result of purifying a PCR product amplifying DNA aptamer. Lane M is a 100 bp DNA marker, and lane 1 is a purified dsDNA aptamer.
FIG. 4 is a graph showing the concentration of a DNA aptamer eluted while conducting a SELEX process for screening a DNA aptamer that specifically binds to an insulin receptor.
Figures 5 (a) and 5 (b) show the structures of candidate IR protein-binding DNA aptamer candidates determined using the DNA mfold program.
FIG. 6 shows the relative number of cells cultured in the aptamer-supplemented medium according to the incubation time.
FIG. 7 shows the results of measuring the degree of phosphorylation of the insulin receptor by ELISA in cells cultured in a culture medium supplemented with aptamer.

Hereinafter, the present invention will be described in detail. In the following description, detailed description of known techniques well known to those skilled in the art may be omitted. In the following description of the present invention, a detailed description of known functions and configurations incorporated herein will be omitted when it may make the subject matter of the present invention rather unclear. In addition, terms used in this specification are terms used to appropriately express the preferred embodiments of the present invention, which may vary depending on the user, the intention of the operator, or the practice of the field to which the present invention belongs. Therefore, the definitions of these terms should be based on the contents throughout this specification. Throughout the specification, when an element is referred to as "comprising ", it means that it can include other elements as well, without excluding other elements unless specifically stated otherwise.

The present invention relates to a DNA aptamer that specifically binds to an insulin receptor (IR) and uses thereof.

"Insulin receptor (IR) protein" is one of the transmembrane receptors that are activated by insulin and IGF-1, IGF-2 and plays an important role in glucose homeostasis, cell growth and cell division control in cell metabolism . The IR protein is composed of two subunits (alpha-subunit and beta-subunit) that form dimers, all alpha-subunits are located outside the cell and an insulin binding site is present. Most of the beta-subunit penetrates the cell membrane, is present in the cell, and has an insulin-regulated tyrosine protein kinase. When insulin binds to the binding site of the IR protein alpha-subunit, a specific tyrosine of the beta-subunit is phosphorylated to mediate its activity. Phosphorylated tyrosine phosphorylates the surrounding amino acids, and this phosphorylation process results in a sequential signal transduction process. This signal transduction process promotes cell growth and division, and activates important cellular functions (see FIG. 1).

The term " DNA aptamer " as used herein refers to a DNA nucleic acid molecule capable of binding with high affinity and specificity to a specific molecule. As used herein, the term " DNA aptamer " is used interchangeably with " DNA oligonucleotide ". The aptamer is a short-chain oligomer that forms a stable tertiary structure and has a specific binding property to the target substance. Aptamers are composed of nucleic acids such as DNA or RNA. They are more stable than antibodies composed of proteins and have the advantage of being able to specifically bind to various target substances (proteins, peptides, metals, chemicals, etc.). In addition, since it can be manufactured using chemical synthesis technique, it can be mass-produced in a short time and at a low cost, and has an excellent advantage of continuously producing an aptamer having the same ability once production and production. In addition, it is highly stable in the surrounding pH and temperature, and it is highly evaluated that it can be used in a variety of fields such as environment and medical care, such as detection of a target substance and development of a disease diagnosis sensor.

In one embodiment of the present invention, the DNA aptamer specifically binding to the IR protein has any one of the nucleotide sequences selected from the group consisting of SEQ ID NOS: 1 to 10, Lt; / RTI > nucleotides, or oligonucleotides having a nucleotide sequence that has at least% identity. In addition, the DNA aptamer can specifically bind human IR protein or His fusion IR protein. The DNA aptamer may be one in which the hydroxy group at the ribose 2 'position of one or more nucleotides constituting the DNA aptamer is substituted with any one selected from the group consisting of a hydrogen atom, a fluorine atom, -OR, -COOR and an amino group. The DNA aptamer may further comprise a labeling substance, and the labeling substance may be a labeling substance selected from the group consisting of a fluorescent substance, an amine group, a biotin and a thiol group, 3 ' terminal.

The term " oligonucleotide " as used herein generally refers to a nucleotide polymer having less than about 200 lengths, including DNA and RNA, preferably DNA nucleotide molecules. The nucleotide can be any substrate that can be introduced into the polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or by DNA or RNA polymerases or by synthetic reactions. If a modification to the nucleotide structure is present, such modification may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. The oligonucleotides can be further modified after synthesis, for example by binding with a label.

The DNA aptamers of the present invention are typically obtained by in vitro selection for binding of the target molecule. Methods for selecting an aptamer that specifically binds to a target molecule are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on a cell surface, ions, metals, salts, polysaccharides can be suitable target molecules for separating aptamers that can specifically bind to each ligand . Selection of an aptamer can utilize in vivo or in vitro selection techniques known by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. Science 249, 505-10, 1990). Specific methods for screening and manufacturing the aptamer are described in U.S. Patent 5,582,981, WO 00/20040, U.S. Patent 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and U.S. Patent 5,756,291, Are incorporated herein by reference.

The DNA aptamer specifically binding to the IR protein of the present invention is preferably an oligonucleotide having any one of base sequences selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 10. This DNA aptamer is presumed to form the secondary structure shown in Fig. 5 herein. In addition, the DNA aptamer specifically binding to the IR protein of the present invention may have substantially the same identity with any one of the nucleotide sequences selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1 to 10, The oligonucleotide having the nucleotide sequence represented by SEQ ID NO.

The above-mentioned substantial identity is determined by aligning the nucleotide sequence of the present invention with any other sequence as much as possible and using an algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 Hewgins and Sharp, Gene 73: 237-44 (1988), pp. 243-47 (1988); Hewlett-Packard et al. ; Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc Acids Res. 16: 10881-90 (1988); Huang et al., Comp. At least 90% identity, more preferably at least 95% identity, and at least 95% homology, when analyzed for an aligned sequence, using the amino acid sequence of SEQ ID NO: 1 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 Or more identity, and most preferably at least 98% identity with the nucleotide sequence of SEQ ID NO: 1.

