KR20170133318A - How to improve cell therapy - Google Patents

Abstract

There is provided a therapeutic method comprising administration of a modified cell population to enhance expression of an E-selectin and / or L-selectin ligand, wherein said modified population of cells is at least 70% Cell viability.

Description

How to improve cell therapy

The present invention was made with Government support under the approval number PO1 HL107146 (ROH1 HL73714 and RO1 HL60528), granted by the National Institutes of Health. The government has certain rights in the invention.

The present invention relates to compositions and methods for modifying cell surfaces and to improved efficacy and applicability of such modified cells in inflammatory conditions, tissue injury / damage and cell-based treatment of cancer.

The success of a cell-based therapy (also known as "adoptive cell therapy") is such that the relevant cells reach the site (s) where they are required to reach the required amount (s) sufficient to achieve the intended biological effect (s) . Cell delivery for clinical indication may be by direct (topical) injection into the relevant tissue (s), by intravascular administration (e.g., by catheter-based delivery to the whole body or specific vascular bed) (E.g., in the case of skin ulcers, burns, etc.). For all forms of cell administration, the administered cells are administered within the site of administration in a tissue microenvironment, which is critical for achieving precisely the intended effect, e. G., Control of inflammation, repair of tissue, elimination of rejection, It is advantageous to have membrane molecules capable of promoting cell lodgement. Because of the completeness of the microvasculature and the well-known knowledge that new microvessel generation (i. E., "Angiogenesis") is a critical prerequisite for tissue regeneration / repair, one such microenvironmental site is microinvasive Is a "peripheral blood vessel area" Indeed, in all tissue injuries, inflammations and cancerous sites, endothelial cells in the microvascular end of the affected tissue (s) present a characteristic set of adhesion molecules that play an important role in recruitment to the target site of circulating (blood derived) cells . These endothelial molecules are up-regulated by inflammatory cytokines such as tumor necrosis factor (TNF) and interleukin 1 (IL-1), including the molecule E-selectin in humans and the molecules E-selectin and P-selectin in mice , Which are lectins belonging to the attachment molecule family known as "selectin" (to be described in more detail below). In addition, leukocytes recruited to any inflammatory site (including cancer) or tissue injuries / lesions suggest L-selectin, a "leukocyte" selectin, and thus the expression of a ligand for L- Lt; RTI ID = 0.0 > (s) < / RTI >

At first glance, direct delivery may seem to be the most effective approach to cell administration, especially considering that a concentrated cell bolus could be applied to the lesion. However, there are situations in which topical injection can produce adverse effects as opposed to the intended therapeutic effect, and furthermore, local injection is only practical for specific anatomical locations: (1) introduction of appropriate cells into the suspension of the medium under hydrostatic pressure , The injection procedure can harm the delivered cells and further impair tissue integrity and hinder early tissue repair and / or host defense processes, thereby exacerbating the inflammatory condition or inducing an appropriate immune response in situ Lt; / RTI > (2) Because needles / devices (and suspensions) are invasive methods, they can induce target tissue damage and / or promote collateral tissue damage; (3) Direct injection is impractical for tissues (eg lungs) that are most feasible for an organ / tissue (eg heart) with clear anatomical boundaries and which do not have extensive connective tissue support; (4) The injection procedure is technically burdensome, labor-intensive and requires the use of a sophisticated delivery system with considerable imaging support, especially for relatively inaccessible and / or fragile institutions / organizations (eg central nervous system) do; (5) Most importantly, many degenerative and inflammatory conditions are widespread and multifocal (eg, osteoporosis, inflammatory bowel disease, multiple sclerosis, etc.), and therefore direct injection is neither practical nor effective to be. Thus, even if there is a clinical condition / situation in which topical injection is feasible, the vascular route of administration may be any general "systemic" disorder as well as any tissue that has a problematic approach and / , Pancreas of diabetes, lung of chronic obstructive pulmonary disease). The ability to repeatedly administer cells with minimal effort is another important practical benefit of systemic injection. Thus, the creation of methods for optimizing the expression / activity of molecular effectors that direct both adhesion / fixation of directly injected cells in an inflammatory environment and physiological transfer of the injected cells into the diseased site (s) into the blood vessel Is a key to achieving the promising prospects of all cell-based therapies.

The ability to direct movement of blood-derived cells to a predetermined location ("homing") has a significant effect on various physiological and pathological processes. Recruitment of circulating cells to specific anatomical locations is initiated by distinct adhesion interactions between the cells in the bloodstream and the vascular endothelium of the target tissue (s). The molecule that mediates this contact is the "oocyte receptor ", as historically defined, these structures regulate the directivity of blood cells to each target tissue. Historically, three "tissue-specific receptor receptors" have been described: promoting α ₄ β ₇ (LPAM-1), and especially cell migration into the skin, of L-selectin, intestinal and gastrointestinal tract-related lymphoid tissues of peripheral lymph nodes (R. Sackstein, Curr Opin Hematol 12, 444 (2005)) of the molecule P-selectin glycoprotein ligand-1 (PSGL-1) known as "skin lymphocyte antigen (CLA) " Notably, in addition to these tissues, it has been recognized for decades that circulating cells, particularly hematopoietic stem cells (HSCs), are efficiently directed to the bone marrow (T. Lapidot, A. Dar, O. Kollet, Blood 106, 1901 (2005)), several studies have pointed to the role of E-celicitin, which binds to cellulytic, mainly HSC E-selectin ligands, in mediating HSC marrow recruitment.

From the biophysical point of view, the receptor receptor acts as a molecular brake, causing cells in the bloodstream to initially tethering to the vascular endothelium at a rate lower than the prevailing blood flow rate and then causing sustained rolling contact (step 1) (R. Sackstein, Curr Opin Hematol 12, 444 (2005)). Thereafter, a cascade of events, typically enriched by chemokines, is followed resulting in the activation of integrins (step 2), stable attachment (step 3) and transmigration (step 4) TA Springer, Cell 76, 301 (1994)). This "multistage paradigm" is defined by the fact that tissue-specific migration is regulated by a distinct combination of the oocyte receptor and chemokine receptor expression in a given circulating cell, resulting in an appropriate angiogenic ligand and a kemokin expressed in the target endothelium And that the "traffic signal" can be perceived in an institution-specific manner. Some evidence suggesting direct trafficking of cells into the bone marrow after engraftment of the receptor receptor suggests that one chemokine, particularly SDF-1 (CXCL12), plays an important role in step-2 mediated recruitment to this part of the cell (1999); Sipkins et al., Nature 435, 969 (2005); A. Peled et al., Science 283, 845 )). However, the expression of SDF-I is not limited to bone marrow, and such chemokines are typically expressed at all tissue injury / inflammation sites (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).

The most efficient effector of the rotational interaction of step 1 is the selectins (E-, P- and L-selectin) and their ligands (R. Sackstein, Curr Opin Hematol 12, 444 (2005)). As its name suggests, selectin, archetypal the tetrasaccharide sialyl Lewis ^{X (Lewis X) (sLe x} ; Neu5Acα2-3Galβ1-4 [Fucα1-3] GlcNAcβ1-) is α (2,3 as shown) ) -Linked sialic acid substituent (s) with a specific carbohydrate determinant consisting of sialofucosylation containing an alpha (1,3) -bonded fucose modification (s) (R. Sackstein, Curr Opin Hematol 12, 444 (2005); MJ Polley et al., Proc Natl Acad Sci USA 88, 6224 (1991)). sLex glycans are recognized by a variety of monoclonal antibodies (mAbs), including mAbs known as "HECA452 ". E-selectin and P-selectin are expressed on the vascular endothelium (P-selectin is also expressed in platelets) and L-selectin is expressed in circulating white blood cells (R. Sackstein, Curr Opin Hematol 12, 444 (2005)). E-selectin and P-selectin are typically inducible endothelial membrane molecules that are expressed exclusively at sites of tissue damage and inflammation, where expression of selectin occurs in response to inflammatory cytokines. However, the microvessel system of bone marrow and skin constitutively express these selectins, and these selectins play an important role in normal state recruitment to these sites of blood-derived cells (R Sackstein J Invest. Dermatology, 122 : 1061-1069 (2004)). Importantly, in all inflammatory sites and tissue injury / damage sites in primates (except rodents), E-selectin indicates that when the promoter elements reactive to inflammatory cytokines TNF and IL-1 were removed from the P-selectin gene , A major vascular selectin that mediates cell recruitment. Thus, in all human inflammatory sites, vascular E-selectin expression is more prominent than the expression of P-selectin (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).

The two major ligands of E-selectin, the highly sialylfucosylated CLA form of PSGL-1 (Z. Laszik et al., Blood 88, 3010 (1996), R. Sackstein, Immunol. Rev. 230: (CJ Dimitroff, JY Lee, S. Rafii, RC Fuhlbrigge, R. Sackstein, J Cells) known as hematopoietic cell E- / L-selectin ligands (HCELL) (HSPC) were identified in human hematopoietic stem / progenitor cells (HSPC), as described in the following references: Biol 153, 1277 (2001); CJ Dimitroff, JY Lee, RC Fuhlbrigge, R. Sackstein, Proc Natl Acad Sci USA 97, 13841 (2000). CD44 is a somewhat ubiquitous plasma membrane protein, but the HCELL phenotype is found primarily in human HSPCs. In contrast to the limited distribution of HCELL, CLA / PSGL-1 is widely expressed in hematopoietic origin and in more mature bone marrow and lymphoid cells in bone marrow (Z. Laszik et al., Blood 88, 3010 (1996), R. Sackstein , Immunol Rev. 230: 140-163 (2009)). HCELL is defined as CD44 that binds to E-selectin and L-selectin under operative, shear conditions, and in addition to sialyl Lewis X (and sLex, HECA452 is a fucose- (E-Ig) recognizing the mAb HECA452 and E-selectin-Ig chimera (E-Ig) recognizing the tetrasaccharide isomer of sLex known as "sialylated Lewis a ≪ RTI ID = 0.0 > CD44 < / RTI > In addition to CLA and HCELL, human leukocytes and HSPCs are also known as "CD43- ", which can function as E-selectin ligands (Fuhlbrigge et al Blood 107: 1421-1426 (2006), Merzaban et al Blood 118: 1774-1783 E-selectin ligand known as E-selectin ligand-1 (ESL-1) has been described in mouse leukocytes (Merzaban et al Blood 118: 1774- 1783 (2011)). Binding to E-selectin (and also L-selectin and P-selectin), in all glycoprotein selectin ligands such as CD43-E, CLA, and HCELL, , 3) -fucose modification (CJ Dimitroff, JY Lee, S. Rafii, RC Fuhlbrigge, R. Sackstein, J Cell Biol 153,1277 ; CJ Dimitroff, JY Lee, KS Schor, BM Sandmaier, R. Sackstein, J Biol Chem (2000); Sackstein, Proc Natl Acad Sci USA 97, 13841 (2000); R. Sackstein, CJ Dimitroff, Blood 96, 2765 276, 47623 (2001)). In human HSPCs, HCELL presents suitable sialo fucosylated selectin binding determinants on N-glycans (CJ Dimitroff, JY Lee, S. Rafii, RC Fuhlbrigge, R. Sackstein, J Cell Biol 153, 1277 R. Sackstein, CJ Dimitroff, Blood 96, 2765 (2000)). In-vitro assays of E- and L-selectin binding under hemodynamic shear stress indicate that HCELL is the most potent ligand of these molecules expressed in any human cell (CJ Dimitroff, JY Lee, S. Rafii, RC Fuhlbrigge, R. CJ Dimitroff, JY Lee, KS Schor, BM Sandmaier, R. Sackstein, J Biol Chem 276, 47623 (2001)). Importantly, although E-selectin is constantly expressed in the microvascular endothelium of bone marrow and skin, the molecule may be involved in the pathogenesis of inflammatory diseases such as inflammatory processes such as direct tissue injury (e.g. burns, trauma, bed sores, etc.), ischemic / vascular events , Neoplasms (such as breast cancer, lung cancer, lymphoma, etc.), immunological / autoimmune conditions (e.g., autoimmune diseases such as stroke, shock, hemorrhage and coagulopathy) Degenerative diseases such as osteoporosis, osteoarthritis, Alzheimer's disease, congenital / hereditary diseases (e.g., muscular dystrophy, lysosomal accumulation diseases such as diabetes mellitus, diabetes mellitus, inflammatory bowel disease, rheumatoid arthritis, rheumatoid arthritis, (Eg, radiation exposure (s), chemical exposure (s), alcoholic hepatitis, alcoholic pancreatitis, alcoholic cardiomyopathy, etc.), toxic drug effects , Cocaine cardiomyopathy, etc.), metabolic disturbances (Eg, radiation-induced tissue damage, surgery-related complications, etc.) and / or idiopathic processes (eg, amyotrophic lateral sclerosis, Parxonias-Turner syndrome Parsonnage-Turner Syndrome, etc.), all of the inflammatory sites-both acute and chronic types-are markedly expressed in the endothelial bed.

Among the various aspects of the present invention is the provision of a method of treating a disease, disorder or medical condition having E-selectin expression in vascular endothelial cells and / or leukocyte infiltrates in the affected tissue (s). E-selectin may be a specific leukocyte and hematopoietic stem / origin cell, such as bone marrow cells (e.g., neutrophils, monocytes, eosinophils, macrophages), dendritic cells (both lymphoid and bone marrow derived), lymphocytes ) And memory cells, non-contact and memory B cells, effector T cells, regulatory T cells, natural killer cells (NK cells), etc.), hematopoietic origin cells and sialylated, fucosylated Carbohydrates (e.g., sialylated Lewis X and members of the Lewis A family). Thus, these cell types are found in acute and chronic inflammatory sites and are recruited into these inflammatory sites by vascular E-selectin. Leukocytes and HSPC characteristically suggest L-selectin. L-selectin itself binds to sialylated fucosylated carbohydrates such as sLex. Thus, inflammatory sites have cells expressing E-selectin (in endothelial cells) and L-selectin (in infiltrating leukocytes and HSPC).

The ability to achieve the intended result (s) of a cell-based therapy is crucially dependent on the delivery of the delivered cells to the site where such cells are required and also the localization of the administered cells in a particular tissue microenvironment. Accordingly, there is a need in the art for methods of promoting vascular delivery to tissue injured / injured, inflamed, cancerous and infected areas of cells administered. In addition, there is a need in the art to enhance the fixation / co-localization of administered cells in affected tissues. Thus, briefly, the present invention provides a method of treating inflammation in a subject, comprising administering to the subject a population of cells expressing an E-selectin ligand and / or an L-selectin ligand at a level that exceeds the level of the native cell population Disorder or medical condition that occurs as a result of a disease or disorder, such as a tissue and / or damaged tissue and / or cancer that has occurred. Administration occurs in accordance with E-selectin expression on endothelial cells in target tissues (e.g., inflamed tissue and / or damaged tissue, cancerous tissue) and / or consistent with accumulation of leukocytes (e.g., leukocyte infiltrate) in the target tissue . Administration may be by direct injection into the target tissue and / or through the vascular system and / or by other means as described in more detail below.

The present invention further relates to a method of treating inflammation using a population of viable cells expressing E-selectin and / or L-selectin ligand. The viable cell population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population. Administration occurs in accordance with E-selectin expression on endothelial cells in target tissues (e.g., inflamed tissue and / or damaged tissue, cancerous tissue) and / or consistent with accumulation of leukocytes (e.g., leukocyte infiltrate) in the target tissue . Administration may be by direct administration to the target tissue and / or via the vascular system (and / or by other means as described in more detail below), and treatment of the disease, disorder or medical condition may result in prolonged engraftment of the administered cells (I. E., Treatment does not require treatment), such as transient colonization or prolonged survival of the administered cells at the site of treatment, proliferation of the administered cells at the site of treatment or treatment, or differentiation and / or maturation of the administered cells at the site of treatment Which can be achieved by either.

The present invention further relates to a group of viable cells expressing E-selectin and / or L-selectin ligand for use in the manufacture of a medicament for treating inflammation in a subject. The viable cell population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population. Administration is consistent with the expression of E-selectin on endothelial cells in target tissues (e.g., inflamed tissue and / or damaged tissue, cancerous tissue) and / or consistent with accumulation of leukocytes (e.g. leukocyte infiltrate) It happens. Administration may be by direct administration to the target tissue and / or through the vascular system and / or by other means as described in more detail below.

The present invention further relates to a group of viable cells expressing an E-selectin and / or L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor / malignant disease, And / or an L-selectin ligand, said population expressing E-selectin ligand and / or L-selectin ligand at a level that exceeds the expression level of the native cell population , Said treatment comprising administering said population in accordance with E-selectin expression on endothelial cells in tumor / malignant tumor tissue and / or consistent with leukocyte accumulation in tumor / malignant tumor tissue.

The present invention further relates to a group of viable cells expressing an E-selectin and / or L-selectin ligand for use in the manufacture of a medicament for the treatment of a disease state exhibiting inflammation, Or a L-selectin ligand, said cell population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population , Said treatment comprising administering said population in accordance with the onset of expression of E-selectin on endothelial cells in tumor / malignant tumor tissue and / or consistent with leukocyte accumulation in tumor / malignant tumor tissue.

Other methods involving administration as described herein (eg, administration via direct injection and / or other means to the vascular system and / or tissue) may include, for example, administering to the subject an inflammatory tissue and / (Collectively, "target" tissues), promoting cell transfer to and / or promoting tissue colonization in a target tissue of a subject, A method of promoting cell transfer and colony formation to a target tissue of a subject, a method of promoting the uptake and engraftment of a cell population in a target tissue in a subject, a method of treating an inflammatory condition of a subject, A method of promoting tissue repair / regeneration in a subject, and a method of treating a tumor / malignant disease in a subject.

In general, there is a need for a method of treating a patient suffering from a medical condition, such as a direct tissue injury (e.g. burn, trauma, SIRS, etc.), neoplasms (eg breast cancer, lung cancer, lymphoma), immunological / autoimmune diseases (eg graft versus host disease, multiple sclerosis, diabetes, inflammatory bowel disease, irritable bowel syndrome, rheumatoid arthritis, , Degenerative diseases (such as osteoporosis, osteoarthritis, Alzheimer's disease, etc.), congenital / hereditary diseases (such as watery epidermolysis, imperfect osteogenesis, muscular dystrophy, lysosomal storage diseases, Huntington's disease) (Eg, radiation exposure (s), chemical exposure (s), alcoholic hepatitis, alcoholic pancreatitis, alcoholic cardiomyopathy, cocaine cardiomyopathy, etc.), metabolic disturbances Toxic pericarditis, metabolic acidosis, etc.), tenderness (eg, radiation Including, but not limited to, those described herein, such as those described herein, including, but not limited to, inflammatory bowel disease, induced tissue injury, complications related to surgery, and / or idiopathic procedures such as amyotrophic lateral sclerosis, Parxonias-Turner syndrome, / RTI > and / or chronic) and / or damaged tissue may be treated according to the methods described herein.

In certain embodiments, for example, the E-selectin ligand and / or the L-selectin ligand expressed by the cell population is selected from the group consisting of a hematopoietic cell E- / L-selectin ligand (HCELL), a neuronal cell adhesion molecule E-selectin ligand -E), CD43E and CLA. In one embodiment, the E-selectin ligand is a hematopoietic cell E- / L-selectin ligand (HCELL) and / or a neuronal cell adhesion molecule E-selectin ligand (NCAM-E). In another embodiment, the E-selectin ligand is HCELL. In another embodiment, the E-selectin ligand is NCAM-E. In another embodiment, the L-selectin ligand is HCELL. Notably, because E-selectin is expressed in the endothelial basis of affected tissues and leukocytes characteristically express L-selectin, HCELL, a potent E-selectin and L-selectin ligand, is the most potent immunoreactive / And can act to explicitly promote tissue fixation in a microenvironment.

As discussed in more detail elsewhere herein, various methods may be used to produce a population of cells for administration to a subject. In one embodiment, the population is prepared by contacting the cell or cell population with a glycosyltransferase with an appropriate donor nucleotide sugar. (HCELL) by a glycosyltransferase-enhanced expression of a fucose residue (fucosylated), a sialic acid residue (sialylated) or both (sialofucosylated) Glycan manipulation can be used to sialopucosylate CD44 to enhance expression. Alternatively, a glycosyltransferase such as fucosyltransferase can be used to deliver a whole glycan structure such as sialyl-Lewis ^X or sialyl-Lewis ^a to the cell surface. In addition, non-enzymatic methods can be used to covalently or non-covalently attach E-selectin and / or L-selectin ligands to the cell surface. For example, glycoprotein, sLex (sialyl-Lewis ^X ), glycomimetic and / or peptidomimetic of sLex glycans, sLea (sialyl-Lewis ^a ), sLea glycans, The mimetic and / or peptidomimetics and other moieties that bind to E-selectin and / or L-selectin can be non-covalently bound to the cell surface using a biotin-streptavidin pair or covalently bound to the cell surface , Where the joining may be direct or through a linker, whether shared or non-covalent. As a further example, in each case mediating attachment of treated cells to E-selectin and / or L-selectin, phage display particles or antibodies that bind to E-selectin and / or L- Can be noncovalently bonded.

Regardless of and in general, and regardless of how the cell population is manufactured, the manufacturing process provides a modified population of cells with at least 70% viability at 24 hours from the time of transformation. In one such embodiment, the modified population of cells has at least 80% viability at 24 hours from the transformation time. In some embodiments, the modified cell population has at least 85% viability at 24 hours from the transformation time. In some embodiments, the modified cell population has at least 90% viability at 24 hours from the transformation time. Viability can be measured by methods known in the art, such as triplan blue exclusion, and by evaluation of dual color flow cytometry measurements for iodinated propidium and annexin V staining. Preferably, the phenotype of the cell (phenotype other than cell surface modification) is preserved after treatment. By the conserved phenotype, the cell is intended to maintain its original function and / or activity. For example, when the cell is a stem cell, it maintains its regenerative capacity, for example its totipotency or its pluripotency or its multipotency or its unipotency.

The modified cell population has a binding to the enhanced E-selectin and / or L-selectin relative to the original cell population (ie, having at least 70% viability at 24 hours from the deformation time described above) . Administration of the cells may be via the vascular system and / or by direct injection into the tissue (and / or by other means as described in detail below). In one embodiment, the modified cell population is administered at a time consistent with the onset of inflammation or leukocyte infiltration into the tissue. In another embodiment, the modified cell population is administered just prior to the onset of inflammation or leukocyte infiltration into the tissue.

When cells are engineered to glycans to enhance sLex expression or through decoration (e. G., Via avidin-streptavidin technology) to sLex structure, increased sLex expression in treated cells is measured using mAb HECA452 Or by fluorescent staining with any other mAb that recognizes the sLex determinant and then detecting the cell fluorescence intensity by flow cytometry. The predetermined fluorescence threshold of the modified cell population is first measured by analyzing a sample of the original (untreated) cell. The increase in sLex of the treated cells is an average of more than 10% of the marker-positive cells (e.g. HECA452-reactive cells) and / or the average channel fluorescence intensity of the baseline (untreated) cell population as compared to the original cell population Is defined as a 10% increase in channel fluorescence intensity. In order to detect whether binding to E-selectin has been increased in the treated cell population, a parallel plate flow chamber study under shear stress conditions as described herein or using E-selectin-Ig chimera Binding to E-selectin can be assessed by evaluating the fluorescence intensity by staining and running analysis of the E-selectin. Control (baseline) samples of cells are assayed using the functional E-selectin binding assays described elsewhere herein or by other commonly adopted E-selectin fluorescent binding assays known in the art. E-selectin binding fluorescence levels are measured against a control (baseline) population sample. The binding to the enhanced E-selectin is defined as the treated cell with increased adhesion to E-selectin in the E-selectin-specific binding assay. In one embodiment, the binding to the enhanced E-selectin is detected by fluorescence transfer in E-selectin binding assays with fluorescent dye-conjugated reagents, e. G. For E-selectin-Ig chimeras, Wherein the number of cells in the population having E-selectin binding is increased by at least 10% (i.e., 10% increase in the marker-positive population) and / or the average channel fluorescence is increased by at least 10% Is at least 10% greater than the fluorescence threshold (associated with the original cell population). In another embodiment, the percentage of cells having increased E-selectin responsiveness is increased by 25% and / or the modified population exceeds 25% of the predetermined fluorescence threshold. In another embodiment, the modified population exceeds 50% of the baseline response and / or the predetermined fluorescence threshold. In another embodiment, the proportion of cells with increased E-selectin responsiveness is increased by 75% over the ratio of the E-selectin-binding cell baseline population and / or the modified population exceeds 75% of the predetermined fluorescence threshold. In another embodiment, at least 90% of the cells of the modified population exceed the baseline E-selectin-binding group and / or predetermined fluorescence threshold. In another embodiment, at least 95% of the cells of the modified population exceed the baseline E-selectin-binding group and / or predetermined fluorescence threshold.

The binding to enhanced L-selectin is determined by binding to L-selectin using a high specificity functional L-selectin binding assay such as a parallel plate flow chamber or Stamper-Woodruff assay under dynamic shear stress conditions. , Where cell treatment increases the proportion of cells that support L-selectin-mediated adhesion. For parallel plate assays, the treated cell population is at least 10% of the temporal / rotational attachment interactions for L-selectin (displayed fixedly on the chamber plastic or glass support surface) relative to that of the baseline (untreated cells) Increase. For the stamper-woodruff assay, increased L-selectin lymphocyte adhesion is defined as at least a 10% increase in treated cell binding to L-selectin ⁺ lymphocytes under rotational shear of 80 rpm; Basal cell binding is assessed in untreated cell populations (control group) and compared directly to treated cell populations.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice and testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other objects and features will be in part apparent and in part pointed out hereinafter.

