KR20170142128A - Detection of Target Nucleic Acid Sequences by PTO Cleavage and Extension Assay Using a Set of CTOs - Google Patents

Abstract

The present invention relates to the detection of target nucleic acid sequences by PTO cleavage and extension (PTOCE) assay using a set of capturing and templating oligonucleotides (CTO). The protocol of the present invention is well adopted to solid phase reaction as well as liquid phase reaction, and ensures detection of multiple target sequences with more improved accuracy and convenience.

Description

Detection of Target Nucleic Acid Sequences by PTO Cleavage and Extension Assays Using CTO Sets {Detection of Target Nucleic Acid Sequences by PTO Cleavage and Extension Assay Using a Set of CTOs}

The present invention relates to detection of a target nucleic acid sequence by a PTOCE (PTO Cleavage and Extension) assay using CTO (Capturing and Templating Oligonucleotides) set.

DNA hybridization is a fundamental process in molecular biology and is influenced by ionic strength, base composition, length of nucleic acid fragments, mismatching, and the presence of denaturants. DNA hybridization-based technology will be a very useful tool for determining specific nucleic acid sequences and will be of particular help in clinical diagnosis, genetic research and forensic laboratory analysis.

However, conventional methods and procedures that rely solely on hybridization are likely to result in false positives due to non-specific hybridization between probe and non-target sequence. Therefore, the conventional methods and processes have a problem of improving reliability.

In addition to probe hybridization processes have been proposed several approaches using further enzymatic reactions, for example, TaqMan ^TM probe method.

In the TaqMan ^TM probe method, the labeled probe hybridized to the target nucleic acid sequence is cleaved by the 5 'nuclease activity of the upstream primer-dependent DNA polymerase to generate a signal indicative of the presence of the target sequence (U.S. Patent No. 5,210,015 , 5,538,848 and 6,326,145). The TaqMan ^TM probe method offers two approaches for signal generation: polymerization-dependent cleavage and polymerization-independent cleavage. In polymerization-dependent cleavage, extension of the upstream primer must occur before the nucleic acid polymerase contacts the 5'-end of the labeled probe. As the extension reaction proceeds, the polymerase gradually cleaves the 5'-end of the labeled probe. In polymerization-independent cleavage, the upstream primer and the labeled probe are hybridized in close proximity to the target nucleic acid sequence, and the binding of the 3'-end of the upstream primer to the nucleic acid polymerase occurs when the nucleic acid polymerase contacts the 5'- So that the label is released. In addition, ^TM TaqMan probe method, discloses that its 5'-terminal region to the labeled probe has a 5'-tail section that are not hybridized with the target sequence is cut off to be a fragment containing the 5'-tail zone formation.

Several methods have been reported in which a probe having a non-complementary 5'-tail region in the target sequence is cleaved by a 5 'nuclease to release a fragment comprising the 5'-tail region.

For example, U.S. Patent No. 5,691,142 discloses a cleavage structure that is cleaved by the 5 ' nuclease activity of a DNA polymerase. A cleavage structure is illustrated in which an oligonucleotide comprising a non-complementary 5 'site for the template and a complementary 3' site for the template is hybridized to the template and the upstream oligonucleotide is hybridized to the template in close proximity. The cleavage structure is cleaved by a DNA polymerase having 5 'nuclease activity or a modified DNA polymerase having reduced synthetic activity, resulting in a non-complementary 5' site in the template. Then, the 5'-site that is released is hybridized with an oligonucleotide having a hairpin structure to form a cleavage structure, whereby a progressive cleavage reaction is induced and a target sequence is detected.

U. S. Patent No. 7,381, 532 discloses that a cleavage structure with a 3 ' -terminally blocked upstream oligonucleotide is cleaved by a DNA polymerase having 5 ' nuclease activity or a FEN nuclease to form a non- the flap site is released and the released 5 'flap site is detected by size analysis or interactive double labeling. U.S. Patent No. 6,893,819 discloses that a detectable released flap is produced by a flap-mediated continuous amplification method that is nucleic acid synthesis dependent. In this method, the flap released from the first cleavage structure cleaves the second cleavage structure in a nucleic acid synthesis dependent manner to release the flap, and detects the released flaps.

By hybridization of the fluorescence-labeled probe in the liquid phase, even if one kind of fluorescent label is used, it is possible to simultaneously detect multiple target nucleic acid sequences by the melting curve analysis. However, conventional techniques for detecting target sequences by 5 ' nuclease-mediated cleavage of interactive-double-labeled probes require different types of fluorescent labels for different target sequences in multiplex target detection , The number of target sequences detected due to the limitation of the number of fluorescent label species is limited.

U.S. Patent Application Publication No. 2008-0241838 discloses a method for detecting a target using a hybridization of a capture probe and a cleavage of a probe having a non-complementary 5 'site in a target nucleic acid sequence. The label is located at the non-complementary 5 'site. The labeled probe hybridized to the target sequence is cleaved to release the fragment, which is then hybridized to the capture probe to detect the presence of the target sequence. In this method, it is essential that the uncleaved / intact probe is not hybridized to the capture probe. To do this, a capture probe with a short length must be immobilized on a solid substrate. However, this restriction lowers the efficiency of hybridization in the solid substrate and makes it difficult to optimize the reaction conditions.

Thus, in a more convenient, reliable and reproducible manner, not only the hybridization but also the target sequence in the liquid and solid phase, more preferably the target sequence in the liquid phase and the solid phase, more preferably the target sequence in the solid phase by the enzymatic reaction such as 5 ' nucleolytic reaction, There is a growing need for a novel approach to detecting sequences. There is also a need in the art for a novel target detection method that is not limited by the number of types of labels (in particular, fluorescent labels).

Numerous patents and publications are referenced throughout this specification and their citations are indicated in parentheses. The disclosures of these patents and documents are hereby incorporated by reference in their entirety to more fully describe the state of the art to which this invention pertains and the teachings of the present invention.

The present inventors have made extensive efforts to develop a novel approach for detecting target sequences in a multiplex system with improved accuracy and convenience. As a result, the present inventors have established a novel protocol for detecting a target sequence, and this target detection is accomplished by probe hybridization, enzymatic probe cleavage, extension and detection of an extended duplex. The protocol of the present invention is applied to solid-phase reactions as well as liquid-phase reactions and allows detection of multiple target sequences with improved accuracy and convenience.

It is therefore an object of the present invention to provide a kit for detecting a target nucleic acid sequence from a DNA or nucleic acid mixture using a PTOCE (PTO Cleavage and Extension) assay using a plurality of CTOs (Capturing and Templating Oligonucleotides).

Other objects and advantages of the present invention will become more apparent from the following detailed description together with the appended claims and drawings.

The present invention provides a novel method for detecting a target nucleic acid sequence by a PTOCE (PTO Cleavage and Extension) assay and a kit for detecting a target nucleic acid sequence by a PTOCE (PTO Cleavage and Extension) assay.

The present invention encompasses the hybridization reaction as well as the enzymatic reaction that occurs depending on the presence of the target nucleic acid sequence.

Ⅰ. Target Detection Process by PTOCE including Melting Analysis

According to one aspect of the present invention, the present invention provides a method for detecting a target nucleic acid sequence from a DNA or nucleic acid mixture by a PTOCE (PTO cleavage and extension) assay, comprising the steps of:

(a) hybridizing the target nucleic acid sequence with an upstream oligonucleotide and a Probing and Tagging Oligonucleotide (PTO); Wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Said PTO comprising (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to said target nucleic acid sequence; And (ii) a 5'-tagging site comprising a nucleotide sequence that is non-complementary to the target nucleic acid sequence; Wherein the 3'-targeting region is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence; Wherein the upstream oligonucleotide is located upstream of the PTO;

(b) contacting the result of step (a) to an enzyme having 5 'nuclease activity under conditions for cleavage of the PTO; The upstream oligonucleotides or extension strands thereof induce cleavage of the PTO by an enzyme having the 5 ' nuclease activity, wherein the cleavage is a 5 ' -tagging site or part of a 5 ' -tagging site of the PTO Releasing the containing fragment;

(c) hybridizing CTO (Capturing and Templating Oligonucleotide) with said fragment released from said PTO; Wherein the CTO comprises: (i) a capture region comprising a nucleotide sequence complementary to a 5'-tagging site or a portion of a 5'-tagging site of the PTO in a 3 'to 5' direction and (ii) A templating site comprising a non-complementary nucleotide sequence at a 3'-targeting site and a 3'-targeting site; Wherein the fragment released from the PTO is hybridized to the capture site of the CTO;

(d) performing an extension reaction using the result of step (c) and a template-dependent nucleic acid polymerase; (I) the sequence and / or length of the fragment, (ii) the sequence and / or length of the CTO, or (iii) the sequence and / or length of the CTO. ) Having a Tm value adjustable by the sequence and / or length of the fragment and the sequence and / or length of the CTO;

(e) melting said elongated dimer at a range of temperatures to provide a target signal indicative of the presence of said elongated dimer; Wherein the target signal comprises at least one of (i) at least one label attached to the fragment and / or the CTO, (ii) a label inserted in the elongated dimer during the elongation reaction, (iii) a label inserted in the elongated dimer during the elongation reaction And (iv) an intercalating label that is linked to said fragment and / or said CTO; And

(f) detecting the extended dimer by measuring the target signal; The presence of the extended dimer indicates the presence of the target nucleic acid sequence.

The present inventors have made extensive efforts to develop a novel approach for detecting target sequences in a multiplex system with improved accuracy and convenience. As a result, the present inventors have established a novel protocol for detecting a target sequence, and this target detection is accomplished by probe hybridization, enzymatic probe cleavage, extension and detection of an extended duplex. The protocol of the present invention is well suited for solid phase reactions as well as liquid phase reactions, allowing multiple target sequences to be detected with improved accuracy and convenience.

The present invention utilizes the following sequential events; Probe hybridization; Cutting and extension of Probing and Tagging Oligonucleotide (PTO); Formation of a target-dependent extension dimer; And detection of extended dimers. Therefore, the present invention is named PTOCE (PTO Cleavage and Extension) assay.

In the present invention, the extended dimer is characterized by a marking that provides a signal indicative of the presence of an extended dimer by melting analysis or detection at a predetermined temperature. The extended dimer also has an adjustable Tm value, which plays an important role in distinguishing it from a plurality of target detection or non-target signals.

Since an extended dimer is produced only when the target nucleic acid is present, the presence of the extended dimer indicates the presence of the target nucleic acid.

A more detailed description of the PTOCE assay, including the melting analysis, is as follows:

Step (a): Hybridization of the target nucleic acid sequence with upstream oligonucleotides and PTO

According to the present invention, first, a target nucleic acid sequence is hybridized with an upstream oligonucleotide and a probing and tagging oligonucleotide (PTO).

The term "target nucleic acid "," target nucleic acid sequence "or" target sequence " as used herein means a nucleic acid sequence to be detected and annealed or hybridized with the probe or primer under hybridization, annealing or amplification conditions.

The term "probe" as used herein refers to a single-stranded nucleic acid molecule comprising a site or regions substantially complementary to a target nucleic acid sequence.

As used herein, the term "primer " refers to an oligonucleotide in which the synthesis of a primer extension product complementary to a nucleic acid strand (template) is induced, i.e. the presence of a polymerizing agent such as a nucleotide and a DNA polymerase, It can act as a starting point for synthesis at suitable temperature and pH conditions. Preferably, the probe and the primer are single-stranded deoxyribonucleotide molecules. Probes or primers used in the present invention may include naturally occurring dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the probe or primer may comprise a ribonucleotide.

The primer should be long enough to be able to prime the synthesis of the extension product in the presence of the polymerizing agent. The appropriate length of the primer is determined by a plurality of factors including, for example, the temperature, the application field and the source of the primer. The term "annealing" or "priming ", as used herein, means that oligodeoxynucleotides or nucleic acids are apposited to a template nucleic acid, which polymerase is capable of polymerizing a nucleotide to form a template nucleic acid, To form nucleic acid molecules.

The term "hybridization " as used herein means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

Hybridization of the upstream oligonucleotide and the PTO with the target nucleic acid sequence can be performed under suitable hybridization conditions that are generally determined by an optimization procedure. Conditions such as temperature, concentration of components, hybridization and wash times, buffer components and their pH and ionic strength may vary depending on various factors including the length and GC amount of the oligonucleotides (upstream oligonucleotides and PTO) and the target nucleotide sequence have. For example, when using relatively short oligonucleotides, it is desirable to select a low stringent condition. For detailed conditions for hybridization, see Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And MLM Anderson, Nucleic Acid Hybridization , Springer-Verlag New York Inc .; NY (1999).

The terms "annealing" and "hybridization" are no different and are used interchangeably herein.

The upstream oligonucleotide and PTO have a hybridization nucleotide sequence complementary to the target nucleic acid sequence. The term "complementary ", as used herein, means that under certain annealing or stringent conditions, the primer or probe is sufficiently complementary to selectively hybridize to the target nucleic acid sequence, and the terms" substantially complementary &Quot; and "perfectly complementary ", and preferably means completely complementary.

The 5'-tagging site of the PTO has a non-complementary nucleotide sequence in the target nucleic acid sequence. The templating site of the CTO (Capturing and Templating Oligonucleotide) has a non-complementary nucleotide sequence at the 5'-tagging site and the 3'-targeting site of the PTO. As used herein, the term "non-complementary" means that the primer or probe is sufficiently non-complementary to the target nucleic acid sequence under certain annealing conditions or stringent conditions and is "substantially non- quot; substantially non-complementary "and" perfectly non-complementary ", and preferably means completely non-complementary. As used herein, the term "Probing and Tagging Oligonucleotide (PTO)" means a nucleic acid sequence that is cleaved after hybridization with (i) a 3'-targeting site serving as a probe and (ii) Quot; means an oligonucleotide comprising a 5'-tagging site having a non-complementary nucleotide sequence. The 5'-tagging site and the 3'-targeting site of the PTO must be located in the 5 '→ 3' order. Figure 1 schematically shows the PTO.

Preferably, the hybridization of step (a) is carried out under stringent conditions in which the 3'-targeting site is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence.

The PTO does not require any specific length. For example, the length of the PTO may be 15-150 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20- 30-50 nucleotides, 30-80 nucleotides, 30-80 nucleotides, 30-60 nucleotides, 30-60 nucleotides, 35- 100 nucleotides, 35-80 nucleotides, 35-60 nucleotides, or 35-60 nucleotides, It can have a length of 50 nucleotides. As long as the 3'-targeting site of the PTO is specifically hybridized to the target nucleic acid sequence, it can have any length. For example, the 3'-targeting site of a PTO may be 10-100 nucleotides, 10-80 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-50 Can have a length of 15-30 nucleotides, 15-30 nucleotides, 20-100 nucleotides, 20-80 nucleotides, 20-50 nucleotides, 20-40 nucleotides, or 20-30 nucleotides. The 5'-tagging site can be of any length as long as it specifically hybridizes to the template site of the CTO and then extends. For example, the 5'-tagging site of a PTO may be 5-50 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 Nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides, or 15-20 nucleotides.

The 3'-terminal of the PTO may have a 3'-OH terminal. Preferably, the 3'-end of the PTO is "blocked" to prevent its extension.

Blocking can be achieved according to conventional methods. For example, blocking may be accomplished by adding a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate or an alkane-diol moiety to the 3'-hydroxyl group of the last nucleotide . Alternatively, blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

Alternatively, the PTO can be designed to have a hairpin structure.

Non-hybridization between the 5'-tagging site of the PTO and the target nucleic acid sequence means that a stable double-strand is not formed between them under certain hybridization conditions. According to a preferred embodiment of the present invention, the 5'-tagging site of the PTO not involved in hybridization with the target nucleic acid sequence forms a single-strand.

The upstream oligonucleotide is located upstream of the PTO.

In addition, upstream oligonucleotides or extended strands hybridized to the target nucleic acid sequence induce cleavage of the PTO by an enzyme having 5 ' nuclease activity.

Induction of PTO cleavage by upstream oligonucleotides can be achieved in two ways: (i) upstream oligonucleotide extension-independent cleavage induction; And (ii) upstream oligonucleotide extension-dependent cleavage induction.

If the upstream oligonucleotide is located close enough to the PTO to induce a cleavage reaction of the PTO by an enzyme with 5 ' nuclease activity, the enzyme bound to the upstream oligonucleotide cleaves the PTO without an extension reaction. On the other hand, when the upstream oligonucleotide is spaced from the PTO, the enzyme having the polymerase activity (e.g., template-dependent polymerase) promotes the extension of the upstream oligonucleotide (e.g., upstream primer) Enzyme with nuclease activity cleaves PTO.

Thus, the upstream oligonucleotide can be positioned relative to the PTO in two ways. The upstream oligonucleotides may be located at a location close to the PTO sufficient to induce cleavage of the PTO in an extended-independent manner. Alternatively, the upstream oligonucleotide may be located at a location remote from the PTO sufficient to induce PTO cleavage in an extension-dependent manner.

The term "adjacent " used in reference to positions or locations herein means that the upstream oligonucleotide is located immediately adjacent to the 3'-targeting site of the PTO and forms a nick do. The term also means that the upstream oligonucleotide is located at a distance of 1-30 nucleotides, 1-20 nucleotides, or 1-15 nucleotides from the 3'-targeting site of the PTO.

The term "distant " used herein to refer to a point or location includes any location or location sufficient to cause an extension reaction to occur.

According to a preferred embodiment of the present invention, the upstream oligonucleotides may be located remote from the PTO to an extent sufficient to induce cleavage of the PTO in an extension-dependent manner.

According to a preferred embodiment of the present invention, the upstream oligonucleotide is an upstream primer or an upstream probe. Upstream primers are suitable for extension-independent cleavage induction or extension-dependent cleavage, and upstream probes are suitable for extension-independent cleavage induction.

Alternatively, the upstream oligonucleotide may have a partial-overlapped sequence with the 5'-part of the 3'-targeting site of the PTO. Preferably, the overlapping sequences are 1-10 nucleotides in length, more preferably 1-5 nucleotides, even more preferably 1-3 nucleotides. If the upstream oligonucleotide has a partial-overlapped sequence with the 5'-part of the 3'-targeting site of the PTO, the 3'-targeting site in the cleavage reaction of step (b) As shown in FIG. In addition, the overlapping sequence allows the desired specific position of the 3'-targeting site to be cleaved.

According to a preferred embodiment of the present invention, the upstream primer induces cleavage of the PTO by an enzyme having 5 ' nuclease activity through its extended strand.

As long as the upstream oligonucleotide induces cleavage of the PTO hybridized to the target nucleic acid sequence and the fragment containing the 5'-tagging site of the PTO or a part of the 5'-tagging site of the PTO is released, a cleavage reaction by the upstream oligonucleotide Conventional techniques can be applied to the present invention. For example, U.S. Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069, 7,381,532, and U.S. Patent Application Publication No. 2008-0241838 can be applied to the present invention.

According to a preferred embodiment of the present invention, the method is carried out in the presence of a downstream primer. The downstream primer additionally generates a target nucleic acid sequence that hybridizes to the PTO and improves the sensitivity of target detection.

According to a preferred embodiment of the present invention, when upstream primer and downstream primer are used, an additional template-dependent nucleic acid polymerase is used for extension of the primer.

According to a preferred embodiment of the present invention, the 5'-tagging site of the upstream oligonucleotide (upstream primer or upstream probe), downstream primer and / or PTO has a dual priming oligonucleotide (DPO) structure developed by the present inventor . Oligonucleotides with a DPO structure exhibit significantly improved target specificity compared to conventional primers and probes (see WO 2006/095981, Chun et al., Dual priming oligonucleotide system for multiplex detection of respiratory viruses and SNP genotyping of CYP2C19 gene, Nucleic Acid Research , 35: 6e40 (2007)).

According to a preferred embodiment of the present invention, the 3'-targeting region of PTO has a modified bispecific oligonucleotide (mDSO) structure developed by the present inventor. The modified bispecific oligonucleotide (mDSO) structure exhibits significantly improved target specificity compared to conventional probes (see WO 2011/028041).

Step (b): Release of fragments from PTO

The result of step (a) is then contacted with an enzyme having 5 'nuclease activity under conditions for cleavage of the PTO. The PTO hybridized to the target nucleic acid sequence is cleaved by an enzyme having 5 ' nuclease activity to release a fragment comprising the 5 ' -tagging site of the PTO or a portion of the 5 ' -tagging site.