In another aspect, the present invention provides a method of amplifying a random DNA aptamer pool comprising the steps of: (a) amplifying a random DNA aptamer pool using a PCR technique; (b) heat-cooling technique and ssDNA preparation using streptavidin; (c) mixing an IR protein or His fusion IR protein with an aptamer pool; (d) reacting an IR protein or His fusion IR protein and aptamer pool mixture with a preactivated Ni-NTA agarose; (e) removing a DNA aptamer that does not bind specifically to the IR protein or the His fusion IR protein; And (f) recovering a DNA aptamer that specifically binds to an IR protein or a His fusion IR protein, wherein the DNA aptamer specifically binds to an IR protein (see FIG. 2).

In one embodiment of the present invention, the screening of a DNA aptamer that specifically binds to the IR protein of the present invention is performed by using a His tagged protein purification technique. First, an IR A method for recovering a DNA aptamer that specifically binds to a histidine-fused IR protein by binding to a Ni-NTA agarose after reacting a complex of a protein with a DNA aptamer pool.

Meanwhile, the DNA aptamer of the present invention specifically binds to an insulin receptor and activates it, thereby inducing a signal transduction process for cell growth and cleavage, thereby promoting the growth and division of animal cells (Figs. 6, 7).

Therefore, the DNA aptamer of the present invention can be used as a culture medium additive for animal cells. In the present invention, an animal cell is a functional and structural basic unit originating from an animal including a human being, and any cell originating from an animal including a human being is included in the scope of the present invention. Accordingly, animal cells of the present invention include, but are not limited to, stem cells, muscle cells, germ cells, cells in skin (e.g., fibroblasts, keratinocytes) and the like. In one embodiment of the present invention, the culture medium is preferably a serum-free or low-serum medium, but is not limited thereto. &Quot; Serum-free " or " low serum " medium means any animal cell culture medium that does not contain more than a certain amount of serum derived from an animal, including a human. The animal cell culture medium may be selected from a suitable cell culture medium (for example, DMEM medium, HAM medium, IMDM medium, RPMI 1640 medium, etc.) known in the art. These media can include salts, vitamins, buffers, energy sources, amino acids, and other materials. These media also include general nutrients for cell growth. The DNA aptamer of the present invention can promote and activate the proliferation of cells in the medium even if it is added to the medium in place of the animal-derived serum. In one embodiment of the present invention, the serum-free medium for animal cell culture may contain an antibiotic, an antifungal agent, and a mycoplasma inhibitor causing contamination if necessary. If necessary, an oxidizing nutrient such as glutamine, An additional energy metabolite such as bait may be added.

In another embodiment, the DNA aptamer of the present invention provides a functional cosmetic composition capable of promoting growth or division of skin cells by utilizing animal cell growth and cleavage promoting effect. The function refers to the growth and cleavage of skin cells, which means alleviating, suppressing or improving the phenomenon appearing on the appearance of the skin due to a cause such as skin disease or skin cell dysfunction or loss. Specifically, the functional cosmetic composition of the present invention is expected not only to regenerate skin but also to alleviate skin diseases, improve wrinkles, inhibit skin aging, improve skin elasticity, and restore skin wounds.

In one embodiment of the present invention, the functional cosmetic composition of the present invention can be prepared into any formulation conventionally used in the art. Examples of such formulations include, but are not limited to, gels, creams, lotions, oils, solutions, suspensions, emulsions, pastes, powders, soaps, surfactant-containing cleansing, powder foundations, emulsion foundations, wax foundations, It is not. The cosmetic composition of the present invention may contain an active ingredient and a carrier ingredient. For example, when the formulation of the cosmetic is paste, cream or gel, animal or vegetable oil, wax, paraffin, starch, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component, When the formulation is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. When the formulation is a solution or an emulsion, a solvent, Or emulsifying agents may be used. In addition, the cosmetic composition of the present invention may contain auxiliary agents such as antioxidants, stabilizers, solubilizers, vitamins, pigments, and perfumes which are commonly used in cosmetic compositions, in addition to the active ingredient and carrier component.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

≪ Example 1 >

IR protein selection and His fused recombinant IR protein preparation

<1-1> Selection of IR protein

IR protein is a receptor capable of binding to insulin, one of the hormones present in the serum. It is a protein that contributes greatly to the acceptance of insulin, which plays a major role in cell growth and cell division and regulation of glucose homeostasis.

In this study, we have selected IR protein as a target to replace insulin so that DNA aptamer can activate important intracellular functions such as cell growth and cell division.

His-fused recombinant IR protein from R & D SYSTEMS was purchased and used to make an IR-specific aptamer to produce an aptamer for the IR protein.

&Lt; Example 2 >

Production of DNA aptamer

<2-1> Random DNA library amplification using PCR technique

To prepare a DNA aptamer that specifically binds to the IR protein, 100 bp of template DNA (5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT) containing 40 random sequences in a ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: (SEQ ID NO: 12) and reverse primer: 5'-AGATTGCACTTACTATCT-3 '(SEQ ID NO: 11) capable of amplifying it by 100 bp (forward primer: 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT- (SEQ ID NO: 13), biotinylated reverse primer: 5'-biotin-AGATTGCACTTACTATCT-3 '(SEQ ID NO: 14)) was prepared from Bionyard.