1 (A) to 1 (D). mouse Intermediate lobe Stem Cells( MSC ) By E- Selectin Ligand Exofucosylation on Expression ( FTVI Treatment). (A) MSCs from C57BL / 6 bone marrow lack CD45 expression and express the characteristic mouse MSC markers Sca-1, CD29, CD44, CD73 and CD105. MSCs inherently lack reactivity with mAb HECA452 and E-selectin-Ig chimera (mE-Ig) (isotype = red and antibody = blue).(B) Fucosyltransferase VI (FTVI) -modified MSC (solid line) was positive stained for mAb HECA452 and reactive with mE-Ig. The degradation (gray histogram) of FTVI-modified MSCs with bromelain and proteinase K significantly reduced the reactivity of murine E-selectin-Ig chimera (mE-Ig), whereas HECA452 staining did not , Suggesting that the bromelain-sensitive glycoprotein acts as the major E-selectin ligand (s) in glycan-modified (i.e., FTVI-treated) MSCs. The dashed lines are color control controls (isotype for HECA452 staining and calcium chelation using EDTA for mE-Ig staining).(C) Western blot analysis of HECA452 (left) and mE-Ig (right) reactivity of cell lysates of unmodified MSC (-) and FTVI-modified MSC (+). FTVI variants usually induced HECA452- and mE-Ig-reactive moieties on a double-stranded glycoprotein band of about 100 kDa.(D) CD44 was immunoprecipitated from the same amount of cell lysate from FTVI-modified (+) MSC or unmodified (-) MSC. The immunoprecipitates were then electroporated and blotted onto CD44 (mAb KM114 and IM7; left) and HECA452 (right).
Figure 2. A parallel plate flow chamber assay of FTVI-modified MSC and unmodified wild type MSC attachment to TNF-a treated human umbilical vein endothelial cells (HUVEC).The FTVI strain was 0.5 dynes / cm²Lt; RTI ID = 0.0 > MSC < / RTI > attachment to HUVEC,²Lt; RTI ID = 0.0 > shear < / RTI > Treatment of HUVEC with an anti-E-selectin (anti-CD62E) function-blocking mAb reduced the rolling adhesive interaction of FTVI-modified MSCs to levels similar to those of unmodified MSCs. Similarly, sialidase treatment of the FTVI-modified MSCs to remove sLex crystal factors reduced attachment to levels equivalent to unmodified MSCs.
3 (A) to 3 (C). In new onset diabetic NOD mice On hyperglycemia Affection ratio transform MSC And FTVI - Modified MSC of Intravenous Effect of administration. (A) The hyperglycemic NOD (untreated control) injected with PBS did not reverse the hyperglycemia (glucose level above 600 mg glucose / dL). Injection of unmodified MSC(B)Compared to, Injection of FTVI-modified MSC(C)Resulted in a significant increase in the number of mice reversed to normal blood glucose and the persistence of diabetes reversal. The arrow on the X axis represents the number of MSC injection days.
4 (A) to 4 (H). In the pancreas, E- Selectin Expression and MSC of Localization To evaluate Islet Immunofluorescence dyeing.4 (A) and 4 (B):(A) Diabetic-resistant BALB / c mice and(B) Pancreatic islet cells of NOD mice were stained for expression of insulin (green) and E-selectin (red). Islet cells are marked with dashed lines. BALB / c(A)Compared with the NOD mouse(B)Indicates reduced insulin production due to pancreatitis. In Figures 4 (C) to 4 (G), the cryostat sections of the pancreas from MSC-treated NOD mice were stained with DAPI (blue). Figures 4 (C) and 4 (D): Staining of serial sections of the NOD pancreas was performed using endothelial marker CD31(C) And E-selectin (D), Confirming the presence of E-selectin on islet cells-peripheral endothelial cells. Figure 4 (E): Co-staining of DAPI (blue), T-cell marker CD3 (green) and insulin (red) in NOD islet cells(E)Shows characteristic T-cell infiltration in the periphery of islet cells. 4 (F) and 4 (G): Cryostat sections stained for invasive MSC (visualized as FITC-conjugated anti-sLex mAb HECA452; green)(F)(APC-conjugated anti-insulin mAb; red) and E-selectin-expressing microvessels(G)(Visualized as PE-conjugated anti-E-selectin mAb; red). The staining identifies HECA452 + MSCs clustered within the pancreatic islet zone close to the E-selectin-expressing microvessels in the islet cell-peripheral region and within the region of the lymphocytic infiltrate (i.e., cells that characteristically express L-selectin). Figure 4 (H): Pancreatic invasion of NOD and BALB / c host of intravenously administered MSCs. The accumulation of FTVI-modified MSCs in the pancreas of NOD mice was three times higher (p < 0.01) than the accumulation of unmodified MSCs, while the difference in pancreatic infiltrates was due to BALB / c host (n = 3 mice per group; At least 30 fields per field were counted at magnification).
5 (A) to 5 (B). MSC of FTVI - Deformation does not affect cell viability or immunosuppressive ability. (A) Similar levels of hGH were detected in the serum of NOD mice at different time points after injection of pHRST-hGH-transduced FTVI-modified MSCs or unmodified MSCs.(B) FTVI-modified MSCs and unmodified MSCs were detected in CD3 / CD28-stimulated NOD CD4⁺T cell proliferation, suggesting that glycan-modification does not increase MSC capacity to inhibit lymphocyte proliferation.
6 (A) to 6 (D). CD44 Lack of expression may be due to systemic administration FTVI - Modified MSC Of the anti-diabetic effect. (A) Compared with the unmodified wild-type MSC (Fig. 3 (B)), the administration of CD44-deficient MSC exhibits an insignificant anti-diabetic effect. Only one NOD mouse (of 7) receiving unmodified CD44 KO MSC showed transient reversal of hyperglycemia (recurrence of diabetes at approximately 30 days) and 6 of 7 diabetic NOD mice maintained hyperglycemia.(B) Compared with the results in mice to which FTVI-modified wild-type MSCs (FIG. 3 (C)) were administered, administration of FTVI-modified CD44 KO MSC gave minimal anti-diabetic effect, Only reversed the hyperglycemia.(C)The accumulation of MSCs in the NOD pancreas was not different (P <0.01) in the mice treated with FTVI-modified CD44 KO MSC (white bars) (p <0.01) compared to the mice receiving unmodified CD44 KO MSC Mice treated with unmodified MSC 4 (H)). MSC infiltration was quantified at X60 magnification.(D) Both FTVI-modified CD44 KO MSC and unmodified CD44 KO MSC retain immunosuppressive ability to similarly reduce T cell proliferation in CD3 / CD28 T cell stimulation assays.
7.Characterization of MSCs from mouse bone marrow. MSCs were differentiated into bone cells, adipocytes and cartilage cells (X200 magnification).
Figure 8. CD44 ^{- / -} The FTVI modification of MSC results in an increase in HECA452 reactivity similar to that of wild-type (WT) MSCs. The FTVI-modified MSC (solid line) and the FTVI-modified CD44 KO MSC (gray filled portion) exhibited similar staining levels to HECA452 while the unmodified MSC (dotted line) did not show reactivity with HECA452, Suggesting that fucosylation produces sialophocosylated epitopes on alternative (i.e., non-CD44) scaffolds in CD44 KO MSCs.
9A-9B: Neural stem cells (NSCs) lack many E-selectin ligands, but express many other cell surface adhesion molecules. (a) (Binding to E-selectin-Ig chimera (E-Ig)) and P-selectin ligand (binding to P-selectin-Ig chimera (P-Ig)) in NSCs, HECA452, KM93, CSLEX- Flow cytometric analysis of expression. The corresponding isotype controls consisted of the respective irradiated antibodies, Rat IgM (for HECA-452; MFI: 1.9), mouse IgM (for KM93 and CSLEX-1; MFI: 2.7)_One(For E-Ig and P-Ig; MFI: 3.5). A histogram plot showing a typical E-Ig binding profile shows that more than 99% of the cells express E-Ig after a glycosyltransferase-programmed stereosubstitution (GPS) via cell surface treatment to fucosyltransferase VI Lt; RTI ID = 0.0 &gt; continuous &lt; / RTI &gt;(b) Flow cytometric analysis of CD43 (S7 and 1B11), PSGL-1 (2PH1, 4RA10), CD44 (IM7, KM114), NCAM, PSA, CD49d, CD49e, CD29, LPAM-1, CD11a, CD18 and CXCR4. The dotted line is the isotype control and the black line is the specific antibody. All displayed results represent n = 5 flow cytometry experiments performed in NSC.
10a to 10c: The GPS treatment of NSC (i.e.,? (1,3) -exofucosylation via FTVI treatment) mainly results in sialophorocosylation on glycoproteins, some of which are linked to glycophosphatidylinositol (GPI) -linked They are. (a) Flow cytometric analysis of HECA452, CD15, KM93, CSLEX1, E-Ig and P-Ig reactivity in BT-NSC (black bars) and GPS-NSC (gray bars). The corresponding isotype controls for each irradiated antibody were as follows: rat IgM (for HECA-452; MFI: 1.8), mouse IgM (for CD15, KM93 and CSLEX-1; MFI: 1.9) and human IgG_One(For E-Ig and P-Ig; MFI: 3.2). The displayed results represent five individual experiments.(b) Flow cytometric analysis of HECA452 reactivity of non-degraded GPS-NSC (black bars) or GPS-NSC (gray bars) degraded by bromelain before GPS treatment. Values are mean ± SEM. (n = 3 for each group).(c) Analysis of HECA452-responsive flow cytometry in GPS-NSC (gray bars) in which the GPI anchor was cleaved by digestion with non-degraded GPS-NSC (black bars) or phospholipase C (PI-PLC). Values are mean ± SEM. (n = 3 for each group).
11a-11c: GPS processing of NSC produces 100, 120 and 140-kDa E-selectin ligands corresponding to HCELL and N-CAM-E.(a) CD44 was immunoprecipitated (using IM7 and KM114 mAb to CD44) from an equal volume of cell lysate from GPS-treated (GPS) NSC or buffer-treated (BT) NSC. Western blot analysis was performed on the immunoprecipitates of NSCs electrostatically punctured and blotted with HECA452, E-Ig and CD44 and the supernatant (SN) from the immunoprecipitates.(b) N-CAM was isolated from an equal volume of cell lysate from (-), GPS-treated (+) or buffer-treated (-) NSC lysate treated with (+) untreated PNGaseF, Lt; / RTI &gt; The immunoprecipitates were then electroporated and blotted with E-Ig and N-CAM. Ca²⁺Lt; RTI ID = 0.0 &gt; E-Ig. &Lt; / RTI &gt;(c) NSCs were treated with GPS on day 0 and cultured for another 3 days in normal growth medium. Cell aliquots were collected every 24 hours and assayed for E-selectin ligand activity by flow cytometry.See also Figs. 11a to 11c, 12a to 12b and 13a to 13f.
12a-12b: GPS-NSC significantly enhanced the dielectric constant adhesion interaction with endothelial E-selectin under defined shear stress conditions. (a) BT-NSC or GPS-NSC at 1.0 dyn / cm²Lt; RTI ID = 0.0 &gt; IL-1ss &lt; / RTI &gt; and TNF-a stimulated HUVEC. Then, 1, 2, 4, 8, 16, 25 and 32 dyn / cm²NSC accumulation was measured in the shear stress of. GPS-NSC is 32 dyn / cm² Lt; RTI ID = 0.0 &gt; HUVEC &lt; / RTI &gt; In order to contrast the specificity of the binding of GPS-NSC, EDTA was added to the assay buffer (EDTA group) or the stimulated HUVEC was pretreated with a function blocking mAb for E-selectin (anti-E- Sel group). Values are mean ± SEM. (n = 4 for each group). P ≤ 0.001 for comparing GPS-NSC to all remaining groups at all shear stress levels.(b) 0.6 dyne / cm²(Round cells / mm) of CHO-E cells perfused over SDS-PAGE immunoblots of HECA-452-reactive membrane glycoprotein of NSCs in NSC²). Immunoprecipitates of CD44 / HCELL and panNCAM from both BT-NSC (black bars) and GPS-NSC (gray bars) were digested by SDS-PAGE and blotted onto HECA-452 . To contrast the specificity of the CHO-E binding to the membrane glycoprotein, EDTA was added to the CHO-E cell containing buffer before use in the adhesion assays; No cells were bound under these conditions (data not shown). The presented results represent a number of experiments (n = 4) on HECA-452 blots of multiple (n = 3) membrane preparations of NSC.
13a-13f: GPS-NSC represents an improved locus in an in vivo EAE model.(a) To(d) GPS-NSC moves to CNS substance more efficiently than BT-NSC. 1 x 10⁶GPS-NSC or BT-NSC was labeled with PKH26 dye and injected intravenously into MOG-induced EAE mice on days 9 and 13 after immunization (PI).(a) Analysis of the EAE mouse brain for BT-NSC or GPS-NSC (PI 17 day) showed that fewer PKH26-positive cells were observed in BT-NSC injected animals compared to GPS-NSC. A yellow arrow indicates NSC, and a white arrow indicates infiltration. A white dashed line indicates the meniscus boundary.20A to 20BThe This figure shows a further analysis of these fragments to confirm that NSC (PKH26; red) is localized outside the Flk-1 blood vessel (green) and that NSC is SOX-2 positive (green).(b) The lumbar spinal cord (pseudo) was collected on day 17 of PI. On the 17th day of PI, more GPS-NSCs migrated to the spinal cord from the blood vessels than BT-NSC. The blood vessels were visualized with Flk-1 (VEGFR2; green) staining. The edge of the spinal parenchyma is highlighted by a white dotted line. NSCs labeled with PKH26 dyes are shown in red and nuclei stained contrasted with TO-PRO-3 are blue. WM: white matter. V: blood vessels.(c) The illustrations show a three-dimensional picture of the moved NSC indicated by the arrow in Fig. 20a.(d) On the 17th day of PI, the quantification of BT-NSC and GPS-NSC quantities per 200x displacement per spinal cord area was measured. A significant increase in the number of mobile GPS-NSCs compared to BT-NSC was evident, * p <0.05.(e) Quantification of biodistribution of NSC. GPS-NSC (gray bars) or BT-NSC (black bars) were labeled with CFDA-SE and injected intravenously to MOG-treated C57BL6 mice on days 9 and 13 after immunization. The percentage of CFSE-positive cells present in defined gates representing NSCs was determined by analyzing the brain, lymph nodes, spleen, liver and lungs 16 hours after the last injection. The signals observed in each tissue tested were normalized using non-AEA mice administered with GPS-NSC or BT-NSC. Background signals were measured using mice not receiving the cells. The error bars represent the standard error of the mean. Data represent two separate experiments in which 10 mice per group were tested.(f) Demonstrating that exopuylated NSCs are found in vivo in the spleen very close to CD4 T cells. Confocal imaging (NSCs are labeled with pink and CD4 T cells labeled with green); This co-localization of NSCs and lymphocytes may be caused by NSC HCELL binding to lymphocyte L-selectin.
14A-14I: GPS-NSC contributes to significant improvement of EAE symptoms through enhanced neuroprotection. (a) Were immunized with MOG 35-55 at day 0 and then with 1 x 10 &lt; RTI ID = 0.0 &gt;⁶ C57BL / 6 mice or sham injected with GFP-labeled buffer-treated NSC (BT-NSC; red triangles; n = 30) or GPS-treated NSC (GPS- ) -Treated mice (no NSC; black circle; n = 30). The mice to which GPS-NSC was administered were simulated-treated mice (p= 0.0001) and BT-NSC were injected intravenously into micep= 0.006) compared with the control group.(b) The cumulative burden of the disease was evaluated by performing a linear regression analysis comparing the slopes of the curves in FIG. 14A. These data emphasize that GPS-NSC (green dotted line) significantly improves the clinical score than BT-NSC (red line). Mice administered with GPS-NSC or BT-NSC showed significantly improved clinical scores compared to mice without NSC (no NSC; black line). These data also suggest that BT-HSPC (blue line) and GPS-HSPC (purple line) exacerbate the disease (Figure 21c).(c) Neurological status at 30 days PI of brain of NSC injected EAE mice was analyzed by staining with anti-CD11b mAb (green) and nuclear marker To-Pro3 (blue). GPS-NSC scans induce significantly less damage per brain slice as measured by the number of CD11b macrophages / microsomal cells from 20 different sections of three different spinal cords. The bar graph shows the CD11b macrophage / microglial cell counts in the spinal cord sections per high magnification field (HPF) from NSC-free samples, BT-NSC or EAE mice administered GPS-NSC, and also the coefficient of infiltration per HPF Were calculated on the basis of To-Pro3 staining. The white box corresponds to a high magnification image. The yellow arrow corresponds to activated microglia and the white arrow corresponds to infiltration into the meninges (m). It is noted that microglia of samples without NSC are activated more than those found in BT-NSC and GPS-NSC samples. In addition, the size of infiltrates in the meninges is larger in samples without NSC than in BT-NSC samples. Scale bar, 100 탆 for top panel. Scale bar, 50 μm for bottom panel.(d) Twenty different sections of three individual brains from mice receiving NSC-free samples (EAE without NSC), BT-NSC (EAE BT-NSC) or GPS-NSC (EAE GPS- NSC) (To measure infiltration), CNPase (to quantify rehydratable cells), Olig-2 (to measure rare proliferative glial cell differentiation), or SOX-9 (to measure the pluripotency of neural progenitor cells) ) And To-Pro3 (blue) to analyze neuropathological status of the brain from EAE mice injected with NSCs. GPS-NSC injections lead to significantly less T-cell infiltration, enhanced rehydration, and the preservation of large numbers of spindle-lined glial cells and cell counts.(e) The bar graphs show that CD4 T, CNPase, Olig2, and SOX-9 cells in brain slices per high-magnification field of view (HPF) of EAE mice treated with NSC-free samples, BT-NSC or GPS-NSC (as outlined in Figure 14d) , Suggesting that the animals to which GPS-NSC was administered exhibited enhanced neuroprotection of the origin cells.(f) To(i) The GPS-NSC and BT-NSC scans showed increased GAP-43 (green; p < 0.001) staining evaluated by quantitative confocal imaging of GAP43 pixel intensity in over 500 individual measurements(f) And staining with reduced monoclonal antibody SMI32 (red; p < 0.001)(h)Induced increased axon regeneration and axon protection compared to control without NSC, as measured by To-Pro3 staining dye was used to detect cell nuclei (blue).(g) And(h) Based on the quantitative confocal imaging of more than 500 individual pixel intensity measurements (Imitola, J., Cote, D., et al. 2011), GAP-43(g) And SMI32(i)The graphical representation of; SMI32 pattern(i)There is axonal ellipsoid in animals with EAE, but NSC(i)Was reduced in injected animals, and SMI32 pixel intensity showed gradual correction of axon integrity in animals with GPS-NSC. As shown in the lower drawing 14i, there is a decrease in the number of axons and axonal segments compared to the control and BT-NSC. Scale bar, 100 탆 except SMI32 stain (here, scale bar: 50 탆).
15: Inflammatory cytokine treatment does not induce selectin ligand expression in mouse NSCs.NSCs were stimulated (all at 10 ng / ml) either with 10 ng / ml of TNFα, 10 ng / ml of IL-1β, 10 ng / ml of IFNν. At 24 hours, NSCs were harvested and analyzed by flow cytometry for E-selectin binding. Controls included untreated NSC and Kg1a cells (positive control for E-selectin binding).
16 (A) to 16 (C): HCELL Is the only E-Molecule produced by GPS processing in one (exemplary) human NSC (CC-2599) Selectin It is a ligand. . (A) Flow cytometric analysis of expression of CD15, CSLEX-1, HECA452 and E-selectin ligand (E-Ig binding) in human NSC (gray bars) treated with GPS or buffer-treated human NSC (BT; black bars). The mean fluorescence intensity for each measured antibody is shown.(B) Flow cytometric analysis of CD44, PSGL-1, NCAM and CD43.(C) Western blot analysis of E-Ig reactivity of NSC lysates from mouse and human sources. CD44 and NCAM were immunoprecipitated from the same amount of cell lysate from GPS-treated (+) or buffer-treated (-) mouse NSC or human NSC. The immunoprecipitates were then electroporated and blotted with E-Ig. When GPS-treated NSC was added to Ca²⁺Lt; RTI ID = 0.0 &gt; E-Ig. &Lt; / RTI &gt;
Figure 17: GPS processing does not affect the ability of the NSC to form the nerve. 200 viable GFP⁺ NSCs were plated every 96 well plate wells after 7 days of GPS treatment. The number of generated neurons was counted, and the number of neurons was divided by the number of cells plated to calculate the number of neurons. There was no statistically significant difference in the number of neural nerves or number of nerves formed between BT-NSC and GPS-NSC. The GFP used for these experiments⁺ Representative images of the neurons are shown wherein the red fluorescence represents nestin expression and the green fluorescence represents GFP. BT-GFP⁺ NSC and GPS-GFP⁺ Note that both NSCs were able to form neurons equally. This figure is related to Figs. 11A to 11C.
18a-18d: GPS treatment does not affect the ability of NSCs to differentiate into neurons (a), astrocytes (b, d) or rare prominent glial cell precursors (d, d).1 x 10⁵ BT-NSC and GPS-NSC were cultured in an appropriate differentiation medium, MAP-2⁺ Neuron(a), GFAP⁺ Astrocytes(b, d) And NG2⁺ Oligodendrocytes(c)The number of Counted every 20x field of view. There was no statistically significant difference between the ability of BT and GPS-NSC to differentiate into these three lineages (p= 0.1).(d) GFAP⁺ Astrocytes and NG2⁺ The spindle-shaped glue cells are shown in red, and To-Pro3 is used to stain nuclei of neural stem cells treated with control buffer (BT) or FTVI (GPS) in vitro. Scale bar: 50 탆. These drawings11A to 11CLt; / RTI &gt;
Figures 19a-19c: GPS treatment does not affect the immunoregulatory function of NSCs in vitro.The direct in vitro inhibitory effect of NSC on lymph node cells (LNC) was determined by co-culturing isolated LNC and irradiated NSC from naive C57BL / 6 mice. Both irradiated BT-NSC and GPS-NSC reacted to LNC in response to concanavalin A (ConA)³H-thymidine incorporation(a)In a dose-dependent manner and also inhibited inflammatory cytokine production as measured by ELISA(b)To the same extent; The ratio corresponds to the number of NSCs versus the number of LNCs (1: 4, 1: 2, 1: 1, 2: 1 and 4: 1). As the ratio of NSC: LNC increases compared to a single LNC (first bar)³It is noted that the amount of H-thymidine incorporation was significantly reduced (p= 0.0005). It is also noted that there is no statistical significance between the ability of BT-NSC and GPS-NSC to inhibit proliferation (p= 0.2).(c) Before RNA extraction and cDNA synthesis, 1×10⁶(5 ng / mL) without or with the treatment of inflammatory cytokines (10 ng / mL IFN-v and 15 ng / mL TNF-a) for 24 hours and no BT-NSC or GPS-NSC for 24 hours. Real-time RT-PCR was performed using 2^{- △△ CT}(Relative to BT or alone GPS-NSC), and the relative expression of LIF mRNA was compared against the GAPDH housekeeping gene. Values are mean ± SEM (n = 4 experiments). These drawings11A to 11CLt; / RTI &gt;
20A to 20B: GPS-NSCs migrate more effectively to the CNS than BT-NSCs.1 x 10⁶GPS-NSC or BT-NSC was labeled with PKH26 dye and injected intravenously into MOG-induced mice on days 9 and 13 after immunization (PI). PI was harvested on day 17, snap-freezing and then 20 mu slices were prepared and stained with the following antibodies to locate blood vessels and NSCs respectively: anti-Flk-1 ( VEGFR2; green) or anti-SOX-2 (red). (a) BT NSCs are mainly FLK-1⁺ While localized with endothelial cells, GPS-NSC is found in parenchyma because it traverses the endothelium. These NSCs express sox-2, a marker for neural stem cells (b). These drawings13A to 13FLt; / RTI &gt;
21A to 21C: GPS treatment results in strong E-selectin ligand activity in mouse HSPC, but this does not translate into an improvement in EAE. (a) BT- and GPS-mouse hematopoietic stem / origin cells (HSPC;^negC-kit^posRTI ID = 0.0 &gt; E-Ig &lt; / RTI &gt; The mean fluorescence intensity was calculated from hIgG_One Above each histogram for isotype control, E-Ig reactivity and E-Ig reactivity in GPS-HSPC are shown. These cells were used as controls for in vivo EAE experiments.(b) Were immunized with MOG 35-55 at day 0 and then with 1 x 10 &lt; RTI ID = 0.0 &gt;⁶ C57BL / 6 mice injected with buffer-treated HSPC (BT-HSPC; center blue diamond; n = 30) or GPS-treated HSPC (GPS-HSPC; - EAE clinical scores of treated mice (no NSC; black circle; n = 30) were measured. Significant improvement in the clinical score in mice treated with BT-HSPC or GPS-HSPC was not apparent. (c) The cumulative load of the disease was evaluated by performing a linear regression analysis comparing the slopes of the curves of FIG. 21b. These drawings14A to 14HLt; / RTI &gt;
22: No evidence of GFP signal was observed from BT-NSC or GPS-NSC injected into EAE mice at PI 30 days.
C57BL / 6 mice were immunized with MOG 35-55 (on day 0) and then treated with 1 x 10 &lt; RTI ID = 0.0 &gt;⁶ The mice were sacrificed at 30 days after injection of buffer-treated NSC (BT-NSC) or GPS-treated NSC (GPS-NSC), or simulated-treated mice (without NSC)⁺ Immunohistochemistry was performed on the cells. Even when the antibody against GFP (red) was compared to the endogenous GFP signal (EGFP; green), GFP⁺ Cells were not identified in sections of related study groups. NSCs cultured prior to injection were used as positive controls (NSC-Pre Tx) and displayed strong GFP signals. Scale bar: 50 탆. In this figure,14A to 14HLt; / RTI &gt;
23: Nerve Restoration Model provided by GPS treatment of native NSC surface proteins, CD44 and NCAM, producing new step 1 effectors HCELL and NCAM-E that efficiently bind to endothelial E-selectin in EAE mice. As a result of the damage, endothelial cells and glial cells produce more damage signals (e.g., SDF-1 alpha and E-selectin) that direct GPS-NSC towards the damage-induced niche . In spite of increased numbers of recruited NSCs, instead of cell replacement, NSCs provide local regulation of immunity and endogenous regeneration of the CNS by increasing the number of SOX-9 + / Olig-2 + sparse glue cells. This leads to subsequently more mature rare dendritic glial cells (CNPase +), less axonal loss and more axon regeneration. Niche molecules secreted by primitive neural stem cells can promote some of the effects provided by its increased colony formation.
Figure 24. MSC of fat derived from dried and obese subjects FTVII treatment causes the formation of sLex structures on the cell surface. The bar graph shows the flow cytometry results of the sLex expression (HECA452-responsiveness) after α (1,3) -exofucosylation of fat-derived MSCs (n = MSC samples from nude and obese subjects)+ SEM).
Figure 25. Western blot analysis of MSC cell lysate from adipose. MSC (BM-MSC) from bone marrow and MSC (A-MSC) lysates from adipose tissue of dry and obese subjects are treated with exofucosylation with FTVII (+) or with a single buffer (-) , Applied to SDS-PAGE and blotted with HECA452 or anti-human CD44 mAb. The lysates of hematopoietic cell line KG1a (control) and fibroblast PIF were co-electroporated and blotted. KG1a cells express HCELL (HECA-452-reactive CD44 at a mW of about 80 kDa). As shown in the figure, FTVII treatment results in enhanced HCELL expression (HECA452-reactive CD44) in MSCs derived from adipose tissue of PIF cells and skin and obese subjects (upper panel); The staining for CD44 expression in each lysate is shown under the HECA452 blot. Expression of HCELL (approximately 80 kDa HECA452-reactive band) was removed after treatment of the cells with sialidase (bottom panel), which is consistent with the sialidase sensitivity of HCELL expression (i.e., elimination of sLex). Note that HCELL can appear as a double line at about 80 kDa, reflecting variable glycosylation of the core CD44 glycoprotein that does not affect the E-selectin or L-selectin ligand activity of the HCELL molecule (see bottom panel FTVII-treated A-MSC profile).
Figure 26. Results of a parallel plate flow chamber study of MSC perfused over TNF-stimulated human umbilical vein endothelial cells (HUVEC). Defined Hemodynamic shear conditions (dynes / cm²(1,3) -exofucosylation (FTVII treatment) of A-MSCs derived from a lean subject (LA-MSC) and an obesity subject (OA-MSC) Gt; E-selectin &lt; / RTI &gt; presented on TNF-stimulated HUVEC; The E-selectin ligand activity of MSCs from FTVII-treated (HCELL +) lipids is equivalent to the E-selectin ligand activity of FTVII-treated (HCELL +) bone marrow derived MSCs (BM-MSC; bottom panel). Untreated MSCs do not have significant binding interactions in HUVEC at any shear stress level.
27 (A) to 27 (C). A variety of white blood cell E- Selectin The effect of α (1,3) - Ex Analysis of the effect of small fucosylation. (A) Parallel plate flow chamber analysis of temporary adherence and rotational interaction of native peripheral blood leukocytes and endothelial E-selectin (expressed in TNF-stimulated human umbilical vein endothelial cells (HUVEC)). Mononuclear cells, CD4 T cells, CD8 T cells and B cells are freshly isolated and then injected with 0.5 to 16 dynes / cm 2 on TNF-stimulated HUVEC (i.e., TNF induces HUVEC to express E-selectin)² The flow of the range was perfused, and cell rotation was observed and recorded for video analysis. Mononuclear cells and CD4 T cells had 16 dynes / cm² , While CD8 and B cells exhibit minimal adhesion-to-electrostatic adhesion interactions, while the &lt; RTI ID = 0.0 &gt; CD8 &lt; / RTI &gt; Note that mononuclear cell rotation was three times greater than CD4 T cells. Values are mean ± SEM for at least 3 independent experiments.(B) Staining with E-selectin-Ig chimera ("E-Ig", probe for E-selectin ligand (R & D Systems) (left) and mAb HECA452 (right) on monocytes, CD4 and CD8 T cells and B cells Representative histogram of flow cytometry. The gray filled curve shows the isotype control (or, for E-Ig staining, the inflow Ca²⁺Selectin binding in the absence of &lt; RTI ID = 0.0 &gt; E-Ig), white curves show specific reactivity^{2 +}&Lt; / RTI &gt;(C) Cells treated with untreated cells (black solid line) or with protease (bromelain) (dashed line) were stained with HECA452 mAb and analyzed by flow cytometry. The protease (bromelain) treatment (dotted line) significantly reduces HECA452 staining of monocytes, CD4 T cells, CD8 T cells and B cells, indicating that glycoproteins are the major carriers of sLex crystal factors in these cells.
28A to 28C. Functional E-selectin ligand expression in monocytes and lymphocytes is increased by the [alpha] (1,3) -exofucosylation treatment. (a) Human monocytes were immunoprecipitated with FTVII or buffer treatment (simulated) and E-selectin-Ig chimera ("E-Ig", probe for E-selectin ligand (R & D Systems) And blotted with HECA-452, anti-CD43, anti-CD44 and anti-PSGL-1 mAb, respectively. It is noted that E-Ig immunoprecipitation was significantly increased in FTVII treatment of monocytes following the production of CD44 (ie, the generation of HCELL) and CD43 (the production of CD43-E-selectin ligand ("CD43-E")).(b) Western blot analysis of E-Ig staining followed by sequential immunoprecipitation of PSGL-1, CD43 and CD44 from lysates of CD4 T cells, CD8 T cells and B cells.(c) ("Unt") and FTVII-treated (ie, α (1,3) -exofucosylation; "FT7") monocytes, TNF-α activated HUVECs (expressing E-selectin), CD4 T Parallel plate flow chamber analysis of temporal attachment and rotational interaction of cells, CD8 T cells and B cells. FTVII treatment ("FT7") significantly increases E-selectin-mediated adhesion of flow cells to HUVEC under all shear stress levels tested.
29 (A) to 29 (C): Dendritic cells derived from monocytes (i.e., CD14 Expression CD14 -S mo-DC) and then cultured CD44 The E- On selectin . (A) Representative flow cytometry histograms of HECA-452 mAb and E-Ig reactive staining of mo-DC. Gray lines indicate isotype control or Ca^{2 +} , Whereas the dotted black line indicates PA-S mo-DC and the solid black line indicates CD14-S mo-DC.(B) Western blot analysis of E-selectin staining of CD14-S and PA-S mo-DC lysates. 2 x 10⁶The whole cell lysate corresponding to mo-DC was digested on SDS-PAGE gel and immunoblotted. The MW marker is on the Y axis (in kDa units). Mo-DC (CD14-S Mo-DC) cultured on CD14 beads has higher HCELL expression (about 80 kDa band) than Mo-DC (PA Mo-DC) cultured on plastic.(C)Western blot analysis of CD44 immunoprecipitated from cell lysates of CD14-S and PA-S mo-DC. The CD44 immunoprecipitate (CD44 IP) was then blotted and stained with E-Ig chimera or anti-CD44 mAb. The MW marker is on the Y axis (in kDa units) as is well known. Note the prominent HCELL expression in CD14-S mo-DC.
30 (A) to 30 (E). The alpha (1,3) - Exofucosylation The higher E- Selectin Ligand Enhancing activity, and endothelial E- Selectin Expression Exofucosylated Of DC Via the endothelium Transendothelial migration TEM ). (A) 2 x 10⁶Western blot analysis comparing E-selectin binding (E-Ig) of lysates of KG1a cells and mo-DC.(B) Western blot analysis of E-Ig reactivity of buffered (-) or FTVI-treated (+) mo-DC. FTVI treatment induces E-Ig binding at about 80 kDa, suggesting enhanced expression of HCELL.(C) Shear flow conditions in TNF- [alpha] -stimulated HUVEC (2 dynes / cm²(BT) mo-DC and FTVI-treated mo-DC buffered (MOI-DC). TEM values are multiples of cell migration in TNF- [alpha] -stimulated HUVEC compared to transfected cells in untreated HUVEC (which is minimal). The TEM was analyzed under different conditions: functional blocking anti-E-selectin mAb Clone 68-5H11, pre-incubated HUVEC, function blocking anti-VLA-4 mAb HP2 / 1 or isotype mAb and pre- , And mo-DCs treated with sialidase or pertussis toxin (PTX). As shown, exo fucosylated DC has a higher TEM than untreated cells; TEM is removed by function-blocking antibodies to E-selectin and VLA-4 and by sialidase or PTX treatment of the cells.(D) Temporal attachment and rotation in TEM calibration mo-DC (endothelial surface area cm²) And stably attached cells (endothelial surface area cm²Per) analysis of the number. Note the higher temporal attachment / rotation interaction with exo fucosylated DC.(E)Average rotational speed of buffered (BT) mo-DC and FTVI-treated mo-DC in TEM assay. The cell number was 2.0 dyne / cm² Shear stress (i.e., 2.0 dyne / cm² Lt; / RTI &gt; stimulated &lt; RTI ID = 0.0 &gt; HUVEC &lt; / RTI &gt; in shear stress). Values are mean ± SD (n = 3). Statistical significance (p <0.05) is indicated by parentheses and asterisks (*). The slower rotation of FTVI-treated DC is an indicator of the higher efficiency of DC binding interactions to endothelial E-selectin under hemodynamic shear conditions.
Figure 31. FoxP3 expression in regulatory T cells produced by in vitro proliferation of human CD4 + cells in the presence of antibodies and IL-2 supplementation to CD3 and CD28.Dual color flow cytometry histogram showing CD4 and FoxP3 expression in cultured CD4 + / CD127-low T cells; High FoxP3 staining suggests that all culture-expanded cells are Tregs.
Figure 32. Flow cytometric profile of sLex expression (HECA452 stain) of buffered (filled with dark gray) Treg and exofucosylated (FTVII-treated; black filled) Treg.Note that buffer-treated Tregs are free of sLex expression (ie, profiles are similar to isotype control streaks (dashed lines)) whereas FTVII-treated cells exhibit high sLex levels.
Figure 33. Western blot analysis of E-Ig staining of FTVII-Treated and Buffered (BT) Tregs compared to human myeloid leukemia cell line KG1a.The buffered Treg does not have an E-selectin ligand. α (1,3) -exofucosylation induces the expression of several glycoprotein E-selectin ligands in Tregs, including the expression of HCELL (approximately 80 kDa band). KG1a cells originally express HCELL.
Figure 34. Potency measurement of regulatory T cell administration in xenograft versus host disease (GVHD).The heterogeneous GVHD-related weight loss (measured at 50 days after PBMC injection) was 1.5 x 10 &lt; RTI ID = 0.0 &gt;⁵But not by injection of a similar dose of buffered Treg (body weight is an average of N = 3 mice). However,⁵Injection of dog Treg prevents GVHD weight loss regardless of the α (1,3) -exofucosylation of the administered Treg cells. Thus, the α (1,3) -exofucosylation of Treg 3-fold increases the efficacy in the immunomodulation of GVHD.