As used herein, the term " conditions for cleavage of PTO "refers to conditions sufficient to cause cleavage of the PTO hybridized to the target nucleic acid sequence by an enzyme having 5 ' nuclease activity such as temperature, pH, Buffer, length and sequence of the oligonucleotide, and enzyme. For example, when the Taq DNA polymerase is used as enzyme having 5 'nuclease activity and conditions for the cleavage of the PTO comprises a Tris-HCl buffer, KCl, MgCl _2, and temperature.

If the PTO is hybridized to the target nucleic acid sequence, its 3'-targeting site is included in the hybridization, but the 5'-tagging site is not hybridized to the target nucleic acid sequence and forms a single-strand (see FIG. 2). As such, oligonucleotides, including both single-stranded and double-stranded structures, can be cleaved using enzymes with 5 'nuclease activity by a variety of techniques known in the art.

The cleavage site of the PTO varies depending on the type of the upstream oligonucleotide (upstream probe or upstream primer), the hybridization position of the upstream oligonucleotide, and the cutting conditions (see U.S. Patent Nos. 5,210,015, 5,487,972, 5,691,142, 5,994,069 And 7,381,532 or U. S. Patent Application Publication No. 2008-0241838).

A number of conventional techniques can be used for the cleavage reaction of the PTO and release a fragment comprising the 5'-tagging site or a portion of the 5'-tagging site.

Taken together, there may be three cleavage sites in the cleavage reaction of step (b). The first cleavage site is the junction site between the hybridization site (3'-targeting site) and the non-hybridization site (5'-tagging site) of the PTO. The second cleavage site is the position separated by some nucleotides from the 3'-end of the 5'-tagging site of the PTO. The second cleavage site may be located at a 5'-end portion of the 3'-targeting site of the PTO. The third cleavage site is the position at which some nucleotides are separated from the 3'-end of the 5'-tagging site of the PTO in the 5'-direction.

According to a preferred embodiment of the present invention, the position at which the cleavage of the PTO is initiated by the template-dependent polymerase having the 5 'nuclease activity while the upstream primer is extended is at the point where the double strand between the PTO and the target nucleic acid sequence starts And is located at a distance of 1 to 3 nucleotides from the starting point.

Thus, the term "5'-tagging site of PTO or fragment containing a portion of 5'-tagging site " used herein to refer to cleavage of PTO by an enzyme having 5 ' 5'-tagging site, (ii) the 5'-tagging site and the 5'-terminal portion of the 3'-targeting site and (iii) the 5'-tagging site. Also, the term "5'-tagging site of PTO or fragment containing part of 5'-tagging site" is expressed herein as "PTO fragment ".

Used herein to refer to PTO or CTO, such as a portion of a 5'-tagging site of a PTO, a 5'-terminal portion of a 3'-targeting site of a PTO and a 5'-terminal portion of a capturing site of a CTO, Part "means a nucleotide sequence consisting of 1-40, 1-30, 1-20, 1-15, 1-10 or 1-5 nucleotides, preferably 1, 2, 3 or 4 nucleotides .

According to a preferred embodiment of the present invention, an enzyme having 5 'nuclease activity is a DNA polymerase or FEN nuclease having 5' nuclease activity and more preferably has thermal stability DNA polymerase or FEN nuclease.

DNA polymerase having 5 'nuclease activity suitable for the present invention is a thermostable DNA polymerase obtained from various bacterial species, which Thermus aquaticus (Taq) , Thermus thermophilus (Tth) , Thermus filiformis , Thermis flavus , Thermococcus literalis, Thermus antranikianii , Thermus caldophilus , Thermus chlariophilus , Thermus flavus , Thermus igniterrae , Thermus lacteus , Thermus oshimai , Thermus ruber, Thermus rubens, Thermus scotoductus , Thermus Silvanus , Thermus species Z05, Thermus species sps 17, Thermus thermophilus , Thermotoga maritima , Thermotoga neapolitana , Thermosipho africanus , Thermococcus litoralis , Thermococcus barossi , Thermococcus gorgonarius , Thermotoga maritima , Thermotoga neapolitana , Thermosiphoafricanus , Pyrococcus woesei , Pyrococcus horikoshii, Pyrococcus abyssi , Pyrodictium occultum , Aquifex pyrophilus And Aquifex aeolieus . Most preferably, the thermostable DNA polymerase is Taq It is a polymerase.

Alternatively, the present invention may employ a DNA polymerase having 5 'nuclease activity modified to have less polymerase activity.

The FEN (flap endonuclease) nuclease used is a 5 'flap-specific nuclease.

Suitable FEN nuclease agents for the present invention include FEN nuclease from a variety of bacterial species, including Sulfolobus solfataricus , Pyrobaculum aerophilum , Thermococcus litoralis , Archaeaglobus veneficus , Archaeaglobus profundus , Acidianus brierlyi , Acidianus ambivalens , Desulfurococcus amylolyticus , Desulfurococcus mobilis , Pyrodictium brockii , Thermococcus gorgonarius , Thermococcus zilligii , Methanopyrus kandleri , Methanococcus igneus , Pyrococcus horikoshii , Aeropyrum pernix And Archaeaglobus Includes veneficus .

When using an upstream primer in step (a), the conditions for cleavage of the PTO preferably include an extension reaction of the upstream primer.

According to a preferred embodiment of the present invention, an upstream primer is used in step (a), wherein a template-dependent polymerase is used for extension of the upstream primer and the template-dependent polymerase has 5 ' It is the same enzyme as the enzyme it has.

Alternatively, an upstream primer is used in step (a), and a template-dependent polymerase is used for extension of the upstream primer, and the template-dependent polymerase is an enzyme different from the enzyme having 5 ' nuclease activity .

Step (c): Hybridization of the CTO with the fragment released from the PTO

The fragment released from the PTO is hybridized with CTO (Capturing and Templating Oligonucleotide).

The CTO comprises a capture region comprising a nucleotide sequence complementary to (i) the 5'-tagging site of the PTO or a portion of the 5'-tagging site and (ii) the 5'-tagging site of the PTO and Lt; / RTI > nucleotide sequence that is non-complementary to the 3'-targeting site.

The CTO serves as a template for the extension of the released fragment from the PTO. The fragment serving as a primer hybridizes to the CTO and extends to form a dimer.

As long as the templating site has a non-complementary sequence at the 5'-tagging site and the 3'-targeting site of the PTO, any sequence may be included. In addition, the template region may include any sequence as long as it can serve as a template for extending the fragment released from the PTO.

As described above, when the fragment having the 5'-tagging site of the PTO is released, it is preferable to design the capturing site of the CTO to include a nucleotide sequence complementary to the 5'-tagging site. When the 5'-tagging site and the fragment having the 5'-terminal portion of the 3'-targeting site are released, the capturing site of the CTO is complementary to the 5'-tagging site and the 5'- Lt; RTI ID = 0.0 > nucleotide < / RTI > When a fragment having a portion of the 5'-tagging site of the PTO is released, it is desirable to design the capturing site of the CTO to include a nucleotide sequence complementary to a portion of the 5'-tagging site.

On the other hand, the capturing region of the CTO can be designed by predicting the cutting position of the PTO. For example, if the capture region of the CTO is designed to include a complementary nucleotide sequence at the 5'-tagging site, the fragment having a portion of the 5'-tagging site or the fragment having the 5'- Lt; RTI ID = 0.0 > and / or < / RTI > When a fragment containing the 5'-tagging site and the 5'-terminal portion of the 3'-targeting site is released, the fragment is ligated to the capturing site of the CTO designed to contain the complementary nucleotide sequence to the 5'- Can be successfully hybridized and can be successfully extended despite the presence of a mismatch nucleotide at the 3'-terminal region of the fragment. This is because although the 3'-end of the primer contains some mismatch nucleotides (e.g., 1-3 mismatch nucleotides), the primer can be extended depending on the reaction conditions.

When a fragment comprising the 5'-tagging site and the 5'-terminal portion of the 3'-targeting site is released, the 5'-terminal portion of the capturing site of the CTO is separated from the 5'- The problem associated with mismatch nucleotides can be solved by designing to have a nucleotide sequence complementary to a portion of the terminus (see FIG. 1).

Preferably, the nucleotide sequence of the 5'-end portion of the capture region of the CTO complementary to the 5'-end portion of the truncated 3'-targeting region is selected according to the expected cleavage site on the 3'-targeting region of the PTO . The nucleotide sequence of the 5'-terminal part of the capture region of the CTO complementary to the 5'-terminal part of the truncated 3'-targeting site is preferably 1-10 nucleotides, more preferably 1-5 nucleotides, more preferably 1-5 nucleotides More preferably 1-3 nucleotides.

The 3'-end of the CTO may contain additional nucleotides that are not included in the hybridization with the fragment. In addition, as long as the CTO is stably hybridized with the fragment, the capture region of the CTO may comprise a nucleotide sequence complementary to only a portion of the fragment (e.g., a portion of the fragment comprising the 3'-terminal portion of the fragment) .

As used herein, the term "capture region comprising a nucleotide sequence complementary to a 5'-tagging site or a portion of a 5'-tagging site" includes a variety of designs and configurations of capture sites of CTOs as described above Explain.

The CTO can be designed to have a hairpin structure.

The length of the CTO can vary. For example, a CTO can be a 7-1000 nucleotide, 7-500 nucleotides, 7-300 nucleotides, 7-100 nucleotides, 7-80 nucleotides, 7-60 nucleotides, 7-40 nucleotides, 15-1000 nucleotides, 15-500 nucleotides , 15-300 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 20-1000 nucleotides, 20-500 nucleotides, 20-300 nucleotides, 20-100 nucleotides, 20-80 nucleotides , 20-60 nucleotides, 20-40 nucleotides, 30-1000 nucleotides, 30-500 nucleotides, 30-300 nucleotides, 30-100 nucleotides, 30-80 nucleotides, 30-60 nucleotides, or 30-40 nucleotides. The capture site of the CTO can be of any length as long as it is specifically hybridized to the fragment released from the PTO. For example, the capture region of a CTO may comprise 5-100 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 5-20 nucleotides, 10-100 nucleotides, 10-60 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 15-100 nucleotides, 15-60 nucleotides, 15-40 nucleotides, 15-30 nucleotides or 15-20 nucleotides. In addition, the templating site of the CTO can have any length as long as it can act as a template in the extension reaction of the fragment released from the PTO. For example, the templating site of a CTO may comprise 2-900 nucleotides, 2-400 nucleotides, 2-300 nucleotides, 2-100 nucleotides, 2-80 nucleotides, 2-60 nucleotides, 2-40 nucleotides, 2-20 nucleotides, 5-900 nucleotides, 5-400 nucleotides, 5-300 nucleotides, 5- 100 nucleotides, 5-80 nucleotides, 5-60 nucleotides, 5-40 nucleotides, 5-30 nucleotides, 10-900 nucleotides, 10-400 nucleotides, 10-300 nucleotides, 15-900 nucleotides, 15-100 nucleotides, 15-80 nucleotides, 15-60 nucleotides, 15-40 nucleotides, or 15-20 nucleotides.

The 3'-terminal of the CTO may have a 3'-OH terminal. Preferably, the 3'-end of the CTO is blocked so that its extension is prevented. Non-extended blocking of the CTO can be achieved according to conventional methods. For example, blocking can be accomplished by adding a chemical moiety such as biotin, a label, a phosphate group, an alkyl group, a non-nucleotide linker, a phosphorothioate or an alkane-diol moiety to the 3'-hydroxyl group of the last nucleotide of the CTO Can be added. Alternatively, blocking can be accomplished by removing the 3'-hydroxyl group of the last nucleotide or by using a nucleotide without a 3'-hydroxyl group, such as a dideoxynucleotide.

The fragment released from the PTO hybridizes with the CTO and provides a form suitable for extension of the fragment. In addition, even if the uncleaved PTO is hybridized with the capturing site of the CTO through its 5'-tagging site, the 3'-targeting site of the PTO is not hybridized to the CTO, preventing the formation of extended duplexes.

The hybridization in step (c) can be explained in detail with reference to the description of the hybridization in step (a).

Step (d): Extension of a fragment

The extension reaction is performed using the template-dependent nucleic acid polymerase and the product of step (c). The hybridized fragment at the capture site of the CTO extends to form an extended dimer. On the other hand, hybridized uncleaved PTO at the capturing site of the CTO is not extended and thereby no extended dimer is formed.

As used herein, the term "extended dimer" refers to a dimer formed by an extension reaction in which the hybridized fragment at the capture site of CTO is extended using template-dependent nucleic acid polymerase and the templating site of CTO as a template.

The extended dimer has a Tm value that is different from the Tm value of the hybrid between the uncut PTO and the CTO.

Preferably, the extended dimer has a Tm value that is higher than the Tm value of the blend between the uncut PTO and the CTO.

The Tm value of the extended dimer can be adjusted by the sequence and / or length of the fragment, (ii) the sequence and / or length of the CTO or (iii) the sequence and / or length of the fragment and the sequence and / or length of the CTO Do.

It is a significant feature of the present invention to use the adjustable Tm value of the extended dimer so that a target signal indicative of the presence of an extended dimer is provided by the melting of the extended dimer in step (e).

The term "Tm" as used herein refers to the melting temperature at which half of the population of double-stranded nucleic acid molecules is dissociated into single-stranded molecules. T _m value is determined by the length and G / C content of the nucleotides which hybridize. T _m values were determined using the Wallace rule (RB Wallace et al., Nucleic Acids Research , 6: 3543-3547 (1979)) and the nearest-neighbor method (Santa Lucia J. Jr. et al., Biochemistry , 35: 3555-3562 (1996)); Sugimoto N. et al., Nucleic Acids Res. , 24: 4501-4505 (1996)).

According to a preferred embodiment of the present invention, the Tm value means the actual Tm value under the reaction conditions actually used.

The template-dependent nucleic acid polymerase used in step (d) includes any nucleic acid polymerase, such as the "Klenow" fragment of E. coli DNA polymerase I, the thermostable DNA polymerase and the bacteriophage T7 It is a DNA polymerase. Preferably, the polymerase is a thermostable DNA polymerase obtainable from a variety of bacterial species, including Thermus aquaticus (Taq) , Thermus thermophilus (Tth) , Thermus filiformis , Thermis flavus , Thermococcus literalis , Thermus antranikianii , Thermus caldophilus, Thermus chliarophilus , Thermus flavus , Thermus igniterrae , Thermus lacteus , Thermus oshimai , Thermus ruber , Thermus rubens, Thermus scotoductus, Thermus Silvanus , Thermus species Z05, Thermus species sps 17, Thermus thermophilus , Thermotoga maritima , Thermotoga neapolitana , Thermosipho africanus , Thermococcus litoralis , Thermococcus barossi , Thermococcus gorgonarius , Thermotoga maritima , Thermotoga neapolitana , Thermosiphoafricanus, Pyrococcus furiosus ( Pfu ), Pyrococcus woesei , Pyrococcus horikoshii, Pyrococcus abyssi , Pyrodictium occultum , Aquifex pyrophilus And Aquifex aeolieus . Most preferably, the template-dependent nucleic acid polymerase is a Taq polymerase.

According to a preferred embodiment of the present invention, the enzyme with 5 'nuclease activity used in step (b) is identical to the template-dependent nucleic acid polymerase used in step (d). More preferably, the enzyme having the 5 ' nuclease activity used in step (b), the template-dependent nucleic acid polymerase used for extension of the upstream primer and the template-dependent nucleic acid polymerisation used in step (d) Enzymes are identical to each other.

The extended dimer includes (i) at least one label attached to the PTO segment and / or CTO, (ii) a label inserted into the extended dimer during the elongation reaction, (iii) a label inserted within the elongated duplex during the elongation reaction, and / Or (iv) a label derived from an intercalating label.

In the presence of the target nucleic acid sequence, the presence of the extended dimer can indicate the presence of the target nucleic acid sequence, since an extended dimer is formed. To detect the presence of an extended dimer in a direct manner, an extended dimer having a label providing a detectable signal is formed in step (d). The label used for the extended dimer provides a signal change depending on whether the extended dimer is a double strand or a single strand and ultimately provides a target signal indicative of the presence of an extended dimer by melting the extended dimer.

Step (e): Melting of extended dimer

Following the extension reaction, the extended dimer is melted at a range of temperatures to provide a target signal indicative of the presence of an extended dimer.

Wherein the target signal comprises at least one of (i) at least one label attached to said fragment and / or said CTO, (ii) a label inserted into said elongated dimer during said elongation reaction, (iii) a label inserted into said elongated dimer during said elongation reaction, Or (iv) an intercalating label that is linked to said fragment and / or said CTO.

The term "target signal ", as used herein, refers to any signal that may indicate the presence of an extended dimer. For example, the target signal includes a signal (signal generation or extinction) from the mark, a change in signal from the mark (signal increase or decrease), a melting curve, a melting pattern and a melting temperature (or Tm value).

According to a preferred embodiment of the present invention, the target signal is a change in the signal from the marker of the extended dimer in the melting step. The change in signal can be obtained by measuring the signal at at least two different temperatures. Alternatively, the target signal is a melting curve, a melting pattern and a melting temperature (or Tm value) obtained by measuring a signal from a marker of the extended dimer at a temperature range. Preferably, the temperature range is the temperature range for the melting curve analysis or the ambient temperature of the Tm value of the extended dimer.

The extended dimer has a higher Tm value than the unconjugated PTO and the CTO blend. Thus, the extended dimer and the hybridization exhibit different melting patterns. These different melting patterns allow differentiation of the non-target signal and the target signal. Different meltting patterns or melt temperatures produce a target signal with an appropriate labeling system.

Melting can be carried out by conventional techniques, including, but not limited to, heat, alkali, formamide, urea and glycocalse treatment, enzymatic methods such as helicase action and binding proteins . For example, the melting can be accomplished by heat treating at a temperature of 80-105 [deg.] C. The general methods of treatment described above are provided by Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001).

Suitable label systems for use in the present invention vary in terms of their type, location and signal generation.

A labeling system useful in the present invention can be described in detail as follows:

(I) a mark attached to a fragment and / or CTO

According to a preferred embodiment of the present invention, the signal is provided by at least one label connected to the fragment and / or the CTO. Since the extended dimer is formed between the PTO fragment and the CTO, the label of the PTO fragment or CTO is present in the extended dimer to provide the target signal in the melting step.

The label includes an interactive double label and a single label.

(I-1) Interactive double labeling

An interactive label system is a signal generation system in which energy is transmitted non-radioactively between a donor molecule and a receptor molecule. As a representative example of an interactive labeling system, the FRET (fluorescence resonance energy transfer) labeling system includes fluorescent reporter molecules (donor molecules) and quenching molecules (receptor molecules). In FRET, energy donors may be fluorescent, while energy receptors may be fluorescent or non-fluorescent. In another form of interactive labeling system, the energy donor is non-fluorescent, e.g., chromophore and the energy receptor is fluorescent. In another form of interactive labeling system, the energy donor is luminescent, e.g., bioluminescent, chemiluminescent or electrochemiluminescent, and the receptor is fluorescent. Donor molecules and acceptor molecules can be described in the present invention as reporter molecules and quaternary molecules, respectively.

Preferably, the signal indicative of the presence of an extended dimer (i. E., The presence of the target nucleic acid sequence) is generated by an interactive label system, more preferably a FRET label system (i.e., an interactive double label system).

Implementation example 1 (interactive in the strand - double label)

In Implementation Example 1 of an interactive double labeling system, a fragment or CTO has an interactive double label comprising a reporter molecule and a quencher molecule; Melting of the extended dimer in step (e) induces a change in the signal from the interactive double marker to provide the target signal in step (e). Implementation Example 1 of an interactive double labeling system is schematically shown in Figures 2, 6 and 9. Example 1 is termed an interactive-double label in the strand.

Implementation example 1 (inter-strand interaction-double labeling)

The illustrated embodiment is described with reference to Fig. The template region of the CTO has a reporter molecule and a quencher molecule. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment, which hybridizes to and extends to the capture region of the CTO to form an extended duplex.

When an extended dimer is formed in step (d), the reporter molecules and the quencher molecules of the CTO are conformationally spaced so that the quencher molecules unequalize the signal from the reporter molecule; When the extended dimer is melted in step (e), the reporter molecule and the quencher molecule are structurally close to each other such that the quencher molecule quantizes the signal from the reporter molecule, thereby providing a target signal, and in step (e) .

As used herein, the expression "reporter molecules and quaternary molecules are structurally adjacent" to a reporter molecule and a quaternary molecule are three-dimensionally adjacent to each other by a silver fragment or a morphological structure of CTO, such as a random coil and a hairpin structure .

