KR20170127800A - Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell - Google Patents

Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell Download PDF

Info

Publication number
KR20170127800A
KR20170127800A KR1020160058402A KR20160058402A KR20170127800A KR 20170127800 A KR20170127800 A KR 20170127800A KR 1020160058402 A KR1020160058402 A KR 1020160058402A KR 20160058402 A KR20160058402 A KR 20160058402A KR 20170127800 A KR20170127800 A KR 20170127800A
Authority
KR
South Korea
Prior art keywords
lactococcus lactis
bfe920
composition
strain
lactis bfe920
Prior art date
Application number
KR1020160058402A
Other languages
Korean (ko)
Other versions
KR101898138B1 (en
Inventor
백보람
송성규
홀잡펠 빌헬름
Original Assignee
주식회사 이뮤너스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 이뮤너스 filed Critical 주식회사 이뮤너스
Priority to KR1020160058402A priority Critical patent/KR101898138B1/en
Priority to PCT/KR2017/004974 priority patent/WO2017196140A2/en
Publication of KR20170127800A publication Critical patent/KR20170127800A/en
Application granted granted Critical
Publication of KR101898138B1 publication Critical patent/KR101898138B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K10/00Animal feeding-stuffs
    • A23K10/10Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A23K10/18Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions of live microorganisms
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K50/00Feeding-stuffs specially adapted for particular animals
    • A23K50/80Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • A61K35/741Probiotics
    • A61K35/744Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/122Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells for inducing tolerance or supression of immune responses

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Polymers & Plastics (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Animal Husbandry (AREA)
  • Zoology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Marine Sciences & Fisheries (AREA)
  • Insects & Arthropods (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Birds (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Physiology (AREA)
  • Fodder In General (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Feed For Specific Animals (AREA)

Abstract

The present invention relates to a functional feed additive for fish culture, containing a Lactococcus lactis BFE920 strain capable of inducing immunoregulatory T cells. More specifically, the present invention relates to an anti-inflammatory or immune-boosting composition containing a Lactococcus lactis BFE920 strain as an active ingredient, and a use thereof. The composition containing the Lactococcus lactis BFE920 shows anti-inflammatory or immune-boosting effects, and thus the composition can be used as feed compositions or feed additives for immune-boosting functions or anti-inflammation in an individual.

Description

면역 조절 T 세포를 유도하는 락토코커스 락티스 BFE920 균주를 포함하는 수산양식 기능성 사료 첨가제{Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell}(Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T cell) which comprises an Lactococcus lactis strain BFE920 inducing immunoregulatory T cells.

본 발명은 면역 조절 T 세포를 유도하는 락토코커스 락티스 BFE920 균주를 포함하는 수산양식 기능성 사료첨가제에 관한 것으로, 구체적으로, 락토코커스 락티스 BFE920 균주를 유효성분으로 포함하는 항염증 또는 면역증진용 조성물 및 이의 용도에 관한 것이다.The present invention relates to a functional food additive for aquaculture comprising Lactococcus lactis strain BFE920 which induces immunoregulatory T cells. Specifically, the present invention relates to an anti-inflammatory or immunomodulating composition comprising Lactococcus lactis strain BFE920 as an active ingredient And its use.

넙치는 한국 수산양식에서 가장 중요한 어종이다. 다만, 수산양식의 경우 제한된 공간에서 양식이 이루어지는 바, 집단 폐사 등의 우려가 존재한다. 특히, 에드워드 감염증은 에드워드시엘라 타르다(Edwardsiella tarda) 균에 의해 유도되는 질병으로, 상기 에드워드시엘라 타르다는 세계적으로 담수어나 해산어에서 고수온, 수질악화, 부영양화와 같은 부적합한 환경 조건 아래에서 감염원(배설물, 물, 진흙)으로부터 물을 통하여 상피의 상처 또는 장을 통해 감염되어 심각한 전신성 세균성 질병을 일으키는 것으로 알려져 있다.Flounder is the most important fish species in Korean aquaculture. However, in the case of aquaculture, aquaculture takes place in a limited space, and there are concerns such as the death of a group. In particular, the Edwards infection is Edwardsiella tarda ), the Edwardian elattarta is a worldwide disease of the epithelium of the world through the water from infectious agents (feces, water, mud) under inadequate environmental conditions such as high water temperatures, deterioration of water quality and eutrophication It is known to infect through wounds or intestines and cause serious systemic bacterial disease.