Embodiment

The present invention relates to a method for the treatment of diseases, disorders or medical conditions that occur as inflammatory tissue and / or damaged tissue or cancer in a subject. The method involves administering to a subject in need of tissue repair / regeneration or cancer therapy a population of cells expressing E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of the original cell population. The composition of the cells is placed in a pharmaceutically acceptable solution, suspension, carrier or vehicle for administration to a subject or prior to administration to a subject (e. G., Cryopreservation).

The administration of a population of cells as described herein for therapeutic indications may be accomplished using anatomical imaging techniques (e.g., radiation, MRI, ultrasound, etc.) or mapping techniques (e.g., epiphysiologic mapping procedures, Procedures, electrodiagnostic procedures, etc.), in various ways clinically guaranteed / indicated in each case using various anatomical access devices, various dosage devices and various anatomical approaches. Cells may be administered systemically via peripheral vascular access (eg, intravenous placement, peripheral venous access devices, etc.) or central vascular access (eg, central venous catheters / devices, arterial access devices / approaches, etc.). The cells may be delivered intravenously into the anatomical supply vessels of the intended tissue site using a catheter-based approach or other vascular access device (e.g., a cardiac catheter method, etc.) that can deliver the vascular mass of the cell to the intended site. Cells may be introduced into the spinal canal and / or into the brain (i. E. Into the submucosal, cerebrospinal fluid and / or subarachnoid space to be distributed within the ventricle). The cells can be injected into a patient's body using a catheter-based approach or direct injection (e. G., Intraperitoneally, intraperitoneally, intraperitoneally, intravascularly (e.g. into the bladder, into the gallbladder, into the bone marrow, into the biliary system Intraurethral, through the pelvic / ureteral approach, into the vagina, etc.)) into the body cavity or anatomical compartment. Cells may be introduced by direct intradermal injection via an intravascular approach (e.g., endocardial myocardial infusion) or transdermal approach or through surgical exposure / approach to tissue or through a laparoscopic / thoracoscopic / endoscopic / colonoscopic approach Or into anatomically accessible tissue sites directly and / or by imaging techniques (e.g., into the joint, into the vertebral disc and other cartilage, into the bone, into the muscle, into the skin, into the connective tissue and into the central nervous system, , Into the relevant tissues / organs such as heart, liver, kidney, spleen, etc.). Cells may also be placed directly into the tissue surface / site (e.g., directly into the tissue, ulcer, burn surface, serous or mucosal surface, epicardium, etc.). The cells may also be administered into a tissue or structure support device (e.g., embedded in a scaffold disposed in a tissue scaffold device and / or tissue, and / or may be administered in a gel and / , Support cells, cytokines, growth factors, resolvin, anti-inflammatory agents, and the like).

The population of cells is administered to a subject during a period of time (i. E., Consistent with induced expression) of E-selectin in the vascular endothelium in one or more tissues of the subject (and consistent with the onset of induction of induced expression) . Enhanced expression of the E-selectin ligand at the surface of the administered cells may be beneficial for vascular remodeling, host defense (e.g., protection against infection or cancer) and / or tissue repair / regeneration and / It will mediate immune regulatory processes that can weaken and / or prevent inflammation. Expression of the ligand for E-selectin mediates the binding of blood-derived cells to vascular E-selectin expressed in endothelial cells at the site of inflammation, leading to delivery of the intravascularly administered cells to the site of inflammation. In addition, the cells may be introduced into the body cavity or compartment directly, by direct topical injection, or via an associated tissue (e. G., Into the subarachnoid space for delivery into the cerebrospinal fluid) Expression of the ligand for E-selectin and / or L-selectin on the administered cells, respectively, whether administered by surface / site administration, is dependent on the E-selectin (i.e., endothelial cells) and / or L-selectin (I. E., Leukocytes), promoting cell fixation in the affected tissue environment. Thus, the spatial distribution and localization of the administered cells in the target tissue is regulated by the expression of E-selectin and / or L-selectin ligand on the cells to which they are administered.

In particular, colonization of the desired cell type at the site of inflammation occurs as a result of enhanced expression of the cell surface E-selectin ligand in the administered cells such that the administered cells have increased binding to E-selectin, This facilitates systemic delivery of the desired cells and / or fixation of the cells when directly injected into the affected site. For example, enhanced expression of an E-selectin ligand (such as HCELL, CD43-E, CLA / PSLG-1, ESL-1, NCAM-E, etc.) may advantageously direct directly injected cells into inflammatory, Lt; RTI ID = 0.0 &gt; E-selectin-expression &lt; / RTI &gt; Thus, the method can be used to deliver, for example, the ability to deliver tissue-mediated stem cells, the ability to deliver immunomodulating cells (e.g., mesenchymal stem cells, T-regulated cells, NK-cells, dendritic cells, etc.) Specific immune effector T cell carcinoma-specific cytotoxic T cells or NK cells, respectively, in the case of an infectious or malignant tumor, Enhancing the efficiency of inflammation, tissue damage or related cellular transfer at or at the site of cancer, including, for example, transmission); These immunological cells (regulatory T-cells, NK cells, cytotoxic T-cells, dendritic cells, etc.) can be antigen-pulsed, tumor cell-pulsed, viral-pulsed and other means of generating antigen specificity Lt; / RTI &gt; Likewise, enhanced expression of L-selectin ligands (e. G., HCELL, PSGL-1, etc.) can advantageously direct directly injected cells into inflammatory, tissue damage or L-selectin-expression infiltration sites of cancerous sites.

Enhanced E-selectin ligand expression at the cell surface will drive the vascular engraftment of cells to any site where E-selectin is expressed. In various embodiments, the cell population expresses a hematopoietic cell E- / L-selectin ligand (HCELL) and / or a neuronal cell adhesion molecule E-selectin ligand (NCAM-E). Other E-selectin ligands that can be expressed by cells include, for example, the CLA-like forms of CD43-E, ESL-1, PSGL-1 and PSGL-1. For example, because CD44 is a ubiquitously expressed cell membrane protein and is presented on stem / origin cell populations of both "adult" and embryo types, glycosylation of the protein is modified by in vitro glycan manipulation, (In the form of CD44) phenotypes may drive the movement into the bone marrow of cells injected (e.g., into the blood vessels) in vivo (adoptive delivery) or any tissue / organ site where E-selectin is expressed will be. Thus, using a modified cell in a therapeutic setting, enumeration of several conditions may result in targeted cell migration in a variety of physiological and pathological processes, including, for example, bone disease, immune disease, infectious disease, Can be achieved.

It has also been found that a disease, disorder or medical condition having an associated inflammation can be treated using the method of the present invention in the absence of differentiation of the cell population in the subject. That is, regardless of the type of tissue involved, there is a nutritional effect of the administered cells at the site of inflammation, without the continued engraftment and / or repopulation of the administered cells. This nutritional effect promotes vascular remodeling (eg, VEGF), promotes tissue repair (eg, TGF-β), is immunomodulatory (eg, IL-10) / RTI &gt; of the cytokines / growth factors that stimulate the growth / proliferation of the cells and many other tissue-repair processes (e. G., Mitochondrial delivery to the cells). In addition, the administered cells (e.g., Tregs, MSC, dendritic cells, etc.) may have potent immunomodulating properties, including direct inhibition of activated lymphocytes (e.g., through the expression of PDL-1).

Cells as modified by E-selectin and / or L-selectin binding activity as compared to native cell type populations, as exemplified by Figures 4 (A) to 4 (H) The population has increased ability to ingest, invade, and colonize tissues near the E-selectin-expressing vasculature. In addition, in one embodiment, such cells settle on the site of inflammation via binding to E-selectin on endothelial cells or settle on the site of infiltrating leukocytes within the inflammatory site (see, for example, Figures 4 (F) and 4 (G) Reference). In addition, beneficial effects (e. G., Amelioration of the disease) include, but are not limited to, parenteral delivery to the inflamed site or infiltrating leukocyte region, in the absence of cell differentiation (or prolonged engraftment) Or by direct injection (i. E., Transient engraftment alone may be sufficient to deliver the intended biological effect (s)).

In certain embodiments, the glycan-manipulation method described in U.S. Patent No. 8,084,236 for enhancing HCELL expression in a population of viable cells, discussed in detail below, induces a large amount of E-selectin ligand expression in such cells, A large amount of an E-selectin ligand and an L-selectin ligand capable of promoting vascular transmission of cells to the site and promoting cell fixation in the affected tissue environment.

Treatment of a subject refers to reducing or eliminating the clinical symptoms of a disease, disorder or medical condition having an inflammation associated with the individual, or delaying or preventing the onset of clinical symptoms of such disease, disorder or medical condition in a subject. For example, the treatment may include, for example, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% , At least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 100%. Actual symptoms associated with acute and chronic inflammation are well known and include, without limitation, location of acute and / or chronic inflammation, cause of acute and / or chronic inflammation, severity of acute and / or chronic inflammation and / or acute and / Can be determined by those skilled in the art by considering factors including tissue or organ affected by inflammation. Skilled artisans will be aware of the appropriate symptoms or indicators associated with a particular type of acute and / or chronic inflammation and will know how to determine whether an individual is a candidate for treatment as disclosed herein.

A subject that may be treated according to the methods described herein includes any mammal such as a mammal (e.g., human) that may be susceptible to disease. Examples include rodents such as humans, non-human primates, cows, horses, pigs, sheep, goats, dogs, cats or mice, rats, hamsters or guinea pigs. A subject may be a subject known to have a disease, disorder or medical condition that is diagnosed with a disease, disorder or medical condition with an associated inflammation, or otherwise the result or symptom is acute and / or chronic inflammation. In some embodiments, the subject may be diagnosed as being at risk for developing a disease, disorder, or medical condition having an associated inflammation, or may be known to be at risk. In certain embodiments, the subject may be selected for treatment based on a known disease, disorder, or medical condition in which the outcome or symptom in the subject is acute and / or chronic inflammation. In some embodiments, the subject may be selected for treatment based on a disease, disorder or medical condition having a suspected associated inflammation in the subject. In some embodiments, the disease, disorder, or medical condition can be diagnosed by detecting a mutation or other abnormality in a biological sample (e.g., urine, sputum, whole blood, serum, faeces, etc., or any combination thereof). Thus, the modified population of cells is administered to a subject based on the fact that mutations, symptoms, or other anomalies are detected, at least in part, in at least one sample (e.g., a biopsy sample or any other biological sample) obtained from the subject . In some embodiments, the diabetes, multiple sclerosis or cancer may be detected in a subject or may not be located in the subject, but may be at least one of a mutation, symptom or other abnormality associated with diabetes, multiple sclerosis or cancer in at least one biological sample May be sufficient to administer the modified cells to a subject according to the methods described herein. In some embodiments, the composition can be administered to prevent the onset of a disease, disorder or medical condition such as diabetes, multiple sclerosis or cancer. However, in some embodiments, the presence of an existing disease, disorder or medical condition may be suspected but not yet confirmed, and the compositions of the present invention may be administered to prevent further growth or development of the disease, disorder or medical condition have. The administered cells can be derived from a self-source (i. E. Derived from the host itself), a copper source (from an identical twin) or a homogeneous source (derived from a donor that is not genetically identical).

Time of administration

As noted above, the population of cells is maintained in a manner consistent with (and preferably consistent with the onset of induced expression of) E-selectin by the endothelial cells of the subject, or the expected increased E - response to a pathogen or disease process having an upregulation immediately prior to expression of the selectin (i. E., Prior to delivery of the E-selectin-induced inflammatory stimulus or as a concomitant preventive measure (e. G. As radiation therapy) (E.g., after exposure to an infectious agent or endogenous reactivation of an infectious agent, prior to an explicit outbreak of autoimmune disease, prior to elaboration of graft versus host disease (GHVD), etc.). Thus, the treatment methods described herein can be performed, for example, when a subject (e.g., a human patient) complains of one or more symptoms of inflammation or anticipated inflammatory outbreaks to his / her internal medicine or health care provider. In the case of subjects with diabetes, for example, such initial symptoms may include polyuria, nocturnal enuresis, weight loss / increase and / or satiety loss, wherein (and prior to the occurrence of diabetic ketoacidosis) Can be administered. In the case of a subject with multiple sclerosis, for example, such initial symptoms may include temporary sensory disturbances (e.g., numbness, numbness) and / or contraction (single contraction) and / or muscle weakness episodes.

In general, the temporal aspect of administration of the modified cells may depend on, for example, the nature of the particular modified cell or disease, disorder or medical condition (and associated inflammation, tissue damage or cancer) to be treated. Other considerations include the severity of the disease, disorder or medical condition; Activity of the particular cell or cell fraction and variants employed; The specific composition used; Age, weight, general health, sex and diet of the subject; Time of administration; Route of administration and rate of excretion; Treatment period; Drugs used in combination or concurrently with therapeutic methods; Other factors may be included.

Thus, administration of the modified cells can occur as a single event or over time of treatment. For example, modified cells may be cultured at different times (e.g., every hour, every 2 hours, every 3 hours, every 4 hours, every 5 hours, every 6 hours, etc.), once a day, once a week, Once every two weeks, once every two months, or once a month. For the treatment of acute conditions, for example, the time course of treatment may be at least hours, days or weeks. Certain conditions can extend treatment from days to weeks, months, or even years. For example, treatment may be extended to one week, two weeks, or more than three weeks (e.g., from one month to several months). In the case of more chronic conditions, treatment can be extended from weeks to months, years or more to the lifetime of patients in need of such treatment. Alternatively, the compounds and preparations may be formulated as a prophylactic or therapeutic means for several weeks, months, years, or throughout the life of the patient, every hour, once a day, once a week, once every two weeks, once every two months, &Lt; / RTI &gt;

It will also be appreciated that the frequency of administration may be increased or decreased depending on the nature and severity of the disease, disorder or medical condition (and associated inflammation) and / or the disease, disorder or medical condition of the subject. For example, depending on these factors and other factors, less frequent administration may be desirable at the beginning of treatment, and more frequent administration at the end or near end may be desirable, or vice versa. Various targets and symptoms may also be tracked (e.g., insulin levels of a diabetic subject) and the dosage and dosage adjusted accordingly.

Optionally, the cells can be divided into multiple doses for administration purposes; As a result, the single dose composition may contain this amount or a minor number thereof to fill the dose.

Indications

The present invention relates to the treatment of diseases, disorders or medical conditions in which E-selectin is expressed and / or infiltrated / accumulated in the tissue (s) in which the L-selectin-expressing leukocyte is expressed in the endothelium of the affected tissue . As discussed above, E-selectin and L-selectin bind to sialylated fucosylated carbohydrates, respectively, and enhanced expression of these sialofucosylated glycan structures on the cell surface results in binding to these selectins It acts as a program. Thus, the present invention describes a method of enhancing the induction of an E-selectin ligand on a cell to be administered to the target tissue (s); In addition, it is possible to enhance the expression of potent E-selectin and L-selectin ligand (such as HCELL) in the administered cells to inhibit E-selectin on vascular endothelial cells and / or L- In explaining a method of promoting adhesion to selectin, the present invention provides a means for enhancing cell colonization / fixation in the relevant tissue microenvironment where biological effects are intended. In general, the methods described herein can be used for immunotherapy applications (e.g., administration of culture-proliferated antigen-specific T cells and / or culture-proliferated NK cells for cancer or infectious disease applications, (Eg, administration of chimeric antigen receptor (CAR) T cells, administration of antigen-pulsed dendritic cells, etc.), immunomodulation / immunosuppressive therapy application (eg, administration of culture- (E.g., administration of stimulated dendritic cells, administration of mesenchymal stem cells, administration of culture-proliferated NKT cells, etc.) or tissue repair / regenerative medicine application (e.g., stem cells and / or origin cells Based therapy approach regardless of whether it is a cell-based therapy, the use of other tissue-repair cells, culture for tissue regeneration / restoration-proliferated stem cells and / or culture-proliferation of progenitor cells) . For use in regenerative medicine applications, the administered cells themselves contribute to the regeneration of target tissues by prolonged engraftment (with concomitant proliferation / differentiation) to produce tissue-specific cells (e. G., Blood cell production (E.g., through transfusion of nutritional effects that stimulate resident stem / origin cells to repair the injured tissue (s)) and / (By weakening the inflammatory process that slows repair) and can deliver tissue repair / restoration effects without prolonged engraftment or differentiation into tissue-resident cells. All applications for all adaptations described herein can be used alone or in combination with an enhancer (e.g., growth factor, tissue scaffold, etc.).

(Eg, soft tissue infections, pneumonia, acute myocardial infarction, stroke, shock, hemorrhage, coagulopathy, etc.), direct tissue injury (eg burns, trauma, fractures, Neoplasms, lung cancer, prostate cancer, renal cell carcinoma, lymphoma, leukemia, etc.), immunological / autoimmune diseases (such as acute or chronic GVHD, multiple sclerosis, diabetes mellitus, , Degenerative diseases such as osteoporosis, osteoarthritis, spinal disc degeneration, Alzheimer's disease, atherosclerosis, etc.), congenital / hereditary diseases (e.g., osteoarthritis), inflammatory bowel diseases (e.g. Crohn's disease, ulcerative colitis, rheumatoid arthritis, psoriasis etc.) : Toxic drug effects (eg, chemotherapy-induced tissue / organ toxicity, radiation therapy toxicity, drug-induced hepatitis, drug-induced cardiac damage) Etc.), toxic damage (e.g., radiation exposure (s), radiation exposure (Eg, urinary toxic pericarditis, metabolic acidosis, etc.), tenderness (eg, radiation-induced tissue damage, surgery related pain, (E.g., acute and / or chronic), including, but not limited to, those described herein, including, but not limited to, those described herein, including but not limited to complications, etc.), and / or idiopathic processes (e.g., amyotrophic lateral sclerosis, Any and all diseases, disorders or medical conditions having an injured / injured or neoplastic condition can be treated according to the methods described herein.

Other general and specific diseases, disorders or medical conditions that may be treated according to the methods described herein include, but are not limited to:

Acute leukemia, such as acute dual-phenotype leukemia, acute lymphoblastic leukemia (ALL), acute myelogenous leukemia (AML) and acute undifferentiated leukemia;

(CME), refractory anemia (RA), refractory anemia (RAEB) with excessive blast cells, refractory anemia (RAEB- T) and refractory anemia (RARS) with cyclic iron hair follicles;

Myeloproliferative disorders such as acute myelofibrosis, unexplained myelogenous leukemia (myelofibrosis), essential hyperplasia, chronic myelogenous leukemia and acute erythropoiesis;

Proliferative cell disorders such as Chediar's eastern syndrome, chronic granulomatous disease, leukocyte adhesion deficiency, myeloperoxidase deficiency, neutrophilactin deficiency and retinoblastoma;

(MPS-II), Hurler's syndrome (MPS-IH), Krabb's disease, Marotho-Lamy syndrome (MPS-II), Lupus erythematosus, Alzheimer's disease, Gaussian Disease, Hunter's syndrome (MPS-IV), mucinous lipidosis II (I-cell disease), mucopolysaccharidosis (MPS), Niemann's disease, acidophilus syndrome (MPS-III) Schizoid Syndrome (MPS-IS), Sly Syndrome, Beta-Glucuronidase Deficiency (MPS-VII), and Monthly Disease;

Genetic erythropoietic disorders such as beta-mediated anemia, black plate-diamond anemia, intrinsic erythropoietin and sickle cell disease;

Genetic platelet disorders such as megakaryopoiesis / congenital thrombocytopenia, gray platelet syndrome;

Cancer, breast cancer, gastric cancer, esophageal cancer, skin cancer, oral cancer, endocrine cancer, liver cancer, bile duct cancer, pancreatic cancer, prostate cancer, ovarian cancer, ovarian cancer, And testicular cancer;

Other applications include, for example, bone marrow transplantation, heart disease (myocardial infarction), liver disease, muscle regression atrophy, Alzheimer's disease, Parkinson's disease, spinal cord injury, spinal disc disease / degeneration, bone disease, fracture, stroke, Stem cells derived from a variety of tissue sources, stem cells derived from various tissue sources, stem cells derived from various tissue sources, stem cells derived from various tissue sources, Cell and origin cells, application and limb regeneration in humans and animals, reconstructive procedures / indications used alone or in combination with enhancers;

Chronic lymphocytic leukemia (CLL), chronic myelogenous leukemia (CML), childhood chronic myelogenous leukemia (JCML) and pediatric bone marrow mononuclear leukemia (JMML),

Stem cell disorders such as poorly regenerating anemia (severe), congenital hemodilution, congenital anomalous keratosis, panconi anemia and paroxysmal nocturnal hemoglobinuria (PNH);

Lymphocyte proliferative disorders such as Hodgkin's disease, non-Hodgkin's lymphoma and pre-lymphocytic leukemia;

Histiocardial disorders such as familial erythropoietic lymphoid tissue hyperplasia, hemophagocytosis, hematopoietic lymphocytic leukemia, histiocytosis-X and Langerhans cell histiocytosis;

Absence of T cells and B cells, absence of T cells, normal B cell SCID, vasodilatory ataxia, non-labeled lymphocyte syndrome, common variable immunodeficiency syndrome, diGorge syndrome, (SCID), SCID accompanied by adenosine deaminase deficiency, Biscott-Aldrich syndrome and X-linked lymphoproliferative disorders, such as Kostmann syndrome, leukocyte depletion, Omenn's Syndrome, ;

Other hereditary disorders such as hypochondroplasia, celioid lipochromatosis, congenital erythropoietic porphyria, familial Mediterranean fever, Glansman platelets hypersensitivity, Lesch-Nichand's syndrome, osteoporosis and Zanthoxib disease;

Plasma cell disorders such as multiple myeloma, plasma cell leukemia and valgentroma macroglobulinemia; And

Autoimmune diseases such as multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, ankylosing spondylitis, diabetes mellitus and inflammatory bowel disease.

The present invention relates to a method of treating or preventing a disease or condition of the joint or skeleton such as disc degeneration, synovial disease, cartilage degeneration, cartilage trauma, cartilage rupture, joint, fracture, bone deformation, osteogenesis, incomplete osteogenesis, / Condition, osteoporosis. Osteoporosis, hypophosphatemia, metabolic bone disease, etc.

Skin / soft tissue disorders and conditions, such as blister disease, psoriasis, eczema, vesicular epidermolysis, ulcerative skin conditions, soft tissue deformities (including postoperative skin and soft tissue deformities), and cosmetic / reconstructive surgery indications.

In general, associated inflammatory symptoms include, without limitation, fever, pain, swelling, redness, erythema, bruising, tenderness, stiffness, swelling, chills, dyspnea, hypotension, hypertension, nasal stuffiness, stuffy head, The present invention relates to a method of treating a disorder or condition selected from the group consisting of anxiety disorder, anxiety disorder, anxiety disorder, Fibrosis, pus, inviscid serous fluid or ulcer. Actual symptoms associated with acute and / or chronic inflammation are well known, and include, without limitation, factors such as location of inflammation, cause of inflammation, severity of inflammation, affected tissue or organ and related disorders, Lt; / RTI &gt;

Specific patterns of acute and / or chronic inflammation are observed during certain conditions that occur in the body, such as when inflammation occurs at the epithelial surface or when pathogenic bacteria are involved. For example, granulomatous inflammation is inflammation resulting from the formation of a granuloma resulting from a limited but diverse number of diseases, including, but not limited to, tuberculosis, leprosy, sarcoidosis and syphilis. Pyogenic inflammation is an inflammation that produces a large amount of pus composed of neutrophils, dead cells, and body fluids. Infection by purulent bacteria, such as Staphylococcus, is a hallmark of this type of inflammation. Serous inflammation is usually inflammation originating from plasma, although it is inflammation originating from a massive effluent of non-viscous serous fluid produced by mesothelial cells of the serous membranes. Skin blisters illustrate these inflammatory patterns. Ulcerative inflammation is an inflammation that results from the loss of tissue from the epithelial surface and exposes the underlying layer to form ulcers.

Acute and / or chronic inflammation can be associated with a large unrelated group of disorders that are the basis of various diseases and disorders. The immune system is often associated with both acute and / or chronic inflammatory disorders in both allergic reactions, arthritic conditions and some myopathies, as well as many immune system disorders resulting in abnormal inflammation. Non-immune diseases with pathogenic origin in acute and / or chronic inflammatory processes include cancer, atherosclerosis and ischemic heart disease. Non-limiting examples of disorders that exhibit acute and / or chronic inflammation as symptoms include, without limitation, acne, acid reflux / heartburn, AMD associated with aging, allergies, allergic rhinitis, Alzheimer's disease, amyotrophic lateral sclerosis, , Cervicitis, arthritis, arthritis, asthma, atherosclerosis, autoimmune disorders, acne, agranulitis, bronchitis, bronchitis, vesicular pemphigus, burns, bursitis, cancer, heart attack, carditis, celiac disease, (Eg acute exacerbation of COPD), cirrhosis, colitis, congestive heart failure, conjunctivitis, drug-induced tissue damage (eg, cyclophosphamide-induced Diabetic nephropathy, diabetic nephropathy, diabetic nephropathy, diabetic ulcer, digestive disorders, diabetic nephropathy, diabetic nephropathy, diabetic nephropathy, diabetic nephropathy, diabetic nephropathy, The present invention relates to a method for the treatment and prophylaxis of a disease or condition selected from the group consisting of a disease, an eczema, an emphysema, an encephalitis, endocarditis, endocrinopathy, endometritis, enteritis, enterocolitis, pharyngitis, epididymitis, fasciitis, fibromyalgia, Inflammatory bowel disease, inflammatory cardiac hypertrophy, inflammatory neuropathy, insulin resistance, interstitial cystitis, interstitial nephritis, chronic obstructive pulmonary disease, cardiovascular disease, heart valve dysfunction, hepatitis, purulent hepatitis, Huntington's disease, hyperlipidemic pancreatitis, hypertension, Myelitis, mastitis, meningitis, metabolic syndrome (syndrome X), migraine, mucositis, multiple sclerosis, myelitis, myositis, myositis, nephritis, myelitis, myelitis, Osteoarthritis, osteoarthritis, osteoarthritis, osteoarthritis, osteoarthritis, osteomyelitis, osteomyelitis, osteoporosis, osteitis, otitis, pancreatitis, Parkinson's disease, mumps, pelvic pain, Pyelonephritis, polycythemia nephritis, rheumatoid arthritis, prostatitis, psoriasis, dermatitis, pyelonephritis, portal inflammation, radiation-induced damage, renal failure, reperfusion injury, retinitis , Thrombosis, stomatitis, stomatitis, stomatitis, stomatitis, surgical complications, synovitis, tendonitis, tendinosis, hay fever, thrombophlebitis, thyroiditis, rheumatoid fever, rhinitis, fever, sarcoidosis, salivary glanditis, sinusitis, , Tonsillitis, trauma, traumatic brain injury, graft rejection, bladder trigemitis, tuberculosis, tumors, ulcers, urethritis, bursitis, uveitis, vaginitis, vasculitis and vulvalis.

A general class of diseases, disorders and traumas that cause or otherwise cause acute and / or chronic inflammation include but are not limited to genetic diseases, neoplasms, direct tissue damage, autoimmune diseases, infectious diseases, vascular diseases / complications such as ischemia / reperfusion injury ), The cause of the personality (eg, drug harm, radiation damage, etc.), and allergic symptoms.

In one embodiment, acute and / or chronic inflammation includes tissue inflammation. Generally, tissue inflammation is an acute and / or chronic inflammation defined as a specific tissue or organ. Thus, for example, tissue inflammation may be caused by inflammation of the skin, such as skin inflammation, muscle inflammation, tendon inflammation, ligament inflammation, bone inflammation, cartilage / joint inflammation, lung inflammation, cardiac inflammation, liver inflammation, gallbladder inflammation, pancreatic inflammation, Inflammation of the gingiva, inflammation of the esophagus, inflammation of the stomach, intestinal inflammation, anal inflammation, rectal inflammation, vascular inflammation, vaginal inflammation, uterine inflammation, testicular inflammation, penile inflammation, vulvar inflammation, neuronal inflammation, oral inflammation, , Inflammation associated with ventricular / meningeal inflammation and / or central nervous system or peripheral nervous system cells / elements.

In another embodiment, acute and / or chronic inflammation includes systemic inflammation. Although the process involved is similar if not the same as tissue inflammation, systemic inflammation is not limited to any particular tissue but rather relates to multiple sites within the body, including the epithelium, endothelium, nerve tissue, serosal surface, and organ system. If this is due to infection, the term sepsis can be used, and the term bacterialemia specifically applies to bacterial sepsis and viremia specifically refers to viral sepsis. Vasodilation and organ dysfunction are serious problems associated with extensive infections that can lead to septic shock and death.

In another embodiment, acute and / or chronic inflammation is induced by arthritis. Arthritis can be caused by, for example, osteoarthritis, rheumatoid arthritis, childhood idiopathic arthritis, vertebral arthritis such as ankylosing spondylitis, reactive arthritis (Reiter's syndrome), psoriatic arthritis, arthritic arthritis associated with inflammatory bowel disease, Inflammation of synovial membrane including Behcet disease, septic arthritis, gout (also commonly gouty arthritis, crystalline synovitis, also referred to as metabolic arthritis), caustic gout (calcium pyrophosphate deposits) and Still's disease Which involves a group of conditions involving injury to the body joints. Arthritis can affect one joint (single arthritis), two to four joints (minor arthritis), or five or more joints (multiple arthritis) and can be autoimmune disease or non-autoimmune disease.