As used herein, the expression "reporter molecules and quaternary molecules are structurally spaced" means that a reporter molecule and a quaternary molecule are three-dimensionally spaced by the formation of a double strand or by a change in the morphological structure of the CTO do.

Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value obtained by measuring a change in the fluorescence signal generated in step (d).

According to a preferred embodiment of the present invention, the reporter molecule and the quencher molecule may be located at any position in the CTO, so long as the signal from the reporter molecule is quenched or unquenched in dependence on extended dimer melting.

According to a preferred embodiment of the present invention, both the reporter molecule and the quencher molecule are linked to the templating or capturing site of the CTO.

According to a preferred embodiment of the invention, the reporter molecule and the quencher molecule are located at the 5'-end and the 3'-end of the CTO.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quencher molecule of the CTO is located at a position separated from its 5 ' -terminal or its 5 ' -terminal by 1-5 nucleotides, It is located at a position to quench or unquantize the signal from the molecule.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quencher molecule of the CTO is located at a position separated from its 3 ' -terminal or its 3 ' -terminal by 1-5 nucleotides, Is located at a position to quench or unquantize the signal from the reporter molecule.

According to a preferred embodiment of the present invention, the reporter molecule and the quencher molecule are positioned at a distance of at most 80 nucleotides from each other, more preferably at most 60 nucleotides, even more preferably at most 30 nucleotides, most preferably at most 25 It is a nucleotide. According to a preferred embodiment of the invention, the reporter molecule and the quencher molecule are located at a distance of at least 4 nucleotides, more preferably at least 6 nucleotides, even more preferably at least 10 nucleotides, most preferably at least 15 nucleotides to be.

In the present invention, a blend between uncut PTO and CTO can be formed.

As shown in Figure 2, when the templating site of the CTO is labeled with an interactive double label, a change in the signal from the label of the hybridization between uncleaved PTO and CTO is not induced. Thus, the hybridization does not provide a non-target signal.

When the capturing moiety of the CTO is labeled with an interactive double label, the blend between the uncleaved PTO and the CTO in the melting step provides a non-target signal. In this case, the difference between the Tm values of the extended dimer and the hybrid can distinguish the target signal of the extended dimer from the non-target signal of the hybrid.

Implementation Example 1 (inter-strand interaction-double labeling)

The illustrated embodiment is described with reference to Fig. The 5'-tagging site of the PTO has a reporter molecule and a quencher molecule. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment containing the 5'-tagging site with the reporter molecule and the quencher molecule. The fragment hybridizes to the capture site of the CTO.

When an extended dimer is formed in step (d), the reporter molecule and the quencher molecule of the fragment are structurally spaced so that the quencher molecule unequivocates the signal from the reporter molecule; When the extended dimer is melted in step (e), the reporter molecule and the quencher molecule are structurally close to each other such that the quencher molecule quantizes the signal from the reporter molecule, thereby providing a target signal, and in step (e) .

According to a preferred embodiment of the present invention, as long as the signal from the reporter molecule is quenched or unquantized in accordance with the melting of the extended dimer, the reporter molecule and the quencher molecule may be located at any position of the fragment.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quencher molecule of the fragment is located at a position separated from its 5 ' -terminal or its 5 ' -terminal by 1-5 nucleotides and the other is the conformation of the fragment. Is located at a position to quench or unquantize the signal from the reporter molecule.

According to a preferred embodiment of the present invention, the reporter molecule and the quencher molecule are positioned at a distance of at most 50 nucleotides from each other, more preferably at most 40 nucleotides, even more preferably at most 30 nucleotides, most preferably at most 20 It is a nucleotide. According to a preferred embodiment of the invention, the reporter molecule and the quencher molecule are located at a distance of at least 4 nucleotides, more preferably at least 6 nucleotides, even more preferably at least 10 nucleotides, most preferably at least 15 nucleotides to be.

As shown in FIG. 6, the blend between uncut PTO and CTO provides a non-target signal in the melting step. In this case, the difference between the Tm values of the extended dimer and the hybrid can distinguish the target signal of the extended dimer from the non-target signal of the hybrid.

Example 2 (Interacting between strands-double labeling)

In Implementation Example 2 of the interactive label system, the fragment has one of the interactive double markers comprising the reporter molecule and the quencher molecule, the CTO having the other of the interactive double markers; Melting of the extended dimer in step (e) induces a change in the signal from the interactive double marker to provide the target signal in step (e).

The illustrated embodiment is described with reference to Fig.

If an extended dimer is formed in step (d), the signal from the reporter molecule linked to the CTO is quenched by the quencher molecule attached to the PTO. When the extended dimer is melted in step (e), the reporter molecules and the quencher molecules are spaced apart from each other such that the quencher molecules unequalize the signal from the reporter molecule, whereby a target signal is provided to determine the presence of an extended dimer in step (e) .

Preferably, the target signal provided in step (e) comprises a melting curve, a melting pattern or a Tm value obtained by measuring a change in the fluorescence signal from an interactive double label.

As long as the signal from the reporter molecule is quenched by the quencher molecule of the extended dimer, the reporter molecule and the quencher molecule can be located at any position of the PTO fragment and the CTO.

According to a preferred embodiment of the invention, the reporter molecule or the quencher molecule of the PTO is located at the 5'-end of the 5'-tagging site.

According to a preferred embodiment of the invention, the reporter molecule or the quencher molecule of the CTO is located at its 3'-end.

As shown in FIG. 8, the blend between uncut PTO and CTO provides a non-target signal in the melting step. In this case, the difference between the Tm values of the extended dimer and the hybrid can distinguish the target signal of the extended dimer from the non-target signal of the hybrid.

Reporter molecules and quencher molecules useful in the present invention may include any molecule known in the art. Examples include Cy2 (506), YO-PRO ™ -1 509, YOYO ™ -1 509, Calcein 517, FITC 518, FluorX ™ 519, Alexa ™ 520, Rhodamine 110 (520), Oregon Green 500 (522), Oregon Green 488 (524), RiboGreen 525, Rhodamine Green 527, Rhodamine 123 529, Magnesium Green 531, , Calcium Green (533), TO-PRO ™ -1 533, TOTO1 533, JOE 548, BODIPY 530/550 550, Dil 565, BODIPY TMR 568, BODIPY 558/568 568), BODIPY 564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC 572, Magnesium Orange 575, Phycoerythrin R & B 575, Rhodamine Phalloidin 575, (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red (590), Cy3.5 (596), ROX (608), Calcium Crimson YO-63 (631), YOYO ™ -3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO TETO3 (660), DiD DilC (5) (665), Cy5 (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Bios CAL Fluor Red 635 (637), FAM (520), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610) , Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) and Quasar 705 (610). The number in parentheses is the maximum emission wavelength in nanometers. Preferably, the reporter molecule and the quencher molecule comprise JOE, FAM, TAMRA, ROX, and a fluorescein-based label.

Suitable reporter-quencher pairs are described in many references: Pesce et al., Editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2 nd Edition (Academic Press, New York, 1971); Griffiths, Color and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, RP, Handbook of Fluorescent Probes and Research Chemicals, 6 th Edition (. Molecular Probes, Eugene, Oreg, 1996); U.S. Patent Nos. 3,996,345 and 4,351,760.

In the present invention, it is noteworthy that non-fluorescent black quencer molecules capable of quenching broad wavelengths or fluorescence of specific wavelengths can be used. Examples of non-fluorescent black quencer molecules are BHQ and DABCYL.

In a FRET label applied to a CTO, the reporter contains a donor of FRET and the quencher contains the remaining partner (receptor) of FRET. For example, fluorescein dye is used as a reporter and rhodamine dye is used as a quancher.

(I-2) Single mark

The invention is also well performed using a single label system that provides a signal indicative of the presence of a target nucleic acid sequence.

According to a preferred embodiment of the invention, the fragment or CTO has a single label, and the melting of the extended dimer in step (e) induces a change in the signal from the single label to provide the target signal in step (e).

Implementation Example 1 (single label system) in Fig.

The illustrated embodiment is described with reference to Fig. The template site of the CTO has a single fluorescent label. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment. The fragment hybridizes and extends to the capture site of the CTO to form an extended dimer. By the formation of extended dimers, the intensity of fluorescence from a single fluorescent label increases. When the extended dimer is melted in step (e), the intensity of the fluorescence coming out of the single fluorescent label is reduced, thereby providing a target signal indicating the presence of an extended dimer in step (e).

According to a preferred embodiment of the present invention, the single label can be located at any position of the CTO as long as there is a change in the level of the signal from the single label as a result of the meltdown of the extended dimer.

According to a preferred embodiment of the invention, the single label is linked to the templating or capturing site of the CTO.

As shown in FIG. 3, when the template site of the CTO is labeled with a single label, a change in signal from the label of the hybridis between the uncleaved PTO and the CTO is not induced. Thus, the hybridization does not provide a non-target signal.

When the capturing moiety of the CTO is labeled with a single label, the blend between the uncut PTO and the CTO in the melting step provides a non-target signal. In this case, the difference between the Tm values of the extended dimer and the hybrid can distinguish the target signal of the extended dimer from the non-target signal of the hybrid.

Implementation Example 2 (single label system) in Fig.

The illustrated embodiment is described with reference to Fig. The 5'-tagging site of PTO has a single fluorescent label. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment containing a 5'-tagging site with a single fluorescent label. By hybridization, the intensity of fluorescence from a single fluorescent label at the 5'-tagging site is increased. When the extended dimer is melted in step (e), the signal intensity from the single fluorescent label is reduced, thereby providing the target signal, indicating the presence of the extended dimer in step (e).

According to a preferred embodiment of the present invention, the single label can be located at any position of the PTO fragment as long as there is a change in the level of the signal from the single label as the elongation dimer is melted.

As shown in FIG. 7, the blend between uncracked PTO and CTO provides a non-target signal in the melting step. In this case, the difference between the Tm values of the extended dimer and the hybrid will distinguish the target signal of the extended dimer from the non-target signal of the hybrid.

The single label used herein should be able to provide a different signal depending on whether it is on a double strand or on a single strand. Single labels include fluorescent labels, luminescent labels, chemiluminescent labels, electrochemical labels, and metal labels. Preferably, the single label comprises a fluorescent label.

The types of single fluorescent labels and preferred binding positions used in the present invention are disclosed in U.S. Patent Nos. 7,537,886 and 7,348,141, the teachings of which are incorporated herein by reference. Preferably, the single fluorescent label comprises JOE, FAM, TAMRA, ROX, and a fluorescein-based label. It is preferred that the residue of the labeled nucleotide is located at the 5'-terminal or 3'-terminal of the oligonucleotide and the internal nucleotide residue in the nucleotide.

A single fluorescent label useful in the present invention can be described with reference to the description of the reporter and the quencher molecule described above.

In particular, when the present invention is practiced using a single label at the solid phase, general fluorescent labels can be used and specific fluorescence capable of providing fluorescent signals with different intensities on double strands or on a single strand No cover is required. The target signal provided in the solid substrate is measured. An implementation of a single label system using the immobilized CTO is schematically shown in FIG.

When CTO immobilized on a solid substrate is used, a chemical label (e.g., biotin) or an enzymatic label (e.g., alkaline phosphate, peroxidase,? -Galactosidase and? -Glucosidase) may be used.

In a labeling system using "fragments and / or labels linked to CTOs ", when labels are formed between the uncleaved PTO and CTO, the label indicates that the label is in a range that does not provide a non-target signal in step (e) Located. Alternatively, if a hybrid between the uncut PTO and the CTO is formed, the label may be located within a range that provides the non-target signal in step (e); The Tm value of the extended dimer is higher than the Tm value of the blend between uncrosslinked PTO and CTO.

In particular, when the hybrid between the uncleaved PTO and the CTO is located within a range that does not provide the non-target signal, the section containing the Tm value of the hybrid is selected as the Tm value of the extended dimer for target nucleic acid sequence detection . ≪ / RTI >

(Ii) a marker inserted in the extended dimer

The present invention can use a label inserted in an extended dimer during an extension reaction to provide a target signal indicative of the presence of an extended dimer.

Even if the PTO fragment or CTO does not have a label, the extended dimer is successfully labeled with the label inserted in the extended dimer during the extension reaction. Figures 10 and 11 diagrammatically illustrate an embodiment in which a single-labeled nucleotide is inserted into an extended duplex during an extension reaction (see C and D in Figures 10 and 11). This embodiment can also be applied to other implementations using the melting analysis.

According to a preferred embodiment of the invention, the target signal is provided by a single label inserted in the extended dimer during the extension reaction; Wherein the inserted single marker is linked to a nucleotide inserted during an extension reaction; Melting of the extended dimer in step (e) induces a change in signal from a single marker to provide a target signal in step (e).

The illustrated embodiment is described with reference to Fig. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment. The fragment hybridizes to the capture site of the CTO immobilized on a solid substrate and extends in the presence of a nucleotide labeled with a single fluorescent label to form an extended dimer. The fluorescence signal from the extended dimer can be detected on the spot of the solid substrate on which the CTO is immobilized. When the extended dimer is melted, the strand with the fluorescent label is released, and the fluorescent signal is no longer detected on the spot (not shown in FIG. 10). Thus, a change in the signal can be provided on the spot by the melting of the extended dimer. That is, a target signal is provided to indicate the presence of an extended dimer in step (e).

The target signal provided in step (e) includes the melting curve, the melting pattern or the Tm value obtained by measuring the change in fluorescence intensity on the CTO-immobilized spot.

According to a preferred embodiment of the present invention, the nucleotide inserted during the extension reaction has a first non-natural base and the CTO has a second non-natural base Lt; RTI ID = 0.0 > non-natural < / RTI > Preferably, the nucleotide with the second non-natural base is located at any position in the templating site of the CTO.

As used herein, the term "non-natural base" refers to a natural (non-natural) base such as adenine (A), guanine (G), thymine (T), cytosine (C) and uracil Quot; means a derivative of a base. The term "non-natural base" as used herein includes, as mother compounds, bases having a base pair pattern different from natural bases, such as those described in U.S. Patent Nos. 5,432,272, 5,965,364, 6,001,983, No. 6,037,120. Base pairs between non-natural bases include two or three hydrogen bonds similar to natural bases. In addition, base pairs between non-natural bases are also formed in a particular manner.

Specific examples of non-natural bases include base pair combinations of the following bases: iso-C / iso-G, iso-dC / iso-dG, K / X, H / 7,422,850).

The illustrated embodiment is described with reference to Fig. The fragment is hybridized to a CTO comprising a nucleotide having a second non-natural base (e.g., iso-dC) that has a specific binding affinity for a first non-natural base (e.g., iso-dG). Extension is carried out in the presence of a nucleotide having a first non-natural base labeled with a single fluorescent label to form an extended dimer. In the extension reaction, the nucleotide having the first non-natural base is inserted at the opposite position of the nucleotide having the second non-natural base.

The fluorescence signal from the extended dimer can be detected on the spot of the solid substrate with the immobilized CTO. When the extended dimer is melted, the strand with the fluorescent label is released, and the fluorescent signal is no longer detected on the spot (not shown in FIG. 11). Thus, a change in the signal can be provided on the spot by the melting of the extended dimer. That is, a target signal is provided to indicate the presence of an extended dimer in step (e).

When the label inserted in the extended dimer is used during the elongation reaction, the label is not included in the blend between the uncleaved PTO and the CTO since the blend is not extended. Thus, the hybridization does not provide a non-target signal.

The type and characteristics of the single label used can be described with reference to the description of a label system using "a fragment and / or a label linked to the CTO " described hereinabove.

(Iii) a marker and fragment attached to the extension dimer or a marker connected to the CTO

As schematically shown in Figures 4 and 5, the present invention may utilize a labeling system using a combination of a marker inserted within the extended dimer and a fragment and / or a marker linked to the CTO during an extension reaction.

According to a preferred embodiment of the present invention, the target signal is provided by a label attached to the fragment and / or the CTO inserted in the extended dimer during the extension reaction and the inserted label is linked to the inserted nucleotide during the extension reaction ; Wherein the two labels are interactive double labels of reporter molecules and quencher molecules; Melting of the extended dimer in step (e) induces a change in the signal from the interactive double label to provide the target signal in step (e).

More preferably, the inserted nucleotide during the extension reaction has a first non-natural base, and the CTO has a second non-natural base with a specific binding affinity for the first non-natural base.

The illustrated embodiment is described with reference to Fig. (E.g., iso-dC) that has a specific binding affinity for the first non-natural base (e. G., Iso-dG) and a second non-natural base Lt; / RTI > Extension is performed in the presence of a nucleotide having a first non-natural base labeled with a quencher or reporter molecule to form an extended duplex and the signal from the reporter molecule is quenched by the quencher molecule. In the extension reaction, the nucleotide having the first non-natural base is inserted at the opposite position of the nucleotide having the second non-natural base.

When the extended dimer is melted in step (e), the reporter molecules and the quencher molecules are spaced apart from each other such that the quencher molecules unequalize the signal from the reporter molecule, whereby a target signal is provided to determine the presence of an extended dimer in step (e) .

Preferably, the target signal provided in step (e) comprises a melting curve, a melting pattern or a Tm value obtained by measuring a change in signal from an interactive double label.

The marker position on the CTO and the insertion position of the marker to be inserted are determined within a range in which the two markers act as an interactive double marker to induce a change in the signal in the melting step.

More preferably, the templating site of the CTO has a reporter or quan- tity molecule and a nucleotide having a second non-natural base. The extension reaction in step (d) is carried out in the presence of a nucleotide having a first non-natural base with a specific binding affinity for the second non-natural base in the quencher or reporter molecule and the CTO. The two non-natural bases of the extended dimer of step (d) quantify the signal from the reporter molecule and induce a signal change by the quencher molecule while forming a base-pair, thereby providing the target signal. Alternatively, the fragment has a reporter or a quencher molecule and the templating site of the CTO has a nucleotide having a second non-natural base. The extension reaction in step (d) is carried out in the presence of a nucleotide having a first non-natural base with a specific binding affinity for the second non-natural base in the quencher or reporter molecule and the CTO. The two non-natural bases of the extended dimer of step (d) induce a change in signal from the reporter molecule by quenching while forming a base-pair, thereby providing a target signal.

Another exemplary implementation is described with reference to FIG. In this embodiment, a fragment comprising a reporter or a quaternary molecule is combined with a second non-natural base (e.g., iso-dC) having a specific binding affinity for a first non-natural base (e.g., iso-dG) Lt; RTI ID = 0.0 > CTO < / RTI > Extension is performed in the presence of a nucleotide having a first non-natural base labeled with a quencher or reporter molecule to form an extended duplex and the signal from the reporter molecule is quenched by the quencher molecule. In the extension reaction, the nucleotide having the first non-natural base is inserted at the opposite position of the nucleotide having the second non-natural base.

When an extended dimer is formed in step (d), the reporter molecule and the quencher molecule are structurally spaced from each other such that the quencher molecule uniquely identifies the signal from the reporter molecule; When the extended dimer is melted in step (e), the reporter molecule and the quencher molecule are structurally close to each other such that the quencher molecule quenches the signal from the reporter molecule, whereby the target signal is provided and extended in step (e) Indicating the presence of a dimer.

Preferably, the target signal provided in step (e) comprises a melting curve, a melting pattern or a Tm value obtained by measuring a change in signal from an interactive double label.

The marker position of the PTO and the insertion position of the marker to be inserted are determined within the range in which the two markers act as an interactive double marker that induces a change in the signal in the melting step.

If the label inserted in the extended dimer is used during the elongation reaction, the label is not included in the blend between the uncleaved PTO and the CTO since the blend is not extended. Thus, the hybridization does not provide a non-target signal in the melting step.

(Iv) Intercalating label.

The present invention can use an intercalating label that provides a target signal indicative of the presence of an extended dimer. Intercalating labels are more useful in solid phase reactions using immobilized CTOs because double-stranded nucleic acid molecules in the sample can generate signals.

Examples of intercalating labels useful in the present invention include SYBRTM Green I, PO-PRO ™ -1, BO-PRO ™ -1, SYTO ^™ 43, SYTO ^™ 44, SYTO ^™ 45, SYTOX ^™ Blue, POPO ™ -1 , POPO ™ -3, BOBO ™ -1, BOBO ™ -3, LO-PRO ™ -1, JO-PRO ™ -1, YO-PRO ^™ 1, TO-PRO ^™ 1, SYTO ^™ 11, SYTO ^™ 13, SYTO ^TM 15, SYTO ^TM 16, SYTO ^TM 20, SYTO ^TM 23, TOTO ™ -3, YOYO ^TM 3, GelStar ^TM and thiazole orange. Intercalating dyes specifically enter into the double-stranded nucleic acid molecule and generate a signal.