An arbitrary DNA library was amplified using the PCR technique. The PCR reaction composition for amplification of the 100 bp DNA library was 1 μl of template DNA, 5 μl of 10 × PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 10 pM forward primer, 2 μl of 10 pM biotinylated reverse primer, 0.3 μl (1 unit / μl) of Ex Taq polymerase (Takara, Japan) and 35.7 μl of distilled water. The PCR reaction conditions were first denaturation at 95 ° C for 4 minutes, 15 cycles of reaction at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 7 minutes Respectively. After the PCR reaction, 4 μl was taken and amplification products were confirmed by 2% agarose gel electrophoresis to determine whether the band appeared at 100 bp. The DNA library obtained through PCR was purified using a PCR purification kit (Qiagen, USA) and recovered using 50 μl of distilled water (FIG. 3).

<2-2> Production of ssDNA using heating-cooling technique

50 μl of DNA library recovered by PCR method and PCR purification kit was added with 50 μl of distilled water to adjust the volume to 100 μl and denaturation of dsDNA with ssDNA using heating- ). Specifically, the dsDNA obtained using the PCR technique and the PCR purification kit was reacted at 85 ° C for 5 minutes to denature the dsDNA with ssDNA. After completion of the reaction, the reaction solution was cooled to 4 ° C to obtain ssDNA Respectively.

<2-3> Screening and recovery of ssDNA

In order to remove biotin-bound ssDNA and primer from the ssDNA product obtained using the heating-cooling technique and to ensure pure ssDNA only in the forward direction, 100 μl of the reaction solution obtained in the above Example was added with streptose 50 μl of streptavidin agarose resin (Thermo Scientific, USA) was added, and reacted at room temperature for 1 hour. The reaction solution was centrifuged at 4,000 rpm for 10 minutes using a centrifuge at 13,000 rpm and then only the supernatant was recovered and treated with the same volume of PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1) And centrifuged at 13,000 rpm for 15 minutes to collect only the supernatant. To the supernatant, 1/100 volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70 ° C for 2 hours or more. After the reaction, only the ssDNA was recovered by centrifugation at 13,000 rpm for 20 minutes at 4 ° C. The recovered ssDNA was dried at 65 ° C and dissolved in 50 μl of distilled water.

&Lt; Example 3 >

Screening for DNA aptamers that specifically bind to recombinant IR proteins using the SELEX technique

<3-1> Composition of each solution used in SELEX

The solutions used for SELEX were Ni-NTA Agarose (Qiagen, USA) and the composition was as follows. Namely, 1X aptamer selection solution (pH 7.9): 500 mM NaCl, 20 mM Tris-HCl, 5 mM immidazole, 2X aptamer sorting solution (pH 7.9): 300 mM NaCl, 40 mM Tris-HCl, 10 mM immidazole, 2 mM MgCl 2, pH 7.2): 137mM NaCl, 2.7mM KCl, 10mM Na 2 HPO 4, 1.8mM KH 2 PO 4, DNA aptamer elution solution (pH 7.2): 137mM NaCl, 2.7mM KCl, 10mM Na 2 HPO 4, 1.8mM KH ₂ PO _4.

<3-2> Construction of a DNA aptamer structure for SELEX

50 μl of 2 × DNA aptamer screening solution was added to 50 μl of ssDNA prepared through Example <2-3>, and the reaction volume was adjusted to 100 μl. The reaction volume was boiled at 85 ° C for 5 minutes to denature the reaction solution, Slowly cooled to form a stable three-dimensional structure of ssDNA aptamer.

<3-3> Screening of DNA aptamers specifically binding to IR proteins using Ni-NTA agarose purification kit

4 μl (30.16 pmol) of the His fusion IR protein purchased in Example 1 was adjusted to a total reaction volume of 100 μl with a 1 × aptamer screening solution, and then the ssDNA aptamer pool obtained in Example <3-2> (323.1.8 pmol) at a ratio of 1:10 and reacted at 4 ° C for 24 hours. To remove the preservation solution of the Ni-NTA agarose purification kit, 200 쨉 l of Ni-NTA agarose was centrifuged at 13,000 rpm for 10 minutes at 4 째 C to remove the supernatant.

To activate the Ni-NTA agarose purification kit, 500 μl of 1 × aptamer screening solution was added, and the mixture was reacted at 4 ° C. for 10 minutes with stirring. After activation, the mixture was centrifuged at 13,000 rpm for 5 minutes at 4 ° C., . After repeating the above procedure twice, the reaction mixture in which the His fusion IR protein and the ssDNA aptamer paste were reacted was reacted with the activated Ni-NTA agarose at 4 ° C for 1 hour with stirring. Thereafter, the supernatant was removed by centrifugation at 13,000 rpm for 10 minutes at 4 ° C, and 500 μl of the washing solution was added to wash the solution. The ssDNA aptamer which was not bound to the His fusion IR protein was removed three times.

To elute the DNA aptamer specifically binding to the His fusion IR protein from the Ni-NTA agarose, 200 μl of the DNA aptamer elution solution was added, boiled at 85 ° C for 5 minutes, reacted at 4 ° C for 5 minutes, , And centrifuged at 13,000 rpm for 10 minutes at 4 DEG C to obtain an eluted solution of the upper layer. The above procedure was repeated twice to obtain an elution solution of the upper layer.

In order to remove the His fusion IR protein from the binding between the His fusion IR protein and the DNA aptamer specifically binding thereto, the same volume of the PCI solution was treated with the elution solution, followed by centrifugation at 13,000 rpm for 15 minutes at 4 ° C Only the supernatant was recovered. Then, to recover only the DNA aptamer that specifically binds to the His fusion IR protein, 1/100 volume of tRNA and 3 volume of 100% ethanol were added to the recovered supernatant through the PCI method, and the mixture was incubated at -70 ° C for 2 hours The reaction mixture was subjected to centrifugation at 4 ° C and 13,000 rpm for 20 minutes. Thus, DNA aptamers specifically binding to IR proteins could be recovered. The recovered DNA aptamers were dried at 65 ° C and dissolved in 50 μl of distilled water.