In yet another embodiment, acute and / or chronic inflammation is induced by autoimmune disorders. Autoimmune diseases can be broadly divided into systemic and organ-specific autoimmune disorders, depending on the major clinical-pathological features of each disease. Systemic autoimmune diseases include, for example, systemic lupus erythematosus (SLE), Sjogren's syndrome, scleroderma, rheumatoid arthritis and multiple myelitis. Local autoimmune diseases can be endocrinologic (type 1 diabetes mellitus, Hashimoto's thyroiditis, Addison's disease, etc.), dermatological (pemphigus), hematologic (autoimmune hemolytic anemia), neurological (multiple sclerosis) &Lt; / RTI &gt; Types of autoimmune disorders include, but are not limited to, acute sporadic encephalomyelitis (ADEM), Addison's disease, allergies or hypersensitivity, amyotrophic lateral sclerosis (ALS), anti-phospholipid antibody syndrome (APS), arthritis, Chronic idiopathic pulmonary disease (COPD) including acute exacerbation thereof, type 1 diabetes mellitus (IDDM), chronic obstructive pulmonary disease (COPD) (including acute exacerbation thereof), autoimmune diseases such as autoimmune hepatitis, autoimmune inner ear disease, autoimmune pancreatitis, , Endometriosis, fibromyalgia, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome (GBS), Hashimoto's thyroiditis, purulent thrombocytopenia, idiopathic thrombocytopenic purpura , Inflammatory bowel disease (IBD), interstitial cystitis, lupus (including lupus erythematosus, drug-induced lupus erythematosus, lupus nephritis, neonatal lupus, subacute skin lupus erythematosus and systemic lupus erythematosus) (Multiple sclerotic encephalomyelitis), rheumatic fever, schizophrenia, rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis, rheumatoid arthritis, Psoriasis, Sjogren's syndrome, hay fever, vasculitis, and vitiligo. In one particular embodiment, acute and / or chronic inflammation is induced or otherwise induced from diabetes in a subject. In another specific embodiment, the acute and / or chronic inflammation is caused or otherwise caused by MS of the subject.

In yet another embodiment, acute and / or chronic inflammation is induced by myopathy. In general, myopathy is caused when the immune system improperly attacks the components of the muscle resulting in intramuscular inflammation. Myopathy includes, for example, inflammatory myopathy and autoimmune myopathy. Myopathy includes dermatomyositis, inclusion body myositis and multiple myositis.

In yet another embodiment, acute and / or chronic inflammation is induced by vasculitis. Vasculitis is a diverse group of disorders characterized by lymphatic vessels due to leukocyte migration and subsequent injury, and inflammation of the vascular wall including blood vessels such as veins (phlebitis), arteries (arteritis), and capillaries. Inflammation can affect blood vessels of any size anywhere in the body. This can affect arteries and / or veins. Inflammation can be focal, meaning inflammation affects a single site in the blood vessel, inflammation can be extensive, inflammation sites are scattered throughout a particular organ or tissue, or even within the body Or more. The vasculitis may be, without limitation, any of the following disorders: Crohn's disease, Crohn's disease (central nervous system vasculitis), ANCA-associated vasculitis, Churg-Strauss arteritis, Golfer's vasculitis, Henoch-Schonlein purpura, anaphylactic vasculitis (allergic vasculitis), Kawasaki disease, microalgal polyposis / multiple vasculitis (SLE) secondary to connective tissue disorders such as multiple nodular arteritis, rheumatic polymyalgia (PMR), rheumatoid vasculitis, Takayasu arteritis, Wegener's granulomatosis and systemic lupus erythematosus (SLE) Rheumatoid arthritis (RA), recurrent polychondritis, Behcet's disease or other connective tissue disorders, vasculitis secondary to viral infection.

In another embodiment, acute and / or chronic inflammation is induced by a skin disorder. Skin disorders include, for example, acne including imaginary constellation windows, vesicular pseudarthrosis, atopic dermatitis and dermatitis including acute and / or chronic radial dermatitis, atopic eczema, contact eczema, dryness eczema, Eczema such as dermatitis, sweating disorder, disk-shaped eczema, intravenous eczema, dermatitis, herpes dermatitis, neurodermatitis and eczema, and ulcerative dermatitis, diabetic dermatomy complication, purulent septic inflammation, plaques psoriasis, Skin including psoriasis, rosacea, and scleroderma, including nail psoriasis, guttate psoriasis, scalp psoriasis, inverse psoriasis, pustular psoriasis, erythrodermis psoriasis and psoriatic arthritis Sclerosis, and ulceration.

In another embodiment, acute and / or chronic inflammation is induced by gastrointestinal disorders. Gastrointestinal disorders include inflammatory bowel disease (IBD), inflammatory bowel disease such as Crohn's disease, and ulcerative colitis such as ulcerative rectalitis, left colitis, pancolitis, and fulminant colitis.

In another embodiment, acute and / or chronic inflammation is induced by cardiovascular disease. LDL cholesterol can cause an immune response when it is stuck in an arterial wall. Acute and / or chronic inflammation can ultimately cause damage to the arteries, which can rupture the arteries. In general, cardiovascular disease is any one of a number of specific diseases that affect the heart itself and / or the vascular system, particularly the veins and arteries that enter and excrete the heart. Vascular inflammation such as hypertension, endocarditis, myocarditis, heart valve dysfunction, congestive heart failure, myocardial infarction, diabetic cardiomyopathy, arteritis, phlebitis, vasculitis; Arteriosclerosis and stenosis, inflammatory heart hypertrophy, arterial occlusive diseases such as peripheral arterial disease; aneurism; embolism; Peeling; Pseudoaneurysm; Vascular malformations; Angioma; thrombosis; Thrombotic phlebitis; Varicose veins; There are over 60 types of cardiovascular disease, including stroke. Symptoms of cardiovascular disorders affecting the heart include, without limitation, chest pain or chest discomfort (angina), pain in one or both arms, left shoulder, neck, jaw or back, chills, dizziness, faster heartbeat, nausea , Abnormal heartbeat, and fatigue. Symptoms of cardiovascular disorders affecting the brain include, without limitation, sudden numbness or weakness of the face, arms or legs, particularly one side of the body, sudden confusion or difficulty in speaking or understanding the conversation, Difficulty in sight; Sudden dizziness, difficulty walking, or loss of balance or coordination, sudden and unexplained severe headache. Symptoms of cardiovascular disorders affecting the legs, pelvis, and / or arms include, without limitation, muscle aches, aches or spasms, and especially cold or stagnant legs or feet at night.

In another embodiment, acute and / or chronic inflammation is induced by the cancer. In general, inflammation regulates the microenvironment around the tumor, contributing to proliferation, survival and migration. For example, fibroplasia inflammation results in a large increase in vascular permeability which causes fibrin to pass through blood vessels. When appropriate coagulation promoting stimuli such as cancer cells are present, fibrogenous exudates are deposited. This is often observed in serous steels, where reversal of fibrofuge exudates to scarring can occur between serum membranes and limit their function. In another example, the cancer is an inflammatory cancer, such as NF- [kappa] B-driven inflammatory cancer.

In another embodiment, the acute and / or chronic inflammation is a pharmacologically-induced inflammation. Certain drugs or exogenous chemical compounds, including deficiencies of major vitamins and minerals, are known to affect inflammation. For example, vitamin A deficiency leads to increased inflammatory response, vitamin C deficiency leads to connective tissue disease, and vitamin D deficiency leads to osteoporosis. Certain pharmacological agents may cause inflammatory complications, for example, drug-induced hepatitis. Certain illegal drugs, such as cocaine and ecstasy, can exert some of their harmful effects by activating transcription factors (eg, NF-κB) that are closely related to inflammation. Radiation therapy can lead to pulmonary toxicity, burns, myocarditis, mucositis, and other tissue damage that is dependent on exposure site and dose.

In another embodiment, acute and / or chronic inflammation is induced by infection. An infectious organism can avoid immediate tissue localization through the circulatory or lymphatic system, where infectious organisms can spread to other parts of the body. If the organism is not prevented by the action of acute inflammation, it can gain access to the lymphatic system through the nearby lymphatic system. Infection of lymphatic vessels is known as lymphadenitis, and infection of lymph nodes is known as lymphadenitis. Pathogens can gain access to blood flow through lymphatic drainage into the circulatory system. Infection includes, without limitation, bacterial cystitis, bacterial encephalitis, influenza, viral encephalitis and viral hepatitis (A, B and C).

In another embodiment, acute and / or chronic inflammation is induced by tissue or organ damage. Tissue or organ damage includes, without limitation, burns, lacerations, scarring, penetration, or trauma.

In another embodiment, acute and / or chronic inflammation is induced by transplant rejection. Implant rejection occurs when the recipient's immune system attacks the implanted organ or tissue and the implanted organ or tissue is not allowed by the transplant recipient's body. Acquired immune responses, transplant rejection, are mediated by both T cell-mediated and humoral immune (antibody) mechanisms. Implant rejection can be classified as hyperactive rejection, acute rejection, or chronic rejection. Acute and / or chronic rejection of implanted organs or tissues is when the rejection is due to poorly understood acute and / or chronic inflammation and immune response to the implanted tissue. Implant rejection includes graft versus host disease (GVHD), either acute or chronic graft versus host disease (GVHD). GVHD is a common complication of allogeneic bone marrow transplantation in which functional immune cells in the transplanted marrow recognize the recipient as "foreign" and initiate an immunological attack. It may also occur during transfusion under certain circumstances. GVHD is divided into acute and chronic forms. Acute and chronic GVHD appear to involve different immune cell subsets, different cytokine profiles, and somewhat different host targets, and respond differently to therapy. In yet another embodiment, acute and / or chronic inflammation is induced by Thl-mediated inflammatory disease. In a well functioning immune system, the immune response should cause a well-coordinated inflammatory-promoting Th1 response and an anti-inflammatory Th2 response suitable for handling the immune challenge. Generally speaking, when an inflammatory-promoting Th1 response is initiated, the body relies on an anti-inflammatory response triggered by a Th2 response to counteract this Th1 response. Such an antagonistic response may, for example, result in the release of Th2 type cytokines such as IL-4, IL-5, and IL-13 associated with the promotion of IgE and eosinophilic response in atopy and IL- . Th1-mediated inflammatory diseases involve excessive inflammatory-promoting responses produced by Th1 cells that cause acute and / or chronic inflammation. Th1-mediated diseases can be induced viral, bacterially or chemically (e.g., environmentally). For example, viruses that cause Th1-mediated diseases can cause chronic or acute infections, which can cause respiratory disorders or influenza.

In another embodiment, acute and / or chronic inflammation includes acute and / or chronic neurogenic inflammation. Acute and / or chronic neurogenic inflammation is initiated and / or mediated through the release of inflammatory molecules such as SP or CGRP released from peripheral sensory nerve terminals (i. E., The centrifugal function opposite to normal afferent signaling to the vertebrae from these nerves) Or sustained inflammatory response. Acute and / or chronic neurogenic inflammation includes both primary inflammation and secondary neurogenic inflammation. Primary neurogenic inflammation refers to tissue inflammation (inflammatory symptoms) initiated by or resulting from the release of a substance from the primary sensory nerve endings (e.g., C and A-delta fibers). Secondary neurogenic inflammation is initiated by non-neurogenic sources of inflammatory mediators such as peptides or cytokines (e. G. Vascular bases such as those from mast cells or immune cells or extravasation from tissue epilepsy) Refers to tissue inflammation that stimulates the distal end to cause the release of inflammatory mediators from the nerves. The net effect of both forms of acute and / or chronic neurogenic inflammation (primary and secondary) is to have an inflammatory state maintained by the sensitization of peripheral sensory nerve fibers. The physiological consequences of acute and / or chronic neurogenic inflammation produced may include, for example, skin pain (alopecia, hyperalgesia), joint pain and / or arthritis, visceral pain and dysfunction, pulmonary dysfunction (asthma, COPD) , And bladder dysfunction (pain, hyperactive bladder).

Route of administration

Cell populations expressing E-selectin and / or L-selectin ligands can be administered to a subject according to a number of suitable routes of administration. Exemplary methods may include vascular injections, such as intravenous (iv) injections or direct transplantation of cells to a target site of a subject.

Other delivery methods may include intra-tracheal delivery, intrathecal delivery, intrathecal delivery, pulmonary delivery, buccal delivery, aerosol delivery, inhalation delivery and oral delivery. Another method is intraarterial delivery, intracerebral delivery, intestinal delivery, intracardial delivery, subcutaneous delivery, intramuscular delivery, orbital delivery, intracavitary delivery, intraspinal delivery, intraperitoneal delivery, intrasternal delivery, intravascular delivery, Transdermal delivery, transdermal delivery, vaginal delivery, rectal delivery, transurethral delivery, intradermal delivery, intraocular delivery, ear delivery, intramammary delivery, orthotopic delivery, intravaginal delivery, intralesional delivery, percutaneous delivery, endoscopic delivery, Mucosal delivery, sublingual delivery, and direct application to the body surface (e. G., Direct application to the skin surface).

The cells may be inserted into a delivery device that facilitates introduction by injection or implantation into a subject. Such a delivery device may comprise a tube, for example a catheter, for injecting cells and body fluids into the body of the recipient subject. Such a delivery device may also include an endoscopic delivery device and method. Preferably, the tube further comprises a needle, for example a syringe, which allows the cells of the invention to be introduced into the subject at the desired location.

The cells may be delivered after an operation / procedure to enhance E-selectin and / or L-selectin binding activity, or may be cryopreserved in some embodiments and then thawed prior to administration to a subject. Cells can be prepared for a variety of different forms of delivery. For example, the cells may be suspended in a solution or gel, or embedded in a support matrix when contained in such delivery devices. The cells may be mixed with a pharmaceutically acceptable carrier or diluent in which the cells of the invention remain viable. Pharmaceutically acceptable carriers and diluents include saline, aqueous buffer solutions, solvents and / or dispersing media. The use of such carriers and diluents is well known in the art. The solution is preferably a sterile fluid. Preferably, the solution is stable under the conditions of manufacture and storage and is preserved to prevent the contaminating action of microorganisms such as bacteria and fungi through the use of, for example, parabens, chlorobutanol, phenol, ascorbic acid, . Solutions may be prepared by incorporating the cells as described herein into a pharmaceutically acceptable carrier or diluent and, if desired, other ingredients followed by filter sterilization.

Intravascular delivery via needle or tube-assisted device (e.g., catheter-based) injection techniques for cell administration may also be useful for delivery across the entire vascular system or to certain organs such as the liver or kidney or any other organ Can be used to achieve the distribution. This includes nonspecific targeting of the vascular system. Alternatively, any organ can be targeted, for example, by selecting a particular injection site, such as the portal vein. Alternatively, injection into any vein in the body may be performed systemically. The method is useful for increasing the number of stem cells in older patients. In addition, the cells can function to improve organ function by resuscitating organs by establishing empty stem cells or producing new stem cells. For example, a cell can occupy a perivascular cell location in the vascular system.

In some embodiments, cells are introduced into a subject as part of a cell aggregate (e.g., pancreatic islet cell), tissue or organ, e.g., as part of an organ transplantation procedure.

Cellular transmission may also be used to target sites of active angiogenesis. For example, delivery of endothelial cells or mesenchymal stem cells or progenitor cells may promote angiogenic responses at wound sites. Targeting of angiogenesis may also be used to target drugs to tumors using cells as vehicles.

Modified cells and methods for their production

Because of its increased potency, at least in part, certain E-selectin and / or L-selectin expressing cells are useful in the methods described herein. By way of example, the cells may be used for the use of MSCs in cell-based therapies (e.g., for bone diseases) or during the regenerative therapy according to the methods described herein, the origin / stem (s) In order to direct migration or invasion of the cells, stem cell engraftment such as HSPC can be improved in clinical transplantation.

Thus, the cells used in the methods described herein express E-selectin ligand and / or L-selectin ligand. Thus, for example, after transformation, cells bind to E-selectin and / or L-selectin. In various embodiments, the modified cell may bind to P-selectin. In one particular embodiment, the cell after transformation expresses a sialofucosylated CD44 sugar form known as hematopoietic cell E- / L-selectin ligand (HCELL). In another specific embodiment, the cell expresses a neuronal cell adhesion molecule E-selectin ligand (NCAM-E) after modification. In certain embodiments, after modification, the cells express both HCELL and NCAM-E. In certain embodiments, the cells express HCELL and / or CD43-E and / or CLA. After deformation, the cells may become involved in the bone marrow and / or inflammation site in vivo.

In certain embodiments, the cells used in the methods described herein express an L-selectin ligand. In one particular embodiment, the cell after transformation expresses a strong L-selectin ligand known as a hematopoietic cell E- / L-selectin ligand (HCELL), sialofucosylated CD44 sugar form. In another embodiment, the cell expresses an increased amount of L-selectin ligand HCELL and / or PSGL-1, or an E-selectin ligand HCELL, CLA, CD43-E, NCAM-E or ESL-1. Such cells may settle to the site of inflammation through binding to E-selectin on endothelial cells or through binding to L-selectin expressed on infiltrating leukocytes in inflammatory sites.

For in vitro tailored manipulation of live cell surface glycans using glycosyltransferases, the treated cells must remain viable and the phenotype preserved after treatment (s). Already, bivalent metal-assistants such as manganese have been considered important for the enzymatic activity of α (1,3) -fucosyltransferase, and these auxiliaries have been used at apparently toxic levels (eg, 10 mM Mn ⁺⁺ ). Currently, however, these glycosyltransferases are used in the presence of relatively small amounts of bivalent metal cofactors (e. G., Divalent cations such as manganese, magnesium, calcium, zinc, cobalt or nickel) or even in the absence of such bivalent metal cofactors &Lt; / RTI &gt; In addition, these enzymes can be stored in the absence of stabilizers such as glycerol, which can be toxic to the cells themselves. The particular glycosyltransferase described in U.S. Patent No. 7,875,585 is particularly useful for glycan modification in living cells, after which the cells and / or particles or fragments thereof can be used in the methods of treatment described herein. In the application of stem cells, it is also important to analyze whether the differentiation according to the characteristic lineage is affected by the enzyme treatment.

Various methods can be used to prepare cells that bind to E-selectin and / or L-selectin.

For example, U.S. Pat. Nos. 7,875,585 and 8,084,236 provide compositions and methods for the in vitro modification of cell surface glycans in viable cells, wherein the latter ultimately results in the production of acute or chronic inflammation as described herein Can be used in treatment methods. The composition comprises a reaction buffer specially made to maintain cell viability and a purified glycosyltransferase polypeptide and physiologically acceptable solution for use with the appropriate donor nucleotide sugar in the reaction conditions. In certain preferred embodiments, the physiologically acceptable solution does not contain, or is substantially free of, bivalent metal co-factors such that cell viability is not impaired. In these and other preferred embodiments, the composition also does not contain, or is substantially free of, stabilizer compounds such as, for example, glycerol. Glycosyltransferases include, for example, fucosyltransferase, galactosyltransferase, sialyltransferase and N-acetylglucosaminyltransferase. In one embodiment, fucosyltransferase is selected from the group consisting of alpha1,3 fucosyltransferase III, alpha1,3 fucosyltransferase IV, alpha1,3 fucosyltransferase V, alpha1,3 fucosyltransferase VI, Alpha 1,3 fucosyltransferase VII or alpha 1,3 fucosyltransferase IX. The sialyltransferase may be ST3GalII, ST3GalIV or ST3GalVI.

The glycans on the surface of the cells are modified by contacting the cell population with one or more of the glycosyltransferase compositions described above. The cell is contacted with the glycosyltransferase composition along with the appropriate nucleotide per donor (e.g., GDP-fucose, CMP-sialic acid) under conditions where the glycosyltransferase has an enzymatic activity. The glycan modification according to this method is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% &Lt; / RTI &gt; In one embodiment, for example, the cells have at least 70% viability at 48 hours after treatment. In one such embodiment, for example, the cells have at least 75% viability at 48 hours after treatment. In one embodiment, for example, the cells have at least 80% viability at 48 hours after treatment. In addition, the phenotype of the cell (other than the glycan variant) is preferably preserved after treatment. By conserved phenotypes, the cell is intended to maintain its original function and / or activity. For example, when a cell is a stem cell, it has an associated totipotency or pluripotency or multipotency or unipotency, which may be its ability, that is, the characteristics of a particular stem cell type. .

Other methods of modifying cells for use in the methods of treatment described herein can be found in U.S. Patent Application Publication No. 2013/0040837. According to the method described in the above publication, a nucleic acid that specifically binds to a non-nucleic acid target (for example, an aptamer) can be immobilized on the cell membrane. Aptamers for a particular target, such as that capable of binding to a particular protein, can be selected. Thus, for example, an elliptical that binds to a cell surface receptor / adhesion molecule (eg, E-selectin, L-selectin) can be immobilized on the cell surface to improve cell targeting. Aptamers are prepared by (i) treatment of cells with sulfonated biotinyl-N-hydroxy-succinimide (NHS-biotin) (in suspension after trypsin treatment) to introduce biotin groups to the cell surface, (ii) Conjugation to the cell surface using a three-step transformation process involving conjugation with a biotinylated tyramine and complexing with a tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, tyrosine, Using this approach, Karp et al., In US 2013/0040837, show that when using this process, typically about 21,000 molecules were attached per cell and the concentration of extramammary on the cell surface And the site density was easily adjusted.

Expression of selectin binding can also be induced by the cLe addition of sLex or sLea moieties, or other oligosaccharide conjugates binding to selectin. For example, a biotin-streptavidin conjugate can be used to conjugate sialyl-Lewis &lt; RTI ID = 0.0 &gt; ^X The moiety was chemically incorporated onto the cell surface. More specifically, the cell surface was biotinylated by allowing the free amine group present on the surface of the cells to react with the N-hydroxy-succinimide group of biotinyl-N-hydroxy-succinimide. Following this step, the biotin moiety of the cell surface was subsequently reacted with the streptavidin molecule. The strong interaction between biotin and streptavidin allows the streptavidin molecule to be immobilized on the cell surface. Streptavidin is then reacted with biotinylated SLeX (sialyl-Lex-PAA-biotin) to introduce SLeX onto the cell surface.

In an alternative approach to the glycan manipulation of cell surfaces, see, for example, Srivastava et al., J. Biol. Chem. 1992, 267: 22356-22361, fucosyltransferases are used to incorporate a total assembly of sLex or sLea glycans into the cell surface. More specifically, Srivastava et al. Have reported that partially purified Le-FucT from human breast milk, using GDP-fucose as a donor for the delivery of single fucose residues, But also the fucosyl moiety substituted at C-6. Therefore, in order to increase the level of expression of E- selectin ligand and / or L- selectin ligand on the surface of these cell populations to levels greater than the expression level of the original cell population using the Foucault room transferase sialyl-Lewis ^X Such as glycans.

In other embodiments, sLex or sLea glycans (which may be produced, for example, by phage display techniques) using a variety of difunctional chemical linkers, or glycomimetics of sLex or sLea, or peptidomimetics of sLex or sLea It is possible to share the metal. Likewise, a mAb or a mAb fragment that binds to E-selectin and / or L-selectin can be conjugated to the cell surface to enhance binding to E-selectin and / or L-selectin, respectively.

In addition to the foregoing, any other method of modifying cells or cells expressing E-selectin ligand and / or L-selectin ligand may be used. This includes, for example, promoting covalent and / or non-covalent interactions, hydrogen bonding and / or van der Waals forces between the cell surface and the ligand, phage display product, and the like.

In general, any type of cell can be transformed and used in the methods of treatment described herein. For animal use, the cells are preferably of animal origin, while in the case of human use the cells are preferably human cells; In each case, an autologous cell source can be used, a winter cell source can be used, a homologous cell source can be used (including combinations of allogeneic donor cells in a given cell population), a heterologous cell source can be used have. The cell may be a primary cell, for example, a primary hepatocyte, a primary neuron, a primary myoblast, a primary mesenchymal stem cell, a primary origin cell, or an established cell line or a cell of a culture-proliferated cell (E. G., T cells, dendritic cells, etc.). Cells do not have to undergo cell division; Finally, differentiated cells can be used in the methods described herein. In this context, the cells may be embryonic stem cells, adult stem cells, induced pluripotent stem cells, blood origin cells, tissue origin cells, epithelium, endothelium, nerve, fat, heart, skeletal muscle, Lymphocytes, such as dendritic cells, monocytes, macrophages, leukocytes (e.g., lymphocytes such as B-lymphocytes, T-lymphocytes, or a subset of T-lymphocytes such as regulatory lymphocytes (CD4 ⁺ / CD25 ⁺ / FOXP3 ⁺ )) , Naive T cells, central memory T cells, effector memory T cells, effector T cells, NK cells), liver, spleen, lung, circulating blood cells, platelets, germ cells, gastrointestinal cells, , Cardiac cells, endothelial cells, endocrine cells, skin cells, muscle cells, nerve cells, and pancreatic cells. The cell can be a cell line, a stem cell, such as a mesenchymal stem cell , Hematopoietic stem cells, tissue stem / Stem cells, embryonic stem cells or embryonic stem cells, or the brain, liver, lung, rectum, or endometrium. The term &quot; progenitor cell &quot; But may be primary cells isolated from any tissue including, but not limited to, stomach, liver, muscle, testes, uterus, ovary, skin, spleen, endocrine organ and bone.

If the cells are maintained under in vitro conditions, conventional tissue culture conditions and methods can be used and are known to those skilled in the art. Methods for isolating and culturing various cells are within the knowledge of those skilled in the art.

In addition, both the xenogeneic cell population and allogeneic cell population are contemplated for use in the methods and compositions described herein. It is also possible to administer the cells in an injectable delivery vehicle such as an aggregate of cells, particles adhered to particles or encapsulated in particles, hydrogels, and tissues attached to an implantable substrate (including a scaffold) or having a scaffold / It is contemplated that the applied cells may be used in the methods and compositions described herein. In addition, cells may be used in conjunction with tissue proliferators / enhancers and / or anti-inflammatory agents such as growth factors, cytokines, prostaglandins, nutritional agents, resorcin, NSAIDS, steroids,

The present invention further encompasses the embodiments enumerated below.

Embodiment 1. A method of promoting and / or delivering a cell to a target tissue of a subject, comprising administering to the subject a population of cells expressing an E-selectin ligand and / or an L-selectin ligand, A method of promoting colonization, said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, said cell administration comprising administering to said endothelial cells an E -Selective expression and / or consistent with leukocyte accumulation within said target tissue.

Embodiment 2. A method of treating a disease, disorder or medical condition that manifests as an inflamed tissue and / or a damaged tissue in a subject, comprising administering to the subject a population of cells expressing the E-selectin ligand and / or L-selectin ligand In a method of treatment, the population expresses an E-selectin ligand and / or an L-selectin ligand at a level that exceeds the level of expression of the native cell population, and wherein said cell administration is an E-selectin expression on endothelial cells in said target tissue Or colonization in injured tissue and / or damaged tissue, which occurs in agreement with, and / or consistent with, leukocyte accumulation within said target tissue, said population being enhanced compared to the original population of cells to which it has been administered .

Embodiment 3. A population of cells expressing an E-selectin ligand and / or an L-selectin ligand may be administered to a subject via vascular delivery and / or direct tissue injection (i.e., directly into the affected tissue (s)) and / (I. E., Placed into a diseased tissue) into and / or into the intrathecal and / or intracardiac bladder and / or anatomical ducts (biliary tract, urinary and / or the like) To a target tissue, said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, In combination with E-selectin expression on the endothelial cells in the target tissue and / or consistent with leukocyte accumulation within the target tissue, wherein the administered cell population is an enhanced promoter, colonization And engrafting.

Embodiment 4. A population of cells expressing an E-selectin ligand and / or an L-selectin ligand is administered directly to the inflamed and / or damaged tissue of the subject, or to the inflamed tissue and / A method of promoting cell delivery and colony formation in an inflamed and / or damaged tissue of a subject, comprising: disposing the E-selectin ligand and / or E-selectin ligand at a level that exceeds the expression level of the native cell population, / Or L-selectin ligand, wherein said injection / placement occurs in agreement with E-selectin expression on endothelial cells in said target tissue and / or consistent with leukocyte accumulation within said target tissue.

Embodiment 5. A method of promoting cell transfer, colony formation, and / or engraftment to a target tissue of a subject, comprising administering a population of cells expressing an E-selectin ligand and / or L-selectin ligand via the vasculature of the subject , Said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, said administration being performed in accordance with E-selectin expression on endothelial cells in said target tissue and / Or coinciding with leukocyte accumulation in the target tissue.

Embodiment 6. The method of claim 1, wherein the cell population expressing the E-selectin ligand and / or L-selectin ligand is introduced into the target tissue by direct injection or placement on the target tissue, And / or L-selectin ligand, wherein said population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, -Electin expression and / or consistent with leukocyte accumulation within the target tissue, said group achieving enhanced target tissue colony formation relative to the original cell population.

Embodiment 7. A method of treating a disease, disorder or medical condition that manifests as inflamed tissue and / or damaged tissue in a subject, comprising administering to the subject a population of cells expressing an E-selectin ligand and / or L-selectin ligand , Said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the original population of cells, said injection comprising an E-selectin ligand and / And / or coincides with leukocyte accumulation within the inflamed tissue and / or damaged tissue.

Embodiment 8. A method of treating a tumor / malignant disease comprising administering to a subject a population of cells expressing an E-selectin ligand and / or an L-selectin ligand, said population comprising (S) on the endothelial cells in the tissue (s) carrying the tumor / malignant cells, and / or in combination with E / selectin ligand and / or tumor / malignant cells In association with leukocyte accumulation within the retaining tissue (s).

Embodiment 9. A population of cells expressing an E-selectin ligand and / or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a disease, disorder or medical condition that manifests as inflamed tissue and / or damaged tissue in a subject, Comprising administering to a subject a population of cells expressing an E-selectin ligand and / or L-selectin ligand, wherein said population is an E-selectin ligand and / or an E-selectin ligand at a level that exceeds the expression level of the original population of cells. L-selectin ligand and said treatment is performed in accordance with E-selectin expression on endothelial cells in inflamed tissue and / or damaged tissue and / or in accordance with leukocyte accumulation in inflamed tissue and / or damaged tissue and / / RTI &gt; and / or &lt; RTI ID = 0.0 &gt; inflammatory &lt; / RTI &gt; tissue and / However.

Embodiment 10. A population of cells expressing an E-selectin ligand and / or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor / malignant disease, wherein said treatment comprises expressing an E-selectin ligand and / Comprising administering to a subject a population of cells that express E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the original cell population, Comprising the step of administering the population in accordance with E-selectin expression on endothelial cells in the tumor / malignant tissue and / or consistent with leukocyte accumulation within the tumor / malignant tissue.

Embodiment 11. A method or population as in any one of embodiments 1 to 10, wherein said cell administration occurs in concert with E-selectin expression on endothelial cells and invasion of E-selectin-bearing leukocytes in target tissue.