An embodiment in which the intercalating dye is intercalated between the base pairs of the extended dimer is schematically shown in FIG. 13 (FIGS. 13C and D). This embodiment can also be applied to other implementations using the melting analysis.

The illustrated embodiment is described with reference to Fig. The fragment is hybridized at the capture site of the CTO immobilized on the solid substrate. Extension is performed in the presence of an intercalating dye (e.g., SYBR ^TM Green) to produce an extended dimer comprising the intercalating dye. A fluorescent signal from an extended dimer on a solid substrate spot with immobilized CTO can be detected using an intercalating fluorescent dye. When the extended dimer is melted, the intercalating fluorescent dye is released and the fluorescent signal is no longer detected on the spot (not shown in FIG. 13). Thus, a target signal is provided to indicate the presence of an extended dimer in step (e).

The blend between uncut PTO and CTO provides a non-target signal at the melting stage. In this case, the difference between the Tm values of the extended dimer and the hybrid can distinguish the target signal of the extended dimer from the non-target signal of the hybrid (not shown in FIG. 13).

Preferably, the target signal provided in step (e) includes a melting curve, a melting pattern or a Tm value obtained by measuring a change in the fluorescence signal generated in step (e).

Step (f): Detection of target signal

Finally, the extended dimer is detected by measuring the target signal provided in step (e), whereby the presence of the extended dimer indicates the presence of the target nucleic acid sequence.

Detection can be performed by various methods depending on the type of the target signal.

According to a preferred embodiment, the detection of the target signal is carried out by means of a melting analysis.

The term "melting analysis" as used herein means a method of obtaining a target signal indicating the existence of the extended duplex by the melting of the extended duplex, and a method of measuring the signal at two different temperatures, melting curve analysis, melting pattern Analysis, and melting peak analysis. Preferably, the melting analysis is a melting curve analysis.

According to a preferred embodiment herein, hybridization is performed after the melting of step (e) to provide a target signal indicative of the presence of said extended dimer. In this case, the presence of extended dimers is detected by hybridization curve analysis.

Melting curves or hybridization curves may be obtained using conventional techniques such as those described in U.S. Patent Nos. 6,174,670 and 5,789,167, Drobyshev et al., Gene 188: 45 (1997); Kochinsky and Mirzabekov Human Mutation 19: 343 (2002); Livehits et al., J. Biomol . Structure Dynam. 11: 783 (1994); And Howell et al ., Nature Biotechnology 17: 87 (1999). For example, the melting curve or hybridization curve may consist of a graphic plot or display of the output signal changes to the parameters of hybridization stringency. The output signal can be plotted directly on the hybridization parameter. Typically, the melting curve or hybridization curve has, for example, fluorescence representing the degree of dimer structure (i.e., degree of hybridization) on the Y-axis and output signal plotted on the X-axis for the hybridization parameter .

PTO and CTO can be composed of naturally occurring dNMPs. Alternatively, the PTO and CTO can be modified nucleotides or non-natural nucleotides such as PNA (Peptide Nucleic Acid, see PCT Application No. WO 92/20702) and LNA (Locked Nucleic Acid, see PCT Application No. WO 98/22489 , WO 98/39352 and WO 99/14226). PTO and CTO may include universal bases such as deoxyinosine, inosine, 1- (2'-deoxy-beta-D-ribofuranosyl) -3-nitropyrrole and 5-nitroindole. The term "universal base" means that it can form a base pair with almost no distinction for each of the natural DNA / RNA bases.

(B), (a) - (d) or (a) - (f), including a denaturation step between said repeating cycles, according to a preferred embodiment of the present invention. Further comprising repeating steps, preferably including a downstream primer. Such repetition amplifies the target nucleic acid sequence and / or the target signal.

According to a preferred embodiment of the invention, steps (a) - (f) are carried out in one reaction vessel or in separate reaction vessels. For example, steps (a) - (b), (c) - (d) or (e) - (f) may be carried out in separate reaction vessels.

According to a preferred embodiment of the present invention, steps (a) - (b) and (c) - (f) may be carried out simultaneously or separately in one reaction vessel depending on the reaction conditions (in particular, temperature).

The present invention does not require that the target nucleic acid sequence to be detected and / or amplified has any particular sequence or length including all DNA (gDNA and cDNA) and RNA molecules.

When mRNA is used as an initial material, a reverse transcription step is essential prior to the annealing step, details of which are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, KF et al., Nucleic Acids Res . 16: 10366 (1988). For the reverse transcription reaction, an oligonucleotide dT primer that hybridizes to a random hexamer or mRNA may be used.

The target nucleic acid sequence that can be detected and / or amplified in the present invention may be any naturally occurring prokaryotic cell nucleic acid, eukaryotic cell (e. G., Protozoa and parasites, fungi, yeast, higher plants, lower animals, (Such as herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, poliovirus, etc.) nucleic acid or viroid nucleic acid.

Further, the present invention is useful for the detection of nucleotide variation. Preferably, the target nucleic acid sequence comprises a nucleotide variation. The term "nucleotide variation" as used herein means all single or plural nucleotide substitutions, deletions, or insertions in DNA sequences of a particular DNA sequence or sequences in similar DNA segments. This continuous DNA fragment contains one gene or some other part of one chromosome. These nucleotide variations may be mutants or polymorphic allele variations. For example, the nucleotide variation detected in the present invention includes single nucleotide polymorphism (SNP), mutation, deletion, insertion, substitution, and translocation. Examples of nucleotide variations include various mutations in the human genome (e.g., mutations in the methylenetetrahydrofolate reductase (MTHFR) gene), mutations associated with drug resistance of the pathogen, and cancer-associated mutations.

In the present invention for detecting a nucleotide variation of a target nucleic acid sequence, when the primer or probe used has a sequence complementary to the nucleotide variation of the target nucleic acid sequence, the target nucleic acid sequence comprising the nucleotide variation is referred to herein as a matching template is described as a matching template. When the primer or probe used has a sequence that is non-complementary to the nucleotide variation of the target nucleic acid sequence, the target nucleic acid sequence comprising the nucleotide variation is referred to herein as a mismatching template.

For detection of a nucleotide variation, the 3'-end of the upstream primer can be designed to be located opposite the nucleotide mutation position in the target nucleic acid sequence. According to a preferred embodiment of the present invention, the 3'-end of the upstream primer has a sequence complementary to the nucleotide variation of the target nucleic acid sequence. The 3'-end of the upstream primer having a sequence complementary to the nucleotide variation of the target nucleic acid sequence is annealed and extended in the matching template to induce PTO cleavage. As a result, the PTO fragment is hybridized to the CTO to provide the target signal. Conversely, when the 3'-end of the upstream primer is mismatched to the nucleotide variation in the mismatch template, even if the upstream primer is hybridized to the mismatch template, it is not extended under conditions where the 3'-terminal annealing of the primer is necessary for the extension reaction No target signal is generated.

Alternatively, PTO cleavage, which is dependent on the hybridization of the PTO with a sequence complementary to the nucleotide variation of the target nucleic acid sequence, can be used. For example, under controlled conditions, a PTO having a sequence complementary to a nucleotide variation of a target nucleic acid sequence is hybridized to a matching template and then cleaved. As a result, the PTO fragment is hybridized to the CTO to provide the target signal. On the other hand, under controlled conditions, the PTO is not hybridized to a mismatch template having a non-complementary sequence at the nucleotide mutation position, and is not cleaved. In this case, preferably the complementary sequence to the nucleotide variation of the PTO is located in the middle of the 3'-targeting region of the PTO.

Alternatively, for detection of a nucleotide variation, the 5'-terminal portion of the 3'-targeting site of the PTO is located in the nucleotide variation of the target nucleic acid sequence, and the 5'-terminal portion of the 3'- It is preferable to have a sequence complementary to the nucleotide variation of the sequence.

In an embodiment for detection of a single nucleotide variation, the 5'-end of the 3'-targeting site of the PTO has a sequence complementary to a single nucleotide variation of the target nucleic acid sequence. As described above, cleavage of the PTO hybridized to a matching template can be accomplished by, for example, immediately upstream of the 5'-end of the 3'-targeting site of the PTO under the upstream primer extension-dependent cleavage induction Can be derived from one position. The 3'-end of the PTO fragment has a complementary nucleotide to a single nucleotide variation. The PTO fragment is hybridized to a CTO having a capture region comprising a sequence corresponding to a nucleotide variation, and then extends to form an extended dimer, thereby providing a target signal. If the same PTO is hybridized to a mismatching template having the same sequence for the matching template except for a single nucleotide mutation, then two nucleotides in the 3'-direction from the 5'-end of the 3'-targeting site of the PTO Disconnection of the PTO may occur at a spaced apart position. The 3'-end of the PTO fragment has a nucleotide that is additionally cleaved in addition to a nucleotide complementary to a single nucleotide variation. In addition, if the position of the CTO hybridized to the truncated nucleotide is designed to have a sequence that is non-complementary to the further truncated nucleotide, the 3'-end of the PTO fragment is not hybridized to the CTO and, under controlled conditions, Lt; / RTI > Even if the PTO fraction elongates to form an extended dimer, the dimer has a Tm value different from that of the dimer due to the hybridization between the PTO and the mismatching template.

According to a preferred embodiment of the present invention, the cleavage site of the PTO having a sequence complementary to the nucleotide variation at a 5'-terminal part of the 3'-targeting site of the PTO is dependent on hybridization with the matching template or mismatch template Wherein the PTO fragments released from the two hybridization events have different sequences and preferably have a different sequence at the 3'-terminal portion thereof, more preferably at the 3'-terminal thereof.

According to a preferred embodiment of the present invention, the selection of the nucleotide sequence of the CTO taking into account the difference in the 3'-terminal part of the PTO fragment makes it possible to discriminate between the matching template and the mismatching template.

According to a preferred embodiment of the present invention, the target nucleic acid sequence used in the present invention is a pre-amplified nucleic acid sequence. The use of pre-amplified nucleic acid sequences significantly increases the sensitivity and specificity of the target detection of the present invention.

According to a preferred embodiment of the present invention, the method is carried out in the presence of a downstream primer.

The advantage of the present invention is further remarkable in that at least two kinds of target nucleic acid sequences are simultaneously detected (multiplexed).

According to a preferred embodiment of the invention, the method is carried out to detect at least two target nucleic acid sequences (more preferably at least three, even more preferably at least five).

According to a preferred embodiment of the invention, the method is carried out (more preferably at least three, more preferably at least five) to detect at least two target nucleic acid sequences; The upstream oligonucleotide comprises at least two oligonucleotides (more preferably at least three, even more preferably at least five), the PTO comprises at least two PTOs (more preferably at least three More preferably at least 5, more preferably at least 3, and most preferably at least 5) CTOs comprise at least one CTO (more preferably at least 2, even more preferably at least 3, most preferably at least 5); When the at least two target nucleic acid sequences are present, the method provides at least two target signals corresponding to at least two target nucleic acid sequences.

The 5'-tagging sites of at least two PTOs may have the same sequence. For example, when the present invention is carried out in screening of a target nucleic acid sequence, the 5'-tagging site of the PTO may have the same sequence.

Furthermore, one kind of CTO can be used for the detection of a plurality of target nucleic acid sequences. For example, when PTOs having the same sequence at the 5'-tagging site are used for screening a target nucleic acid sequence, one kind of CTO can be used.

According to a preferred embodiment of the present invention, the extended dimers corresponding to at least two target nucleic acid sequences have mutually different Tm values.

According to a preferred embodiment of the present invention, at least two target signals corresponding to at least two target nucleic acid sequences are provided from different kinds of labels.

According to a preferred embodiment of the present invention, at least two target signals corresponding to at least two target nucleic acid sequences are provided from the same kind of label.

According to a preferred embodiment of the present invention, at least two target signals corresponding to at least two target nucleic acid sequences are provided from the same kind of label; The extended dimers corresponding to at least two target nucleic acid sequences have mutually different Tm values.

As used herein, the term "different kind of label" means a label whose detectable signal has different characteristics. For example, FAM and TAMRA as fluorescent reporter labels are considered as different types of labels because their excitation and emission wavelengths are different from each other.

In order to simultaneously detect at least two kinds of target nucleic acid sequences by the melting curve analysis, when the extended dimers corresponding to at least two kinds of target nucleic acid sequences have mutually different Tm values by the present invention, At least two kinds of target nucleic acid sequences can be detected even if FAM (e.g., FAM) is used.

Target detection using solid-state CTO

The remarkable advantage of the present invention is that detection of the target nucleic acid sequence is effective even in a solid phase such as a microarray.

According to a preferred embodiment of the present invention, the present invention is carried out in a solid phase, and the CTO is immobilized on the solid substrate through its 5'-terminal or 3'-terminal. In the solid phase, the target signal provided on the solid substrate is measured.

When the immobilized CTO is used, the melting analysis using the above-mentioned marking system can be applied to the solid-phase reaction of the present invention.

According to a preferred embodiment of the present invention, the target signal is provided by a single label attached to the fragment or by a single label inserted into the extended dimer during the extension reaction. In particular, when the present invention is practiced using a single label at the solid phase, general fluorescent labels can be used and specific fluorescence capable of providing fluorescent signals with different intensities on double strands or on a single strand No cover is required.

When CTO immobilized on a solid substrate is used, a chemical label (e.g., biotin) or an enzymatic label (e.g., alkaline phosphate, peroxidase,? -Galactosidase and? -Glucosidase) may be used.

For solid phase reactions, the CTO is immobilized (directly or indirectly) (preferably indirectly) to the surface of the solid substrate via its 5'-terminal or 3'-terminal (preferably 3'-terminal). The CTO may also be immobilized on a solid substrate surface in a covalent or noncovalent manner. When the immobilized CTO is immobilized indirectly on the solid substrate surface, a suitable linker is used. Linkers useful in the present invention may include any linker used for immobilizing probes on a solid substrate surface. For example, an alkyl or aryl compound having an amine group or an alkyl or aryl compound having a thiol group can be used as a linker for CTO immobilization. A poly (T) tail or poly (A) tail can also be used as the linker.

According to a preferred embodiment of the present invention, the solid substrate used in the present invention is a microarray. Microarrays providing the reaction environment of the present invention may include any of those known in the art. All of the processes of the present invention, i.e. hybridization with a target nucleic acid sequence, cleavage, extension, melting and fluorescence detection are carried out on a microarray. The CTO immobilized on the microarray is used as a hybridizable array element. Solid state substrates for fabricating microarrays include metal (e.g., gold, copper and copper alloys, aluminum), metal oxides, glass, ceramics, quartz, silicon, semiconductors, Si / SiO ₂ wafers, germanium, gallium arsenide , Carbon, carbon nanotubes, polymers (e.g., polystyrene, polyethylene, polypropylene, and polyacrylamide), Sepharose, agarose, and colloids. The plurality of immobilized CTOs of the present invention can be immobilized on one addressable site or a plurality of addressable sites on a solid substrate and the solid substrate can contain 2-1,000,000 addressable sites . Conventional fabrication techniques such as photolithography, ink-jetting, mechanical micro-spotting, and the like methods can be used to fabricate an immobilized CTO to produce an array or array for a particular application.

In the present invention, a plurality of target nucleic acid sequences can be simultaneously detected even when one kind of label is used because the label on the immobilized CTO is physically separated. Therefore, the number of target nucleic acid sequences detectable by the present invention on a solid phase is not limited.

Ⅱ. Preferred embodiments using amplification of the target nucleic acid sequence

Preferably, the present invention is carried out simultaneously using amplification of the target nucleic acid sequence using a pair of primers comprising an upstream primer capable of synthesizing a target nucleic acid sequence and a downstream.

According to another aspect of the present invention, the present invention provides a method for detecting a target nucleic acid sequence from a DNA or nucleic acid mixture by a PTOCE (PTO cleavage and extension) assay, comprising the steps of:

(a) hybridizing the target nucleic acid sequence with a pair of primers comprising an upstream primer and a downstream primer and a Probing and Tagging Oligonucleotide (PTO); Wherein each of the upstream primer and the downstream primer comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Said PTO comprising (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to said target nucleic acid sequence; And (ii) a 5'-tagging site comprising a nucleotide sequence that is non-complementary to the target nucleic acid sequence; Wherein the 3'-targeting region is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence; Wherein the PTO is located between the upstream primer and the downstream primer; Said PTO is blocked at its 3'-end to prevent extension;

(b) contacting the result of step (a) to a template-dependent nucleic acid polymerase having 5 'nuclease activity under conditions for extension of said primer and cleavage of said PTO; When the PTO is hybridized to the target nucleic acid sequence, the upstream primer is extended and the extended strand induces cleavage of the PTO by a template-dependent nucleic acid polymerase having the 5 ' nuclease activity, Tagged portion of said PTO or a portion of said < RTI ID = 0.0 > 5'-tagging < / RTI >

(c) hybridizing CTO (Capturing and Templating Oligonucleotide) with said fragment released from said PTO; Wherein the CTO comprises: (i) a capture region comprising a nucleotide sequence complementary to the 5'-tagging site of the PTO or a portion of the 5'-tagging site; and (ii) A templating site comprising a tagging site and a non-complementary nucleotide sequence at the 3'-targeting site; Wherein the fragment released from the PTO is hybridized to the capture site of the CTO;

(d) performing an extension reaction using the result of step (c) and a template-dependent nucleic acid polymerase; Said fragment hybridized to said capture region of said CTO extends to form an extended dimer; Wherein said extended dimer comprises a sequence and / or length of said fragment, (ii) a sequence and / or length of said CTO, or (iii) said sequence and / or length of said fragment and said sequence and / Lt; RTI ID = 0.0 > Tm < / RTI >

(e) melting said elongated dimer at a range of temperatures to provide a target signal indicative of the presence of said elongated dimer; Wherein the target signal comprises at least one of (i) at least one label attached to the fragment and / or the CTO, (ii) a label inserted in the elongated dimer during the elongation reaction, (iii) a label inserted in the elongated dimer during the elongation reaction And (iv) an intercalating label that is linked to said fragment and / or said CTO; And

(f) detecting the extended dimer by measuring the target signal; The presence of the extended dimer indicates the presence of the target nucleic acid sequence.

Since the preferred embodiment of the present invention implements the above-described steps of the present invention, the common description therebetween omits its description in order to avoid the excessive complexity of the present specification.

According to a preferred embodiment of the present invention, the method comprises repeating the steps (a) - (b), (a) - (d) or (a) - (f) . Reaction repetition is accompanied by amplification of the target nucleic acid sequence. Preferably, the amplification is carried out according to the polymerase chain reaction (PCR) disclosed in U.S. Patent Nos. 4,683,195, 4,683,202 and 4,800,159.

According to a preferred embodiment of the present invention, the method is carried out in order to detect at least two kinds of target nucleic acid sequences.

According to a preferred embodiment of the present invention, at least two target signals corresponding to at least two target nucleic acid sequences are provided from the same kind of label; The extended dimers corresponding to at least two target nucleic acid sequences have mutually different Tm values.

Ⅲ. Target detection method by PTOCE including detection process at designated temperature

The present invention can be modified to use a target signal that occurs in association with the formation of an extended dimer.

According to another aspect of the present invention, the present invention provides a method for detecting a target nucleic acid sequence from a DNA or nucleic acid mixture by a PTOCE (PTO cleavage and extension) assay, comprising the steps of:

(a) hybridizing the target nucleic acid sequence with an upstream oligonucleotide and a Probing and Tagging Oligonucleotide (PTO); Wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence; Said PTO comprising (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to said target nucleic acid sequence; And (ii) a 5'-tagging site comprising a nucleotide sequence that is non-complementary to the target nucleic acid sequence; Wherein the 3'-targeting region is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence; Wherein the upstream oligonucleotide is located upstream of the PTO;

(b) contacting the result of step (a) to an enzyme having 5 'nuclease activity under conditions for cleavage of the PTO; Wherein said upstream oligonucleotide or extension strand thereof induces cleavage of said PTO by an enzyme having said 5 ' nuclease activity, wherein said cleavage is carried out at the 5 ' -tagging site of said PTO or at said 5 ' Emitting a fragment comprising a portion;

(c) hybridizing CTO (Capturing and Templating Oligonucleotide) with said fragment released from said PTO; Wherein the CTO comprises: (i) a capture region comprising a nucleotide sequence complementary to the 5'-tagging site of the PTO or a portion of the 5'-tagging site; and (ii) A templating site comprising a 5'-tagging site and a non-complementary nucleotide sequence at the 3'-targeting site; Wherein the fragment released from the PTO is hybridized to the capture site of the CTO;

(d) performing an extension reaction using the result of step (c) and a template-dependent nucleic acid polymerase; Said fragment hybridized to said capture region of said CTO extends to form an extended dimer; Wherein said extended dimer comprises a sequence and / or length of said fragment, (ii) a sequence and / or length of said CTO, or (iii) said sequence and / or length of said fragment and said sequence and / Lt; RTI ID = 0.0 > Tm < / RTI > (I) at least one label attached to said fragment and / or CTO, (ii) a label inserted into said extended dimer during said elongation reaction, (iii) at least one (Iii) providing a target signal by a label and (iv) an intercalating label inserted in said elongated dimer during said extension reaction; And

(e) detecting the extended dimer by measuring the target signal at a specified temperature at which the extended dimer retains its double-stranded form, whereby the presence of the extended dimer indicates the presence of the target nucleic acid sequence.