<3-4> Negative selection for nonspecific DNA aptamer removal

In order to remove nonspecific DNA aptamers selected by binding to histidine residues and agarose that are not IR proteins, DNA was added to Ni-NTA agarose in which only histidine amino acid was immobilized without IR protein between 5 and 6 times of SELEX Negative selection was performed to bind the aptamer solution. Thereafter, SELEX was performed up to a total of 10 times in the same manner as 3-3 to obtain an aptamer that specifically binds to the target IR protein.

<Example 4>

Selection of SELEX rounds for screening optimal DNA aptamers specifically binding to His fusion IR proteins

<4-1> Confirmation of each round's affinity using nano drop

After completion of the SELEX 10 times, the concentration of eluted ssDNA in each round was measured using a Nano drop Micro spectrophotometer to quantitatively confirm the progress of SELEX and the affinity of eluted ssDNA aptamer in each round Respectively. As a result of measuring the concentration of ssDNA aptamer eluted in each round using nano-drop, the concentration of 8 rounds was the highest at 167.8 ng / μl after negative screening, and the concentrations of 9 rounds and 10 rounds were 149.4 ng / μl And 161.1 ng / μl, respectively. As a result, it was confirmed that the optimal aptamer pool that is most specifically bound to the His fusion IR protein after the negative screening was an 8 round pool 4).

<4-2> Identification of optimal round using real-time PCR technique

Real-time PCR was performed to confirm the progress of SELEX progression and the affinity of eluted DNA aptamer quantitatively after each round of SELEX. First, the ssDNA aptamers eluted at the 6th round, 7th round, 8th round, 9th round and 10th round after the initial DNA library and negative screening were amplified using the PCR technique, and the ssDNA was secured using the heat- Respectively. The ssDNA aptamer pools obtained at 6, 7, 8, 9, and 10 rounds were prepared at the same concentration and reacted with the same concentration of His fusion IR protein at 4 ° C for 24 hours or longer. The reaction solution was reacted with activated Ni-NTA agarose for 1 hour, and centrifuged at 13,000 rpm for 10 minutes at 4 ° C to remove the supernatant. After washing with washing solution three times, the ssDNA not binding to the His fusion IR protein was removed, and the DNA aptamer bound to the His fusion IR protein was recovered by reacting with the aptamer elution solution. The His-fused IR protein and the DNA aptamer bound to the recovered His-fused IR protein were treated with the same volume of PCI to remove the His fusion IR protein. Then, 1/100 volume of tRNA of the recovered solution and 3 volumes of 100% For 2 hours or more. The recovered DNA was dried at 85 ° C and dissolved in 50 μl of distilled water. Each of the obtained ssDNAs was diluted to 8 ⁰ and 8 ^-1 and 8 ^-2 , respectively, and used as a template DNA for real-time PCR.

Real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad, USA). The real-time PCR conditions were 95 ° C for 20 sec, 55 ° C for 20 sec, and 72 ° C for 20 min. The reaction was repeated for 40 cycles, followed by extension at 72 ° C for 5 minutes. Real-time PCR results could be obtained the results from the experiments with the samples diluted to ^8-1 as template DNA. The real-time PCR Ct values were 11.68, 11.93, 10.20, 11.48 and 12.59 in the 6th, 7th, 8th, 9th and 10th rounds, respectively. It was confirmed that 8 rounds of ssDNA aptamers were full of a higher concentration of aptamer than 6, 7, 9, and 10 rounds, and no more SELEX progression was required (see Table 1). It is confirmed that this is consistent with the results of the aptamer concentration measurement recovered in each round confirmed using nano drop. From the nano drop and real time PCR results, it was confirmed that the 8 rounds of Aptamer paste showed the highest binding efficiency to the His fusion IR protein.

Real-time PCR analysis of SELEX rounds 6R (1 X 8 ^-1 ) 7R (1 X 8 ^-1 ) 8R (1 X 8 ^-1 ) 9R (1 X 8 ^-1 ) 10R (1 X 8 ^-1 ) Ct value 11.68 11.93 10.20 11.48 12.59

&Lt; Example 5 >

Obtain a candidate for DNA aptamer that specifically binds to IR protein

5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-N40-AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 11) and reverse primer (SEQ ID NO: 11) were prepared for eight rounds of ssDNA aptamer pools which were found to have the highest affinity with His fusion IR protein through nano- : 5'-AGATTGCACTTACTATCT-3 '(SEQ ID NO: 13) to obtain dsDNA.

The thus-obtained dsDNA was cloned using a T-blunt cloning kit (SolGent, Korea). For cloning, 1 μl of T-vector (10 ng / μl), 4 μl of PCR product (20 ng / μl) and 1 μl of 6 × T-blunt buffer were mixed and reacted at 25 ° C for 10 minutes. T-blunt cloning 6 μl of the reaction mixture was mixed with 100 μl of DH5α, heat shocked at 42 ° C for 30 seconds, and reacted on ice for 2 minutes. Then, 900 占 퐇 of SOC (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose) medium was added and cultured at 37 占 폚 for 1 hour Respectively.

Then, 200 μl of the culture was taken and cultured in LB containing ampicillin (50 μg / ml), kanamycin (50 μg / ml), X-gal (50 μg / ml) and IPTG (Solgent, Korea). After sequencing, 42 non-overlapping white colonies were selected, and the nucleotide sequence of each colony was determined (Solgent, Korea) We were able to obtain 10 IR protein binding DNA aptamers. Table 2 below shows the sequences of 10 IR protein-binding DNA aptamer candidates obtained using the Ni-NTA agarose IR protein-binding DNA aptamer selection SELEX technique.