12. The method or group of any one of embodiments 1-11, wherein said administration / injection occurs during leukocyte infiltration into one / said inflamed tissue and / or damaged tissue.

Embodiment 13. A method or population as in any one of embodiments 1-12, further comprising engaging said group of administered cells in an environment of one / said inflamed tissue and / or damaged tissue.

Embodiment 14. The method or group of any one of embodiments 1-13, wherein the immunomodulatory effect is achieved by colonizing one or more cells in the inflamed tissue and / or damaged tissue.

15. The method or group of any one of embodiments 1-14, wherein the tissue repair effect is achieved by colonizing one or more of the tissues in which the inflammation has occurred and / or the cells administered in the injured tissue.

Embodiment 16. The method of any one of embodiments 1-15, wherein an enhanced host defense / immune response effect is achieved by the delivery and colonyisation of one / said infected tissue and / or the administered cells in the injured tissue , Method or group.

Embodiment 17. The method or group of any one of embodiments 1-16, wherein the anti-malignant tumor effect is achieved by colonizing of one of the administered cells in the tumor / malignant tissue site.

Embodiment 18. The method or cluster of any one of embodiments 1-17, wherein said administration / injection comprises one or a series of injections of said cell population.

Embodiment 19. The method of any one of embodiments 1-18, wherein said administration / injection comprises one day, once a week, once every two weeks, once a month, or once a year, Method or group.

Embodiment 20. The method or group of any one of embodiments 1 to 9, further comprising one or more additional doses / injections at a reduction in the immunomodulatory effect of the previous dose / injection in the subject.

Embodiment 21. The method or group of any one of embodiments 1 to 20, wherein said population of cells is administered / injected intravenously.

Embodiment 22. The method or group of any one of embodiments 1-21, wherein said population of cells is administered by direct injection into the inflamed tissue and / or damaged tissue.

Embodiment 23: A method or a population according to any one of embodiments 1-21, wherein the population of cells is placed on the inflamed tissue and / or the damaged tissue.

24. The method or group of any one of embodiments 1-21, wherein said population of cells is placed on one / said inflamed tissue and / or damaged tissue.

Embodiment 25. The method or group of any one of embodiments 1-21, wherein said population of cells is used in combination with other enhancing agents, anti-inflammatory agents, or tissue scaffolds / implantable devices / gels.

Embodiment 26. A method or population according to any one of embodiments 1-25, wherein said cell population expresses E-selectin ligand and L-selectin ligand.

27. The method of any one of embodiments 1-26 wherein the E-selectin ligand and / or the L-selectin ligand is selected from the group consisting of hematopoietic cell E- / L-selectin ligand (HCELL), neuronal cell adhesion molecule E-selectin ligand -E), CD43E, CLA and ESL-1.

28. The method of any one of embodiments 1-27 wherein the E-selectin ligand is a hematopoietic cell E- / L-selectin ligand (HCELL) and / or a neuronal cell adhesion molecule E-selectin ligand (NCAM-E) Method or group.

Embodiment 29. A method or a population according to any one of embodiments 1-28, wherein the E-selectin ligand is HCELL.

Embodiment 30. The method or group of any one of embodiments 1-29, wherein the E-selectin ligand is NCAM-E.

Embodiment 31. A method or a population as in any one of embodiments 1-30, wherein the L-selectin ligand is HCELL.

32. The method of any one of embodiments 1 to 31 wherein said cell population is selected from the group consisting of epithelium, endothelium, nerve, fat, heart, skeletal muscle, fibroblast and immune cells (e.g. dendritic cells, monocytes, macrophages, (For example, a subset of T-lymphocytes such as NK cells, B-lymphocytes, lymphocytes such as T-lymphocytes or regulatory lymphocytes (CD4 ⁺ / CD25 ⁺ / FOXP3 ⁺ ), cytotoxic lymphocytes, etc.) (For example, mesenchymal stem cells, hematopoietic stem cells, tissue stem / progenitor cells (e. G., Stem cells, Derived stem cells or derived pluripotent stem cells or stem cells derived from differentiated stem cells derived from embryonic stem cells or derived pluripotent stem cells, Cell, or adult line Isolated from a differentiated source cell derived from a cell or from any tissue (e.g., brain, liver, lung, bowel, stomach, fat, muscle, testis, uterus, ovary, skin, spleen, endocrine organ and bone) A primary cell, or a culture-proliferated population of primary cells, or a culture-proliferated stem cell population, or a culture-proliferated primary cell population.

Embodiment 33. A method or group according to any one of embodiments 1 to 32, wherein said cell population is mesenchymal stem cells, hematopoietic stem cells, tissue stem / origin cells, umbilical cord stem cells or embryonic stem cells.

34. The method of any one of embodiments 1-33, wherein said population of cells is selected from the group consisting of leukocytes (e.g., NK cells, B-lymphocytes, lymphocytes such as T-lymphocytes, or regulatory lymphocytes (CD4 ⁺ / CD25 ⁺ / FOXP3 ⁺ )), Cytotoxic T cells, etc.).

35. The method of any one of embodiments 1-34, wherein said disease, disorder or medical condition is selected from the group consisting of direct tissue injury (e.g. burns, trauma, bed sores, etc.), ischemic / vascular events (e.g., myocardial infarction, stroke, (Eg breast cancer, lung cancer, prostate cancer, lymphoma, leukemia, etc.), immunological / autoimmune disease (eg, (Eg, osteoarthritis, osteoarthritis, Alzheimer's disease, etc.), congenital / hereditary diseases (eg, osteoporosis, osteoarthritis, Toxic effects (eg, drug-induced hepatitis, drug-induced cardiac damage, etc.), toxic damage (eg, radiation exposure (s), chemical Exposure (s), Alcoholic Hepatitis, Alcoholic Pancreatitis, Al (Eg, radiation-induced tissue damage, surgery-related complications, etc.), and / or idiopathic processes (eg, coronary heart disease, cocaine cardiomyopathy, etc.), metabolic disturbances : Amyotrophic lateral sclerosis, Farsonage-Turner syndrome, etc.).

Embodiment 36. A method or a population according to any one of embodiments 1-35, wherein the disease, disorder or medical condition is diabetes.

Embodiment 37. A method or population according to any one of embodiments 1-36, wherein said disease, disorder or medical condition is multiple sclerosis.

Embodiment 38. The method of any one of embodiments 1-37, wherein the subject is a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse or a swine, a method or a group.

Embodiment 39. A method or group as in any one of embodiments 1-38, wherein the subject is a human patient.

Embodiment 40. The method of any one of embodiments 1-39, wherein said cell population is treated to form a modified cell population having enhanced expression of E-selectin and / or L-selectin ligand, With a viability of at least 70% after 24 hours.

Embodiment 41. A method or population as in any one of embodiments 1-40, wherein said population of cells has at least 80% viability at 24 hours after treatment.

Embodiment 42. A method or population as in any one of embodiments 1-40, wherein said population of cells has at least 70% viability at 48 hours after treatment.

Embodiment 43. A method or population according to any one of embodiments 1 to 42, wherein said population of cells is colonized within a tissue comprising invasive leukocytes when said population of cells is administered to a subject.

Embodiment 44. A method or group of Embodiment 43 wherein said administration is direct injection into tissue or placement into tissue.

Embodiment 45. A method or group of Embodiment 43 wherein the administration is vascular administration.

Embodiment 46. A method or population according to any one of embodiments 1-21 or 25-42 wherein said population is administered systemically via peripheral vascular access or central vascular access.

Embodiment 47. A method according to any of embodiments 1-21 or 25-42, wherein said population uses a catheter-based approach or other vascular access device capable of delivering the vascular bolus of a cell to the intended site Wherein the anatomical supply vessels are intravascularly administered to the intended tissue site.

Embodiment 48. A method or a population according to any one of embodiments 1-21 or 25-42 wherein said population is administered by introduction into the spinal canal and / or into the brain.

Embodiment 49. A method or a population according to any one of embodiments 1-21 or 25-42 wherein said population is administered directly into the body cavity by a catheter-based approach or by direct injection.

50. Embodiment 50. The method of any one of embodiments 1-21 or 25-42 wherein said population is administered by direct topical injection using an intravascular approach or transdermal approach or directly into anatomically accessible tissue site / RTI &gt; and / or administered under the guidance of imaging techniques.

Embodiment 51. A method or a population according to any one of embodiments 1-21 or 25-42 wherein said population is administered by direct placement at the relevant tissue surface / site.

Embodiment 52. The combination of any one of embodiments 1-21 or 25-42, wherein said population is implanted in a scaffold administered into a scaffold or placed into a tissue and / or administered in a gel and / or administered with an enhancer, Method or group.

Embodiment 53. A method or a population according to any one of embodiments 1-21 or 25-42 wherein said population is administered into cerebrospinal fluid.

Although the invention has been described in detail, it will be apparent that modifications and variations are possible without departing from the scope of the invention as defined in the appended claims. In addition, it should be understood that all examples of the invention are provided as non-limiting examples.

Example

The following non-limiting examples are provided to further illustrate the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent approaches that have been found to function well in the practice of the invention by the inventors and therefore can be considered to constitute examples of the manner in which they are carried out. . However, it should be understood by those skilled in the art that many changes in light of the present disclosure can be made in the specific embodiments disclosed and still obtain the same or similar results without departing from the scope of the invention.

Example 1: Alpha (1,3) -fucosyltransferase treatment of adipose-derived mesenchymal stem cells enhances the expression of HCELL

Previous studies have shown that bone marrow-derived mesenchymal stem cells (MSC) can be glycan manipulated by? (1,3) -fucosyltransferase to generate potent E-selectin and L-selectin ligand HCELL (R Sackstein et al, Nature Medicine 14: 181-187 (2008)). To determine whether HCELL expression could be enhanced in MSCs derived from non-bone marrow sources, we analyzed the effect of [alpha] (1,3) -exofucosylation on fat-derived mesenchymal stem cells . To this end, adipose tissue was obtained from the liposuction material of both dried and obese subjects, and mesenchymal stem cells were cultured as described (R Sackstein et al., Nature Medicine 14: 181-187 (2008)). Normal oxygen (21% O ₂₎ the cell condition and the low-oxygen (<5% O ₂₎ conditions, both from FBS (20% FBS and 1% penicillin / streptomycin mayisinreul containing a DMEM) or human platelet lysate (5% human platelets for (DMEM containing lysis and 1% penicillin / streptomycin) was grown to low density (confluence < 60%) in supplemented MSC medium. When confluence reached 60%, MSCs were subcultured and MSCs were collected in passages 3-6. MSC (20 × 10 ⁶ / ml) was then added to the Hanks equilibrium free of divalent cations containing 10 mM HEPES, 0.1% human serum albumin and 1 mM GDP-fucose (Sigma) Ml of Fucosyltransferase VII (FTVII; in a suspension of R & D Systems, without divalent cation) or fucosyltransferase VI (60 mU / ml) at 20 ug / ml in Hank's balanced salt solution (HBSS) The control cells (buffer-treated) were treated with the same buffer without FTVII or without FTVI. Cell viability was assayed in the presence of iodinated propidium and &lt; RTI ID = 0.0 &gt; Cell viability was consistently above 80% at 24 hours after [alpha] (l, 3) -exofucosylation with FTVI or FTVII. Figure 24 26 .

Example 2: Alpha (1,3) -fucosyltransferase treatment of human blood leukocytes induces high levels of E-selectin ligand activity in cells and enhances the expression of HCELL.

Enhanced expression of E-selectin ligands (i. E., HCELL and other E-selectin ligands) on the surface of the desired cells (e. G., Stem cells, origin cells, leukocytes, etc.) On the basis of vascular E-selectin expression at the site of tumor inflammation / injury and tumor / cancer infiltrate. In addition, the administered cells can accumulate in the peri-vascular region through E-selectin ligand attachment to E-selectin expressed in endothelial cells, and the administered cells can also be used to treat inflammatory / damaged or invasive leukocyte surfaces (Or other enhanced E-selectin / L-selectin ligand) expression at the relevant administered cell surface, once ex vascularized, can be inhibited by targeting the L-selectin ligand to the target And may act to promote colonization of the administered cells within the tissue. Thus, stem cell / source cells and specific leukocyte subsets (such as NK cells, CD4 T cells, CD8 T cells, Tregs, monocytes, dendritic cells and granulocytes, as well as related The expression of HCELL and other E-selectin ligands and / or L-selectin ligands in leukocytes (including, for example, antigen-specific T cells, proliferating NK cells, chimeric antigen receptor T cells (CAR T cells) Strengthening can be utilized in adoptive cell therapy (for tissue regeneration / restoration and / or for immunotherapy to increase immunity or decrease immunity). Thus, crucially, the enhanced expression of HCELL allows efficient delivery of intravascularly administered cells to the target site by E-selectin-dependent endothelial interaction, resulting in the recruitment of blood-derived cells, followed by the release of extravasated cells Selectin-mediated and L-selectin-mediated fixation for distinct tissue microenvironment. In addition, similarly, enhanced expression of HCELL and other E-selectin / L-selectin ligands, even when these cells are injected directly into the affected tissue injury / damage site (s) or cancer site, Selectin-mediated and L-selectin-mediated colonization.

To analyze the effect of exofucosylation on the molecular targets of cell surface alpha (1,3) -exofucosylation and leucocyte E-selectin and L-selectin ligand activity, the primary human peripheral blood obtained from citrated whole blood Studies on leukocytes were performed. Leukocytes were separated into mononuclear cells (CD14 + cells), CD4 + lymphocytes, CD8 + lymphocytes and B cells (CD19 + cells) by immuno magnetic bead separation method (Miltenyi). Cells were incubated at 20 &lt; RTI ID = 0.0 &gt; g / ml &lt; / RTI &gt; in Hank's balanced salt solution (HBSS) without divalent cations containing 10 mM HEPES, 0.1% human serum albumin and 1 mM GDP-fucose (R Sackstein et al., Nature Medicine 14: 181-187 (2008)), or fucosyltransferase VI (FTVII; manufactured by R & D Systems, ), Whereas control cells (buffer-treated) were treated with the same buffer without FTVII or without FTVII. Cell viability was routinely evaluated by dual laser flow cytometry using iodidated propidium and Annexin V staining. Cell viability was consistently above 80% at 24 hours after exofucosylation using FTVI or FTVII. 27 (A) to 27 (C) and Figs. 28A to 28C .

Example  3: Alpha (1,3) - &lt; RTI ID = 0.0 &gt; Fucosyltransferase  Lt; RTI ID = 0.0 &gt; E- Selectin Ligand  Inducing activity HCELL &Lt; / RTI &gt;

In order to evaluate the ability of? (1,3) -exofucosylation to modulate the E-selectin and L-selectin ligand activities of human dendritic cells, anti-CD14 coated magnetic beads (Miltenyi Biotech) Monocyte-derived dendritic cells &lt; RTI ID = 0.0 &gt; (mo) &lt; / RTI &gt; were cultured for 6 days with cytokine IL-4 and GM- -DC). &Lt; / RTI &gt; Monocyte purity was assessed by flow cytometry for expression of CD14 and the differentiation and maturation of mo-DCs were assessed by staining for expression of BDCA-1, HLA-DR, CD80 and CD86 (BD Biosciences, respectively). The Mo-DCs were then incubated in each case for 20 min at 37 [deg.] C in Hank's balanced salt solution (HBSS) without divalent cations containing 10 mM HEPES, 0.1% human serum albumin and 1 mM GDP-fucose Fucosyltransferase VII (FTVII; manufactured by R & D Systems, in the absence of divalent cation) or fucosyltransferase VI (at 60 mU / ml (R Sackstein et al., Nature Medicine 14: 181-187 (2008))), whereas control cells (buffer-treated) were treated with the same buffer without FTVII or without FTVI. Cell viability was routinely evaluated by dual laser flow cytometry using iodidated propidium and Annexin V staining. Cell viability was consistently above 80% at 24 hours after exofucosylation using FTVI or FTVII. 29 (A) to 29 (C) and 30 (A) to 30 (E) .

Example 4: Alpha (1,3) -fucosyltransferase treatment of primary cultures of human regulatory T cells (Treg) induces a high level of E-selectin ligand activity and enhances the expression of HCELL in these cells; Administration HCELL + Treg inhibits heterologous GVHD induced by autologous cells.

The ability to enhance the delivery of immunomodulatory cells (such as MSCs and Tregs) to the site of inflammation can reduce tissue damage in immunological diseases such as GVHD, rheumatoid arthritis, etc. and infections such as sepsis, To improve the potential of adoptive cell therapy. To this end, we investigated the effect of [alpha] (1,3) -exofucosylation on the ability of intravascularly administered primary human Tregs to treat xenograft versus host disease in a human-murine GVHD model. Since this strategy can be associated with clinical hematopoietic stem cell transplantation (ie, Tregs can be propagated from donor hematopoietic / immune cell inoculations and thus donor Tregs can be used to treat GVHD induced by donor immune cells ), We sought to assess the ability of Tregs derived from autologous lymphocyte sources to induce GVHD. For this, whole blood of healthy human donors was subjected to Ficoll gradient centrifugation to obtain peripheral blood mononuclear cells (PBMC). CD4-high / CD127-low T cells were isolated using a negative selection autoimmune bead system (Miltenyi) and propagated in culture in the presence of IL-2 supplemented anti-CD3 / anti-CD28 mAb to produce CD4 + / FoxP3 + / CD25 + cells (Treg). Differential PBMCs from the same donor were injected intraperitoneally (10 ⁷ cells / mouse) into NSG host mice. The proliferated Treg cells were harvested after 14 days of injection (and therefore on day 14 of Treg proliferation) and then incubated with 10 mM HEPES, 0.1% human serum albumin and 1 mM GDP-fucose (Sigma (FTVII; manufactured by R & D Systems, Inc. in a suspension without bivalent cation) or fucosyltransferase VI (20 μg / ml) in Hank's balanced salt solution (HBSS) (buffer-treated) were treated with the same buffer without FTVII or with FTVI (cell viability was maintained at &lt; RTI ID = 0.0 &gt; Were routinely evaluated by dual laser flow cytometry using iodidopropylidium and Annexin V staining; cell viability was consistently above 80% at 24 hours after Fructosylation with FTVI or FTVII. Then, a mouse buffer solution were injected at a dose of the blood vessel treated (BT) Treg or exo Foucault misfire of Treg 2.5 × 10 ⁵ cells / mouse. The mice were then followed clinically and the mouse body weight was monitored for 50 days after the initial PBMC injection. The data shown in the figure show that FTVII treatment of human Treg induces the expression of E-selectin ligand comprising HCELL. Injection of exofucosylated autologous Tregs into mice with heterologous GVHD (induced by previous administration of autologous PBMC) results in a reduction in GVHD, as evidenced by the reversal of weight loss; The exo fucosylated Treg is three times more potent than the nonfucosylated Treg in reversing GVHD. See Figures 31-34 .

Example 5: Alpha (l, 3) -fucosyltransferase treatment of MSCs and human blood leukocytes resulted in L-selectin ligand activity in these cells as assessed by stamper-woodruff lymphocyte adhesion assays .

Stamperwood rough lymphocyte adhesion assays are a common tool for evaluating L-selectin ligand activity (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)). The assays, designed in the 1970s to assess the molecular basis of lymphocyte binding to the lymph node high endothelial venule, are based on the surface of L-selectin-native lymphocytes - native to the surface of living lymphocytes - To measure the ability to attach to the expressed ligand (s) thereof. The assay is carried out under rotational shear conditions that impose distinct biophysical constraints on binding interactions: only the most potent L-selectin ligands (presented on the surface of the cells attached to the glass) are the L-selectin presented in the spin suspension of the lymphocytes Lt; / RTI &gt; Indeed, the only L-selectin ligands strong enough to support the L-selectin-mediated binding of lymphocytes in the assay are HCELL and "endothelial" L-selectin ligands presented on the lymph node high endothelial cleavage (Collectively referred to as "addressin") (R. Sackstein, Immunol. Rev. 230: 140-163 (2009)).

In order to evaluate the expression of L-selectin ligand activity induced by? (1,3) -exofucosylation, the stamper-woodruff was incubated with native cells, buffer-treated cells and? (1,3) Lt; RTI ID = 0.0 &gt; cytosine &lt; / RTI &gt; Briefly, a lymphocyte suspension (10 ⁷ / ml lymphocytes in RPMI 1640 medium) prepared from human blood was overlaid on a glass slide containing the preparation of the relevant cells placed on the slide by cell centrifugation. Slides were placed on a rotating platform for incubation at 4 [deg.] C for 30 minutes under shear conditions. The slides were then rinsed with PBS to remove unattached lymphocytes, fixed in 3% glutaraldehyde and stained with methyl green-thionine. Slides were examined for lymphocyte adhesion to cell centrifuged cells by light microscopy. Selectin ligand activity was measured by counting the number of lymphocytes attached to the confluent region of cell-centrifuged cells using an ocular grid under a 250X magnification. Cell centrifuged cells with attached lymphocytes are scored and the proportion of these cells in the lawn of cell centrifuged cells is quantified (as shown in the symbolic description in Table 1 below).

As shown in Table 1 , although the native MSC does not have L-selectin binding activity, the [alpha] (1,3) -exofucosylation of MSC induces significant L-selectin binding activity and the L-selectin-mediated lymphocyte binding Were essentially observed in all exo fucosylated cells. Although human CD4 T cells, human monocytes and human dendritic cells each exhibit an L-selectin binding activity which is not large, these cells support strong L-mediated lymphocyte adhesion after [alpha] (1,3) -exofucosylation. Although human Treg, B cells and CD8 cells do not inherently have L-selectin ligand activity, each cell type can be induced to bind L-selectin by? (1,3) -exofucosylation, Triggered Tregs show a significant increase in L-selectin adhesion. Thus, L-selectin binding is promoted essentially in all human leukocytes after alpha (l, 3) -exofucosylation, particularly L-selectin ligand activity is reduced by alpha (1,3) -exofucosylation to human MSC, CD4 T cells, monocytes, dendritic cells, and Tregs. In each case, this L-selectin binding activity reflects enhanced HCELL expression and is shown in Figures 25, 28a to 28c, 30 (A) to 30 (E) lt; RTI ID = 0.0 &gt; HCELL &lt; / RTI &gt; expression in these cells as shown by Western blot data staining for sLex / E-Ig.

Example 6 - HCELL expression in murine MSC allows pancreatotropism in NOD mice and confer sustained reversal of autoimmune diabetes.

Introduction

Despite considerable advances in hyperglycemia-controlled drug therapy, type 1 diabetes (T1D) is still associated with significant morbidity and mortality, and continues to place significant public health burdens, requiring a breakthrough treatment strategy [1, 2]. Cell-based immunomodulation therapy has emerged as a promising approach in the treatment of T1D [3]. Mesenchymal stem cells (MSCs) have become the fastest growing cell therapy for the treatment of various refractory immune-mediated diseases including T1D due to their immunomodulatory properties, stability profile, easy acquisition and strong in vitro proliferation [4 7]. In preclinical models using NOD mice, we and others have recently reported that systemically administered MSCs have utility in reducing autoimmune diabetes [8-13]. However, the benefits of MSC therapy in reversing hyperglycemia were temporary, highlighting the urgent need to develop strategies to improve the effectiveness of MSC-based therapies for T1D [6].

The efficacy of immunomodulating cell therapy is closely related to the ability of injected cells to migrate to inflamed tissue [14,15]. In some organs (such as the heart), direct (local) injection of cells into the affected site can achieve colony formation necessary for physiological gain [16]. However, in the treatment of T1D, the vascular pathway of cell transfer is mandatory, since direct injection of cells into the pancreatic parenchyma can trigger the release of proteases and other enzymes that can lead to life-threatening considerable pancreatic inflammation . The migration of blood-derived cells to tissue is initiated by temporary attachment / rotation attachment interaction in the target tissue endothelium. The most potent mediators of these binding interactions are the three Ca ⁺⁺ -dependent lectins (E-, P- and L-selectin, CD62E, &lt; RTI ID = 0.0 &gt; CD62P and CD62L) [17]. Importantly, E-selectin, a selectin in the microvessel system of all inflammatory sites, is expressed in response to inflammatory cytokines such as TNF-α [17,18]. E-selectin binds to membrane glycoproteins and / or glycolipids on circulating cells that circularly present sialofucosylated tetrasaccharides known as "sialylated Lewis X" (sLex). However, MSCs do not naturally express E-selectin ligands [19]. This transport defect is limiting the usefulness of MSC-based therapies by restricting MSC engraftment in inflamed peripheral tissues after intravenous administration [17,20]. Thus, the present inventors have found that MSC transport to the inflamed pancreas can be enhanced by cell surface glycan modification to enhance E-selectin ligand expression, and that this is why MSC treatment effect (s) in NOD mouse new- And to investigate whether or not it could affect the quality of life. The findings of the present inventors show that the biologic effect of MSC effect in diabetes, which emphasizes the unique and important role of enhanced expression of E-selectin ligand HCELL in enhancing the ability of murine MSC to reverse hyperglycemia in diabetic NOD mice Provide new insights.

Materials and methods

mouse

C57BL / 6, B6.129 (Cg) -Cd44 tm1Hbg / J (CD57BL / 6 CD44 under genetic background ^{- / -;} CD44- knockout (knock out) ( "CD44- KO")), BALB / c and NOD Mice were purchased from Jackson Laboratories and housed and / or housed in the pathogen-free environment of Harvard Medical School's Animal Care and Housing facility. Experiments requiring mouse use were approved by the Institutional Animal Care and Use Committee.

MSC culture

The bone marrow MSCs were derived as previously described [9, 10]. Briefly, bone marrow cells isolated from C57BL / 6 (wild type) or from CD44-KO mice were treated with 10% fetal bovine serum (Lonza), 10 ng / ml fibroblast growth factor (PeproTech), 100 U / ml penicillin And inoculated into a culture medium consisting of Dulbecco's Modified Eagle Medium containing 100 [mu] g / ml streptomycin (Gibco). MSCs in cultures of passages 4 to 6 were used for the experiments.

Identification and differentiation of MSC

MSCs were characterized by flow cytometry using relevant isotype controls with anti-mouse antibodies directed against cell surface markers Sca1, CD44, CD73, CD45, CD29 and CD105 (all from eBioscience). Recombinant mouse E-selectin (CD62E) -human Fc chimera was purchased from R & D Systems. MSCs were tested for their ability to differentiate into various mesodermal systems as previously described [21,22]. Briefly, chondrocyte differentiation of MSCs was induced in culture medium with ascorbic acid (50 μg / ml) and TGFβ1 (1 ng / ml). After incubation for 3 weeks, the plates were washed with PBS, fixed with 4% paraformaldehyde and stained with 0.05% Alcian blue for visualization of the cartilage by light microscopy. Bone genetic differentiation was induced in culture medium using ascorbic acid (50 占 퐂 / ml), sodium? -Glycerophosphate (10 mM) and dexamethasone (10 nM). After 2 weeks, the plates were washed and fixed with 4% paraformaldehyde and stained with 2% Alizarin Red for visualization of characteristic calcium deposits. Fatty differentiation was induced by addition of dexamethasone (100 nM) and insulin (6 ng / ml) in F12 medium supplemented with 1% fetal bovine serum, 1% glutamine, 1% penicillin-streptomycin. Cells were fixed in 4% paraformaldehyde and stained with a 0.3% oil red solution in 60% isopropanol to evaluate lipid-loaded vacuoles.

MSC exofucosylation

MSC in suspension (10x10 &lt; ⁶ &gt; per 200 [mu] l reaction) was incubated with Ca2 ⁺ and Mg2 ^{+ -free} Was treated with 60 mU / ml fucosyltransferase VI (FTVI) or single reaction buffer (unmodified MSC) in a reaction buffer consisting of Hank's balanced salt solution (HBSS) ("FTVI-modified MSC"). After treatment, the MSCs were washed with HBSS containing 0.2% HSA and 20 mM HEPES. Cell viability was assessed by trypan blue exclusion and iodinated propidium staining (sustained viability greater than 85% at 24 hours after desorption and treatment). The FTVI strain was evaluated by flow cytometry. The FTVI enzyme was provided by Roland Wohlgemuth (Sigma Chemical Corporation).

Western blot analysis

FTVI-modified MSC lysate and unmodified MSC lysate were diluted in buffer A (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 20 mg / mL phenylmethylsulfonyl fluoride, 0.02% sodium azide and protease inhibitor (NP-40) in cocktail tablets (Roche Molecular Biochemicals). All western blots of whole cell cell lysates or immunoprecipitated proteins were 7.5% as previously described, SDS-PAGE gel under reducing conditions [19] The amount of lysate in each lane was normalized to the number of cells subjected to each western blot .. Blots were obtained by using Lumi-Light Western Blotting Substrate (Roche) And visualized by chemiluminescence.

Flow cytometry and immunoprecipitation studies

Flow cytometry was performed as previously described [19]. See the Supplemental Methods section for more details.

Parallel plate flow chamber attachment black

To evaluate E-selectin mediated MSC binding on stimulated human umbilical vein endothelial cells (HUVEC) as previously described, dynamic flow attachment assays were performed using a parallel plate flow chamber (250 [mu] m channel depth x 5.0 mm channel width) [19]. See the Supplemental Methods section for more details.

Transduction of MSC by hGH viral vector

MSCs were transduced with lentiviruses containing hGH plasmid constructs as previously described [21]. hGH levels were measured by enzyme-linked immunosorbent assay (Roche Diagnostics) in MSC supernatants and in the sera of injected animals.

Transduction of MSC by GFP viral vectors

MSCs were transduced with retroviral plasmids containing GFP (GFP-MSC) as previously described [21]. The transduced MSCs were evaluated for nuclear peri expression of GFP by fluorescence microscopy. MSC (not GFP-transduced) was labeled with fluorescent dye CFSE as a complementary approach to the use of GFP-MSC for assessing the ear.

Immunofluorescence

The pancreas was embedded in tissue OCT and frozen and sectioned into freezing inserts. Immunofluorescence images were taken using a Nikon E-1000 epifluorescence microscope (X400 total magnification). See the Supplemental Methods section for more details on specific staining.

Mitogen-stimulated CD3 / CD28 T cell proliferation assay

T cell proliferation assays using anti-CD3 and anti-CD28 stimuli were used to evaluate the effect of FTVI modification on the immunoregulatory ability of MSCs. Briefly, 1 x 10 ⁵ NOD splenocytes were cultured in the presence of irradiated (3000 rad) untransformed and FTVI-modified MSC titers (5 × 10 ² to 5 × 10 ⁴ ) at 10% CD3e and anti-CD28 (1 per well each) for 72 hours in RPMI medium (Lonza) supplemented with fetal serum (Gemini Bio-Products), 1% penicillin streptomycin (Lonza) and 1% glutamine Ug; eBioscience). During the last 12 hours of the 72 hour incubation period, the cells were pulsed with 1 mu Ci of tri-deuterium thymidine and lymphocyte proliferation ( ³ H-thymidine incorporation) was measured by scintillation count. Results are reported as the mean of triplicate samples (mean cpm ± SEM).