Since the preferred embodiment of the present invention implements the above-described steps of the present invention except for the melting step, the common description therebetween is skipped to avoid the excessive complexity of the present specification.

Since the target signal is provided by measuring the signal changes provided in the melting of the extended dimer, the present invention using the above-described melt analysis requires detection of signals from the mark at at least two different temperatures.

Alternatively, in one aspect of the present invention, the extended dimer itself provides a signal that distinguishes between the case where the extended dimer is formed and the case where it is not formed, the signal indicating that the extended dimer has a predetermined temperature temperature, whereby the presence of the target nucleic acid sequence is determined.

The present invention is to measure a target signal associated with the formation of an extended dimer to detect the presence of a target nucleic acid sequence.

In the present invention, the extended dimer has a label, whereby the extended dimer provides a target signal.

Preferably, the target signal comprises a signal (signal generation or signal annihilation) originating from the label of the extended dimer at the specified temperature.

The marking of the present invention can be carried out in the same manner as the method using the above-described melting analysis. Figures 2-13 may illustrate one aspect of the invention that is slightly modified for detection at a specified temperature.

The principle of operation based on a target signal from an extended dimer is as follows: (i) extension of the fragment induces a change in the signal from the marker to provide a target signal; or

(Ii) hybridization of the fragment and the CTO induces a change in signal from the label to provide a target signal, which retains the target signal.

An embodiment of the working principle (i) can be described with reference to Fig. When immobilized CTO is used, the present invention detects multiple target nucleic acid sequences in a more effective manner. The templating site of the immobilized CTO has reporter molecules and quencher molecules. The reporter molecules and the quencher molecules are structurally close to each other and the quanter molecule quantizes the signal from the reporter molecule. When a fragment hybridizes to the capture region of the CTO, the quencher molecule quantizes the signal from the reporter molecule. By the formation of the extended dimer, the reporter molecules and the quencher molecules are structurally spaced from each other such that the quencher molecules uniquely identify the signal from the reporter molecule. The target signal is provided in the extension phase (C and D in Fig. 9).

In Fig. 9, the hybrid between uncut PTO and CTO does not form an extended dimer. Thus, the quanter molecule still quenched the signal from the reporter molecule. The blend does not provide a non-target signal.

An embodiment of the operating principle (ii) can be described with reference to Fig. The drawing shows not only a method using the melting analysis but also an aspect of the present invention. The 5'-tagging site of the PTO has a reporter molecule and a quencher molecule. The reporter molecules and the quencher molecules are structurally close to each other and the quanter molecule quantizes the signal from the reporter molecule. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment comprising a 5'-tagging site with a reporter molecule and a quencher molecule, and the fragment is hybridized to the capture site of the CTO. By such hybridization, the reporter molecule and the quencher molecule are structurally spaced from each other, so that the quencher molecule uniquely identifies the signal from the reporter molecule. The target signal is provided in the fragment hybridization step, and the extended dimer maintains the target signal (C and D in Fig. 6).

In Figure 6, the blend between the uncut PTO and the CTO provides a non-target signal (C and D in Figure 6) and requires dissociation of the blend to remove the non-target signal. Thus, the temperature at which the target signal is measured is determined such that the hybridisate dissociates. According to a preferred embodiment of the present invention, the temperature is additionally determined in consideration of the Tm value of the mixed product.

According to a preferred embodiment of the present invention, an extended dimer can be detected at a temperature at which the mixture is partially disassociated.

The specified temperature is higher than the temperature minus 10 ° C from the Tm value of the mixed product, preferably higher than the Tm value minus 5 ° C of the mixed product, more preferably higher than the Tm value of the mixed product, Is higher than the Tm value of the mixture by 5 占 폚.

According to a preferred embodiment of the present invention, the target signal provided by the extended dimer is provided during the extension of step (d); 2-4 and 9-11, the intercalated PTO and CTO intercalate does not provide a non-target signal.

According to a preferred embodiment of the present invention, the target signal provided by the extended dimer is provided by hybridization of the fragment and CTO in step (C), and in step (d) the formation of the extended dimer maintains the target signal ; Said blend between uncracked PTO and CTO provides a non-target signal; As shown in FIGS. 5-8 and 12-13, the specified temperature is higher than the Tm value of the mixed product.

When the intercalated PTO and CTO blend provides a non-target signal (panel D of FIG. 6), it is necessary to dissociate the hybridisate to remove the non-target signal. Thus, the temperature at which the target signal is measured is determined such that the hybridisate dissociates.

A labeling system useful in the present invention can be described as follows:

(I) a mark attached to a fragment and / or CTO

(I-1) Interactive double labeling

In an embodiment of an interactive double labeling system, the CTO has an interactive double label comprising a reporter molecule and a quencher molecule; The extension of the fragment in step (d) induces a change in the signal from the interactive double label to provide the target signal. Example 1 of an interactive double label system is schematically shown in Fig. The target signal is provided as an extension-synchronized signal generation.

According to a preferred embodiment of the invention, the reporter molecule and the quencher molecule may be located at the templating site of the CTO.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quencher molecule of the CTO is located at a position separated from its 5 ' -terminal or its 5 ' -terminal by 1-5 nucleotides, It is located at a position to quench or unquantize the signal from the molecule.

In an embodiment of an interactive double labeling system, the CTO has an interactive double label comprising a reporter molecule and a quencher molecule; Hybridization of the fragment and CTO in step (c) induces a change in signal from the interactive double label to provide a target signal, which retains the target signal.

According to a preferred embodiment of the present invention, the reporter molecule and the quencher molecule may be located at the capture region of the CTO.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quencher molecule of the CTO is located at a position separated from its 3'-terminal or its 3'-terminal by 1-5 nucleotides, and the other is a reporter It is located at a position to quench or unquantize the signal from the molecule.

In this embodiment, the intercalated PTO and CTO intercalate provides a non-target signal; The temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

In an embodiment of an interactive double labeling system, the fragment has an interactive double label comprising a reporter molecule and a quencher molecule; Hybridization of the fragment and CTO in step (c) induces a change in signal from the interactive double label to provide a target signal, which retains the target signal. Implementation Example 1 of an interactive double labeling system is schematically shown in Fig.

According to a preferred embodiment of the present invention, one of the reporter molecule and the quanter molecule of the fragment is located at a position separated from its 5 ' -terminal or its 5 ' -terminal by 1-5 nucleotides and the other is a reporter It is located at a position that quantizes the signal from the molecule.

In this embodiment, the intercalated PTO and CTO intercalate provides a non-target signal; The temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

In an embodiment of an interactive double labeling system, the fragment has one of the interactive double markers comprising a reporter molecule and a quencher molecule and the CTO has the other of the interactive double markers; Hybridization of the fragment and CTO in step (c) induces a change in signal from the interactive double label to provide a target signal, which retains the target signal. An example of an interactive dual labeling system is schematically shown in FIG.

As long as the signal from the reporter molecule is quenched by the quencher molecule, the reporter molecule and the quencher molecule can be located at any position of the PTO fragment and the CTO.

According to a preferred embodiment of the present invention, preferably the reporter molecule or the quencher molecule of the PTO is located at the 5'-end of the PTO.

According to a preferred embodiment of the invention, preferably the reporter molecule or the quencher molecule of the CTO is located at the 5'-end of the CTO.

In this embodiment, the intercalated PTO and CTO intercalate provides a non-target signal; The temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

(I-2) Single mark

In an embodiment of the single label system, the CTO has a single label, and extension of the fragment in step (d) induces a change in signal from a single label to provide a target signal. An implementation of a single label system is schematically shown in FIG. The target signal is provided as an extension-synchronized signal generation.

According to a preferred embodiment of the present invention, the template portion of the CTO is labeled with a single label.

In an embodiment of the single label system, the CTO has a single label, and the hybridization of the fragment and the CTO in step (c) induces a change in signal from a single label to provide a target signal, .

According to a preferred embodiment of the present invention, the capture region of the CTO is labeled with a single label.

In this embodiment, the intercalated PTO and CTO intercalate provides a non-target signal; The temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

In an embodiment of the single label system, the fragment has a single label, and the hybridization of the fragment and the CTO in step (c) induces a change in signal from a single label to provide a target signal, . An implementation of a single label system is schematically shown in FIG.

In this embodiment, the intercalated PTO and CTO intercalate provides a non-target signal; The temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

The single label used herein should be able to provide a different signal depending on whether it is on a double strand or on a single strand. Single labels include fluorescent labels, luminescent labels, chemiluminescent labels, electrochemical labels, and metal labels. Preferably, the single label comprises a fluorescent label. The types of single fluorescent labels and preferred binding sites used in the present invention are disclosed in U.S. Patent Nos. 7,537,886 and 7,348,141, which are incorporated herein by reference in their entirety. Preferably, the single fluorescent label comprises JOE, FAM, TAMRA, ROX, and a fluorescein-based label. It is preferred that the residue of the labeled nucleotide is located at the 5'-terminal or 3'-terminal of the oligonucleotide and the internal nucleotide residue in the nucleotide.

A single fluorescent label useful in the present invention can be described with reference to the description of the reporter and the quencher molecule as described above.

In particular, when the present invention is practiced using a single label at the solid phase, general fluorescent labels can be used and specific fluorescence capable of providing fluorescent signals with different intensities on double strands or on a single strand No cover is required.

When CTO immobilized on a solid substrate is used, a chemical label (e.g., biotin) or an enzymatic label (e.g., alkaline phosphate, peroxidase,? -Galactosidase and? -Glucosidase) may be used.

According to a preferred embodiment of the present invention, when a blend between uncracked PTO and CTO is formed, it is preferred that the blend does not provide a non-target signal in step (d), as shown in Figures 2-3 and 9 A cover within the scope and connected to the CTO is located.

Optionally, if a hybrid is formed between the uncleaved PTO and CTO as shown in Figures 6-8 and 12, the label may be located within a range that provides the non-target signal in step (d) ; The Tm value of the extended dimer is higher than that of the uncrosslinked PTO and CTO.

(Ii) a marker inserted in the extended dimer

In particular, when the present invention is practiced on a solid phase using immobilized CTO, the present labeling system is more useful for providing a target signal, as shown diagrammatically in FIGS.

According to a preferred embodiment of the invention, the target signal is provided by a single label inserted in the extended dimer during the extension reaction; The inserted single marker is linked to the inserted nucleotide during the extension reaction; Extension of the fragment in step (d) induces a change in signal from a single marker to provide the target signal in step (d).

According to a preferred embodiment of the invention, the nucleotide inserted during the extension reaction has a first non-natural base, as shown diagrammatically in Figure 11, and the CTO has a specific binding affinity for the first non-natural base Lt; RTI ID = 0.0 > non-natural < / RTI > Preferably, the nucleotide having the second non-natural base can be located at any position in the templating site of the CTO.

If a label inserted in the extended dimer is used during the elongation reaction, the label is not included in the blend between the uncleaved PTO and the CTO since the blend is not extended. Thus, the hybridization does not provide a non-target signal.

(Iii) a marker and fragment attached to the extension dimer or a marker connected to the CTO

As schematically shown in Figures 4 and 5, the present invention may utilize a labeling system using a combination of a marker inserted within the extended dimer and a fragment and / or a marker linked to the CTO during an extension reaction.

According to a preferred embodiment of the present invention, the target signal is provided by a label inserted into the extended duplex and a fragment and / or a marker linked to the CTO during an extension reaction; The inserted marker is linked to the inserted nucleotide during the extension reaction; Wherein the two labels are interactive double labels of reporter molecules and quencher molecules; The extension of the fragment in step (d) induces a change in the signal from the interactive double label to provide a target signal.

More preferably, the inserted nucleotide during the extension reaction has a first non-natural base and the CTO has a second non-natural base having a specific binding affinity for the first non-natural base.

Preferably, the target signal provided in step (e) is a signal from an interactive double label of step (d).

If a label inserted in the extended dimer is used during the elongation reaction, the label is not included in the blend between the uncleaved PTO and the CTO since the blend is not extended. Thus, the hybridization does not provide a non-target signal.

(Iv) Intercalating label.

The present invention can use an intercalating label that provides a target signal indicative of the presence of an extended dimer. Intercalating labels are more useful in solid phase reactions using immobilized CTOs because double-stranded nucleic acid molecules in the sample can generate signals.

The illustrated embodiment is described with reference to Fig. The PTO hybridized to the target nucleic acid sequence is cleaved to release a fragment. The fragment is hybridized to the CTO. Extension is performed in the presence of an intercalating dye (e.g., SYBR ^TM Green) to produce an extended dimer comprising the intercalating dye.

In FIG. 13, the intercalated PTO and CTO intercalate compound provides a non-target signal (C and D in FIG. 13) and it is necessary to dissociate the intercalated compound to remove the non-target signal. Therefore, the temperature at which the target signal is measured is determined in consideration of the Tm value of the mixed product.

Preferably, the target signal provided in step (e) is a signal from the intercalating dye.

According to a preferred embodiment of the present invention, the PTO and / or CTO is blocked at its 3'-end and prevented from extending.

According to a preferred embodiment of the present invention, the upstream oligonucleotide is an upstream primer or an upstream probe.

According to a preferred embodiment of the present invention, the upstream oligonucleotide is located close to the PTO to induce cleavage of the PTO by an enzyme having 5 ' nuclease activity.

According to a preferred embodiment of the present invention, the upstream primer induces cleavage of the PTO by an enzyme having 5 ' nuclease activity through its extended strand.

According to a preferred embodiment of the invention, the method comprises repeating steps (a) - (b), (a) - (d) or (a) - (e) .

According to a preferred embodiment of the invention, steps (a) - (b) or (c) - (e) are carried out in one reaction vessel or in separate reaction vessels.

According to a preferred embodiment of the present invention, the method is carried out to detect at least two target nucleic acid sequences; Wherein the upstream oligonucleotide comprises at least two oligonucleotides, the PTO comprises at least two PTOs, and the CTO comprises at least one CTO; When the at least two target nucleic acid sequences are present, the method provides at least two target signals corresponding to at least two target nucleic acid sequences.

According to a preferred embodiment of the present invention, the upstream oligonucleotide is an upstream primer and the template-dependent nucleic acid polymerase is used in step (b) for extension of the upstream primer.

According to a preferred embodiment of the present invention, the CTO is immobilized on the solid substrate through its 5'-terminal or 3'-terminal and measures the target signal provided in the solid substrate.

According to a preferred embodiment of the invention, the target signal is provided by a single label attached to the fragment or by a single label inserted in the extended dimer during the extension reaction.

According to a preferred embodiment of the present invention, the method is carried out in the presence of a downstream primer.

The detection of step (e) may be performed in a real-time manner, an end-point manner or a designated time interval manner. If the present invention additionally includes repeating steps (a) - (b), (a) - (d) or (a) - (e), in each cycle of the repetition at a specified temperature Time manner), at the end of the repetition at the specified temperature (i. E., End-point manner) or at the designated time intervals during the repetition at the specified temperature. Advantageously, said detection can be performed in each cycle of said iteration in a real-time manner to improve detection accuracy and quantification.

IV. Kit for target detection

According to another aspect of the present invention, the present invention provides a kit for detecting a target nucleic acid sequence from a DNA or nucleic acid mixture by a PTOCE (PTO cleavage and extension) assay:

(a) an upstream oligonucleotide; Wherein the upstream oligonucleotide comprises a hybridization nucleotide sequence complementary to the target nucleic acid sequence;

(b) PTO (Probing and Tagging Oligonucleotide); Said PTO comprising (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to said target nucleic acid sequence; And (ii) a 5'-tagging site comprising a nucleotide sequence that is non-complementary to the target nucleic acid sequence, wherein the 3'-targeting site is hybridized to the target nucleic acid sequence and the 5'- Is not hybridized to the target nucleic acid sequence; Wherein the upstream oligonucleotide is located upstream of the PTO; Wherein said upstream oligonucleotide or its extended strand induces cleavage of said PTO by an enzyme having 5 ' nuclease activity, said cleavage comprising the 5 ' -tagging site of said PTO or a portion of said 5 ' Releasing the fragment comprising; And

(c) CTO (Capturing and Templating Oligonucleotide); Wherein the CTO comprises: (i) a capture region comprising a nucleotide sequence complementary to the 5'-tagging site of the PTO or a portion of the 5'-tagging site; and (ii) A templating site comprising a 5'-tagging site and a non-complementary nucleotide sequence at the 3'-targeting site; Wherein the fragment released from the PTO is hybridized to the capture site of the CTO; And wherein the fragment hybridized to the capture site of the CTO is extended by a template-dependent nucleic acid polymerase to form an extended duplex.

Since the kit of the present invention is constructed so as to be able to carry out the detection method of the present invention described above, the common description therebetween is omitted in order to avoid the excessive complexity of the present specification.

According to a preferred embodiment of the present invention, the kit further comprises an enzyme having 5 'nuclease activity.

According to a preferred embodiment of the present invention, the kit further comprises a template-dependent nucleic acid polymerase.

According to a preferred embodiment of the present invention, the PTO and / or CTO has at least one label.

According to a preferred embodiment of the present invention, the kit further comprises a label which is inserted into the extended dimer during the extension reaction.

According to a preferred embodiment of the present invention, the kit further comprises a label which is inserted into the extended dimer during the extension reaction, and wherein the PTO and / or CTO has at least one label.

According to a preferred embodiment of the present invention, the kit further comprises an intercalating indicator.

According to a preferred embodiment of the present invention, the label is a single label or an interactive double label.

According to a preferred embodiment of the present invention, the kit is used for detecting at least two nucleic acid sequences, wherein the upstream oligonucleotide comprises at least two oligonucleotides, the PTO comprises at least two PTOs, and the CTO Includes at least two types of CTOs.

According to a preferred embodiment of the present invention, the CTO is immobilized on a solid substrate through its 5 ' -terminal or 3 ' -terminal.

According to a preferred embodiment of the present invention, the kit further comprises a downstream primer.

All kits of the invention described herein above can optionally include reagents necessary to perform a target amplification PCR reaction (e. G., PCR reaction) such as a buffer, a DNA polymerase joiner and deoxyribonucleotide-5-triphosphate have. Alternatively, the kit of the present invention may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. The kit may also include a positive control and reagents that are necessary to perform negative control reactions. Optimal amounts of reagents used in a particular reaction can be readily determined by those skilled in the art having the teachings herein. Typically, the kit of the present invention is fabricated as a separate package or compartment comprising the aforementioned components.

V. PTOCE assay using CTO set

Interestingly, the inventors have found that when performing a PTOCE assay using CTO sets each having 4 bases at the 5'-end of the capture site, target detection is achieved in an efficient manner. Under these discoveries, the present inventors have discovered that CTO having G at the 5'-end of the capture site, CTO having C at the 5'-end of the capture site, CTO having A at the 5'-end of the capture site, A set of CTOs containing CTO at the 5'-end of the capture site was designed and the 5'-end of the capturing site of the CTO was designed to hybridize to the 5'-end of the 3'-targeting site of the PTO Respectively. This new approach can increase the efficiency of the previously reported PTOCE assay developed by the present inventors (see WO 2012/096523).