Selected IR protein-binding DNA aptamer candidates Clone name SEQ ID NO: The selected sequence (5'-3 ') Sequence length (bp) IR-1 SEQ ID NO: 1 CTACAGCGTTAGTCTCAACTGCCTCTCGTGTACATGCTTG 40 IR-2 SEQ ID NO: 2 GCGTGATATAGACGGTTTCTCCTAATAACTTATTTGACGG 40 IR-3 SEQ ID NO: 3 TCCATGTAGTGGCCGCATAAAGGCTTATGATCGTTCGTTG 40 IR-4 SEQ ID NO: 4 CAACATCGGCTTGCAATCTCCAAGGCTTCCTTACAGCGCA 40 IR-5 SEQ ID NO: 5 GCGCTCCATCAGCAATGGCAGCCTCGCACGTCATCGTTTG 40 IR-6 SEQ ID NO: 6 CCATTGCGGGAATTATTGTCTGCTCGTTCAGTCTCTGTGA 40 IR-7 SEQ ID NO: 7 TCACACGCTCCCTTAGGCTGCTCAGTAGTCCCTTACGTCG 40 IR-8 SEQ ID NO: 8 CGAGTATACATACGAAGGTTTGCATGGGGGTGGGTCGCCG 40 IR-9 SEQ ID NO: 9 GGACCAACCTATTTCCCACTGGGCACCATGTTCGTAACTG 40 IR-10 SEQ ID NO: 10 TCCGTTTGCCCATTAGACAATGGCCGAATTCTTTGGGTGG 40

&Lt; Example 6 >

Determination of the structures of IR protein-binding DNA aptamer candidates

The structures of DNA aptamer candidates that specifically bind to the IR protein could be imaged using the DNA mfold program provided by the Rensselear polytechnic institute (Figures 5a, 5b).

&Lt; Example 7 >

Affinity testing between IR protein and IR-linked aptamer candidates using SPR

&Lt; 7-1 > IR protein and DNA specifically binding thereto Aptamer  The angle between candidates Affinity  SPR analysis experiment for quantification

Surface plasmon resonance (SPR) experiments were performed using BIAcore 3000 (BIACORE), a SPR detection system, to determine the affinity between the IR protein and the aptamer candidate groups obtained in Example 5 above Respectively. In order to quantify the affinity between the IR protein and the aptamer candidate group, a sensor chip CM5 (GE Healthcare, UK) whose surface was coated with a carboxyl group was used. First, a mixture of 0.1 M N-hydroxysuccinimide (NHS) and 0.4 M N-ethyl-N '- (dimethylaminopropyl) carbodiimide (EDC) was flowed into the sensor chip CM5 at a rate of 5 μl / min for 10 minutes. Was activated with a good N-hydroxysuccinimide ester (NHS-ester). To immobilize the IR protein on the surface of the NHS-ester-activated sensor chip CM5, an IR protein solution dissolved in 10 mM sodium acetate (pH 4.5) buffer at a concentration of 60 μg / ml was added at a rate of 5 μl / min for 10 minutes And the chip surface was coated with IR protein. Then, the remaining carboxyl reactors on the surface of the sensor chip were deactivated by flowing 1 M ethanolamine hydrochloride (pH 8.5) at a rate of 5 μl / min for 10 minutes to a sensor chip to which the His fusion IR protein was immobilized. This prevented other reagents and DNA aptamers from binding directly to the chip surface. After each experiment, the sensor chip was regenerated with 1 M NaCl, 50 mM NaOH. Rate variables were obtained and quantified by the BIA evaluation program (BIACORE).

<7-2> Measurement of Affinity of IR Protein Binding DNA Aptamer Candidate Groups

IR protein-bound DNA aptamer candidates obtained for isolating the aptamer having the highest affinity with the IR protein were dissolved in HBS-EP buffer (GE Healthcare, UK) at concentrations of 300 nM, 500 nM and 700 nM, respectively . (300 nM, 500 nM, 700 nM each) IR conjugated DNA aptamer was added to the sensor chip (channel 1) and the IR protein immobilized sensor chip (channel 2) The affinity between the IR protein and the DNA aptamer candidate group specifically binding thereto was quantified by injecting a candidate group. The dissociation constant (KD) of the DNA aptamer candidate group that specifically binds to each IR protein was obtained. As a result, the dissociation constant (K _D ) of the IR_3 aptamer among the His fusion IR protein binding DNA aptamer candidates was 2.26 X 10 ^-13 And the highest affinity value for the target IR protein (see Table 3).

IR protein binding aptamer candidate dissociation constants Clone name K _D (M) Clone name K _D  (M) IR-1 7.92 X 10 ^-12 IR-6 6.58 X 10 ^-12 IR-2 3.03 X 10 ^-12 IR-7 4.51 X 10 ^-12 IR-3 2.26 X 10 ^-13 IR-8 2.67 X 10 ^-12 IR-4 7.96 X 10 ^-10 IR-9 8.78 X 10 ^-10 IR-5 7.78 X 10 ^-11 IR-10 9.20 X 10 ^-11

&Lt; Example 8 >

Evaluation of the effect of IR-linked aptamers on the growth of animal cells

&Lt; 8-1 > Preparation of animal cell culture for assessment of animal cell growth promoting activity

To evaluate the effect of IR-linked aptamers on the growth of animal cells, animal cells were cultured. The animal cells used were Hela KCTC HC18802 and the culture medium was supplemented with 5% or 10% Fetal Bovine Serum (FBS) in Dulbecco Modified Eagle Medium (DMEM) and cultured in a CO ₂ incubator. Hela cells were streaked in a 25T flask with 10% FBS supplemented medium for 2-3 days. Subsequently, subculture was performed using a 5% FBS medium in a 75T flask.