Study of New Onset Hyperglycemia Inversion in NOD Mice

Unmodified MSC and FTVI-modified MSCs (0.5 x 10 ⁶ cells in 200 μl) were injected via tail vein into female NOD (> 250 mg glucose / dL) on day 2 and on day 7 and day 30 after hyperglycemia, Mice were injected intravenously. To assess the effect of MSC administration on hyperglycemia, blood was collected through the tail vein and glucose was measured as described previously [9, 10].

statistics

Data from experimental and immunohistochemical experiments were analyzed using standard t-test and Mann-Whitney test. Survival data were evaluated using Kaplan-Meyer analysis. Prism software (GraphPad Software, Inc., San Diego, Calif.) Was used to perform the analysis and to graph. A P value of less than 0.05 is considered significant. Data represent the mean ± SEM.

Supplementary Method

Flow cytometry and immunoprecipitation studies

Mouse CD44 mAb (KM114; rat IgG1), purified anti-mouse CD44 mAb (IM7; rat IgG2b), and anti-mouse CD44 mAb And picoeritrin (PE) -labeled streptavidin (all from BD Pharmingen) were used to perform ¹⁹ flow cytometry as previously described. For Western blotting, MSC lysates were incubated with anti-CD44 immunoprecipitating antibody (KM114 / IM7) or a suitable isotype control and then collected using protein G-agarose (Invitrogen). Immunoprecipitates were extensively washed using Buffer A, 1% SDS containing 2% NP-40, then applied to SDS-PAGE and transferred to polyvinylidene difluoride membranes and incubated with HECA452 or anti-mouse CD44 antibody KM114 / IM7), followed by incubation with an appropriate HRP-conjugated secondary antibody for visualization by chemiluminescence using a Lumi-Light Western Blotting Substrate (Roche).

Parallel plate flow chamber attachment black

Confluent HUVECs were stimulated with TNF-alpha (40 ng / ml) for 6 hours to upregulate E-selectin expression. Wild type (WT) and CD44KO MSCs were harvested using 0.005% trypsin / EDTA, FTVI modified for 90 min at 37 [deg.] C, or treated with a single buffer (control). The MSCs were then resuspended at 10 ⁶ cells / ml in Hank's balanced salt solution supplemented with 1 mM calcium chloride, 1 mM magnesium chloride, 5 mM HEPES and 1 mg / ml BSA. The shear stress levels of 1.0, 2.0, 5.0, 10.0, 20.0 and 30.0 dynes / cm ² were applied at 3 minute intervals after the MSC was perfused over the HUVEC monolayer at 0.5 dynes / cm ² . MSCs interacting with the HUVEC (cells rotating in an observation field or rotating into an observation field within a 10 second time period) were observed in the center of the chamber, at least six observation fields at each shear stress level. As a control for evaluating the specificity of E-selectin binding to stimulated HUVEC, FTVI-modified MSCs were treated with sialidase from Vibrio cholerae (0.1 U / ml; Roche) The acid was cut and the attachment was also assessed in the presence of function-blocking anti-human E-selectin mAb (10 [mu] g / ml) (BD Farming Gegen).

Immunofluorescence

The tissue was cryostat-sectioned to a thickness of 10 mu m and fixed on the slide in cold acetone for 5 minutes. After drying, the sections were blocked with 1% BSA and incubated overnight with the primary antibody. The sections were washed 3 times with Tris-buffered saline (TBS) and incubated with the secondary antibody for 1 hour. E-selectin (CD62E) staining was performed using primary rat anti-mouse CD62E (R & D Systems, 1: 100) and secondary PE-conjugated goat anti-rat IgG (Southern Biotech, 1: 500). Isotype-matched rat mAbs were used as staining controls. CD31 staining was performed using rat anti-mouse CD31 (Biocare, 1: 200) and secondary PE-conjugated goat anti-rat IgG (Southern Biotech, 1: 500). CD31 and E-selectin co-localization were performed in serial sections. Insulin staining was performed using purified guinea pig anti-insulin (Dako, 1: 5) and APC conjugated donkey anti-guinea pig IgG (H + L) (Jackson Immunoresearch, 1: 200). FTVI-modified MSCs were detected in tissue sections using HECA452 mAb (rat anti-CLA IgM mAb (Biolegend, 1: 200)) and FITC conjugated mouse anti-rat IgM (Biolegend, 1: 500). The sections were overlaid with a single mounting medium, overlayed with overlapping media containing DAPI (Vector Labs) if indicated, covered with cover slips and visualized with an immunofluorescence microscope.

result

Expression and functional analysis of FTVI-modified MSC

MSCs from bone marrow from C57BL / 6 mice ("wild type") or CD44-KO mice (CD44 ^{- / -} under the C57BL / 6 background), a diabetic resistant strain, exhibit characteristic small spindle fibroblast-like patterns And could be differentiated into the mesoderm cell type ( Fig. 7 ). MSCs expressed cell surface markers characteristic of MSCs ( Fig. 1 (A) ). MSC recognizes the absence of reactivity with mAb HECA 452 (recognizing the basic sialo fucosylated E-selectin binding determinant (such as sialylated Lewis X (sLe ^x )) and the absence of reactivity with the E-selectin- Ig chimera E- Ig did not express the native E-selectin ligand ( Fig. 1 (B) ).

Previous studies of human MSCs have shown that glycoengineering (i.e., glycosyltransferase-programmed stereosubstitution) using α- (1,3) -fucosyltransferase VI (FTVI) (GPS) is known as a hematopoietic cell E- / L-selectin ligand (HCELL), which is a fucosylated sialyl lactosaminylated glycosaminoglycan of CD44 in which the original membrane CD44 binds strongly to E-selectin Lt; RTI ID = 0.0 &gt; E-selectin. &Lt; / RTI &gt; To determine whether cell surface exofucosylation can program E-selectin ligand activity on murine MSCs, cells were treated with FTVI using optimized reaction conditions to preserve cell viability. The FTVI modification of MSC markedly induced not only staining with mAb HECA452 but also binding to murine E-selectin-Ig chimera (mE-Ig) ( Fig. 1 (B) ). Notably, protease degradation of MSC prior to FTVI modification significantly reduced mE-Ig reactivity, suggesting that the glycoprotein, which is not glycolipid, is the major carrier of E-selectin binding determinants ( Fig. 1 (B) ). Western blots of whole cell lysates ( Fig. 1 (C) ) and immunoprecipitated CD44 (Fig. 1 (D) ) following exofucosylation of mouse MSC were obtained from sialofucosylation recognized by E-Ig and HECA-452 Showed that the major membrane glycoprotein modulated with CD44 (approximately 100 kDa) was in the "standard" (ie, no splice variant exon) form. These data suggest that the FTVI variant converts the murine MSC surface CD44 to HCELL.

FTVI-modified mouse MSC increased binding to E-selectin under physiological shear stress conditions.

To assess the ability of FTVI-modified mouse MSC to bind E-selectin under physiological shear stress conditions, we performed a parallel plate flow chamber assay of both unmodified MSC and TVI-modified MSCs. For this, the HUVEC monolayer was first stimulated with TNF-α to up-regulate E-selectin expression. As shown in FIG . 2 , the FTVI-strain can cause the MSC to attach to the HUVEC at a shear stress level as high as 0.5 dynes / cm ² to 20 dynes / cm ² . In the flow chamber study, incubation with HUVEC and function-blocking E-selectin mAb and sialidase treatment of MSC (to remove sLe ^x presentation), respectively, showed that attachment of FTVI-modified MSCs was similar to that of unmodified MSCs , MSC attachment to stimulated HUVEC is absolutely dependent on E-selectin receptor / ligand interaction ( Figure 2 ). Overall, these findings suggest that the FTVI modification of murine MSC induces potent E-selectin binding activity that can sustain E-selectin adhesion at hemodynamic shear stress levels well in excess of the typical levels of capillary-posterior vein [ 17].

Systemically administered FTVI-modified MSC strongly reverses new onset hyperglycemia in NOD mice.

To assess whether the FTVI-modification affects the ability of MSCs to modulate diabetes in NOD mice, new-onset diabetic NOD mice are given either cells (untreated control) or hyperglycemia (glucose> 250 mg / dL) 2 5 × 10 ⁵ FTVI-modified or 5 × 10 ⁵ unmodified C57BL / 6 MSCs were injected intravenously (via the tail vein) in the primary and then intravenously on the 7th and 30th days after the onset of hyperglycemia. As shown in Fig . 3 (A) , the untreated NOD mice showed rapid increase in blood glucose levels, except for one animal that died within several weeks of hyperglycemia. A transient reversal of autoimmune diabetes (ie, 3 of 9 mice were normal blood glucose at 3 weeks, 2 of 9 animals were normal blood glucose at 6 weeks, all animals were hyperglycemic for 12 weeks) In contrast to the administration of modified MSC ( Fig. 3 (B) ), the injection of FTVI-modified MSC strongly and permanently reversed hyperglycemia ( Fig. 3 (C) ). Remarkably, 7 of 8 mice were normal blood glucose for 3 weeks, 6 of 8 mice was maintained normal blood glucose levels for 6 weeks, 5 of 8 mice did not have diabetes for more than 12 weeks after the initial treatment (Figure 3 (Fig . The majority of mice in the FTVI-modified MSC group with unmodified MSC and blood glucose levels above 600 mg / dl survived to 90 days, whereas only one (7 mice) in the untreated group (no MSC) Survived for 90 days.

E-selectin expression and MSC localization in the pancreas of NOD mice

To examine the effect of FTVI-modification on MSC transport to the pancreas, we first used an immunofluorescence microscope to evaluate the expression of E-selectin in the microvascular system of the pancreas of 14-week-old NOD mice. Islet cells - peripheral blood vessels have been reported to be the primary sites of inflammatory cell transport leading to pancreatitis [23, 24]. ( FIG. 4 (A) ), whereas the islet cell-peripheral blood vessels of the pancreas of the NOD mouse expressed E-selectin ( FIG. 4 (B) ), And co-localized with CD31 staining ( Fig. 4 (C) and 4 (D) ). T-cell infiltration into diabetic islet cell margins was confirmed by CD3 staining of the NOD pancreas during diabetes incidence ( Fig. 4 (E) ). To evaluate pancreatic infiltration of FTVI-modified MSCs systemically administered in NOD mice, we frozen sections of the pancreas were stained with antibody HECA452. As shown in FIGS . 4 (F) and 4 (G) , HECA452 ⁺ MSCs are expressed in the periphery of the E-selectin-expressing microvessel system 1 day after transplantation, the colonization (E-selectin- Peripheral region and T cell infiltration (L-selectin-expression) region. In order to evaluate the degree of posttreatment FTVI-modified MSC and unmodified MSC after systemic administration, GFP-transduced FTVI-modified MSC and unmodified MSC were intravenously injected into NOD mice and their pancreas, pancreatic lymph nodes, mesentery Lymph nodes and spleen were harvested on day 4 post-injection, sectioned, and evaluated for presence of MSC by fluorescence microscopy. The FTVI-modified MSC showed a 3-fold higher pancreatic invasion compared to the unmodified MSC, whereas a difference in pancreatic infiltration of FTVI-modified MSC and unmodified MSC injected from diabetic-resistant BALB / c mice was not observed ( Fig. 4 (H) ). However, no difference was noted in the degree of deterioration of FTVI-modified MSCs and unmodified MSCs to lymphoid tissues of treated NOD mice.

Exofucosylation was not effective on MSC immunosuppressive ability or in vivo survival.

We previously reported that measuring human growth hormone (hGH) produced by hGH-transduced MSCs is a sensitive method for evaluating the lifespan of administered MSCs [21]. In order to evaluate whether the increase of the administered reverse FTVI- hyperglycemia of the modified MSC takes place as a result of the survival advantage, ⁵ × 10 5 of hGH- transformed after the onset of the introduction of the MSC FTVI- modified and non-modified MSC hyperglycemia NOD mice were injected on days 2 and 7 and serum hGH was measured at various time points after injection. As shown in Fig . 5 (A) There was no difference in the hGH production pattern, suggesting that the FTVI modification did not affect survival of the MSC in vivo. To assess whether exofucosylation modifies MSC immunoregulatory ability, we performed co-cultured T cell inhibition assays. T cell proliferation was equally attenuated by FTVI-modified MSC and unmodified MSC ( Fig. 5 (B) ), suggesting that exofucosylation does not provide additional immunomodulatory properties for MSCs.

The absence of MSC CD44 expression eliminates the anti-diabetic effect of FTVI-modified MSCs.

To test whether CD44 expression is a prerequisite for the enhanced anti-diabetic effect of FTVI-modified MSC, we generated MSCs from CD44 KO mice (CD44 ^{- / -} under the C57BL / 6 genetic background). Except for CD44, the MSCs generated from the bone marrow of CD44 KO mice exhibited the same level of cell surface adhesion molecules. According to flow cytometry, exo fucosylated CD44 KO MSC exhibited HECA452-reactivity equivalent to the HECA452-responsiveness of the exo fucosylated wild-type MSC (Fig. 8 ), indicating that the sialorphocylated determinant was generated in an alternative (i.e., non-CD44) scaffold It suggests. In order to assess whether administration of CD44 KO MSC gave an anti-diabetic effect, 5 × 10 ⁵ FTVI-modified CD44 KO and KO CD44 KO, and C57BL / 6 wild type MSCs were injected into new onset diabetic NOD mice on days 2, 7 and 30 after the onset of hyperglycemia. 5 of 6 mice receiving unmodified CD44 KO MSC and 6 of 7 mice receiving FTVI-modified CD44 KO MSC ( Figures 6 (A) and 6 (B) , respectively ) As evidenced by failure, CD44 deficiency in MSCs resulted in a significant impairment of its anti-diabetic effect compared to wild-type MSCs. After injection of NOD mice, CFSE-labeled FTVI-modified CD44 KO MSCs and unmodified CD44 KO MSCs showed no difference in transport to the pancreas ( Fig. 6 (C) ) and their levels were similar to those observed for wild type MSCs ( Fig. 4 (H) ). The ability of MSC inhibition was not eliminated by lack of MSC CD44 expression in vitro or by exofucosylation of CD44 KO MSC (Fig. 6 (D) ), indicating that the FTVI-treated CD44 ^{- / -} Suggesting that the absence of blood glucose effects is not due to inherent immune regulation deficiency. Notably, the findings that exofucosylation makes the expression of cell surface sialopucosylation possible to be recognized by HECA452 on CD44 KO MSC, but these cells do not realize the intended biological consequences in diabetic NOD mice, In defining / predicting the biological effects of enhanced selectin binding induced by surface glycan manipulation - beyond simple flow cytometric studies to evaluate E-Ig and HECA452 immunoreactivity - biochemical studies (e. G. Western blot analysis).

Argument

MSC has become the center of some human trials to treat a variety of refractory immune-mediated diseases, including T1D, due to its immunomodulatory properties, stability profile and strong in vitro propagation [6]. MSCs have been shown to inhibit pancreatic islet and autoimmune diabetes mellitus through multidimensional immunomodulatory effects on pathogen components that are crucial to the elaboration of T1D [25, 26]. These effects are mediated by the modulation of inflammatory cytokine-modulated cytokines and the proliferation of regulatory DCs and T cells, and the expression of MSCs of negative co-stimulatory molecules (such as PDL-1) that can directly inhibit autoreactive T cells Including the ability to promote [8-10,13]. Therefore, MSC therapy is likely to be an interesting and specific strategy for treating T1D. Nevertheless, there is an urgent need to improve the efficacy of MSC-based therapies in T1D [6].

In previous studies, the inventors observed that intravenous administration of fully homologous MSCs was associated with a transient reversal of hyperglycemia in diabetic NOD mice [9]. The present inventors assumed that the closest obstacle to realizing a more potent anti-diabetic effect would be the relatively low MSC locus to the inflamed pancreas. Here, the present inventors sought to evaluate whether systemic administration of MSCs with enhanced potency through enhanced HCELL expression affects the reversal of diabetes in the NOD model. To this end, because the CD44 KO phenotype could be used in this genetic background, we used C57BL / 6 strain as the homologous source of MSC. Because the present inventors previously examined the immune system mediating the anti-diabetic effect of MSCs [9, 10], we focused on metabolic control as the primary endpoint for assessing the efficacy of MSC therapy.

For a relatively short period of time <30 days), this study assessed the effect of MSC on the reversal of autoimmune diabetes over a prolonged observation period (90 days). Our data here demonstrate that the conversion of native membrane CD44 to HCELL by cell surface a- (1,3) -exofucosylation ("FTVI-modification") results in a high-efficacy mouse MSC binding to E-selectin . We observed E-selectin expression in the islet cell-peripheral region of the pancreas of NOD mice with pancreatic islets in the pancreas of diabetic-resistant mice. Consistent with these findings, the inventors have not observed differences in the level of the putative levels of the injected allogeneic C57BL / 6 FTVI-modified MSCs and of the diabetes-resistant mice (BALB / c host) of unmodified MSCs into the pancreas Compared with unmodified MSC, pancreatic infiltration of C57BL / 6 (allogeneic) FTVI-modified MSCs systemically administered in diabetic NOD mice was elevated and accompanied by persistent diabetes reversal. Notably, we did not observe any difference in lymphatic tissue infiltration between animals receiving FTVI-modified MSCs and those receiving unmodified MSCs, but we have found that within the peri-vascular region of E-selectin- Cellular fixation / engraftment in leukocyte clusters was significantly increased. Overall, these data highlight the important role of MSC pancreatic colonization in suppressing autoimmune diabetes, but do not rule out the potential contribution of the pancreatic exocrine effect of MSCs.

Using the fully homologous FTVI-modified (HCELL) MSCs observed in this study and compared to the anti-diabetic effects observed using intravenously administered allogeneic unmodified MSCs in this study and previous studies [9] Lt; RTI ID = 0.0 &gt; T1D &lt; / RTI &gt; reversal does not appear to be due to the enhanced immunosuppressive ability of the glycine engineered MSC itself or the in vivo survival benefit provided by glycoprotein manipulation of MSCs. In previous studies, we observed an improved anti-diabetic effect in NOD mice following intravenous administration of the anti-allogeneic MSCs obtained from NOR mice [10], probably because of the in vivo tissue colonization / survival of the cells Lt; RTI ID = 0.0 &gt; anti-homologous &lt; / RTI &gt; However, in particular, since manufacturing and regulatory issues support the use of "off-the-shelf" (ie, cultured-proliferated, pooled) allogeneic MSC products, It may be advantageous to use strategies that increase the efficacy of the source MSC. The finding that the exo fucosylated CD44 KO MSC lacks the ability to induce persistent reversal of hyperglycemia suggests that despite the apparent production of FTVI-dependent surface sialo fucosylated determinants that can be detected by HEC452 reactivity , Suggesting that E-selectin binding determinants (i. E., Elaboration of HCELLs), which are clearly indicated on the CD44 scaffold, are required to achieve a potent anti-diabetic effect. This may be related to the important role of HCELL expression to achieve the necessary tissue organs and extravasation [27] and / or may reflect the essential conditions of HCELL / CD44 expression to achieve proper colonization at relevant microenvironmental sites [ 28]. The role of in situ fixation to achieve the MSC effect (s) has been emphasized by the study of simultaneous transplantation of MSCs with an ischemic allograft producing an immunoprivileged region [29-31]. In this regard, it has been shown that E-selectin is expressed in the endothelium of affected tissues and that leukocytes characteristically express L-selectin and the expression of HCELL, a potent E-selectin and L-selectin ligand, The observed localization of HCELL ⁺ MSC in islet cell peripheral blood vessels and islet cell leukocyte infiltrates emphasizes the functional role of HCELL in allowing immunomodulation, since it acts to clearly promote tissue fixation in the environment. Further studies are needed on the immunomodulatory effect of in vivo MSCs, but the data presented here emphasize the possibility of enhanced pancreatic activity through systemic administration of HCELL ⁺ MSC in T1D regimens. More broadly, the fact that E-selectin is up-regulated by cytokines such as TNF and IL-1 in the endothelial field of all inflammatory sites [17,18] improves the efficacy of MSC-based therapies for a wide variety of inflammatory conditions To provide enhanced MSC HCELL expression.

Reference literature-Example 6

Example 7 - Cell surface glycan manipulation of neural stem cells increases neurodegeneration and improves recovery in a murine MS model.

Introduction

Nature has developed a highly efficient mechanism of delivering circulating cells to inflammation and injury sites. This process is controlled by a highly ordered cascade of molecular interactions (Butcher, EC 1991; Sackstein, R. 2005; Springer, TA 1994). The most essential event in cell recruitment is the most efficient mediation by binding to its respective counter-receptor of selectin, a family of three Ca ²⁺ -dependent lectins (consisting of E-selectin, P-selectin and L-selectin) Shear-resistant adhesion of flow cells on the surface of the endothelial cells. These interactions initially allow the cells to temporarily attach to the vessel wall and allow the cells to rotate along the endothelial surface at a rate less than the rate of predominant hemodynamic flow in the context of vessel shear flow (step 1). This process facilitates the binding of specific cell-derived chemokine receptors to appropriate cytokines present in the peri-vascular region, thereby triggering an internal-external signaling event that leads to increased adhesion of the integrin family members (step 2). Subsequently, the adherent interaction between activated cell integrin and its endothelial cell counter-receptor induces stalling of rotation and stable attachment of cells to the vessel wall (step 3) and ultimately induces transendothelial migration (Extravasation, step 4).

In experimental autoimmune encephalomyelitis (EAE), multiple sclerosis (MS) and its animal model, the recruitment of immunological effectors is mediated by the upregulation of vascular selectins E-selectin and P-selectin. E-selectin and P-selectin are expressed in the endothelium following in vivo activation by LPS or TNF-a, whereas P-selectin is only transiently expressed in murine EAE (Piccio, L., Rossi, B., et al., 2002). Notably, E-selectin is expressed asymmetrically at the site where blood vessels are branched throughout the inflammatory period, suggesting that there is a preferential recruitment domain (Piccio, L., Rossi, B., et al 2002). E-selectin is also characteristically found in blood vessels from acute plaques of MS patients (Lee, S. J. and Benveniste, E. N. 1999; Washington, R., Burton, J., et al. These findings suggest that E-selectin plays a dominant role in recruitment of circulating cells to the brain in inflammatory diseases.

All three selectins were identified as α (2,3) -linked sialic acid substitutions on galactose and α (1,3) -glucosamine on N-acetylglucosamine, which are circularly labeled as terminal tetrasaccharide sialyl Lewis X (sLe ^x ) (Polley, MJ, Phillips, ML, et al., 1991; Sackstein, R., 2005), which consists of sialofucosylation containing a conjugated fucose modification. These structures, also known as "CD15s &quot;, can be presented on protein scaffolds (i.e., glycoproteins) or lipid scaffolds (i.e., glycolipids) and are recognized by mAbs such as CSLEX-1 and HECA-452 (Alon, R., Feizi, T., et al., 1995; Dimitroff, CJ, Lee, JY, et al., 2001; Fuhlbrigge, RC, Kieffer, JD, et al., 1997; Gadhoum, SZ and Sackstein, R. 2008; Merzaban , JS, Burdick, MM, et al. 2011). Although this additional structural modification, which mainly involves sulfation, increases the binding affinity of P-selectin and L-selectin for sLe ^x , this modification is not necessary for optimal binding of E-selectin (Leppanen, A , White, SP, et al., 2000; Rosen, SD 2004).

Neural stem cell (NSC) -based therapies have given many promises for stopping and reversing disease progression in CNS inflammation and / or degenerative diseases (Ben-Hur, T., Einstein, O., et al. 2003; Einstein J., Raddassi, K., et al., 2004, Lee, ST, Chu, Y. et al., 2006. Einstein, O., Grigoriadis, N., et al. Pluchino, S., Quattrini, A., et al. 2003; Pluchino, S., Zanotti, L., et al. 2005; Ziv, Y., Avidan, H., et al 2006). NSCs have been identified as CXCR4 (Bezzi, P., Domercq, M., et al. 2001; Flax, JD, Aurora, S., et al. 1998; Imitola, J., Raddassi, K., et al. It is well known that expression of step 2 and step 3/4 effectors such as VLA-4 (Pluchino, S., Zanotti, L., et al. 2005; Rampon, C., Weiss, N., et al. , But there is no data as to whether the NSC originally expressed the stage 1 effector. Thus, we examined the expression of the stage 1 effector in mouse NSCs and found that these cells apparently lacked the stage 1 effector, particularly the E-selectin ligand. Using the EAE model, we found that E-selectin ligand activity enhanced through cell surface glycan manipulation could affect the migration of administered NSCs and, more importantly, the therapeutic effect (s) of the administered cells Respectively. To this end, the inventors have used a technique called glycosyltransferase-programmed steric substitution (GPS) to generate selectin-binding glycan determinants on related cell surfaces (Sackstein, R., Merzaban, JS, et al 2008). Here, the inventors of the present invention found that GPS modifies glycans of two kinds of neural stem cell membrane glycoprotein, CD44 and NCAM to produce E-selectin ligand HCELL (hematopoietic cell E- / L-selectin ligand) and NCAM-E, respectively Lt; RTI ID = 0.0 &gt; E-selectin &lt; / RTI &gt; ligand in NSCs. NSC E-selectin ligand activity increased the neurotic properties and improved the clinical outcome of EAE in the absence of a detectable long-term engraftment, which resulted in the restoration effect of these tissue-specific stem cells rather than direct regeneration effect It suggests. Importantly, the administration of GPS-engineered mouse hematopoietic stem / progenitor cells (HSPC) did not improve the EAE clinical course, so that this neurotoxic effect is not a universal characteristic of adult stem cells. These findings demonstrate the direct evidence that manipulation per cell surface to produce effectors of cell migration can improve stem cell-based therapies and also provide a new perspective on the use of NSCs in the treatment of neuroinflammatory diseases Have a significant clinical significance in providing.

result

Expression of molecular effect of cell migration in neural stem cells

Flow cytometry was performed on the primary cultures of mouse NSCs in order to analyze the expression of cell effectors of step 1, step 2 and step 3/4 of cell migration. NSC lacked reactivity with E-selectin-Ig chimera (E-Ig) and P-selectin-Ig chimera (P-Ig), which, even in the presence of inflammatory mediators ( FIG. 15 ) -Electin ligand is absent ( Figure 9a ); NSCs were also not stained with mAb CSLEX1, KM93 or HECA452 (each confirming sLe ^x ). NSCs expressed CD44 and integrin VLA-4 (CD49d / CD29) and VLA-5 (CD49e / CD29) as well as the chemokine receptor CXCR4; These NSC marker expression patterns were observed by others (Back, SA, Tuohy, TM, et al., 2005; Campos, LS, Decker, L., et al. 2005, Pluchino, S., Quattrini &lt; / RTI &gt; et &lt; RTI ID = 0.0 &gt; Pluchino, S., Zanotti, L., et al. 2005) ( Fig. 9b ). NSC also characteristically expressed a nerve cell adhesion molecule (NCAM) in addition to the well-described polysialic acid (PSA) (Vitry, S., Avellana-Adalid, V., et al. 2001) ( FIG . NSC did not express PSGL-1, CD43, LFA-1 (lacking both CD11a (alpha ₁ ) chain and CD18 (beta ₂ ) chain) and LPAM-1 (alpha ₄ beta ₇ ) ( FIG . These results demonstrate that NSC mediates the extracellular flux of stages 2 through 4, lacking the expression of the stage 1 effector of the multistage cascade of cell migration, and also mediates chemokine receptors involved in mobilization in the developing brain via radial migration Suggesting the expression of related integrin effectors (Imitola, J., Comabella, M., et al., 2004).

GPS enhances E-selectin ligand activity on neural stem cells.

CD44, a molecule involved in the migration of NSC (Deboux, C., Ladraa, S., et al. 2013) and brain cancer stem cells (Fu, J., Yang, QY, et al. ( Fig. 9B ). However, the finding that NSC lacks E-selectin binding ( Figure 9a ) suggests that these cells do not naturally express the E-selectin binding sugar form of CD44, known as HCELL (Dimitroff, CJ, Lee, JY Dimitroff, CJ, Lee, JY, et al., 2001; Sackstein, R., 2004). Thus, the present inventors sought to determine whether glycosyltransferase-programmed steric substitution (GPS) of CD44 glycans can enhance HCELL expression (Sackstein, R., Merzaban, JS, et al. To this end, we treated NSC with fucosyltransferase VI (FTVI), an α (1,3) -linkage-specific fucosyltransferase. The enzyme specifically positions fucose on the terminal 2-lactosamine unit; When the lactosamine is capped with? (2,3) -linked sialic acid, sLe ^x is produced. After treatment FTV (GPS-NSC) in NSC, consistent with mAbs CSLEX1, KM93 and reactivity was induced with HECA452, which is associated E-Ig binding (Fig. 10a) and sLe ^x epitope strong expression (Fig. 10a) but with a P- There was no induction of Ig binding ( Fig. 10A ). Notably also, (known also as SSEA-1 or Le ^x) Expression of CD15 was high in NSC (Fig. 10a), FTVI is by a bicyclic allylated terminal galactosyl samin Foucault misfire can generate CD15 (SSEA-1) to note , But the expression of CD15 did not change after enhanced fucosylation ( Fig. 10A ). Taken together, these data suggest that only α (1,3) -exofucosylation occurred in sialylated lactosaminyl glycans. Bromelain degradation of NSC before GPS treatment significantly reduced HECA452 responsiveness ( FIG. 10b ), demonstrating that the glycoprotein, not the glycolipid, is the major carrier of the sialorphocyclyl crystallizing factor. The phosphatidylinositol phospholipase C (PI-PLC) treatment of GPS-NSC resulted in a minor but significant reduction of the HECA452 signal according to FACS (Fig. 10c), suggesting that a small population of sLe ^x -modified glycoproteins are glycosylphosphatidylinositol (GPI) -connected ones.