In another aspect of the invention, there is provided a kit for detecting a target nucleic acid sequence from a mixture of DNA or nucleic acids, the kit comprising a set of Capturing and Templating Oligonucleotides (CTO)

Wherein each CTO comprises: (a) (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence; And (ii) a portion of the 5'-tagging site or the 5'-tagging site of a Probing and Tagging Oligonucleotide (PTO) comprising a 5'-tagging site comprising a nucleotide sequence non-complementary to the target nucleic acid sequence A capture region comprising a complementary nucleotide sequence, and (b) a template region comprising a 5'-tagging site of said PTO and a non-complementary nucleotide sequence at said 3'-targeting site;

The CTO set includes:

CTO (Capturing and Templating Oligonucleotide) with G at the 5'-end of the capture region, and

CTO with C at the 5'-end of the capture site;

Or the CTO set comprises:

CTO having G at the 5'-end of the capturing site,

CTO having C at the 5'-end of the capturing site,

CTO having A at the 5'-end of the capture site, and

CTO having T at the 5'-end of the capture site;

Wherein the 5'-end of the capture site of the CTO is hybridized to the 5'-end of the 3'-targeting site of the PTO;

Except for the 5'-end of the capture region, the capture region of the CTO has the same nucleotide sequence; Wherein the templating sites of the CTO have the same nucleotide sequence or different nucleotide sequences;

The CTO having a single label or interactive double label comprising a reporter molecule and a quencher molecule;

The nucleotide sequence of each of the capture and templating sites of the CTO is non-complementary to the target nucleic acid sequence;

The 3'-targeting site of the PTO is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence;

The upstream oligonucleotides or extension strands thereof induce cleavage of the PTO hybridized to the target nucleic acid sequence by an enzyme having 5 ' nuclease activity, which cleaves the 5 ' -tagging site of the PTO or the 5 & Terminus of the 3'-targeting site of the PTO, and the fragment released from the PTO is 5 ' -terminal complementary to the 5 ' -terminal of the 3 ' -target site of the PTO Hybridized to the capture region of the CTO having a '-terminus;

Said fragment hybridized to the capture region of said CTO is extended by a template-dependent nucleic acid polymerase to form an extended duplex; The extended dimer provides a target signal.

The kit of the present invention comprises a CTO set.

The CTO set includes a CTO having G at the 5'-end of the capture site, a CTO having C at the 5'-end of the capture site, a CTO having A at the 5'-end of the capture site, Lt; RTI ID = 0.0 > T < / RTI >

The CTO used has 5'-terminal nucleotides that are different from each other at the capture site. The 5'-end of the capture site of the CTO is a position that hybridizes to the 5'-end of the 3'-targeting site of the PTO.

Under certain conditions, the cleavage site of the PTO in the PTOCE assay may be located at a position separated by one nucleotide from the 3'-end of the 5'-tagging site of the PTO in the 3'-direction. These conditions include the use of a primer pair, a thermal stability DNA polymerase (e.g. Taq polymerase), a cycle reaction of denaturation, annealing and extension (e.g., PCR thermal protocol), 4 Lt; RTI ID = 0.0 > PTO < / RTI > that is completely non-complementary to the target nucleic acid sequence.

The kit of the present invention is characterized in that the cleavage site of the PTO by an enzyme having 5'-nuclease activity is located at a position spaced apart by one nucleotide from the 3'-end of the 5'-tagging site of the PTO in the 3'-direction Used in PTOCE assays conducted under conditions.

When the cleavage reaction occurs in the manner described above, the fragment released from the PTO has one of A, T, G, and C at its 3'-terminus according to the target nucleic acid sequence. A kit comprising a set of CTOs containing the same capture region except for the 5'-end of the capture site can provide a target signal regardless of the type of nucleotide at the 3'-end of the released fragment. In this regard, a PTOCE assay using a CTO set with PTO compatible with a CTO can successfully and easily detect a target nucleic acid sequence regardless of the type of target nucleic acid sequence.

A set of CTOs comprising four types of CTOs are used to form extended dimers that can hybridize to the released fragment to provide a target signal without knowledge of the target nucleic acid sequence.

In particular, the upstream oligonucleotides or extension strands thereof induce cleavage of the PTO hybridized with the target nucleic acid sequence by an enzyme having 5 ' nuclease activity, which cleaves the 5 ' -tagging site of the PTO or the 5 ' End of the 3'-targeting site of the PTO, and the fragment released from the PTO is complementary to the 5'-end of the 3'-targeting site of the PTO RTI ID = 0.0 > 5'-terminal < / RTI > Said fragment hybridized with the capture region of said CTO is extended by a template-dependent nucleic acid polymerase to form an extended duplex; The extended dimer provides a target signal.

Except for the 5'-end of the capture region, the capture region of the CTO has the same nucleotide sequence; The templating site of the CTO has the same nucleotide sequence or different nucleotide sequence, especially the same nucleotide sequence.

The nucleotide sequence of each of the capturing and template sites of the CTO is designed to be non-complementary to the target nucleic acid sequence.

Optionally, the CTO set comprises a CTO having a G at the 5'-end of the capture site and a CTO having a C at the 5'-end of the capture site.

For example, if the PTO is designed to have G or C at the 5'-end of the 3'-targeting site, a CTO set with the two types of CTOs may be hybridized to the released fragment to provide a target signal Lt; RTI ID = 0.0 > dimer. ≪ / RTI > The strategy of including G or C improves the reliability of precise cleavage at the 5'-end of the 3'-targeting region of the PTO and the efficiency of the extension reaction of the hybridized fragment to the capture region of CTO.

The CTO has a single label or an interactive double label comprising a reporter and a quencher molecule.

According to one embodiment, an interactive double-labeled reporter molecule and a quencher molecule are located at the capture region of the CTO, and such hybridization of the fragment and the CTO induces a change in signal from the interactive double label, And the extended dimer retains the target signal.

According to one embodiment, an interactive double-labeled reporter molecule and a quencher molecule are located at the templating site of the CTO, such extension of which elicits a change in signal from an interactive double label to provide a target signal do.

According to one embodiment, a single marker is located at the capture site of the CTO, such hybridization of the fragment and the CTO inducing a change in signal from a single marker to provide a target signal and the extended dimer retains the target signal .

According to one embodiment, a single marker is located at the templating site of the CTO, such extension of which elicits a change in signal from a single marker to provide a target signal.

According to one embodiment, a single label or interactive double label is located within a range where the hybridization does not provide a non-target signal when a blend between the uncleaved PTO and the CTO is formed.

According to one embodiment, a single label or interactive double label is located within a range that provides a non-target signal when a blend between the uncut PTO and CTO is formed; The Tm of the elongated dimer is higher than that of the uncrosslinked PTO and the CTO.

According to one embodiment, the kit further comprises a label inserted in the extended dimer during the extension reaction; The target signal is provided by a single label attached to the label and the CTO inserted in the extended dimer during the extension reaction; The inserted marker being linked to the inserted nucleotide during the extension reaction; Wherein the two labels are interactive double labels of reporter molecules and quencher molecules; The extension of the fragment induces a change in the signal from the interactive double label to provide a target signal. More specifically, the nucleotide inserted during the extension reaction has a first non-natural base, and the CTO has a second non-natural base having a specific binding affinity for the first non-natural base .

According to one embodiment, the CTOs have the same or different labels to each other.

According to one embodiment, the CTO is blocked at its 3'-end to prevent extension.

In another aspect of the invention, there is provided a kit for detecting a target nucleic acid sequence from a mixture of DNA or nucleic acids, the kit comprising a set of Capturing and Templating Oligonucleotides (CTO)

Wherein each CTO comprises: (a) (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence; And (ii) a portion of the 5'-tagging site or the 5'-tagging site of a Probing and Tagging Oligonucleotide (PTO) comprising a 5'-tagging site comprising a nucleotide sequence non-complementary to the target nucleic acid sequence A capture region comprising a complementary nucleotide sequence, and (b) a template region comprising a 5'-tagging site of said PTO and a non-complementary nucleotide sequence at said 3'-targeting site;

The CTO set includes:

CTO having GG at two 5'-terminal nucleotides of the capturing site, CTO having CC at two 5'-terminal nucleotides of the capturing site, AA of two nucleotides at the 5'-terminal of the capturing site, , CTO with TT at the 5'-terminal two nucleotides of the capturing site, CTO with GC at the 5'-terminal two nucleotides of the capturing site, 5'-terminal 2 of the capturing site CTO having GA in two nucleotides at the 5'-terminal of the capturing region, CTO having CG at two nucleotides at the 5'-terminal of the capturing region, CTO having CG at two nucleotides at the 5'- '- CTO with two nucleotides at the terminal, CTO with CT at the 5'-terminal two nucleotides of the capturing site, CTO with AG at the 5'-terminal two nucleotides of the capturing site, The 5'- CTO having AC at only two nucleotides, CTO having AT at the 5'-terminal two nucleotides of the capturing site, CTO having TG at the 5'-terminal two nucleotides of the capturing site, CTO with TC at the 5'-terminal 2 nucleotides and CTO with TA at the 5'-terminal 2 nucleotides of the capturing site;

Wherein the 5'-terminal two nucleotides of the capture region of the CTO are hybridized to the 5'-terminal 2 nucleotides of the 3'-targeting region of the PTO;

Except for the 2 ' -terminal nucleotides of the capture region, the capture region of the CTO has the same nucleotide sequence; Wherein the templating sites of the CTO have the same nucleotide sequence or different nucleotide sequences;

Said CTO having an interactive double label comprising a single label or reporter molecule and a quencher molecule;

The nucleotide sequence of each of the capture and templating sites of the CTO is non-complementary to the target nucleic acid sequence

The 3'-targeting site of the PTO is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence;

The upstream oligonucleotides or extension strands thereof induce cleavage of the PTO hybridized with the target nucleic acid sequence by an enzyme having 5 ' nuclease activity, which cleaves the 5 ' -tagging site of the PTO or the 5 & Terminus of the 3'-targeting site of the PTO, wherein the fragment released from the PTO is a 5 ' -terminal 2 of the 3 ' -target site of the PTO Hybridizes to the capture region of the CTO with 5 ' -terminal nucleotides complementary to two nucleotides;

Said fragment hybridized to the capture region of said CTO is extended by a template-dependent nucleic acid polymerase to form an extended duplex; The extended dimer provides a target signal.

When the cleavage reaction of the PTO occurs at a position spaced apart by two nucleotides in the 3'-direction from the 3'-end of the 5'-tagging site of the PTO, a set of CTOs containing 16 types of CTOs is detected by PTOCE It is useful in Sei.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to a target-dependent extended dimer (PTO) hybridized to a target nucleic acid sequence, wherein PTO (Probing and Tagging Oligonucleotide) is cleaved to release a fragment and the fragment is hybridized to a capturing and templating oligonucleotide Lt; / RTI > The extended dimer provides a signal (signal generation or extinction) or a signal change (signal increase or decrease) indicative of the presence of the target nucleic acid sequence.

(b) the presence of an extended dimer is determined by various methods or processes such as a melting curve and detection at a specified temperature (e.g., real-time mode and end-point mode).

(c) The present invention simultaneously detects at least two kinds of target nucleic acid sequences by a melting curve analysis even if only one type of label (e.g., FAM) is used. On the other hand, conventional multiplex real-time methods, which are carried out in liquid phase, suffer serious problems with the limitations associated with the number of detectable fluorescent labels. The present invention successfully overcomes this disadvantage and broadens the application of multiplex real-time detection.

(d) The present invention can be carried out using a plurality of label systems. For example, a label attached at any position of the PTO and / or CTO can be used to provide a target signal indicative of an extended dimer. Also, a label inserted into the extended dimer during the extension reaction can be used in the present invention. In addition, a combination of such markers can be used. A versatile labeling system applicable to the present invention will select a suitable labeling system depending on the experimental condition or purpose.

(e) the invention provides a method for detecting and / or identifying a sequence and / or length of the CTO, the sequence and / or length of the fragment, (ii) the sequence and / or length of the CTO, or (iii) Or a target-dependent extended dimer having a tail-adjustable nominal Tm value.

(f) Conventional melting curve analysis using amplification products relies on the sequence of the amplification product, which makes it very difficult to obtain the desired Tm value of the amplification product. On the other hand, the present invention can select the desired Tm value of the extended duplex, depending on the sequence of the extended duplex that is not the sequence of the amplification product. Therefore, the present invention can be easily applied to detecting a plurality of target sequences.

(g) Conventional melting curve analysis using direct hybridization between a target probe and a target nucleic acid sequence is highly likely to result in a false positive signal due to non-specific hybridization of the probe. On the other hand, the present invention completely overcomes the problem of false positive signals by using enzymatic cleavage and extension as well as PTO hybridization.

(h) The Tm value of the conventional melting curve analysis is influenced by the sequence variation of the target nucleic acid sequence. However, the extended dimer of the present invention provides constant Tm values that remain constant regardless of the sequence variation of the target nucleic acid sequence, ensuring excellent accuracy in the melting curve analysis.

It is noteworthy that (i) the sequence of the 5'-tagging site of the PTO and the sequence of the CTO can be selected without regard to the target nucleic acid sequence. This allows pre-design of the 5'-tagging site of the PTO and a pool of sequences for the CTO. The 3'-targeting site of the PTO should be constructed in consideration of the target nucleic acid sequence, but the CTO can be made in a ready-made fashion without considering the information of the target nucleic acid sequence or the target nucleic acid sequence. This feature provides significant advantages over multiplexed target detection, particularly microarrays using CTO immobilized on a solid substrate.

Figure 1 shows the schematic structure of Probing and Tagging Oligonucleotide (PTO) and Capturing and Templating Oligonucleotide (CTO) used in the PTOE assay. Preferably, the 3'-end of the PTO and CTO is blocked to prevent extension.
Figure 2 schematically shows a PTOCE assay including a melt analysis. The CTO has a reporter molecule and a quencher molecule at its templating site.
Figure 3 schematically shows a PTOCE assay including a melt analysis. The CTO has a reporter molecule at its templated site. The reporter molecules are required to exhibit different signal intensities depending on whether they are present on the single-stranded or double-stranded form.
Figure 4 schematically shows a PTOCE assay including a melt analysis. The CTO has an iso-dC moiety and a reporter molecule at its templated site. Quencher-iso-dGTP is incorporated into the extended dimer during the extension reaction.
Figure 5 schematically shows a PTOCE assay including a melt analysis. The PTO has a reporter molecule at its 5'-tagging site and the CTO has an iso-dC residue at its templating site. Quencher-iso-dGTP is inserted into the extended dimer during the extension reaction.
Figure 6 schematically shows a PTOCE assay comprising a melting assay. PTO has a reporter molecule and a quencher molecule at its 5'-tagging site.
Figure 7 schematically shows a PTOCE assay including a melt analysis. PTO has reporter molecules at its 5'-tagging site. The reporter molecules are required to exhibit different signal intensities depending on whether they are present on the single-stranded or double-stranded form.
Figure 8 schematically shows a PTOCE assay including a melt analysis. The PTO has a quencher molecule at its 5'-tagging site and the CTO has a reporter molecule at its capturing site.
Figure 9 schematically shows a PTOCE assay including detection at a specified temperature. The CTO has a reporter molecule and a quencher molecule at its templating site. The CTO is immobilized on the solid substrate through its 3'-terminal.
Figure 10 schematically shows a PTOCE assay including detection at a specified temperature. The reporter-labeled dATP is inserted into the extended dimer during the extension reaction. The CTO is immobilized on the solid substrate through its 3'-terminal.
Figure 11 schematically shows a PTOCE assay involving detection at a specified temperature. The CTO has an iso-dC residue at its templating site and a reporter-isoDGTP is inserted into the extended dimer during the elongation reaction. The CTO is immobilized on the solid substrate through its 3'-terminal.
Figure 12 schematically shows a PTOCE assay including detection at a specified temperature. PTO has reporter molecules at its 5'-tagging site. The CTO is immobilized on its solid substrate via its 5 ' -end.
Figure 13 schematically shows a PTOCE assay including detection at a specified temperature using an intercalating beacon. The CTO is immobilized on its solid substrate via its 5 ' -end.
Figure 14 is a plot of the < RTI ID = 0.0 > Neisseria < / RTI > The results of the detection of the gonorrhoeae gene are shown. The CTO has a reporter molecule and a quencher molecule at its templating site.
Figure 15 is a plot of the < RTI ID = 0.0 > Neisseria < / RTI > The results of the detection of the gonorrhoeae gene are shown. PTO has a quencher molecule at its 5'-end and CTO has a reporter molecule at its 3'-end.
Figure 16 shows the result that the Tm value of the extended dimer is regulated by the CTO sequence.
FIG. 17 shows the results of the measurement of Neisseria by the PTOCE assay using PCR amplification The results of the detection of the gonorrhoeae gene are shown. The CTO has a reporter molecule and a quencher molecule at its templating site. Figure 17a shows the results of a PTOCE assay that includes real-time PCR detection, and Figure 17b shows the results of a PTOCE assay that includes a post-PCR melting assay.
18 is a graph showing the results of the measurement of the < RTI ID = 0.0 > Neisseria & The results of the detection of the gonorrhoeae gene are shown. CTO has an iso-dC residue and a reporter molecule at its 5'-end. Quencher-iso-dGTP is inserted into the extended dimer during the extension reaction. Figure 18a shows the results of the PTOCE assay including real-time PCR detection, and Figure 18b shows the results of the PTOCE assay including post-PCR melting analysis.
FIG. 19 is a graph showing the relationship between the concentration of Neisseria The results of the detection of the gonorrhoeae gene are shown. PTO has a quencher molecule at its 5'-end and CTO has a reporter molecule at its 3'-end. Figure 19A shows the results of a PTOCE assay including real-time PCR detection, and Figure 19B shows the results of a PTOCE assay including post-PCR melting analysis.
Figure 20 shows the results of simultaneous detection of the Neisseria gonorrhoeae (NG) gene and the Staphylococcus aureus (SA) gene by the PTOCE assay including post-PCR melting analysis. The CTO has a reporter molecule and a quencher molecule at its templating site.
Fig. 21 shows the detection results of the Neisseria gonorrhoeae gene by the PTOCE assay including the melting analysis in the microarray. The CTO is immobilized through its 5 ' -terminal. PTO has reporter molecules at its 5'-tagging site.
Figure 22 is a graph showing the effect of the PTOCE assay on the < RTI ID = 0.0 > Neisseria < / RTI > The results of the detection of the gonorrhoeae gene are shown. The CTO is immobilized through its 5 ' -terminal. PTO has reporter molecules at its 5'-tagging site.
23 is a Neisseria by PTOCE assays, including real-time detection at the specified temperature in the microarray The results of the detection of the gonorrhoeae gene are shown. The CTO is immobilized through its 3'-end and has reporter molecules and quencher molecules at its templating site.
Figure 24 shows single or multiple target detection results by a PTOCE assay including endpoint detection at a specified temperature in a microarray. The CTO is immobilized through its 5 ' -terminal. PTO has reporter molecules at its 5'-tagging site. The Neisseria gonorrhoeae (NG) gene and the Staphylococcus aureus (SA) gene were used as target nucleic acid sequences.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

Example

Example  One: PTOCE (Probing and Tagging Oligonucleotide Cleavage & Extension) Assy  evaluation

The inventors evaluated whether the extended dimer could provide a target signal for the detection of the target nucleic acid sequence and assessed the novel assay PTOCE (PTO Cleavage and Extension) of the present invention.

For this evaluation, a PTOCE assay (PTOCE assay containing a melting assay) was performed to detect the presence of the extended dimer by melting analysis. We used Taq DNA polymerase with 5 'nuclease activity for extension of upstream primer, cleavage of PTO and extension of PTO fragment.

The extended dimer formed during the assay was designed to have an interactive double label. The interactive duplex labeling of the extended duplexes consists of (i) a CTO with a reporter molecule and a quaternary molecule labeled CTO (double-labeled CTO) or (ii) a CTO with a quencher molecule and a reporter molecule with a quaternary-labeled PTO and a reporter- Covered CTO). The 3'-end of PTO and CTO was blocked with a carbon spacer. A synthetic oligonucleotide for the Neisseria gonorrhoeae (NG) gene was used as a target template.

1-1. Using dual-label CTO PTOCE Assay

The PTO does not have a cover. The CTO has a quaternary molecule (BHQ-1) and a fluorescent reporter molecule (FAM) at its templating site. The sequences of the synthetic template, upstream primer, PTO and CTO used in this example are as follows:

NG-T 5'-AAATATGCGAAACACGCCAATGAGGGCATGATGCTTTCTTTTTGTTCTTGCTCGGCAGAGCGAGTGATACCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-1 5'- ACGACGGCTTGGC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 3)

C3 Spacer] -3 '(SEQ ID NO: 4), NG-CTO-15'- [BHQ-1] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGTAAAGCCAAGCCGTCGT [

(The underlined letter indicates the 5'-tagging region of the PTO)

2 pmoles of the synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of the upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 3), 2 pmoles of CTO (SEQ ID NO: 2.5 mM MgCl ₂ , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 캜 for 15 minutes, and the process was repeated 30 times at 95 캜 for 30 seconds and at 60 캜 for 60 seconds. After the reaction, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in Fig. 14, when a template was present, a peak was detected at 76.5 DEG C, which corresponds to the expected Tm value of the extended dimer. No peak was detected in the absence of the template. In this labeling method, a peak corresponding to the unconjugated PTO and the CTO was not detected because the hybrid between uncut PTO and CTO did not provide any signal. When no PTO was present or no CTO was present, no peak was observed.