<8-2> Experiments on growth of animal cells treated with IR-linked aptamer

Hela cells cultured in 5% FBS culture medium were washed twice with 5 ml of 1X PBS buffer. After treatment with 1 ml of 0.25% trypsin-EDTA, the cells were placed in a CO ₂ incubator to allow the cells to separate from the flask surface. After confirming that the cells had disappeared from the surface using an inverted microscope, 9 ml of 5% FBS culture medium was used to collect all of the distant cells. Thereafter, centrifugation was carried out at 2000 rpm for 2 minutes to recover only the cell pellet. The cell pellet was suspended in 1 ml of the culture medium and then subjected to cell-counting to confirm the number of cells. 10 ⁴ cells per well were inoculated in a 12-well plate and the amount of medium in the well was limited to 1 ml. Serum free medium was prepared by adding transferrin (5 ug / ml) and sodium selenite (5 ng / ml) to DMEM medium supplemented with insulin (1 ug / ml) or IR-binding aptamer (55.95 ng / ml) ) Was used as a test medium (see Table 4). Animal cells were cultured in a CO2 incubator for 3 days. Cell counts were measured daily using a cell-counting kit reagent (Dojindo, Japan) to determine the degree of cell growth. After adding 100 μl of cell-counting kit reagent per well, the reaction was allowed to proceed for 1 hour and 10 minutes, and the absorbance was measured at 450 nm wavelength band.

Medium conditions for growth of animal cells Sample name Medium condition Control Serum-free medium + D.W Insulin Serum-free medium + Insulin Apta 1 Serum-free medium + IR-2 Apta 2 Serum-free medium + IR-3 Apta 3 Serum free medium + IR-6 Apta 4 Serum-free medium + IR-8 Apta 5 Serum-free medium + IR-10

The number of cells treated with insulin or IR-conjugated aptamer was greater than that of the sample without addition of growth factors. In particular, the number of cells in the Apta 5 sample added with IR-10, one of the IR-binding aptamers, was comparable to the number of cells in the insulin-added sample (see FIG. 6). This shows that IR-binding aptamers promote the growth of animal cells as well as insulin.

<8-3> IR-binding aptamer treatment Experiment to measure the degree of phosphorylation of cultured animal cells

The degree of phosphorylation of the insulin receptor was measured to determine if the IR-linked aptamer normally binds to the targeted insulin receptor and activates the signal transduction pathway associated with cell division and growth.

Hela cells cultured in 5% FBS culture medium were washed twice with 5 ml of 1X PBS buffer. After treatment with 1 ml of 0.25% trypsin-EDTA, the cells were placed in a CO ₂ incubator to allow the cells to separate from the flask surface. After confirming that the cells had disappeared from the surface using an inverted microscope, 9 ml of 5% FBS culture medium was used to collect all of the distant cells. Thereafter, centrifugation was carried out at 2000 rpm for 2 minutes to recover only the cell pellet. The cell pellet was suspended in 1 ml of the culture medium, and then inoculated in 75T flask at a ratio of 1: 3, and the amount of the medium in the 75T flask was limited to 15 ml. After incubation for 2 ~ 3 days in a CO ₂ incubator, all cells were attached to the flask. After the culture medium was removed, the culture medium was replaced with a medium supplemented with 0.1% FBS, and the cells were incubated for 16 hours for serum starvation. After starvation, all cells were replaced with culture medium supplemented with aptamer and incubated for 24 hours. For the serum-free medium, transferrin (5 ug / ml) and sodium selenite (5 ng / ml) were added to the DMEM medium (see Table 5).

Media conditions for phosphorylation measurement Sample name Medium condition N.C1 Serum-free medium + D.W N.C2 Serum-free medium + EGF (1 ng / ml) + PDGF (5 ng / ml) IN (1 ng / ml) + PDGF (5 ng / ml) + Insulin (1 ug / ml) Apta1-1 Serum free medium + EGF (1 ng / ml) + PDGF (5 ng / ml) + IR-2 Concentration: 559.5 ng / ml Apta 1-2 Concentration: 1119 ng / ml Apta 1-3 Concentration: 2238 ng / ml Apta 2-1 Serum-free medium + EGF (1 ng / ml) + PDGF (5 ng / ml) + IR-10 Concentration: 559.5 ng / ml Apta 2-2 Concentration: 1119 ng / ml Apta 2-3 Concentration: 2238 ng / ml