Cell lysate and the immune a western blot of precipitated CD44 is one of a protein per the formula in Foucault misfire in an essential sialic recognized by the HECA452 the CD44 standard bis peulrayiseu Mode for from the GPS-NSC (about 100 kDa; Figure 11a ), And CD44 was also reactive with E-Ig (Fig. 11A ). However, after thorough immunoprecipitation of CD44, other candidate glycoprotein E-selectin ligand (s) was identified by the reactivity of E-Ig and HECA452 in the remaining supernatant fractions. Two bands appeared at about 120 and about 140 kDa. The molecular weight profile of these bands ( Figure 11a ) and the 120 kDa form of NCAM (Gascon, E., Vutskits, L., et al. 2007; Maness, PF and Schachner, M. 2007; Rutishauser, U. 2008) Based on the partial PI-PLC sensitivity of E-selectin binding ( FIG. 10c ), the inventors speculated that NCAM could act as an additional E-selectin ligand. Thus, we performed immunoprecipitation with the pan-NCAM mAb and observed that the remaining bands that persisted after intensive immunoprecipitation of CD44 were indeed those of NCAM (FIG. 11b ). To determine whether the relevant sialophoryl fucosylation in NCAM was presented on the N-glycan, we used the N-glycosidase F digestion followed by Western blotting of the GPS-NSC lysate with E-Ig The reactivity was tested (Figure 11a ); No apparent staining with E-Ig after degradation was observed, suggesting that the relevant E-selectin binding determinant (s) are presented on the N-glycan. The GPI-fixed type contribution of NCAM-E to total sLe ^x expression after enhanced fucosylation of NSC was due to a small reduction of HECA452 signal (and E-Ig signal-data not shown) after PI-PLC treatment As shown, it is not large ( Fig. 10c ). Thus, enhanced α (1,3) -fucosylation of murine NSC produced a unique E-selectin ligand reactive form of the neural precursor molecule named "NCAM-E" as well as HCELL. Interestingly, human NSC (CC-2599) only expresses HCELL after GPS treatment and does not express NCAM-E ( Figs. 16A-16C )

To assess the stability of GPS-engineered E-selectin ligand activity in NSC, we measured E-Ig reactivity at 24 hour intervals by flow cytometry after enhanced exo fucosylation. E-selectin ligand activity was stable up to 24 hours and then decreased to undetectable levels up to 72 hours, probably due to surface protein turnover ( Figure 11c ). NSC viability (Figure 17 ) was not affected by enhanced exofucosylation and there was no difference in number or proliferation of neurons or differentiation of NSCs in a clonogenic assay (Figures 18a-18d ). Thus, there was no apparent expression shape difference induced by GPS treatment of NSC except for the generation of E-selectin ligand.

NSC inhibits the proliferation of T cells in vitro (Einstein, O., Fainstein, N., et al. 2007; Einstein, O., Grigoriadis, N., et al. 2006; Martino, G. and Pluchino, S. 2006), in particular, mitigated the mitotic response of T cells in vitro. In order to assess whether these NSC immunoregulatory functions are affected by enhanced E-selectin ligand activity, the present inventors investigated whether the effects of the GPS-NSC inhibiting lymph node cell proliferation in response to Con A activation and the control buffer- NSC (BT-NSC) capabilities were tested. As shown in Figs. 19A-19C , both GPS-NSC and BT-NSC could not only reduce T cell proliferation, but also inhibited inflammatory cytokine production, suggesting that the immune regulation Suggesting that there are no pros and cons. Interestingly, we also observed the same release of leukemia inhibitory factor (LIF) from NSCs in inflammatory cytokine treatment for both BT-NSC and GPS-NSC when GPS-treated cells were enhanced upon binding to E-Ig (Fig. 19C ). Thus, enhanced exo fucosylation of NSCs induced transient E-selectin ligand activity without undesirable effects on NSC phenotype or function as measured by in vitro studies.

GPS-NSC represents a strong physiological rotational interaction with E-selectin.

To analyze the efficacy of E-selectin ligand activity of GPS-NSC under physiological blood flow conditions, human umbilical vein endothelial cells (HUVEC) stimulated with cytokines (IL-1 [beta] and TNF- [ A parallel plate flow chamber study was conducted. As shown in FIG . 12A , GPS-NSC exhibited significant E-selectin ligand activity, which was completely eliminated in the presence of EDTA or by the use of blocking anti-E-selectin mAbs. Significant shear-resistant rotational interactions were observed within normal postcapillary vein shear levels (1 to 4 dynes / cm ² ) and persisted above 20 dynes / cm ² ( Figure 12a ). In order to analyze whether HCELL or NCAM-E which is a perturbed E-selectin ligand is more potent E-selectin ligand in NSC, we used blot-rotation assay (Fuhlbrigge, RC, King, SL, et al., 2002). This technique allows to assess the contribution of each of HCELL and NCAM-E to E-selectin ligand activity of GPS-NSC by detecting shear-dependent selectin ligand interactions on the membrane protein degraded by SDS-PAGE. Thus, E-selectin transfected CHO cells (CHO-E) were perfused over HECA-452 immunostained blots of GPS-NSC lysates to assess their respective E-selectin binding properties. As illustrated in FIG . 12B , more CHO-E cells were attached and interacted with HCELL than either the 120 kD form of 140 or the 140 kD form of NCAM-E. The CHO-E cells suspended in the flow medium containing 5 mM EDTA were attached to a negligible extent in any region of the blot, confirming Ca ²⁺ -dependent binding consistent with selectin ligand activity.

GPS-NSCs show increased in situ and tissue infiltration in vivo EAE.

To assess whether the injected NSCs were substantially invading the CNS, the present inventors conducted confocal microscopy studies. To this end, GPS-NSC and BT-NSC were labeled with PKH26 dye and injected intravenously into MOG-induced chronic EAE mice by two separate intravenous injections: before disease onset (post-immunization (PI) day 9) At the onset (PI 13 days). The number of days was selected based on a previous study on E-selectin expression in the brain endothelium of EAE (Piccio, L., Rossi, B., et al. 2002). Lumbar spinal cord spinal cord and brain were collected on day 4 (PI 17 days) after the second NSC injection. Confocal analysis of the brain demonstrated both high amounts of GPS-NSC ( Figure 13a ) and localization of Flk-1 ⁺ extravascular ( Figure 20a -b) in the brain. In addition, a parallel analysis of spinal cord in which the majority of pathologies occurred in EAE ( FIGS. 13B-13D ) demonstrated twice as many extravascular GPS-NSC infiltrations as BT-NSC infiltration up to PI 17 day (Fig. 13D). These data suggest that GPS-NSC infiltrates the CNS stroma much more efficiently than BT-NSC in both the brain and spinal cord. To further confirm confocal data of the present application, the present inventors have studied the effect of GPS-engineered E-selectin ligand activity on the short term prolongation of NSCs in vivo. NSCs were stained with a fluorescent dye tracking dye, CFSA-SE (carboxyfluorescein diacetate neomycidyl ester), and as described in the Materials and Methods section, MOG was used to quantify PI on days 9 and 13 Adoption transfer was performed with C57BL / 6 mice. Within 16 hours after the second cell injection, the inventors observed that GPS-NSC accumulated three to five times more efficiently in brain, spleen and liver than BT-NSC ( Fig. 13E ). The relative advantage of GPS-NSCs in infiltrating the brain, spleen and liver is that their average CFDA-SE fluorescence is not reduced compared to BT-NSC (data not shown), and therefore the preferential proliferation of these cells in situ But also the true difference in transport. Clearly, there is a close interaction of NSCs with CD4 ⁺ T cells among these cells that have migrated to the spleen ( Fig. 13f ). The injected cells were also accumulated in the lungs, but there was no difference between GPS-NSC and BT-NSC, possibly reflecting steric hatching in the pulmonary microvessels ( Figure 13e ). Thus, sLe ^x structures formed on NSCs after GPS-treatment allow migration of these cells to these organs and emphasize the very important role of E-selectin ligand activity in driving tissue-specific migration of NSCs in vivo do.

GPS-NSCs increased the conversion of the nervous system to the improvement of neuropathology by endogenous indirect nerve regeneration in EAE.

To know whether the improved tissue organs of NSCs promoted the therapeutic effect, we monitored the neurological status of C57BL / 6 mice treated with NSC injections after MOG-induced chronic EAE, Restoration and pathology were analyzed. Nerve precursors were administered by two separate intravenous injections on PI 9 day and PI 13 day. Five groups of EAE mice were tested: (1) GPS-NSC; (2) BT-NSC; (3) HBSS (simulated; i.e., no cells); (4) BT-HSPC; And (5) GPS-HSPC. Clinical scores were assessed daily in a blinded fashion in individual mice ( Figure 14a ) and linear regression of the cumulative load of disease was calculated ( Figure 14b and Table 2 ).

Table 2 . EAE characteristics in C57BL / 6 mice treated intravenously with GPS-treated NSC

Injection of control NSC (BT-NSC) weakened the clinical severity of EAE compared to HSPC and simulated animals ( p = 0.006). (N = 30, p = 0.006), GPS-HSPC (n = 30; p <0.0001) and BT-HSPC ) And simulated (n = 30; p < 0.0001) treated animals. GPS-HSPC (indicating a significant increase in E- selectin ligand activity, see Fig. 21a) scanning (Merzaban, JS, Burdick, MM , et al. 2011)) or BT-HSPC scanning none compared to control animals of the MOG -Induced animal clinical score, it is important to note that improvement in this disease severity is specific to NSC ( Figures 21b-21c and Table 3 ).

Table 3 : Clinical features of EAE in C57BL / 6 mice injected intravenously with GPS-treated HSPC

In fact, GPS-HSPC or BT-HSPC showed a tendency to worsen clinical outcome, suggesting that the beneficial effect of observed NSC infusion is not a general feature of adult stem cells.

Notably, at 30 days after EAE induction, neuropathological examination showed statistical significance of several parameters of inflammation and nerve regeneration in mice treated with GPS-NSC compared to BT-NSC and simulated animals ( Fig. 14C ). To determine the effect of NSC injections on the neuropathological state of EAE, the present inventors evaluated a number of different markers. First, to assess the degree of inflammation, we stained sections of spinal cord from each mouse study group against CD11b, a marker that identifies invasive macrophages and microglia. Animals with EAE administered alone with HBSS buffer alone exhibited a high level of staining for CD11b, where the cells exhibited an increased number of membrane processes, morphological evidence of the activated phenotype ( Figure 14c ). The number of CD11b-stained cells was significantly reduced in BT-NSC treated mice ( p < 0.0001), and notably, these levels were much lower in GPS-NSC injected animals (BT-NSC P < 0.005). Importantly, macrophages / microglia exhibited reduced CD11b staining and more isolated membrane processes, indicative of reduced activation ( Figure 14c ). In addition, quantification of brain CD4 + T cells in different treatment groups showed a significant reduction of invasive T cells in the animals to which GPS-NSC was administered ( Figures 14d and 14e ). To evaluate nerve regeneration, we stained sections of the spinal cord for markers GAP-43 and SMI-32 ( Figs. 14f-14i ). In animals in which GPS-NSC was injected, the expression of GAP-43, a molecule associated with axon integrity and regeneration, was increased compared to mice administered with BT-NSC or alone HBSS buffer ( Figures 14f-14i ). Conversely, we observed a specific decrease in the expression of SMI-32, an axonal degeneration marker in animals treated with GPS-NSC compared to mice administered BT-NSC or HBSS buffer ( Figures 14h-14i ). These data support the notion that the improved clinical effects provided by GPS-NSCs surpass BT-NSCs lead to increased lesional migration of tissue-specific NSCs.

To further assess whether the observed effect of GPS-NSCs reflects increased neuronal regeneration, we have used oligodendrogenesis and mature oligodendrocytic cells, including CNPase, Olig-2 and SOX9, &Lt; / RTI &gt; were stained for the markers associated with. We observed a statistically significant increase in the number of Olig-2, SOX9 and CNPase cells in animals receiving GPS-NSC compared to BT-NSC or control (FIGS. 14d and 14e ). Although there was evidence of injected NSC (SOX-2 ⁺ cells; Figs. 20a to 20b ) at PI 17 day, we observed continuous colony formation by NSC (tagged with GFP) in any injection group at PI 30 days ( Fig. 22 ), suggesting that the NSC neuroprotection mechanism associated with the improved locus, the sustained presence of the administered NSC, and the differentiation into neural lineage cells are not required. Taken together, these data suggest that the GPS-NSC treatment of mice promoted the delivery of NSCs to the CNS and provided neural reconstruction through indirect nerve regeneration rather than through direct nerve regeneration (ie cell replacement) .

Argument

MS is a chronic dehydrative disorder of the CNS characterized by multifocal inflammatory lesions that cause progressive destruction of the myocyte and cause axonal damage and loss (Imitola, J., Chitnis, T., et al., 2006). Stem cell-based therapies include repair of damaged / inflamed tissues by indirect (regenerating) the production of supportive / nutritional factors (indirect regeneration) by substituting diseased cells (direct regeneration) and / Provides a possibility. In the case of sowing neurological diseases such as MS, the use of tissue-specific NSCs can be demonstrated to be clinically useful in achieving CNS recovery, but the closest obstacle to achieving this goal is the appropriate number of cells To the nerve damage site. Previous studies have shown the benefit of transplanted NSCs in stroke, spinal cord trauma and experimental models of MS (Ben-Hur, T., Einstein, O., et al. 2003; Einstein, O., Fainstein, N., et al., 2007; Einstein, O., Grigoriadis, N., et al., 2006; Imitola, J., Raddassi, K., et al., 2004. Lee, ST, Chu, K., et al., 2008 Pluchino S., Quattrini, A., et al., 2003; Pluchino, S., Zanotti, L., et al., 2005; Ziv, Y., Avidan, H., et al., 2006). Although direct injection into affected areas has been used as a delivery route in these studies, it is unlikely that multifocal CNS disorders will be affected in the multifocal CNS disease, as topical administration (i.e., in situ injection) is unrealistic considering the diffusive nature of the disease and associated anatomical constraints Vascular transport pathways are required to achieve proper colonization of NSCs in the tissue (s). Until now, there have been no studies evaluating the expression of molecular effectors of cell migration in NSC, and more importantly, there have been no studies dealing with how these expression of the effectors can enhance NSC neurotoxicity.

Our studies show that NSC expresses the relevant Stage 2 to 4 effectors, but noticeably lacks the Stage 1 effector: (1) NSCs (even when grown in the presence of inflammatory cytokines) are inherently E-selectin Or does not express a ligand for P-selectin ( Figure 15 ); (2) NSC lacks the expression of glycan sLe ^x , the standard selectin binding determinant; And (3) NSCs do not express the glycoprotein PSGL-1, a selectin ligand on aquatic-specific Th1 cells reported to mediate transport to the brain (Piccio, L., Rossi, B., et al. Piccio, L., Rossi, B., et al., 2002). Importantly, the expression of endothelial selectins, particularly E-selectin, is involved in the recruitment of immunological effectors in MS and EAE (Lee, SJ and Benveniste, EN 1999; Piccio, L., Rossi, B., et al 2002). Accordingly, the present inventors herein herein evaluated whether glycan manipulation of NSCs to enhance the expression of E-selectin ligands can enhance cellular proliferation and, as a result, have biological effects in MS models.

The data set of this study shows that cultured NSCs express two well-characterized neuronal cell surface molecules, CD44 and NCAM (Back, SA, Tuohy, TM, et al. 2005; Pluchino, S., Quattrini, A., et al., 2003). Notably, exofucosylation of murine NSC resulted in high expression of sLe ^x determinants primarily on these glycoproteins, programming the conversion of CD44 to the potent E-selectin ligand HCELL (Dimitroff, CJ, Lee, JY, et 2000, Dimitroff, CJ, Lee, JY, et al. 2001), and two sialofucosylated sugar forms of NCAM of about 120 kDa and about 140 kDa, designated by the present inventors as "NCAM- Lt; / RTI &gt; Blot rotation assays showed that HCELL was the major E-selectin ligand expressed on GPS-NSC (FIG. 12B ). These findings are evidenced by flow cytometric measurements after removal of NCAM-E by PI-PLC degradation, showing significant maintenance of NSC sLe ^x expression and E-Ig responsiveness (FIG. 10c ).

NCAM, a member of the immunoglobulin superfamily, is expressed in both neurons and glial cells and is commonly regarded as a mediator of cell-cell interactions that establish the physical fixation of the cell's environment to its environment. Post-translational glycan modification, consisting of a-2,8-linked polycylactic acid (PSA) on the NCAM protein core, provides unique properties in neuronal migration (Gascon, E., Vutskits, L., et al. 2007; Maness, PF and Schachner, M. 2007; Rutishauser, U. 2008), PSA-NCAM appears to play a very important role in mediating precursor cell migration in the brain (Glaser, T., Brose, C., et al. 2007 Lavdas, AA, Franceschini, I., et al., 2006; Zhang, H., Vutskits, L., et al., 2004). The present inventors' data provide the first evidence that NCAM acts as a receptor for exo fucosylation and presents an associated terminal? - (2,3) -sialyl lactosaminyl glycane capable of producing sLe ^x determinant do. After manipulation of NSCs on the cell surface, the level of PSA expression was not changed, and the induced E-selectin ligand activity was not permanent because the sLe ^x expression was completely lost within 72 hours after the enhanced fucosylation (Figures 11a-11c ) . Thus, after extravasation, a temporary return to the native NCAM would have occurred, and then the invasive NSC may have undergone CNS migration in endogenous NCAM-mediated parenchyma. In particular, murine NSCs express NCAM with α- (2,3) -sialyl lactosaminyl glycans, but our study of human NSCs (CC-2599) showed that after exopucosylation, these cells secreted only HCELL And do not express NCAM-E (Fig. 15 ); Thus, human NSCs can express the relevant sialolactosaminyl glycans that act as receptors for enhanced fucosylation only on CD44. These species differences should be considered when interpreting xenotransplant studies using human NSCs in rodent systems (Goncharova, V., Das, S., et al.

The induction of E-selectin ligand activity has a significant effect on cell transport, which functions to direct cell migration to the endothelial bases expressing E-selectin. As suggested by others, the inventors observed that NSCs present the chemokine receptors CXCR4 and integrin VLA-4 (see Figures 9a-9b ). CXCR4 expression on human NSCs (Bezzi, P., Domercq, M., et al. 2001; Flax, JD, Aurora, S., et al. 1998; Imitola, J., Raddassi, K., ) Promotes migration in vivo towards the CNS injured region where the local astrocytes and endothelium have been shown to upregulate Factor 1 alpha (SDF-1 alpha, also known as CXCL12) from cognate ligand interstitial cells (Imitola, J , Raddassi, K., et al., 2004). These observations define CXCR4 as an important step-two effector in promoting NSC withdrawal from CNS injuries. The corresponding endothelial receptor VCAM-1 for VLA-4 is also up-regulated in the inflammatory response of the brain to injury (Justicia, C., Martin, A., et al. In addition to CXCR4, only NSCs that constitutively express VLA-4 were able to accumulate around the CNS microvessels in inflamed lesions (Pluchino, S., Zanotti, L., et al. 2005) , And the VLA-4 / VCAM-1 axis also seemed to play a very important role in the migration of NSCs. Recent xenotransplant studies suggest that integrin can act as a step-1 mediator of migration on human NSCs in rat stroke models, suggesting that selectin interactions are not required in such model systems (Goncharova, V., Das, S., et al., 2014). Further studies are needed, but the various roles (s) of the integrin as a mediator of the phase 1 interaction are not limited to the inflammation model used, the host animal system, the permeability of the blood vessels, the expression of endothelial adhesion molecules at the site of inflammation, Bargatze, RF, et al., 1995; Ding, ZM, Babensee, JE, et &lt; RTI ID = 0.0 &gt; Zarbocck, A., Lowell, CA, et al., 2007). In any case, the expression of the E-selectin ligand as a step 1 effector on the NSC can compensate for the constitutive expression of CXCR4 and VLA-4, thereby optimizing the recruitment of NSCs to the inflammatory site. Thus, even though we observed that intravenously administered (non-modified) BT-NSC could invade the brain of EAE mice ( Figure 13e ), E-selectin ligand expression enhanced by the sugar- Significantly increased NSC migration. This increased neurotropism was associated with significantly reduced CNS inflammation ( Figures 14a-14i ). In addition, as shown in Figures 13a-13f , NSC accumulation in the CNS parenchyma was twice as high as GPS-NSCs than BT-NSC by day 17 post-injection, suggesting that enhanced expression of the Phase 1 effector .

In addition to enhanced neuropsychiatry, short-term acquired data also showed significantly higher spleen and GPS-NSC accumulation in the liver than BT-NSC ( Figure 13e ). These findings are consistent with studies (Politi, LS, Bacigaluppi, M., et al. 2007) that systemically administered NSCs tend to accumulate in the brain and also in the spleen and liver of mice with EAE. E-selectin expression in the spleen has been described in human, non-human primates and rodents (Alam, HB, Sun, L., et al. 2000; Drake, TA, Cheng, J., et al. (Emmgholipour, S. et al., 1996), which is characterized by inflammatory-promoting cytokines, which are characteristically expressed in CNS inflammatory conditions (Schwartzer, KM, Drager, AM, et al. , Eshaghi, SM, et al., 2013, Weishaupt, A., Jander, S., et al., 2000); Indeed, conjugation of sLe ^{x to} the polymer has been shown to significantly enhance the accumulation of this polymer in the spleen (Horie, K., Sakagami, M., et al. 2000; Horie, K., Sakagami, M. , et al. 2004), provides direct evidence that sLe ^x expression promotes delivery to the spleen. It has been reported that spleen infiltration by NSC reduces the production of inflammatory cytokines by resident spleen cells (eg, macrophages), resulting in anti-inflammatory effects (Lee, ST, Chu, K., et al. Other studies have shown that intravascularly administered NSCs inhibit peripheral neuropathy (Einstein, O., Fainstein, N., et al. 2007; Einstein, O., Grigoriadis, N., et al. 2006 ), Or CNS injuries (Martino, G. and Pluchino, S. 2006; Pluchino, S., Zanotti, L., et al. 2009; Wang, L., Shi, J ., et al., 2009). Thus, the uptake of increased spleen by enhanced expression of E-selectin ligand activity on the observed NSC may contribute to neuroprotection through immunomodulation due to increased tissue ratio of NSC versus immune cells. This concept is based on our in vitro data showing that T-cell proliferation is reduced as the ratio of injected NSCs to splenocytes is increased, even though GPS-NSC does not provide an immunomodulatory advantage compared to that observed with control NSC (Fig. 19A ).

Previous studies on cell surface exoglycosylation have used human mesenchymal stem cells in a xenograft model and found that the therapeutic effect on tissue injury, that is, the ability of peripherally engineered stem cells to become involved in inflammation sites, But did not address whether such cells could have the desired regeneration and / or tissue-protective effect (s). Although the enhancement of NSC recruitment to the CNS was observed after the injection of GPS-NSC, there was no increase in long-term engraftment of the corresponding NSCs. Thus, even though enhanced CNS infiltration has been achieved by utilizing physiological cell migration (i.e., in a non-invasive manner capable of preserving the CNS tissue microenvironmental structure), the present inventors have found that the administered NSC has a functional CNS tissue in place But did not observe the differentiation into progeny through regeneration (i. E., Through direct regeneration). In fact, we observed that administration of GPS-NSC improved the ability of endogenous neural precursors to become sparse dendritic cells ( Figs. 14d and 14e ). Thus, our findings do not support a paradigm of direct neuronal regeneration, but instead, the primary role of NSCs in CNS tissue repair is to restore neuronal recovery (ie, through indirect nerve regeneration) (Caplan, AI 2009; Hess, DC and Borlongan, CV 2008; Laterza, C., Merlini, A., et al, 2013, Phinney, DG and Prockop, DJ 2007). Consistent with this concept, undifferentiated NSCs have been reported to significantly reduce scar formation and increase survival and function of endogenous glial and neuronal cells through the secretion of neurotrophins such as LIF (Laterza, C., Merlini , A., et al., 2013). In addition, NSCs have been shown to induce indirect nerve regeneration by endogenous cells, such as BMP-4 and Noggin (Imitola, J., Raddassi, K., et al. 2004; Pluchino, S., Zanotti, L., et al 2005), which supports the formation of damage-induced growth niches.

Overall, our data indicate that glycosylation of NSCs that enhance the expression of E-selectin ligands can enhance tissue colony formation, mediate immune regulation and tissue repair without the need for sustained / prolonged engraftment of administered NSCs . Notably, despite enhanced E-selectin ligand activity, the injection of GPS-HSPC did not improve the process of EAE (in fact, HSPC injection worsens the disease. See Figures 21a-21b and Table 3 ), Suggesting that the observed neuroprotective effect of GPS-NSC is not a general feature of adult stem cells and is due to the neural restoration effect inherent to NSC. Consistent with the findings of these adult stem cell-specific biological effects (s), human HSPCs induce strong host immune rejection in mouse models of congenital keratopathies, while other adult stem cells, such as mesenchymal stem cells, (Liu, H., Zhang, J., et al. 2010). Further research is needed on the molecular mechanism (s) mediating neuroprotection by the observed NSCs, but our results suggest that cell surface glycan manipulation does not alter self-renewal capacity, differentiation potential, Suggesting that it does not alter the innate immune regulatory capacity of the immune system. Overall, the data provided herein show that the present inventors have found that E-selectin ligand expression enhanced through exo fucosylation of the NSC surface results in increased tissue recruitment at the CNS inflammation site, Leading to a model for promoting payload delivery ( Figure 23 ). Since E-selectin expression is significantly up-regulated on the endothelial basis at all inflammatory sites in humans, our investigations have shown that not only MS but also other cell-mediated processes for improving the efficacy of other stem cell therapies for catastrophic multifocal inflammatory diseases It has significant translational effects on future clinical trials using glycan manipulation.

Materials and methods

Code of Ethics: All mouse experiments were conducted in accordance with NIH guidelines for the management and use of animals under the approval of the Harvard Medical School's Harvard Medical School Public Affairs Committee. The following are details related to mouse use in these experiments. Use Justification : EAE is a useful model for human disease multiple sclerosis. There are no mathematical models, computer simulations or in vitro systems that can replace in vivo disease. Many treatments available for MS and other autoimmune diseases were tested first and the mechanism of these treatments was examined in EAE. MOG-induced EAE in C57 / BL6 mice is of great value because many knockout and transgenic mice under this background are available. Veterinary care: Mice are handled and administered in accordance with Federal, Agency and AAALAC guidelines. Procedures to minimize adverse effects : After immunization, animals are examined daily. In animals with EAE, a sagging tail (grade 1), partial hind palsy (grade 2), complete hind palsy (grade 3), limb incomplete paralysis (grade 4), dysphoria or animal death (grade 5) occur. Most animals are of grade 0 to 3, rarely animals reach grade 4 and in this case euthanasia is performed. When animals are struck by EAE, animals are provided with a gel pack to ensure access to water and access to food is allowed in the cage. Euthanasia is performed by CO2 inhalation according to the institution's guidelines.

Reagents: The following antibodies were purchased from BD Pharmingen the Gen: Function blocking mouse anti-human E- selectin (68-5H11; IgG1), rat anti-human CLA (HECA-452; IgM) , mouse anti-human sLe ^x ( Mouse PSGL-1 (KPL-1; IgG1), rat anti-mouse PSGL-1 (2PH1 and 4RA10; IgG1), mouse anti-human CD15 Mouse CD43 (S7; IgG2a), mouse anti-human CD43 (1G10; IgG1), mouse anti-human CD44 (515; IgG1), rat anti- Human CXCR4 (12G5; IgG2a), rat anti-human CD56 (NCAM16.2; IgG2b), rat anti-human CXCR4 (2B11; IgG2b) Mouse CD11a (2D7; IgG2a), rat anti-mouse CD11b (GAME-46; IgG1), rat anti-mouse CD29 (KM16; IgG2a), rat anti- mouse CD49d (IgG2a), mouse IgG1, kappa isotype, mouse IgG 2a isotype, mouse IgM isotype, rat IgG isotype, rat IgM isotype and human IgG ₁ isotype. The following secondary antibodies were also purchased from BD Farming: PE streptavidin, biotin anti-rat IgM and goat anti-mouse Ig-HRP. The following secondary antibodies were purchased from Southern Biotech: rabbit anti-human IgG-biotin, goat anti-mouse IgM-PE, goat anti-rat IgG-PE, goat anti- mouse Ig- biotin, Anti-rat Ig-HRP and goat anti-human Ig-HRP. Recombinant mouse E-selectin / human Ig chimera (E-Ig) and recombinant mouse P-selectin / human Ig chimera (P-Ig) were purchased from R & D. Mouse anti-human sLe ^x (KM93; IgM) was purchased from Calbiochem. Rat anti-mouse CD43 (1B11; IgG2a) was purchased from Biolegend. Rat anti-mouse LPAM-1 (DATK32; IgG2a) and mouse anti-SMI32 (SMI-32; IgG1) were purchased from Abcam. Mouse anti-human CD15 (80H5; IgM) was purchased from Coulter-Immunotech. PNGase F was purchased from New England Biolabs. PI-PLC, bromelain, soybean trypsin inhibitor, DNase and mouse anti-MP2 (HM-2; IgG1) were purchased from Sigma. Mouse-anti-GFP (B2, IgG _2a ) was purchased from Santa Cruz Biotechnology, Inc, Santa Cruz, CA. To-pro3 was purchased from Invitrogen. Mouse anti-human polyacid (PSA; IgG2a) was donated by Dr. Nicholas Stamatos. Fucosyl transferase VI (FTVI) enzyme was donated by Dr. Roland Wohlgemuth (Sigma-Aldrich).

cell: Mouse NSCs were isolated and cultured as previously described (Imitola, J., Comabella, M., et al., 2004; Imitola, J., Raddassi, K., et al. Briefly, dissociated NSCs (5 x 10 ⁵ cells per ml) isolated from the apical brain VZ of 12-day-old murine embryos were incubated in 5% CO ₂ at 37 ° C in uncoated 25-cm ² flasks (Falcon) (GIBCO), 1% penicillin / streptomycin (GIBCO) 8 mg / ml heparin (Sigma), 10 ng / ml leukemia inhibitor (LIF, Chemicon), 20 ng / ml bFGF (Calbiochem). NSC was used after the second subculture for most of the experiments. Single cell suspension of neural stem cells was achieved by mechanical dissociation of microspheres in Versene (Life Technologies).

For isolation of mouse HSPC, bone marrow was collected from the femur and tibia of C57BL / 6 mice and a single cell suspension was prepared. Erythrocytes were lysed using red cell lysis buffer (Sigma). Cells were then washed with a Lineage Cell Depletion Kit (Miltenyi Biotec) prior to system depletion and filtered through a 100 mu m cell strainer (BD Falcon). Cell preparations were depleted using an autoMACS ( ^TM) separator (Miltenyi Biotec.). After depletion, cells were positively screened for c-kit using CD117 MicroBeads (Miltenyi Biotec.). The generated line ^neg C-kit ^pos group (referred to as HSPC) was used for in vivo EAE mouse studies.

Chinese hamster ovary cells were transfected with full length E-selectin (CHO-E) and maintained as previously described (Dimitroff, CJ, Lee, JY, et al. The human? FGF-dependent NSC cell line CC-2599 was cultured as previously described (Imitola, J., Raddassi, K., et al. 2004) for the data presented in Figures 16 (A) Respectively.