1-2. Quatcher -sign PTO  And reporter-labeled CTO PTOCE Assay

The PTO labeled its 5 ' -terminal with a quencher molecule (BHQ-1). CTO labeled its 3'-end with a fluorescent reporter molecule (FAM).

The sequences of the synthetic template, upstream primer, PTO and CTO used in this example are as follows:

NG-T 5'-AAATATGCGAAACACGCCAATGAGGGGCATGATGCTTTCTTTTTGTTCTTGCTCG

GCAGAGCGAGTGATACCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-2 5 '- [BHQ-1] ACGACGGCTTGGCTTTAC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3'

(SEQ ID NO: 5)

NG-CTO-2 5'-CCTCCTCCTCCTCCTCCTCCTCCAGTAAAGCCAAGCCGTCGT [FAM] -3 '(SEQ ID NO: 6)

(The underlined letter indicates the 5'-tagging site of the PTO)

2 pmoles of the synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 5), 2 pmoles of CTO (SEQ ID NO: 2.5 mM MgCl ₂ , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 캜 for 15 minutes, and the process was repeated 30 times at 95 캜 for 30 seconds, 60 캜 for 60 seconds, and 72 캜 for 30 seconds. After the reaction, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in Fig. 15, when a template was present, a peak was detected at 77 DEG C, which corresponds to the expected Tm value of the extended dimer. In this labeling method, since the blend between uncut PTO and CTO provides a non-target signal, a peak appeared at 64.0 [deg.] C - 64.5 [deg.] C corresponding to the expected Tm value of the blend between uncut PTO and CTO. When no PTO was present or no CTO was present, no peak was observed.

These results show that a target-dependent extension dimer is generated and the extended dimer provides a target signal indicative of the presence of the target nucleic acid sequence.

Example  2: Extension Dimer Tm  Adjustment of value

We further tested whether the Tm value of the extended duplex in the PTOCE assay can be controlled by the sequence of CTO.

For this experiment, we used three CTOs with different sequences at the templating site. The PTO does not have a cover. Three CTOs have a quaternary molecule (BHQ-1) and a fluorescent reporter molecule (FAM) at its templated site. The 3'-end of PTO and CTO was blocked with a carbon spacer.

A PTOCE assay was performed using three CTOs, each containing a melting assay.

The sequences of the synthetic template, upstream primer, PTO and CTO used in this example are as follows:

NG-T 5'-

SEE

CCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-3 5'- ACGACGGCTTG GCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 7)

(SEQ ID NO: 4) < RTI ID = 0.0 > (SEQ ID NO: 4) < / RTI >

3 '(SEQ ID NO: 8) < tb > < tb > < tb > < SEP >

3 '(SEQ ID NO: 9) < tb > < tb > < tb > < SEP >

(The underlined letter indicates the 5'-tagging site of the PTO)

2 pmoles of the synthetic template for the NG gene (SEQ ID NO: 1), 10 pmoles of upstream primer (SEQ ID NO: 2), 5 pmoles of PTO (SEQ ID NO: 7), CTO (SEQ ID NO: ) ₂ pmole, 2.5 mM MgCl 2 , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 캜 for 15 minutes, and the process was repeated 30 times at 95 캜 for 30 seconds and at 60 캜 for 60 seconds. After the reaction, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in FIG. 16, when a template was present, a peak was detected at 76.0 ° C, 69.0 ° C, or 64.5 ° C. Each peak corresponds to the expected Tm value of the extended dimer by the CTO of the test subject. No peak was detected in the absence of the template.

These results indicate that the Tm value of the extended dimer is adjustable by the sequence of the CTO.

Example  3: Real-time detection or Melting  Including analysis PTOCE  Used target Nucleic acid sequence  detection

The present inventors have examined whether the PTOCE assay can detect the target nucleic acid sequence in a real-time PCR method (i) or a post-PCR melting analysis method (ii): (i) cutting of PTO and extension of PTO fragment Involved amplification of the target nucleic acid by PCR procedures and the presence of the extended dimer was detected at the specified temperature of each cycle (PTOCE assay including real-time detection at the designated temperature); Or (ii) cleavage of the PTO and extension of the PTO fragment entail amplification of the target nucleic acid by PCR procedures, and the presence of the extended dimer was detected by post-PCR melting analysis (PTOCE assay containing the melting analysis).

The upstream primer is involved in PTO cleavage by an enzyme having 5 'nuclease activity and also participates in the amplification of a target nucleic acid sequence by a PCR process together with a downstream primer. Taq DNA polymerase having 5 'nuclease activity was used for extension of upstream primer and downstream primer, cleavage of PTO and extension of PTO fragment.

The extended dimer was designed to have an interactive double label. (Ii) CTO with iso-dGTP and reporter molecules and iso-dC residues inserted during the extension reaction, or (iii) CTOs with reporter molecules and iso-dC residues inserted during the extension reaction, PTO with quencher molecules and CTO with reporter molecules. The 3'-end of PTO and CTO was blocked with a carbon spacer.

Neisseria Genomic DNA of gonorrhoeae (NG) was used as a target nucleic acid.

3-1. Using dual-label CTO PTOCE Assay

The PTO has no label and the CTO has a quaternary molecule (BHQ-1) and a fluorescent reporter molecule (FAM) at its templating site.

The sequences of upstream primer, downstream primer, PTO and CTO used in this example are as follows:

NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-3 5'- ACGACGGCTTG GCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 7)

(SEQ ID NO: 4) < RTI ID = 0.0 > (SEQ ID NO: 4) < / RTI >

(The underlined letter indicates the 5'-tagging region of the PTO)

3-1-1. Including real-time detection at the specified temperature PTOCE Assay

10 pmole of downstream primer (SEQ ID NO: 10), 10 pmole of upstream primer (SEQ ID NO: 2), 5 pmole of PTO (SEQ ID NO: 7), CTO (SEQ ID NO: 4) ) ₂ pmole, 2.5 mM MgCl 2 , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 DEG C for 15 minutes, and the process was repeated 60 times at 95 DEG C for 30 seconds, 60 DEG C for 60 seconds, and 72 DEG C for 30 seconds. Signals were detected at 60 ° C for each cycle. The detection temperature was determined to the extent that the extended dimer retained its double-stranded form.

As shown in Fig. 17A, the target signal (Ct 31.36) was detected in the presence of the template. No signal was detected in the absence of template.

3-1-2. Melting  Including analysis PTOCE Assay

After the reaction of Example 3-1-1, the reaction mixture was cooled to 35 占 폚, held at 35 占 폚 for 30 seconds, and slowly heated from 35 占 폚 to 90 占 폚 to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in FIG. 17B, when a template was present, a peak was detected at 76.0 DEG C, which corresponds to the expected Tm value of the extended dimer. No peak was detected in the absence of the template. In this labeling method, no peak corresponding to the blend between uncrosscut PTO and CTO was detected, since the hybrid of the uncleaved PTO and CTO did not provide any signal.

3-2. Quatcher -iso- dGTP  And iso-dC The residue  Reporter-labeled CTO with PTOCE Assay

The PTO does not have a cover. CTO has a reporter molecule (FAM) and an iso-dC residue at its 5'-end. During the extension reaction of the PTO fragment, the iso-dGTP labeled with the quaternary molecule (dabcyl) is inserted at a position complementary to the iso-dC residue.

The sequences of upstream primer, downstream primer, PTO and CTO used in this example are as follows:

NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-1 5'- ACGACGGCTTGGC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 3)

NG-CTO-5 5'- [FAM] [Iso-dC] CTCCTCCAGTAAAGCCAAGCCGTCGT [C3 spacer] -3 '(SEQ ID NO: 11)

(The underlined letter indicates the 5'-tagging region of the PTO)

3-2-1. Including real-time detection at the specified temperature PTOCE Assay

10 pmole of downstream primer (SEQ ID NO: 10), 10 pmole of upstream primer (SEQ ID NO: 2), 5 pmole of PTO (SEQ ID NO: 3), CTO (SEQ ID NO: 11) .) 2 pmole and 2X sample the Lexus ^® master mix (Cat No. A4100, Promega, reaction in a final volume of 20 containing ㎕ USA) 10 ㎕ was performed; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 ° C for 15 minutes and the process was repeated 5 times at 95 ° C for 30 seconds, 60 ° C for 60 seconds, 72 ° C for 30 seconds, 60 ° C, 72 ° C for 30 seconds, and 55 ° C for 30 seconds . Signals were detected at 60 ° C for each cycle. The detection temperature was determined to the extent that the extended dimer retained its double-stranded form.

Multiplexers ^® master mix within a DNA polymerase having 5 'nuclease activity, were used for the extension of the upstream primer and downstream primer, and extension of the cut fragments of the PTO PTO.

As shown in Fig. 18A, the target signal (Ct 33.03) was detected in the presence of the template. No signal was detected in the absence of template.

3-2-2. Melting  Including analysis PTOCE Assay

After the reaction of Example 3-2-1, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in Fig. 18B, when a template was present, a peak was detected at 70.0 DEG C, which corresponds to the expected Tm value of the extended dimer. No peak was detected in the absence of the template. In this labeling method, no peak corresponding to the blend between uncrosscut PTO and CTO was detected, since the hybrid of the uncleaved PTO and CTO did not provide any signal.

3-3. Quatcher -sign PTO  And reporter-labeled CTO PTOCE Assay

The 5'-end of the PTO was labeled with the quaternary molecule (BHQ-1). The 3'-end of the CTO was labeled with a fluorescent reporter molecule (FAM).

The sequences of upstream primer, downstream primer, PTO and CTO used in this example are as follows:

NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-4 5 '- [BHQ-1] ACGACGGCT TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3' (SEQ ID NO: 12)

NG-CTO-2 5'-CCTCCTCCTCCTCCTCCTCCTCCAGTAAAGCCAAGCCGTCGT [FAM] -3 '(SEQ ID NO: 6)

(The underlined letter indicates the 5'-tagging region of the PTO)

3-3-1. Including real-time detection at the specified temperature PTOCE Assay

10 pmole of downstream primer (SEQ ID NO: 10), 10 pmole of upstream primer (SEQ ID NO: 2), 5 pmole of PTO (SEQ ID NO: 12), CTO (SEQ ID NO: 6) ₂ pmole, 2.5 mM MgCl 2 , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 DEG C for 15 minutes, and the process was repeated 60 times at 95 DEG C for 30 seconds, 60 DEG C for 60 seconds, and 72 DEG C for 30 seconds. Signals were detected at 60 ° C for each cycle. The detection temperature was determined to the extent that the extended dimer retains the double-stranded form, and the temperature is higher than the Tm value of the hybrid of the uncrosslinked PTO and CTO.

As shown in FIG. 19A, the target signal (Ct 29.79) was detected in the presence of the template. No signal was detected in the absence of template.

3-3-2. Melting  Including analysis PTOCE Assay

After the reaction in Example 3-3-1, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in Fig. 19B, when the template was present, a peak was detected at 76.5 DEG C, which corresponds to the expected Tm value of the extended dimer. In the present labeling method, a peak corresponding to the Tm value of the uncrosslinked PTO and the CTO of the CTO was detected at 48.0 DEG C in the absence of the template, since the mixture between uncut PTO and CTO provides a non-target signal.

These results indicate that the target nucleic acid sequence can be detected by PTOCE including real-time detection or melting analysis.

Example  4: Melting  Including analysis PTOCE At Assay  Plural target Nucleic acid sequence  detection

We also tested whether a PTOCE assay, including a melting assay, could detect multiple target nucleic acid sequences using the same kind of reporter molecule.

Cleavage of the PTO and extension of the PTO fragment were accompanied by amplification of the target nucleic acid by the PCR procedure, and the presence of the extended dimer was detected by post-PCR melting analysis (PTOCE assay including the melting analysis).

The extended dimer formed during the assay was designed to have an interactive double label. The interactive double labeling of the extended dimer was provided by the CTO labeled with the reporter molecule and the quaternary molecule at its templated site. CTOs have the same kind of fluorescent reporter molecule (FAM), but elongated dimers of different Tm values are produced. The 3'-ends of the PTO and CTO were blocked with a carbon spacer.

Neisseria Genomic DNA of gonorrhoeae (NG) and Staphylococcus aureus (SA) was used as a target nucleic acid.

The sequences of upstream primer, downstream primer, PTO and CTO used in this example are as follows:

NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-3 5'- ACGACGGCTTG GCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 7)

C3 Spacer] -3 '(SEQ ID NO: 4), NG-CTO-15'- [BHQ-1] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGTAAAGCCAAGCCGTCGT [

SA-F 5'-TGTTAGAATTTGAACAAGGATTTAATC-3 '(SEQ ID NO: 13)

SA-R 5'-GATAAGTTTAAAGCTTGACCGTCTG-3 '(SEQ ID NO: 14)

SA-PTO-1 5'- AATCCGACCACG CATTCCGTGGTCAATCATTCGGTTTACG [C3 spacer] -3 '(SEQ ID NO: 15)

(SEQ ID NO: 16) < RTI ID = 0.0 > [C3 spacer] -3 '(SEQ ID NO: 16) < / RTI >

(The underlined letter indicates the 5'-tagging region of the PTO)

10 pmole of each downstream primer (SEQ ID NOs: 10 and 13), 10 pmole of each upstream primer (SEQ ID NOs: 2 and 14), 100 pmole of each PTO NO: 7 and 15) 5 pmole, each CTO (SEQ ID NO: 4 and 16) 2 pmole, 2.5 mM MgCl 2 , 10 [mu] l of 2X master mix, 200 [mu] M dNTPs and 1.6 units of H- Taq DNA polymerase (Solgent, Korea) were reacted in a final volume of 20 [mu] l; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 DEG C for 15 minutes, and the process was repeated 60 times at 95 DEG C for 30 seconds, 60 DEG C for 60 seconds, and 72 DEG C for 30 seconds. After the reaction, the reaction mixture was cooled to 35 DEG C, held at 35 DEG C for 30 seconds, and slowly heated from 35 DEG C to 90 DEG C to obtain a melting curve. Fluorescence was continuously measured during the rise of temperature to monitor dissociation of double-stranded DNA. The melting peak is derived from the melting curve data.

As shown in FIG. 20, when there is a template, a plurality of target signals (Tm of NG: 75.5 DEG C and Tm of SA: 63.5 DEG C) were detected. No signal was detected in the absence of template.

These results suggest that the PTOCE assay involving the melting analysis can detect multiple target nucleic acids by using the same kind of reporter molecule (eg FAM) under the condition that the extended dimer corresponding to the target nucleic acid has a different Tm value .

Example  5: In a microarray Melting  Including analysis PTOCE Assy  evaluation

We further tested a PTOCE assay that included a melting assay in a microarray. PTO cleavage was performed in individual containers and a portion of the reaction product was transferred to a microarray where CTO was immobilized. After the extension reaction, the presence of the extended dimer was detected by the melting analysis.

Taq with 5 ' nuclease activity DNA polymerase was used for extension of upstream primer, cleavage of PTO and extension of PTO fragment. The extended dimer formed during the assay was designed to have a single label. A single label of the extended dimer was provided by PTO labeled with Quasar 570, whose 5 ' -end was a fluorescent reporter molecule. The 3'-ends of the PTO and CTO were blocked with a carbon spacer. The CTO had poly (T) ₅ as a linker and was immobilized on the surface of the glass slide using an amino group (AminnoC7) at its 5'-end. A marker probe with a fluorescent reporter molecule (Quasar 570) at its 5'-end was immobilized on the glass slide surface using an amino group at its 3'-end.

The sequences of the synthetic template, upstream primer, PTO, CTO and marker used in this example are as follows:

NG-T 5'-

SEE

CCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-5 5 '- [Quasar570] ACGACGGCTTGGCTTTAC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3' (SEQ ID NO: 17)

-3 '(SEQ ID NO: 18) < RTI ID = 0.0 > (SEQ ID NO: 18) < / RTI >

Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19)

(The underlined letter indicates the 5'-tagging region of the PTO)

NSB9 NHS slide (NSBPOSTECH, Korea) was used for the construction of CTOs and markers (SEQ ID NOs: 18 and 19). CTOs and markers, which had been dissolved to a final concentration of 10 μM in an NSB spotting buffer, were printed on NSB9 NHS slides using a PersonalArrayer ™ 16 Microarray Spotter (CapitalBio, China). The CTO and markers were spotted side by side in 2x1 duplicate spots and the microarray thus fabricated was incubated overnight in a chamber maintained at about 85% humidity. To remove non-specifically bound CTOs and markers, the slides were incubated in a buffer containing 2x SSPE (0.3 M sodium digoxyl chloride, 0.02 M sodium digoxidase and 2.0 mM EDTA), pH 7.4 and 7.0 mM SDS The solution was washed at 37 < 0 > C for 30 minutes and washed with distilled water. The DNA-functionalized slides were then dried using a slide centrifuge and stored in a dark room at 4 ° C until use.

2 pmoles of the synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of the upstream primer (SEQ ID NO: 2), 1 pmole of PTO (SEQ ID NO: 17) and 2.5 mM MgCl ₂ , 25 [mu] l of the 2X master mix, 200 [mu] M dNTPs and 4 units of H- Taq DNA polymerase (Solgent, Korea) were subjected to cleavage reaction; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 캜 for 15 minutes, and the process was repeated 30 times at 95 캜 for 30 seconds and at 63 캜 for 60 seconds.

30 [mu] l of the resulting mixture was applied to the chamber assembled on the surface of the CTO (SEQ ID NO: 18) cross-linked NSB glass slide. Slides were placed in a thermocycler (Genepro B4I, China) in an in situ block manner. For the melting analysis, six identical slides were made. The extension reaction was carried out at 55 캜 for 20 minutes. The slides thus produced were incubated at room temperature for 1 minute. Finally, each slide was washed with distilled water for 1 minute at 44 캜, 52 캜, 60 캜, 68 캜, 76 캜 or 84 캜. Image acquisition was performed by scanning with a 5-μm pixel resolution using a confocal laser scanner Axon GenePix 4100A (molecular Device, US). Fluorescence intensity was analyzed using quantitative microarray analysis software, GenePix pro6.0 software (molecular Device, US). Fluorescence intensity was expressed as spot-medians after removing the surrounding background. To investigate reproducibility, each spot was spotted by two. Fluorescence intensity was expressed as the average value of repeated spots.

As shown in FIGS. 21A and 21B, the melting curve was obtained by measuring the fluorescence intensity from spots produced by different cleaning temperatures. The presence of extended dimers was determined from the above melting curve data.

Example  6: In a microarray  Including real-time detection PTOCE Assy  evaluation

The present inventors have experimented with a PTOCE assay that includes real-time detection at a specified temperature in a microarray.

The CTO was cut and PTO fragments were repeated on the immobilized microarray. The presence of the elongated dimer was detected at a predetermined temperature every predetermined cycle.

Taq DNA polymerase with 5 'nuclease activity was used for extension of upstream primer, cleavage of PTO and extension of PTO fragment.

The extended dimer formed during the assay was designed to have a single label or an interactive double label. A single label of the extended dimer was provided by a reporter molecule labeled PTO (reporter-labeled PTO). Interactive double labeling of extended dimers was provided by CTO (double-labeled CTO) labeled with reporter molecules and quencher molecules. The 3'-ends of the PTO and CTO were blocked with a carbon spacer.

The CTO has poly (T) as a linker. The CTO was immobilized on the surface of the glass slide using the amino group at its 5'-terminal or 3'-terminal (AminnoC7). A marker probe with a fluorescent reporter molecule (Quasar 570) at its 5'-end was immobilized on the glass slide surface using an amino group at its 3'-end. The fluorescence intensity on the glass slide was measured at the specified temperature. The detection temperature was determined to the extent that the extended dimer retained its double-stranded form. Neisseria gonorrhoeae (NG) was used as a template.

6-1. Reporter - Cover PTO  Used PTOCE Assay

PTO has Quasar 570 as a fluorescent reporter molecule at its 5'-end. The CTO was immobilized through its 5 ' -terminal. In this labeling method, the detection temperature was determined to the extent that the extended dimer retains its double-stranded form, and the temperature is higher than the Tm value of the blend between uncrosslinked PTO and CTO.