After incubation, all cells were collected and 500 μl of cell lysis buffer was added, followed by reaction on ice for 30 minutes to completely dissolve the cells. The lysed cells were centrifuged (13000 rpm, 4 ° C, 10 minutes) to recover only the lysate. Lysates were assayed for phosphorylation of insulin receptors using the phosphotyrosine insulin receptor ELISA kit (Raybiotec, U.S.A). It was confirmed that the phosphorylation of insulin receptor was more active in the Apta 1-1, 1-2, 1-3, 2-1, and 2-2 samples added with the aptamer by concentration than the insulin-added sample 7). This means that IR-binding aptamers can activate the action of insulin receptors as well as insulin, and furthermore, IR-binding aptamers can be used as an additive for serum-free medium by replacing insulin.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that the present invention may be embodied in various other forms without departing from the spirit or essential characteristics thereof. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Insulin receptor-specific DNA aptamers and uses thereof <130> PN1607-229 <160> 15 <170> KoPatentin 3.0 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-1 <400> 1 ctacagcgtt agtctcaact gcctctcgtg tacatgcttg 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-2 <400> 2 gcgtgatata gacggtttct cctaataact tatttgacgg 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-3 <400> 3 tccatgtagt ggccgcataa aggcttatga tcgttcgttg 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-4 <400> 4 caacatcggc ttgcaatctc caaggcttcc ttacagcgca 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-5 <400> 5 gcgctccatc agcaatggca gcctcgcacg tcatcgtttg 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-6 <400> 6 ccattgcggg aattattgtc tgctcgttca gtctctgtga 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-7 <400> 7 tcacacgctc ccttaggctg ctcagtagtc ccttacgtcg 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-8 <400> 8 cgagtataca tacgaaggtt tgcatggggg tgggtcgccg 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-9 <400> 9 ggaccaacct atttcccact gggcaccatg ttcgtaactg 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> IR-10 <400> 10 tccgtttgcc cattagacaa tggccgaatt ctttgggtgg 40 <210> 11 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> template DNA <400> 11 ggtaatacga ctcactatag ggagatacca gcttattcaa ttnagatagt aagtgcaatc 60 t 61 <210> 12 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 12 ggtaatacga ctcactatag ggagatacca gcttattcaa tt 42 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 13 agattgcact tactatct 18 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> biotinylated reverse primer <400> 14 agattgcact tactatct 18 <210> 15 <211> 927 <212> PRT <213> Unknown <220> <223> Insulin Receptor <400> 15 His Leu Tyr Pro Gly Glu Val Cys Pro Gly Met Asp Ile Arg Asn Asn   1 5 10 15 Leu Thr Arg Leu His Glu Leu Glu Asn Cys Ser Val Ile Glu Gly His              20 25 30 Leu Gln Ile Leu Leu Met Phe Lys Thr Arg Pro Glu Asp Phe Arg Asp          35 40 45 Leu Ser Phe Pro Lys Leu Ile Met Ile Thr Asp Tyr Leu Leu Leu Phe      50 55 60 Arg Val Tyr Gly Leu Glu Ser Leu Lys Asp Leu Phe Pro Asn Leu Thr  65 70 75 80 Val Ile Arg Gly Ser Arg Leu Phe Phe Asn Tyr Ala Leu Val Ile Phe                  85 90 95 Glu Met Val His Leu Lys Glu Leu Gly Leu Tyr Asn Leu Met Asn Ile             100 105 110 Thr Arg Gly Ser Val Arg Ile Glu Lys Asn Asn Glu Leu Cys Tyr Leu         115 120 125 Ala Thr Ile Asp Trp Ser Arg Ile Leu Asp Ser Val Glu Asp Asn Tyr     130 135 140 Ile Val Leu Asn Lys Asp Asp Asn Glu Glu Cys Gly Asp Ile Cys Pro 145 150 155 160 Gly Thr Ala Lys Gly Lys Thr Asn Cys Pro Ala Thr Val Ile Asn Gly                 165 170 175 Gln Phe Val Glu Arg Cys Trp Thr His Ser His Cys Gln Lys Val Cys             180 185 190 Pro Thr Ile Cys Lys Ser His Gly Cys Thr Ala Glu Gly Leu Cys Cys         195 200 205 His Ser Glu Cys Leu Gly Asn Cys Ser Gln Pro Asp Asp Pro Thr Lys     210 215 220 Cys Val Ala Cys Arg Asn Phe Tyr Leu Asp Gly Arg Cys Val Glu Thr 225 230 235 240 Cys Pro Pro Pro Tyr Tyr His Phe Gln Asp Trp Arg Cys Val Asn Phe                 245 250 255 Ser Phe Cys Gln Asp Leu His His Lys Cys Lys Asn Ser Arg Arg Gln             260 265 270 Gly Cys His Gln Tyr Val Ile His Asn Asn Lys Cys Ile Pro Glu Cys         275 280 285 Pro Ser Gly Tyr Thr Met Asn Ser Ser Asn Leu Leu Cys Thr Pro Cys     290 295 300 Leu Gly Pro Cys Pro Lys Val Cys His Leu Leu Glu Gly Glu Lys Thr 305 310 315 320 Ile Asp Ser Val Thr Ser Ala Gln Glu Leu Arg Gly Cys Thr Val Ile                 325 330 335 Asn Gly Ser Leu Ile Ile Asn Ile Arg Gly Gly Asn Asn Leu Ala Ala             340 345 350 Glu Leu Glu Ala Asn Leu Gly Leu Ile Glu Glu Ile Ser Gly Tyr Leu         355 360 365 Lys Ile Arg Arg Ser Tyr Ala Leu Val Ser Leu Ser Phe Phe Arg Lys     370 375 380 Leu Arg Leu Ile Arg Gly Glu Thr Leu Glu Ile Gly Asn Tyr Ser Phe 385 390 395 400 Tyr Ala Leu Asp Asn Gln Asn Leu Arg Gln Leu Trp Asp Trp Ser Lys                 405 410 415 His Asn Leu Thr Ile Thr Gln Gly Lys Leu Phe Phe His Tyr Asn Pro             420 425 430 Lys Leu Cys Leu Ser Glu Ile His Lys Met Glu Glu Val Ser Gly Thr         435 440 445 Lys Gly Arg Gln Glu Arg Asn Asp Ile Ala Leu Lys Thr Asn Gly Asp     450 455 460 Gln Ala Ser Cys Glu Asn Glu Leu Leu Lys Phe Ser Tyr Ile Arg Thr 465 470 475 480 Ser Phe Asp Lys Ile Leu Leu Arg Trp Glu Pro Tyr Trp Pro Pro Asp                 485 490 495 Phe Arg Asp Leu Leu Gly Phe Met Leu Phe Tyr Lys Glu Ala Pro Tyr             500 505 510 Gln Asn Val Thr Glu Phe Asp Gly Gln Asp Ala Cys Gly Ser Asn Ser         515 520 525 Trp Thr Val Val Asp Ile Asp Pro Pro Leu Arg Ser Asn Asp Pro Lys     530 535 540 Ser Gln Asn His Pro Gly Trp Leu Met Arg Gly Leu Lys Pro Trp Thr 545 550 555 560 Gln Tyr Ala Ile Phe Val Lys Thr Leu Val Thr Phe Ser Asp Glu Arg                 565 570 575 Arg Thr Tyr Gly Ala Lys Ser Asp Ile Ile Tyr Val Gln Thr Asp Ala             580 585 590 Thr Asn Pro Ser Val Pro Leu Asp Pro Ile Ser Val Ser Asn Ser Ser         595 600 605 Ser Gln Ile Ile Leu Lys Trp Lys Pro Pro Ser Asp Pro Asn Gly Asn     610 615 620 Ile Thr His Tyr Leu Val Phe Trp Glu Arg Gln Ala Glu Asp Ser Glu 625 630 635 640 Leu Phe Glu Leu Asp Tyr Cys Leu Lys Gly Leu Lys Leu Pro Ser Arg                 645 650 655 Thr Trp Ser Pro Pro Phe Glu Ser Glu Asp Ser Gln Lys His Asn Gln             660 665 670 Ser Glu Tyr Glu Asp Ser Ala Gly Glu Cys Cys Ser Cys Pro Lys Thr         675 680 685 Asp Ser Gln Ile Leu Lys Glu Leu Glu Glu Ser Ser Phe Arg Lys Thr     690 695 700 Phe Glu Asp Tyr Leu His Asn Val Val Phe Val Pro Arg Ser Ser Arg 705 710 715 720 Lys Arg Arg Ser Leu Gly Asp Val Gly Asn Val Thr Val Ala Val Pro                 725 730 735 Thr Val Ala Phe Pro Asn Thr Ser Ser Thr Ser Val Pro Thr Ser             740 745 750 Pro Glu Glu His Arg Pro Phe Glu Lys Val Val Asn Lys Glu Ser Leu         755 760 765 Val Ile Ser Gly Leu Arg His Phe Thr Gly Tyr Arg Ile Glu Leu Gln     770 775 780 Ala Cys Asn Gln Asp Thr Pro Glu Glu Arg Cys Ser Val Ala Ala Tyr 785 790 795 800 Val Ser Ala Arg Thr Met Pro Glu Ala Lys Ala Asp Asp Ile Val Gly                 805 810 815 Pro Val Thr His Glu Ile Phe Glu Asn Asn Val Val His Leu Met Trp             820 825 830 Gln Glu Pro Lys Glu Pro Asn Gly Leu Ile Val Leu Tyr Glu Val Ser         835 840 845 Tyr Arg Arg Tyr Gly Asp Glu Glu Leu His Leu Cys Val Ser Arg Lys     850 855 860 His Phe Ala Leu Glu Arg Gly Cys Arg Leu Arg Gly Leu Ser Pro Gly 865 870 875 880 Asn Tyr Ser Val Arg Ile Arg Ala Thr Ser Leu Ala Gly Asn Gly Ser                 885 890 895 Trp Thr Glu Pro Thr Tyr Phe Tyr Val Thr Asp Tyr Leu Asp Val Pro             900 905 910 Ser Asn Ile Ala Lys His His His His His His His His His His         915 920 925