GPS-Processing, PI-PLC and Bromelain Reaction: Procedures for GPS processing of murine NSC are as previously described for MSC (Sackstein, R., Merzaban, JS, et al. Briefly, neurons were first harvested and incubated with PBS / EDTA (0.02%) at 37 ° C for 15 minutes to dissociate into single cells. Then, the cells were washed with HBSS and counted, and HEPES 20 mM during the 37 ℃ 40 minutes, 0.1% human serum albumin and 1 mM GDP- fucose HBSS (Ca ^{+ 2} or Mg ^{2 +} no) containing 60 mU of / ml &lt; / RTI &gt; FTVI. The PI-PLC reaction was carried out at 37 占 폚 for 1 hour using 0.1 U / ml. Bromelain reaction was carried out at 37 DEG C for 1 hour in HBSS + 2% BSA + 0.1% bromelain.

Flow cytometry: aliquots of cells (2 x 10 ⁵ cells) were washed with PBS / 2% FBS and incubated with primary mAb or isotype control mAb (unconjugated or fluorescent dye conjugated). Cells were washed with PBS / 2% FBS and incubated with appropriate secondary fluorescent dye-conjugated anti-isotype antibody for indirect immunofluorescence. After washing the cells, the FITC or PE fluorescence intensity was measured using a Cytomics FC 500 MPL flow cytometer (Beckman Coulter Inc., Fullerton, CA).

Immunoprecipitation study: Cell lysates of BT-NSC or GPS-NSC were incubated with an immunoprecipitated antibody or a suitable isotype control and then incubated with protein G-agarose. Immunoprecipitates were extensively washed using Buffer A, 1% SDS containing 2% NP-40. In some experiments, immunoprecipitates were treated with N-glycosidase F (New England Biolabs) as previously described (Dimitroff, CJ, Lee, JY, et al. For Western blot analysis, all immunoprecipitates were diluted and boiled in sample buffer, then applied to SDS-PAGE, transferred to PVDF membrane and immunostained with HECA-452 or E-Ig.

Western blot analysis: BT-NSC and GPS-NSC were diluted in buffer A (150 mM NaCl, 50 mM Tris-HCl, pH 7.4, 1 mM EDTA, 20 ug / ml PMSF, 0.02% sodium azide; and protease inhibitor cocktail tablets Molecular Biochemicals) using 2% NP-40. Western blotting of the quantified protein lysate or the co-precipitated protein was performed under reducing conditions as previously described (Dimitroff, CJ, Lee, JY, et al. 2001). The blot was visualized by chemiluminescence using a Lumi-Light Western blotting substrate (Roche).

Parallel plate flow chamber attachment assay: E-selectin binding ability of BT-NSC and GPS-NSC was performed using a parallel plate flow chamber assay (Glycotech; Gaithersburg, Md.). NSC (0.5 x 10 ⁶ cells / ml, suspended in HBSS / 10 mM HEPES / 2 mM CaCl ₂ solution) was perfused over the confluent HUVEC monolayers. First, the, flow rate, and then in contact with the HUVEC monolayer for NSC at a shear stress of 0.5 dyne / cm ² was adjusted to exert shear stress of 0.5 to 30 dynes / cm ² range. The number of BT-NSC or GPS-NSC attached to the HUVEC monolayer at a shear stress of 0.5, 1, 2, 5, 10, 20 and 30 dyne / cm ² was determined in the last 15 second interval. Each test was performed at least 3 times and the values were averaged. 5 mM EDTA was added to the assay buffer to chelate the Ca ²⁺ required for selectin binding or to treat the HUVEC with the function-blocking anti-human E-selectin mAb for 5 min before use in the adhesion assay A control test was performed.

Blot Rotation Assay: Blot rotation assays have been described previously (Dimitroff, CJ, Lee, JY, et al. 2000; Fuhlbrigge, RC, King, SL, et al. 2002; Sackstein, R. and Fuhlbrigge, R. 2006), herein used to detect selectin-binding activity of NSC membranes degraded by SDS-PAGE. Western blots of NSC membrane preparations were stained with anti-CLA (HECA-452) and made semi-transparent by immersion in DMEM with 10% glycerol. The CHO-E cells were re-suspended in DMEM containing 2mM CaCl ₂ and 10% glycerol ^{(5 × 10 6 / mL)} . The blots were placed under a parallel plate flow chamber and CHO-E cells were perfused at physiologically relevant shear stress of 1.0 dyne / cm &lt; ² &gt; and the volume was adjusted to account for the increase in velocity due to the presence of 10% glycerol in the flow medium The flow rate was adjusted. Molecular weight markers were used as a guide to aid flow chamber placement over the dyed bands of interest. The number of interacting cells per mm &lt; ² &gt; was tabulated and edited as a function of molecular weight area to make an attachment histogram. Nonspecific attachment was assessed by perfusion of the CHO-E cell suspension containing 5 mM EDTA in the flow medium.

Immunization and Neural Stem Cell Injection for EAE-Injection: 1 × 10 ⁶ cells were treated with MOG 35-55 (subcutaneous injection in the lateral side), without or with GPS, NSC or bone marrow HSPC (system ^neg C-kit ^pos ) (See details in the Supplemental Materials section) and then injected into the tail vein of C57BL / 6 mice on days 9 and 13 (PI). EAE was scored in a blinded fashion; The investigator was not involved in the injection and did not know the composition of the group. The details of the rating scale are summarized in the Supplemental Materials section. BT-NSC, GPS-NSC, BT-HSPC or GPS-HSPC were injected into the tail vein of EAE mice as cell suspensions in a volume of 0.2 ml of HBSS. Simulated mice (no NSC) injected with single HBSS were used as negative controls.

Short term study: BT-NSC and GPS-NSC were treated with 5 mM CFDA-SE (Invitrogen) in RPMI containing 10% FBS for 5 min at room temperature and treated with MOG-treated on days 9 and 13 after immunization (PI) C57BL6 mice were injected intravenously. Two million NSCs in a volume of 0.2 mL HBSS were injected into each mouse on each day. The sole HBSS buffer was used to measure the background signal. BT-NSC and GPS-NSC were also injected into non-immunized animals with MOG and used to normalize the signals observed in each assayed tissue. At 16 hours post secondary NSC transfer, mice were sacrificed and perfused with 1X PBS without Ca ²⁺ and Mg ²⁺ . Brain, spinal cord, lymph node, spleen, liver and lung. The brain and spinal cord were homogenized. The resulting pellet was resuspended in 0.25% trypsin-EDTA (Invitrogen) and incubated at 37 [deg.] C for 10 minutes. The digestion process was stopped using DMEM containing 0.01% SBTI, 0.001% DNase and 0.075% BSA. The lymph node, spleen and liver were mechanically dissociated and the single-cell suspension obtained was evaluated for the frequency of CFDA-SE positive cells by flow cytometry in the FL1 channel. Flow cytometry data were analyzed and expressed as a percentage of CFDA-SE-positive events detected in 200,000 cells scanned in a narrow gate set to include NSCs. The gates were determined based on a mixture of cultured NSCs with a suspension of cells isolated from each tissue tested (brain, spinal cord, lymph node, spleen, liver and lung).

Analysis of NSC transfer to CNS: BT-NSC, GPS-NSC were labeled with PKH26 dye (Invitrogen) and injected intravenously into MOG-treated C57BL6 mice on days 9 and 13 after immunization (PI). One million NSCs in a volume of 0.2 mL HBSS were injected into each mouse on each day. The sole HBSS buffer was used to measure the background signal. On day 4 post secondary NSC delivery, mice were sacrificed and perfused with 1X PBS without Ca ²⁺ and Mg ²⁺ , and lumbar-sacral spinal cord was collected. The spinal cord was selected because the size and location of the whole brain CNS lesion was highly variable in the B6 model compared to the more predictable location (the sacral region) and also the more extensive pathology of the spinal cord (Chitnis, T., Najafian, Wang, Y., Imitola, J., et al., 2008). Then, for FACS analysis, the spinal cord was homogenized and the resulting pellet resuspended in 0.25% trypsin-EDTA (Invitrogen) and incubated at 37 ° C for 10 minutes. The digestion process was stopped using DMEM containing 0.01% SBTI, 0.001% DNase and 0.075% BSA. For histological analysis, the brain and spinal cord were snap-frozen in liquid nitrogen and stored at-80 C until fragmented. The laryngeal-sacral spinal cord or the cryostat section (20 탆) of the anterior, middle, and posterior brains was fixed with 4% paraformaldehyde for 15 minutes, then stained with the antibody of interest, and blood vessels were stained with anti-Flk- (VEGFR2, Sigma) and NSCs were stained with anti-sox-2 (Millipore) or visualized in red by PKH26 dye. The spinal cord was then homogenized and the resulting pellet resuspended in 0.25% trypsin-EDTA (Invitrogen) and incubated at 37 [deg.] C for 10 minutes. The digestion process was stopped using DMEM containing 0.01% SBTI, 0.001% DNase and 0.075% BSA. The blood vessels were visualized by Flk-1 (VEGFR2) staining.

Immunization and NSC / HSPC injection for EAE-induction: 1 × 10 ⁶ cells were immunized with MOG 35-55 (PI) without treatment with GPS or with HSPC (system ^neg C-kit ^pos ) On the 1st and 13th day, C57BL / 6 mice were injected into the tail vein. MOG 35-55 (MEVGWYRSPFSROVHLYRNGK), corresponding to the mouse sequence, is synthesized by QCB Inc. (BioBrain International Inc., Hopkinton, MI) and purified over 99% by HPLC. Mice using 0.4mg Mycobacterium tuberculosis-to Bell particulates (Mycobacterium Tuberculosis) (H37Ra, Difco , Detroit, Michigan) 0.1 ml PBS and 0.1 ml CFA 150 to 200㎍ of MOG-peptide immunized subcutaneously in the flank of the containing And injected intraperitoneally with 200ng pertussis toxin (List Laboratories, Campbell, CA) on the day of immunization and two days later. EAE was scored in a blinded fashion; The investigator was not involved in the injection and did not know the composition of the group. The following grades were used: grade 1, singleton weakening of axially sagging tail or axially sagging tailless gait; Grade 2, partial hind palsy; Grade 3, whole hind limb or partial hind limb and forelimb paralysis; Grade 4, total hindlimbs and partial forelimbs; Grade 5, dying or death of an animal. BT-NSC, GPS-NSC, BT-HSPCs and GPS-HSPC were injected into the tail vein of EAE mice as cell suspensions in a volume of 0.2 ml HBSS. Simulated mice (no NSC) injected with single HBSS were used as negative controls.

Immunohistochemical staining: Mice were sacrificed and perfused with 50 ml standard saline before any intravascular PBMCs were removed. For confocal imaging, animals were perfused intracardially with 10 ml of 4% paraformaldehyde in PBS. The brain and spinal cord were removed, embedded in OCT, rapidly frozen in liquid nitrogen and stored at -70 ° C. until sectioning. Cryostat sections (10 μm) of spinal cord were fixed with acetone or 4% paraformaldehyde and then labeled with antibodies of interest. Missing isotype-matched Ig and primary antibodies were used as negative controls. Each sample was evaluated at a minimum of three different interleaved levels. Whole tissue sections (longitudinal spinal cord sections) were evaluated for a given cell marker at 40X magnification. The number of cell staining positive for a given marker was counted in 10 40X (high magnification field) fields per section. The results of one intercept were summed and averaged across the intercepts.

Dyeing for confocal microscopy: Paraformaldehyde fixed sections (40 μm) were washed with PBS containing 4% goat serum, 0.3% BSA and 0.3% Triton, followed by overnight incubation with primary antibody and blocking solution And incubated with the secondary antibody for 2 hours. The present inventors used highly cross-adsorbed secondary antibodies (Alexa 488 and Alexa 594) to avoid cross-reactivity. Confocal microscopy was performed using a Zeiss laser scanning microscope 3D analysis software (Zeiss, Tonewood, NY) with a multitrack acquisition protocol to avoid possible duplication of the two fluorescent pigments.

The effect of GPS treatment on NSC differentiation, self-renewal ability and in vitro immunosuppressive effect : The procedure for the GPS treatment of Murine NSC is as previously described for MSC (Sackstein, R., Merzaban, JS, et al 2008). BT-NSC and GPS-NSC were compared in vitro for their ability to self-regenerate, form neural nerves, differentiate into MAP2 ⁺ neurons and inhibit the proliferation of ConA-activated lymph node cells. NSC Differentiation and Self-renewal Ability: Neurons cultured initially in FGF / EGF containing medium were plated on poly-D-lysine (PDL) -coated glass cover slips to allow proliferation and harvested, ) Or enzyme treated with FTVI (60 mU / mL), and then BT-NSC and GPS-NSC obtained were plated at a clone density of 20 cells per 쨉 l and allowed to proliferate as a nerve root for 96 hours to 5 days. Neurographic images were taken using an Axiovision microscope (NY). For neuronal, astrocytic, and rare dendritic cell differentiation, dissociated neurons were plated on PL-coated glass cover slips in 24-well plates and incubated with 1% glutamax, 1% antibiotic / And cultured in the presence of neurobasal medium containing antifungal agent and 2% B27-supplement. New medium was added every other day until day 5 and cells were immunofluorescently stained with MAP2 (neurons), GFAP (astrocytes) and NG2 (rare proliferative glial cell precursors). MAP2 ⁺ , GFAP ^+, and NG2 ⁺ cells were counted using standard stellar techniques, preventing the investigator from seeing the treatment. Co-culture of neural stem cells and lymph node cells: Lymph nodes were isolated from naive C57BL / 6 mice. Lymph node cells (LNC) were cultured as single-cell suspensions in 2x10 ⁵ cells per well in 96-well plates as previously described (Einstein, O., Fainstein, N., et al. 2007). The culture medium consisted of 10% fetal bovine serum, L-glutamine, sodium pyruvate, non-essential amino acids, 2-mercaptoethanol, HEPES and antibiotics (BioWhittaker) in the presence or absence of 2.5 ug / ml concanavalin A (ConA, Sigma) ) Was supplemented with RPMI-1640. Neurons were dissociated and first irradiated with 3,000 rads of radiation (BT) followed by GPS or no treatment. After irradiation, dissociated NSCs were added directly to LNC culture medium at different ratios with ConA stimulated LNC. The ratio of the number of tested NSCs to the number of LNCs was as follows: 1: 4, 1: 2, 1: 1, 2: 1, and 4: 1. The cells were then incubated for 48 hours before addition of thymidine. Thymidine incorporation assay was performed after 16 hours.

Evaluation of E-selectin ligand after inflammatory cytokine treatment of NSC: 1.5 x 10 ⁶ cells / well were inoculated into 6 well plates containing 3 ml growth medium per well and incubated with 10 ng / ml TNF? (R &D; 410-TRNC) (All at 10 ng / ml) using 10 ng / ml IL-1β (R &D; 401-ML), 10 ng / ml IFNv (R &D; 485-MI). After 24 hours and 48 hours, the neurons were harvested by centrifugation and stained with E-Ig for flow cytometry analysis.

Measurement of LIF mRNA : 1 x ¹⁰⁶ mouse embryonic NSCs were treated or not treated with inflammatory cytokines (IFN-v at 10 ng / ml and TNF-a at 15 ng / ml) for 24 hours. Then, total RNA was extracted using a triazole reagent, and the amount of extracted RNA was measured using an Agilent 2200 Tab station system. CDNA synthesis was performed using a high performance cDNA reverse kit (Applied Biosystems) and random hexamers. mRNA levels were measured using RT-PCR and multiples of gene expression were calculated using the 2 ^-ΔΔΔCT method. The forward primer sequence for the LIF gene was CCTACCTGCGTCTTACTCCATCA and the reverse primer was CCCCAAAGGCTCAATGGTT (Sigma). The relative expression of LIF mRNA was assayed against the GAPDH housekeeping gene, where TGCACCACCAACTGCTTAGC was used as an omni-directional primer and GGCATGGACTGTGGTCATGAG was used as a reverse primer.

Analysis of NSC transfer to CNS: BT-NSC, GPS-NSC were labeled with PKH26 dye (Invitrogen) and injected intravenously into MOG-treated C57BL6 mice on days 9 and 13 after immunization (PI). One million NSCs were injected into each mouse on each day. The sole HBSS buffer was used to measure the background signal. Mice were sacrificed at 24 or 4 days after secondary NSC delivery, perfused, and lumbar-sacral spinal cord collected. The spinal cord was selected because the size and location of the CNS lesion in the whole brain was very variable in size compared to the spinal cord with a more predictable location (the sacral region) and also with a more extensive pathology in the B6 model (Chitnis, T., Najafian Wang, Y., Imitola, J., et al., 2008). Subsequently, for flow cytometry FACS analysis, the spinal cord was homogenized and the resulting pellet resuspended in 0.25% trypsin-EDTA and incubated at 37 [deg.] C for 10 minutes. The digestion process was stopped using DMEM containing 0.01% SBTI, 0.001% DNase and 0.075% BSA. For histological analysis, the brain and spinal cord were snap-frozen in liquid nitrogen and stored at-80 C until fragmented. Cryostat sections (20 μm) of the lumbar spinal cord or anterior, middle and posterior brains were fixed and stained with antibodies of interest. The blood vessels were visualized by anti-Flk-1 (VEGFR2) and NSCs were stained with anti-sox-2 (Millipore) or visualized in red by PKH26 dye. For neuropathological analysis, cell quantification was performed by stereomicroscopic analysis of animals of different groups. The spinal cord and brain were sectioned, stained for each third section of the cervical and sacral area, and cell quantification was performed at high magnification of 3 to 5 sections. Using LSM 510 confocal microscope with power stage, the total number of cells per enantiomeric intensity and high magnification was calculated stereostatically.

Statistical Analysis- Data are expressed as means ± SEM. The statistical significance of the differences between the means was measured by 2-way ANOVA. Post-hoc multiple comparisons were performed by the Turkish t-test when the mean was found to be significantly different. Statistical significance was defined as p <0.05.

Reference literature - Example 7

Claims (53)

Promoting and / or promoting cellular transfer of a subject to a target tissue, including administering to the subject a population of cells expressing an E-selectin ligand and / or an L-selectin ligand, or promoting tissue colonization within a target tissue of a subject Wherein said population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, said cell administration comprising E-selectin expression on endothelial cells in said target tissue And / or consistent with leukocyte accumulation within said target tissue. A method of treating a disease, disorder or medical condition that manifests as an inflamed tissue and / or a damaged tissue in a subject, comprising administering to the subject a population of cells expressing an E-selectin ligand and / or L-selectin ligand, Said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population and said cell administration is performed in accordance with E-selectin expression on endothelial cells in said target tissue and / Or coinciding with leukocyte accumulation in the target tissue, wherein the population represents enhanced localization and / or colonization in the inflamed tissue and / or damaged tissue relative to the original population of cells administered. A group of cells expressing an E-selectin ligand and / or an L-selectin ligand may be administered to a subject via angiogenesis and / or direct tissue injection (i.e., directly into the affected tissue (s)) and / (I. E., Placed into a diseased tissue) into the intestinal tract and / or into the bladder and / or into the anatomical duct (biliary tract, urinary system, etc.) and / Wherein said population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, wherein said cell administration is an endothelial cell phase in said target tissue E-selectin expression and / or consistent with leukocyte accumulation within said target tissue, wherein said administered population of cells is characterized by enhanced homing, colonization and survival compared to the original population of cells Wherein at least one of the engraftment is achieved. Cell population that expresses an E-selectin ligand and / or an L-selectin ligand into a tissue and / or damaged tissue of an inflammatory subject and / or injured tissue of the subject, Comprising administering to the subject an effective amount of an E-selectin ligand and / or an L-selectin ligand at a level that exceeds the level of expression of the original cell population, Wherein said injection / placement occurs in accordance with E-selectin expression on endothelial cells in said target tissue and / or consistent with leukocyte accumulation within said target tissue. A method for promoting cell transfer, colony formation, and / or engraftment to a target tissue of a subject, comprising administering a population of cells expressing E-selectin ligand and / or L-selectin ligand through the vascular system of the subject, The group expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, and wherein said administration is performed in accordance with E-selectin expression on endothelial cells in said target tissue and / Lt; RTI ID = 0.0 &gt; leukocyte &lt; / RTI &gt; accumulation within the target tissue. Colonization and / or colonization of a population of cells within a target tissue of a subject, including direct injection of a cell population expressing an E-selectin ligand and / or L-selectin ligand into a target tissue or placement on a target tissue, Or engraftment, said population expressing an E-selectin ligand and / or an L-selectin ligand at a level that exceeds the level of expression of the native cell population, said injection comprising an E- Wherein said group is achieved consistent with expression of selectin and / or consistent with leukocyte accumulation within said target tissue, said group achieving enhanced target tissue colony formation relative to the original cell population. A method of treating a disease, disorder or medical condition that manifests as an inflamed tissue and / or a damaged tissue in a subject, comprising administering to the subject a population of cells expressing an E-selectin ligand and / or L-selectin ligand, Said population expressing an E-selectin ligand and / or L-selectin ligand at a level that exceeds the level of expression of the native cell population, said injection comprising E-selectin expression on endothelial cells in inflamed tissue and / And / or coinciding with leukocyte accumulation within the inflamed tissue and / or damaged tissue. A method of treating a tumor / malignant disease in a subject comprising administering to the subject a population of cells expressing an E-selectin ligand and / or an L-selectin ligand, wherein the population exceeds the expression level of the native cell population (S) on the endothelial cells in the tissue (s) carrying the tumor / malignant cells, and / or in combination with E / selectin ligand and / or tumor / malignant cells In association with leukocyte accumulation within the retaining tissue (s). A cell population expressing an E-selectin ligand and / or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a disease, disorder or medical condition that manifests as inflamed tissue and / or damaged tissue in a subject, E-selectin ligand and / or L-selectin ligand, wherein the population comprises an E-selectin ligand and / or L-selectin ligand at a level that exceeds the expression level of the native cell population, Selectin ligand and said treatment is performed in accordance with E-selectin expression on endothelial cells in inflamed tissue and / or damaged tissue and / or in accordance with leukocyte accumulation in inflamed tissue and / or damaged tissue and / Comprising administering the population in a manner consistent with leukocyte accumulation in inflamed tissue and / or damaged tissue. A cell population expressing an E-selectin ligand and / or an L-selectin ligand for use in the manufacture of a medicament for the treatment of a tumor / malignant disease, wherein said treatment is a cell expressing an E-selectin ligand and / Comprising administering to the subject a population of E-selectin ligands and / or L-selectin ligands, wherein the population expresses an E-selectin ligand and / or L-selectin ligand at a level that exceeds the expression level of the native cell population, Cell population in accordance with E-selectin expression on the cell and / or in accord with leukocyte accumulation in the tumor / malignant tissue. 11. A method or a population according to any one of claims 1 to 10, wherein said cell administration occurs in concert with E-selectin expression on endothelial cells and invasion of E-selectin-bearing leukocytes in target tissues. 12. A method or a population according to any one of claims 1 to 11, wherein said administration / injection occurs during infiltration of leukocytes into one / said inflamed tissue and / or damaged tissue. 13. A method or a population according to any one of claims 1 to 12, further comprising engaging the group of administered cells in an environment in which one / the inflammation has occurred and / or the damaged tissue. 14. A method or a population according to any one of claims 1 to 13, wherein the immunomodulatory effect is achieved by colonizing one or more of the cells in the inflamed tissue and / or damaged tissue. 15. A method or a population according to any one of claims 1 to 14, wherein the tissue repair effect is achieved by colonizing one or more of the tissues in which the inflammation has occurred and / or the cells administered in the injured tissue. 16. A method according to any one of claims 1 to 15, wherein the enhanced host defense / immune response effect is achieved by delivery and colonization of one / said inflamed tissue and / Method or group. 17. A method or a population according to any one of claims 1 to 16, wherein the anti-malignant tumor effect is achieved by colonizing of cells administered in one / said tumor / malignant tissue site. 18. The method according to any one of claims 1 to 17, wherein the administration / injection comprises one or a series of injections of the cell population. 19. The method according to any one of claims 1 to 18, wherein the administration / injection comprises once-daily, weekly, bi-weekly, monthly or yearly injections of the cell population Or collective. 10. A method or a population according to any one of claims 1 to 9, further comprising one or more additional administrations / injections of the cell population upon reduction of the immunomodulatory effect of the previous administration / injection in the subject. 21. The method according to any one of claims 1 to 20, wherein the cell population is administered intravenously and / or injected. 22. The method according to any one of claims 1 to 21, wherein the cell population is administered by direct injection into an inflamed tissue and / or damaged tissue. 22. A method or a population according to any one of claims 1 to 21, wherein the population of cells is placed on the inflamed tissue and / or the damaged tissue. 22. A method or a population according to any one of claims 1 to 21, wherein the population of cells is / are placed on one or more of the tissues in which the inflammation has occurred and / or the damaged tissue. 22. The method according to any one of claims 1 to 21, wherein the cell population is used in combination with other enhancers, anti-inflammatory agents or tissue scaffolds / implantable devices / gels. 26. The method according to any one of claims 1 to 25, wherein the cell population expresses E-selectin ligand and L-selectin ligand. 27. The method of any one of claims 1 to 26 wherein the E-selectin ligand and / or the L-selectin ligand is selected from the group consisting of a hematopoietic cell E- / L-selectin ligand (HCELL), a neuronal cell adhesion molecule E-selectin ligand -E), CD43E, CLA and ESL-1. 28. The method of any one of claims 1 to 27 wherein the E-selectin ligand is a hematopoietic cell E- / L-selectin ligand (HCELL) and / or a neuronal cell adhesion molecule E-selectin ligand (NCAM-E) Method or group. 29. The method according to any one of claims 1 to 28, wherein the E-selectin ligand is HCELL. 30. A method according to any one of claims 1 to 29, wherein the E-selectin ligand is NCAM-E. 31. The method according to any one of claims 1 to 30, wherein the L-selectin ligand is HCELL. 32. The method of any one of claims 1 to 31 wherein said cell population is selected from the group consisting of epithelial, endothelial, neural, fat, heart, skeletal muscle, fibroblast and immune cells (e.g. dendritic cells, monocytes, macrophages, For example, lymphocytes such as NK cells, B-lymphocytes, T-lymphocytes, or subsets of T-lymphocytes such as regulatory lymphocytes (CD4 ⁺ / CD25 ⁺ / FOXP3 ⁺ ), cytotoxic lymphocytes, (Eg, mesenchymal stem cells, hematopoietic stem cells, tissue stem / progenitor cells (eg, neurons), pancreas cells, Derived stem cells or derived pluripotent stem cells, or differentiated stem cells derived from embryonic stem cells or derived pluripotent stem cells (e. G., Embryonic stem cells, stem cells, myocyte stem cells or pulmonary stem cells), umbrella stem cells or embryonic stem cells, , Or adult stem cells Derived primary cells isolated from the differentiated primary cells or any tissues such as brain, liver, lung, bowel, stomach, fat, muscle, testes, uterus, ovary, skin, spleen, endocrine organs and bones Cells, or a culture-proliferated population of primary cells, or a culture-proliferated stem cell population, or a culture-proliferated primary cell population. 33. The method according to any one of claims 1 to 32, wherein the cell population is mesenchymal stem cells, hematopoietic stem cells, tissue stem / origin cells, umbilical cord stem cells or embryonic stem cells. 34. The method of any one of claims 1 to 33 wherein said cell population is selected from the group consisting of leukocytes (e.g., NK cells, B-lymphocytes, lymphocytes such as T-lymphocytes, or regulatory lymphocytes (CD4 ⁺ / CD25 ⁺ / FOXP3 ⁺ ), Cytotoxic T cells, etc.). &Lt; / RTI &gt; 34. The method of any one of claims 1 to 34 wherein the disease, disorder or medical condition is selected from the group consisting of direct tissue injury (e.g. burns, trauma, bed sores, etc.), ischemic / vascular events (e.g., myocardial infarction, stroke, (Eg, breast cancer, lung cancer, prostate cancer, lymphoma, leukemia, etc.), immunological / autoimmune disease (eg, Degenerative diseases such as osteoporosis, osteoarthritis, Alzheimer's disease, congenital / hereditary diseases such as graft versus host disease, multiple sclerosis, diabetes, inflammatory bowel disease, irritable bowel syndrome, rheumatoid arthritis, psoriasis, Toxic damage (eg, radiation exposure (s), chemical exposure (s)), toxic drug effects (eg, drug-induced hepatitis, drug-induced cardiac damage) (S), Alcoholic hepatitis, Alcoholic pancreatitis, Alcoholic myocardium (Eg, radiation-induced tissue damage, surgery-related complications, etc.), and / or idiopathic processes (eg, amyotrophic lateral sclerosis, Sagging sclerosis, Parsonnage-Turner Syndrome, etc.). 37. A method or a population according to any one of claims 1 to 35, wherein the disease, disorder or medical condition is diabetes. 37. A method or a population according to any one of claims 1 to 36, wherein said disease, disorder or medical condition is multiple sclerosis. 37. The method of any one of claims 1 to 37, wherein said subject is a human, non-human primate, mouse, rat, dog, cat, horse or swine, method or group. 39. The method according to any one of claims 1 to 38, wherein the subject is a human patient. 40. The method according to any one of claims 1 to 39, wherein said cell population is treated to form a modified cell population having enhanced expression of E-selectin and / or L-selectin ligand, With a viability of at least 70% after 24 hours. 40. A method or a population according to any one of claims 1 to 40, wherein said population of cells has at least 80% viability at 24 hours after said treatment. 40. A method or a population according to any one of claims 1 to 40, wherein said population of cells has at least 70% viability at 48 hours after said treatment. 43. A method or population according to any one of claims 1 to 42, wherein upon administration of the cell population to a subject, the population of cells is colonized within a tissue comprising invasive white blood cells. 44. The method of claim 43, wherein the administration is direct injection into the tissue or placement on the tissue. 44. The method of claim 43, wherein said administration is vascular administration. 43. A method or a population according to any one of claims 1 to 21 or 25 to 42, wherein the population is administered systemically via peripheral vascular access or central vascular access. 42. A method according to any one of claims 1 to 21 or 25 to 42, wherein said population is selected from the group consisting of catheter-based approaches or other vessels capable of delivering vascular bolus of cells to the intended tissue site A method or a population that is administered intravascularly into the anatomical supply vessel of the intended tissue site using an access device. 43. A method or a population according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered by introduction into the spinal canal and / or into the brain. 43. A method or a population according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered directly into the body cavity by a catheter-based approach or by direct injection. 43. A method according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered by direct focal injection using an intravascular approach or transdermal approach or by administering an anatomically accessible tissue site Administered or administered directly, and / or under the guidance of imaging techniques. 43. The method according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered by direct placement at the relevant tissue surface / site. Method or group. 43. A pharmaceutical composition according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered into a scaffold or embedded in a scaffold disposed into tissue and / or administered in a gel and / Administered, method, or group. 43. A method or a population according to any one of claims 1 to 21 or 25 to 42, wherein said population is administered into cerebrospinal fluid.

Images