The sequences of the synthetic template, upstream primer, PTO, CTO and marker used in this example are as follows:

NG-T 5'-

SEE

CCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-5 5 '- [Quasar570] ACGACGGCTTGGCTTTAC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3' (SEQ ID NO: 17)

-3 '(SEQ ID NO: 18) < RTI ID = 0.0 > (SEQ ID NO: 18) < / RTI >

Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19)

(The underlined letter indicates the 5'-tagging region of the PTO)

Slides were made with the same protocol as used in Example 5. 2 pmoles of the synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of the upstream primer (SEQ ID NO: 2), 1 pmole of PTO (SEQ ID NO: 17) and 2.5 mM MgCl ₂ , 15 [mu] l of 2X master mix, 200 [mu] M dNTPs and 2.4 units of H- Taq DNA polymerase (Solgent, Korea) were subjected to PTOCE reaction; The entire mixture was applied to a chamber in which a CTO (SEQ ID NO: 18) was assembled on the surface of a cross-linked NSB glass slide. Slides were placed in a thermocycler (Genepro B4I, China) in an in situ block manner. For the cycling analysis, five identical slides were produced. The PTOCE reaction was carried out as follows: denaturation at 95 ° C for 15 minutes, and 0, 5, 10, 20 or 30 cycles of 95 ° C for 30 seconds, 60 ° C for 60 seconds and 55 ° C for 60 seconds. After the reaction according to the number of cycles, the slides were washed with distilled water for 1 minute at 64 ° C. Image acquisition was performed by scanning with a 5-μm pixel resolution using a confocal laser scanner Axon GenePix 4100A (molecular Device, US). Fluorescence intensity was analyzed using quantitative microarray analysis software, GenePix pro6.0 software (molecular Device, US). Fluorescence intensity was expressed as a spot-median after removing the surrounding background. To investigate reproducibility, each spot was spotted by two. Fluorescence intensity was expressed as the average value of repeated spots.

As shown in FIGS. 22A and 22B, when the template was present, the fluorescence intensity for the target nucleic acid sequence increased with the number of cycles (0 cycle_RFU: 1,304 ± 0.7; 5 cycles_RFU: 18,939 ± 1,342.1; RFU: 30,619 ± 285.0; 20 cycles_RFU: 56,248 ± 2,208.3; and 30 cycles_RFU: 64,645 ± 1,110.2). In the absence of the template, there was no change in fluorescence intensity with the number of cycles.

6-2. Using dual-label CTO PTOCE Assay

CTO is immobilized through its 3'-end and has a quaternary molecule (BHQ-2) and a fluorescent reporter molecule (Quasar570) at the templated site.

The sequences of the synthetic template, upstream primer, PTO, CTO and marker used in this example are as follows:

NG-T 5'-

SEE

CCGATCCATTGAAAAA-3 '(SEQ ID NO: 1)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-6 5'- ACGACGGCTTGGCTTTAC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3 '(SEQ ID NO: 20)

(SEQ ID NO: 21) < tb > < tb > < tb > < SEP >

Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19)

(The underlined letter indicates the 5'-tagging region of the PTO)

Slides were made with the same protocol as used in Example 5. 2 pmoles of the synthetic template (SEQ ID NO: 1) for the NG gene, 10 pmoles of the upstream primer (SEQ ID NO: 2), 1 pmole of PTO (SEQ ID NO: 20)₂ 15 [mu] l of the 2X master mix, 200 [mu] M dNTPs and 100 [mu]Taq The PTOCE reaction was carried out in a final volume of 30 μl containing 2.4 units of DNA polymerase (Solgent, Korea); The entire mixture was applied to a chamber in which a CTO (SEQ ID NO: 21) was assembled on the surface of an NSB glass slide cross-linked. Slide in drilling (in situ) Block in a thermocycler (Genepro B4I, China). For the cycling analysis, five identical slides were produced. The PTOCE reaction was carried out as follows: denaturation at 95 ° C for 15 minutes, 0, 5, 10, 20 or 30 cycles of 95 ° C for 30 seconds, 60 ° C for 60 seconds and 50 ° C for 60 seconds. After the reaction according to the number of cycles, image acquisition was performed by scanning with a 5-μm pixel resolution using a confocal laser scanner Axon GenePix 4100A (molecular Device, US). Fluorescence intensity was analyzed using quantitative microarray analysis software, GenePix pro6.0 software (molecular Device, US). Fluorescence intensity was expressed as a spot-median after removing the surrounding background. To investigate reproducibility, each spot was spotted by two. Fluorescence intensity was expressed as the average value of repeated spots.

As shown in FIGS. 23A and 23B, the fluorescence intensity for the target nucleic acid sequence increased with the number of cycles when the template was present (0 cycle_RFU: 28,078 ± 460.3; 5 cycles_RFU: 35,967 ± 555.1; RFU: 44,674 ± 186.0; 20 cycles_RFU: 65,423 ± 2.1; and 30 cycles_RFU: 65,426 ± 2.8). In the absence of the template, there was no change in fluorescence intensity with the number of cycles.

Example  7: In a microarray  At the specified temperature End - PTOCE including point detection Assay  A plurality of target Nucleic acid sequence  detection

We further tested multiple target detection using a PTOCE assay that includes end-point detection at a specified temperature in a microarray.

The PTO cleavage is carried out in a separate vessel using the PCR procedure and the appropriate amount of the result is transferred to the microarray where the CTO is immobilized. After the extension reaction, the presence of the extended dimer was detected by end-point detection at the designated temperature.

Taq DNA polymerase with 5 'nuclease activity was used for extension of upstream primer and downstream primer, cleavage of PTO and extension of PTO fragment.

The extended dimer formed during the assay was designed to have a single label. A single label of the extended dimer was provided by a PTO labeled with Quasar 570, a 5 '-terminal fluorescent reporter molecule. The 3'-ends of the PTO and CTO were blocked with a carbon spacer.

The CTO had poly (T) ₅ as a linker and was immobilized on a glass slide using an amino group (AminnoC7) at its 5'-end. A marker probe having a fluorescent reporter molecule (Quasar 570) at its 5'-end was immobilized on a glass slide using an amino group at its 3'-end.

The fluorescence intensity on the glass slide was measured at the specified temperature. The detection temperature was determined to the extent that the extended dimer retains the double-stranded form, and the temperature is higher than the Tm value of the hybrid of the uncrosslinked PTO and CTO. Genomic DNA of Staphylococcus aureus (SA) and Neisseria gonorrhoeae (NG) was used.

The sequences of the upstream primer, the downstream primer, the PTO, the CTO and the marker used in this example are as follows:

NG-F 5'-TACGCCTGCTACTTTCACGCT-3 '(SEQ ID NO: 10)

NG-R 5'-CAATGGATCGGTATCACTCGC-3 '(SEQ ID NO: 2)

NG-PTO-5 5 '- [Quasar570] ACGACGGCTTGGCTTTAC TGCCCCTCATTGGCGTGTTTCG [C3 spacer] -3' (SEQ ID NO: 17)

-3 '(SEQ ID NO: 18) < RTI ID = 0.0 > (SEQ ID NO: 18) < / RTI >

SA-F 5'-TGTTAGAATTTGAACAAGGATTTAATC-3 '(SEQ ID NO: 13)

SA-R2 5'-TTAGCTCCTGCTCCTAAACCA-3 '(SEQ ID NO: 22)

SA-PTO-2 5 '- [Quasar570] AATCCGACCACGCTATGC TCATTCCGTGGTCAATCATTCGGTTTACG [C3 spacer] -3' (SEQ ID NO: 23)

3 '(SEQ ID NO: 24) < tb > < SEP >

Marker 5 '- [Quasar570] ATATATATAT [AminoC7] -3' (SEQ ID NO: 19)

(The underlined letter indicates the 5'-tagging region of the PTO)

Slides were made with the same protocol as used in Example 5.

10 pmole of each downstream primer (SEQ ID NO: 10 and / or 13), 10 pmole of each upstream primer (SEQ ID NO: 2 and / or 22), PTO (SEQ ID NO: ID NO: 17 and / or 23) 1 pmole and 2.5 mM MgCl ₂ , 25 [mu] l of the 2X master mix, 200 [mu] M dNTPs and 4 units of H- Taq DNA polymerase (Solgent, Korea) were subjected to cleavage reaction; The tube containing the reaction mixture was placed in a real time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 DEG C for 15 minutes, and the process was repeated 60 times at 95 DEG C for 30 seconds and at 63 DEG C for 60 seconds. 30 [mu] l of the resulting mixture was applied to a chamber where CTOs (SEQ ID NOs: 18 and 24) were assembled onto the surface of cross-linked NSB glass slides. Slides were placed in a thermocycler (Genepro B4I, China) in an in situ block manner. The extension reaction was carried out at 55 캜 for 20 minutes. Thereafter, the slides thus prepared were washed with distilled water at 64 DEG C for 1 minute. After each wash, image acquisition was performed using a confocal laser scanner Axon GenePix 4100A (molecular Device, US) with a scanning resolution of 10 μm pixel resolution. Fluorescence intensity was analyzed using quantitative microarray analysis software, GenePix pro6.0 software (molecular Device, US). Fluorescence intensity was expressed as a spot-median after removing the surrounding background. To investigate reproducibility, each spot was spotted by two. Fluorescence intensity was expressed as the average value of repeated spots.

As shown in FIG. 24, when an SA template was present, a target signal (SAU: 65, 192 ± 198.7) for SA was detected. In the presence of the NG template, the target signal for NG (RFU: 65,332 ± 1.4) was detected. In the case of both SA and NG templates, target signals for SA (RFU: 65,302 ± 0.7) and NG (RFU 65,302 ± 0.7) were all detected.

Example  8: Manufacture of CTO set

A set of CTOs for detecting all or any target nucleic acid sequence in the PTOCE assay is prepared as follows:

AA-CTO-G: 5'- [BHQ-1] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGT G CCAAGCCGTCGT [C3Spacer] -3 '(SEQ ID NO: ] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGT C CCAAGCCGTCGT [C3Spacer] -3 '(SEQ ID NO: 26)

AA-CTO-A: 5 ' - [BHQ-1] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGT A CCAAGCCGTCGT [C3Spacer] -3' (SEQ ID NO: 27)

(SEQ ID NO: 28) AA-CTO-T: 5'- [BHQ-1] CCTCCTCCTCCTCCTCCTCC [T (FAM)] CCAGT T CCAAGCCGTCGT [C3Spacer]

The CTO has a quaternary molecule (BHQ-1) and a fluorescent reporter molecule (FAM) at its templated site. The underlined character indicates the capturing region. The bold-shaped nucleotides at the 5'-end of the capture site represent the other four bases, respectively.

Example  9: Using a CTO set PTOCE At Assay  by target  Detection of sequence

100 pmol of genomic DNA, 10 pmole of upstream primer, 10 pmole of downstream primer, 5 pmole of PTO, 2 pmoles of each CTO of CTO set, and MgCl ₂ 2.5 mM, dNTPs 200 [mu] M and H- Taq DNA polymerase (Solgent, Korea) in a final volume of 20 [mu] l containing 10 [mu] l of 2X mastermix; Place the tube containing the reaction mixture in a real-time thermocycler (CFX96, Bio-Rad); The reaction mixture was denatured at 95 캜 for 15 minutes and subjected to 60 cycles of 95 캜 for 30 seconds, 60 캜 for 60 seconds, and 72 캜 for 30 seconds. Signals are detected at 60 ° C for each cycle. The detection temperature is determined within the range in which the extended dimer retains the double stranded form.

As a target template, Neisseria Genomic DNA of pathogens such as gonorrhoeae (NG) and Staphylococcus aureus (SA) is used. A downstream primer (SEQ ID NO: 10) and an upstream primer (SEQ ID NO: 2) for a target gene, and a downstream primer (SEQ ID NO: SEQ ID NO: 13) and an upstream primer (SEQ ID NO: 14).

All PTOs are designed to have a complementary sequence at the capturing site of the CTO, except for the nucleotides at the 5'-end of the capture site of the CTO at their 5'-tagging site. The 3'-targeting region of the PTO is designed to have various sequences depending on the probing region of the target nucleic acid sequence. When AA-CTO-G and AA-CTO-C are used, the 3'-targeting sites of the PTO are designed to have G or C at their 5'-end.

 The results of the PTOCE assay using the CTO set show that all target nucleic acid sequences are detected using a CTO set comprising four CTOs or two CTOs (AA-CTO-G and AA-CTO-C).

It will be understood by those skilled in the art that the preferred embodiments of the present invention have been described in detail and modifications and variations are possible in accordance with the principles of the invention and that the scope of the invention is defined by the appended claims and their equivalents. Well recognized.

<110> Seegene, Inc. <120> Detection of Target Nucleic Acid Sequences by PTO Cleavage and          Extension Assay Using a Set of CTOs <130> PN170161 <150> US 62 / 351,080 <151> 2016-06-16 <160> 28 <170> KoPatentin 3.0 <210> 1 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> NG-T <400> 1 aaatatgcga aacacgccaa tgaggggcat gatgctttct ttttgttctt gctcggcaga 60 gcgagtgata ccgatccatt gaaaaa 86 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NG-R <400> 2 caatggatcg gtatcactcg c 21 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > NG-PTO-1 <400> 3 acgacggctt ggctgcccct cattggcgtg tttcg 35 <210> 4 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-1 <400> 4 cctcctcctc ctcctcctcc tamccagtaa agccaagccg tcgt 44 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NG-PTO-2 <400> 5 acgacggctt ggctttactg cccctcattg gcgtgtttcg 40 <210> 6 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-2 <400> 6 cctcctcctc ctcctcctcc tccagtaaag ccaagccgtc gt 42 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> NG-PTO-3 <400> 7 acgacggctt ggcccctcat tggcgtgttt cg 32 <210> 8 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-3 <400> 8 tttttttttt cctcctccag taaagccaag ccgtcgt 37 <210> 9 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-4 <400> 9 tttttttttt ttttttttag taaagccaag ccgtcgt 37 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> NG-F <400> 10 tacgcctgct actttcacgc t 21 <210> 11 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-5 <400> 11 ctcctccagt aaagccaagc cgtcgt 26 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> NG-PTO-4 <400> 12 acgacggctt gcccctcatt ggcgtgtttc g 31 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> SA-F <400> 13 tgttagaatt tgaacaagga tttaatc 27 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SA-R <400> 14 gataagttta aagcttgacc gtctg 25 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> SA-PTO-1 <400> 15 aatccgacca cgcattccgt ggtcaatcat tcggtttacg 40 <210> 16 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> SA-CTO-1 <400> 16 tttttttttt tttttttgca tagcgtggtc ggatt 35 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NG-PTO-5 <400> 17 acgacggctt ggctttactg cccctcattg gcgtgtttcg 40 <210> 18 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-S1 <400> 18 tttttcctcc tcctcctcct cctcctccag taaagccaag ccgtcgt 47 <210> 19 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> Marker <400> 19 ATTACHMENTS 10 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> NG-PTO-6 <400> 20 acgacggctt ggctttactg cccctcattg gcgtgtttcg 40 <210> 21 <211> 52 <212> DNA <213> Artificial Sequence <220> <223> NG-CTO-S2 <400> 21 cctcctcctc ctcctcctcc tccagtaaag ccaagccgtc gttttttttt tt 52 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> SA-R2 <400> 22 ttagctcctg ctcctaaacc a 21 <210> 23 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> SA-PTO-2 <400> 23 aatccgacca cgctatgctc attccgtggt caatcattcg gtttacg 47 <210> 24 <211> 53 <212> DNA <213> Artificial Sequence <220> <223> SA_CTO-S1 <400> 24 tttttcttct tcttcttctt cttcttcttc ccccagcata gcgtggtcgg att 53 <210> 25 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> AA-CTO-G <400> 25 cctcctcctc ctcctcctcc tccagtgcca agccgtcgt 39 <210> 26 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> AA-CTO-C <400> 26 cctcctcctc ctcctcctcc tccagtccca agccgtcgt 39 <210> 27 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> AA-CTO-A <400> 27 cctcctcctc ctcctcctcc tccagtacca agccgtcgt 39 <210> 28 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> AA-CTO-T <400> 28 cctcctcctc ctcctcctcc tccagttcca agccgtcgt 39

Claims (10)

A kit for detecting a target nucleic acid sequence from a DNA or a mixture of nucleic acids, comprising a set of Capturing and Templating Oligonucleotides (CTO)
Wherein each CTO comprises: (a) (i) a 3'-targeting region comprising a hybridization nucleotide sequence complementary to the target nucleic acid sequence; And (ii) a portion of the 5'-tagging site or the 5'-tagging site of a Probing and Tagging Oligonucleotide (PTO) comprising a 5'-tagging site comprising a nucleotide sequence non-complementary to the target nucleic acid sequence A capture region comprising a complementary nucleotide sequence, and (b) a template region comprising a 5'-tagging site of said PTO and a non-complementary nucleotide sequence at said 3'-targeting site;
The CTO set includes:
CTO (Capturing and Templating Oligonucleotide) with G at the 5'-end of the capture region, and
CTO with C at the 5'-end of the capture site;
Or the CTO set comprises:
CTO having G at the 5'-end of the capturing site,
CTO having C at the 5'-end of the capturing site,
CTO having A at the 5'-end of the capture site, and
CTO having T at the 5'-end of the capture site;
Wherein the 5'-end of the capture site of the CTO is hybridized to the 5'-end of the 3'-targeting site of the PTO;
Except for the 5'-end of the capture region, the capture region of the CTO has the same nucleotide sequence; Wherein the templating sites of the CTO have the same nucleotide sequence or different nucleotide sequences;
The CTO having a single label or interactive double label comprising a reporter molecule and a quencher molecule;
The nucleotide sequence of each of the capture and templating sites of the CTO is non-complementary to the target nucleic acid sequence;
The 3'-targeting site of the PTO is hybridized to the target nucleic acid sequence and the 5'-tagging site is not hybridized to the target nucleic acid sequence;
The upstream oligonucleotides or extension strands thereof induce cleavage of the PTO hybridized to the target nucleic acid sequence by an enzyme having 5 ' nuclease activity, which cleaves the 5 ' -tagging site of the PTO or the 5 & Terminus of the 3'-targeting site of the PTO, and the fragment released from the PTO is 5 ' -terminal complementary to the 5 ' -terminal of the 3 ' -target site of the PTO Hybridized to the capture region of the CTO having a &apos;-terminus;
Said fragment hybridized to the capture region of said CTO is extended by a template-dependent nucleic acid polymerase to form an extended duplex; The extended dimer provides a target signal.
The method of claim 1, wherein the interactive double-labeled reporter molecule and the quencher molecule are located at the capture region of the CTO, wherein hybridization of the fragment and the CTO induces a change in signal from the interactive double label, Wherein the extended dimer maintains the target signal.
The method of claim 1, wherein the interactive double-labeled reporter molecule and the quencher molecule are located at the templating site of the CTO, wherein the elongation of the fragment induces a change in signal from the interactive double label, Provided kit.
The method of claim 1, wherein the single marker is located at the capture site of the CTO, wherein hybridization of the fragment and the CTO induces a change in signal from a single marker to provide a target signal and the extended dimer maintains the target signal The kit.
2. The kit of claim 1, wherein the single marker is located at a templating site of the CTO, wherein the extension of the fragment provides a target signal by inducing a change in signal from a single marker.
The kit of claim 1, wherein the single label or interactive double label is located within a range where the hybridization does not provide a non-target signal when a hybrid between the uncut PTO and the CTO is formed.
The method of claim 1, wherein the single label or interactive double label is located within a range that provides the non-target signal if the hybrid between the uncut PTO and the CTO is formed; The Tm of the elongated dimer is higher than that of the uncrosslinked PTO and the CTO.
2. The kit of claim 1, wherein the kit further comprises a label inserted in the elongate dimer during the elongation reaction; The target signal is provided by a single label attached to the label and the CTO inserted in the extended dimer during the extension reaction; The inserted marker being linked to the inserted nucleotide during the extension reaction; Wherein the two labels are interactive double labels of reporter molecules and quencher molecules; Wherein extension of the fragment induces a change in signal from the interactive double label to provide a target signal.
9. The method of claim 8, wherein the nucleotide inserted during the extension reaction has a first non-natural base and the CTO has a second non-natural base with a specific binding affinity for the first non- A kit having a nucleotide.
The kit according to claim 1, wherein the CTO is blocked at its 3'-terminal to prevent its extension.

Images