Claims (11)

A DNA aptamer that specifically binds to an insulin receptor protein having the nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 10. The method according to claim 1,
Wherein the DNA aptamer further comprises a labeling substance. 3. The method of claim 2,
Wherein the DNA aptamer is labeled at the 5 'end or the 3' end of the DNA aptamer with a labeling substance selected from the group consisting of a fluorescent substance, an amine group, a biotin and a thiol group. The method according to claim 1,
Wherein the hydroxy group of the ribose 2 'position of the at least one nucleotide constituting the DNA aptamer is substituted with any one selected from the group consisting of a hydrogen atom, a fluorine atom, -OR, -COOR and an amino group. An animal cell culture medium comprising at least one DNA aptamer selected from oligonucleotides consisting of SEQ ID NO: 1 to SEQ ID NO: 10. 6. The method of claim 5,
Wherein the medium is a serum-free or low serum medium. 6. The method of claim 5,
Wherein the DNA aptamer is used as an insulin replacement agent. And at least one DNA aptamer selected from oligonucleotides consisting of SEQ ID NO: 1 to SEQ ID NO: 10 as an active ingredient. 9. The method of claim 8,
Wherein said composition promotes the growth or division of skin cells. (a) amplifying a pool of random DNA aptamers using a PCR technique;
(b) preparing ssDNA using heat-cooling technique and streptavidin;
(c) mixing the IR protein or His-fused IR protein with the aptamer pool;
(d) reacting the IR protein or His fusion IR protein and aptamer pool mixture with a pre-activated Ni-NTA agarose;
(e) removing a DNA aptamer that does not bind specifically to the IR protein or the His fusion IR protein; And
(f) recovering a DNA aptamer that specifically binds to an IR protein or a His fusion IR protein, wherein the DNA aptamer specifically binds to an insulin receptor protein. 11. The method of claim 10,
In the step (f)
A real-time PCR step for SELEX round selection with optimal affinity;
PCR and cloning steps for selection of IR protein or His fusion IR protein binding DNA aptamer candidates in the optimal SELEX round;
Measuring the affinity of the IR protein or His fusion IR protein binding DNA aptamer candidate group to the IR protein or His fusion IR protein; And
Determining the DNA sequence of the selected IR protein or His fusion IR protein-binding DNA aptamer candidate group, and selecting a DNA aptamer that specifically binds to the IR protein or His fusion IR protein Lt; / RTI &gt;

Images