한편, 프로바이오틱스는 항생물질을 의미하는 항생제(antibotics)와는 대립되는 어원적의미를 가지는 것으로 장내의 미생물 균형에 도움을 주는 미생물 제제 또는 미생물 성분으로 정의되며, 대표적으로 락토바실러스균과 비피더스균 등의 유산균이 이에 해당한다. 또한, 프로바이오틱스는 사람과 동물에 대한 독성유전자를 보유하지 않고, 병원성 물질 또한 생산하지 않아 GRAS(generally recognized as safe)로 분류된다. 따라서, 안정성이 입증된 프로바이오틱스를 이용한 사료 첨가제의 개발이 활발히 이루어지고 있다. On the other hand, probiotics are defined as microbial agents or microbial components that help to balance microbes in the intestine, which have an etymological meaning as opposed to antibiotics, which means antibiotics. Typically, probiotics are lactic acid bacteria such as Lactobacillus and Bifidus . In addition, probiotics do not possess toxic genes for humans and animals, nor produce pathogenic substances, and are classified as GRAS (generally recognized as safe). Therefore, development of a feed additive using proven probiotics has been actively conducted.

일 예로, 국내공개특허 제10-2011-035554호는 신규한 바실러스 속 CMB L1 및 락토바실러스 속 CMB201의 혼합균주 및 이를 이용한 항암 및 면역증강용 식품 조성물 및 항균활성이 있는 미생물 제제를 개시하고 있으며, 국내등록특허 제10-0977407호는 동물의 주요 탐식세포인 호중구의 각종 활성을 증가시키고 병원성 세균의 공격접종에 대한 비특이적인 방어능을 증진시키는 자이고사카로마이세스 바일리(Zygosaccharomyces bailii)의 용균 추출물을 함유하는 동물용 면역증강제 및 사료첨가제를 개시하고 있다. 그러나, 프로바이오틱스를 이용한 사료첨가제의 실제 면역활성은 미비하여, 여전히 면역활성이 우수한 프로바이오틱스를 이용한 사료첨가제에 대한 연구가 필요한 실정이다. For example, Korean Patent Laid-Open No. 10-2011-035554 discloses a mixed strain of novel Bacillus genus CMB L1 and Lactobacillus genus CMB201, a food composition for anticancer and immunity enhancement using the same, and a microorganism preparation having antimicrobial activity, Domestic Patent No. 10-0977407 discloses a method for producing a lytic extract of Zygosaccharomyces bailii which increases various activities of neutrophils, which are major phagocytic cells of animals, and enhances nonspecific defense against attack of pathogenic bacteria And an animal immunity enhancer and a feed additive containing the same. However, the practical immune activity of the feed additive using probiotics is insufficient, and studies on feed additive using probiotics still having excellent immunity activity are needed.

이러한 배경하에서, 본 발명자들은 항염증 및 면역증진 효과를 갖는 사료 첨가제를 개발하고자 예의 노력한 결과, 락토코커스 락티스 BFE920(Lactococcus lactis BFE920)가 항염증 또는 조절 면역 T 세포활성, 장내 밀착 연접 활성이 증가시키고, 장내 투과율을 감소시키며, 병원균인 에드워드시엘라 타르다의 감염에 따른 넙치의 생존율을 증가시킴을 확인하여 본 발명을 완성하였다. Under these circumstances, the present inventors have made intensive efforts to develop a feed additive having an anti-inflammatory and immunosuppressive effect. As a result, it has been found that Lactococcus lactis BFE920 enhances anti-inflammatory or regulated immune T cell activity and intestinal adhesion activity And the survival rate of flounder caused by infection with the pathogen, Edwardian elataarta, is increased. Thus, the present invention has been completed.

본 발명의 하나의 목적은 락토코커스 락티스(Lactococcus lactis) 균주를 유효성분으로 포함하는 항염증 또는 면역증진용 조성물을 제공하는 것이다.One object of the present invention is to provide a process for the preparation of Lactococcus lactis lactis ) as an active ingredient. The present invention also provides a composition for preventing or treating inflammation.

본 발명의 다른 하나의 목적은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 치료용 약학 조성물을 제공하는 것이다.Another object of the present invention is to provide a pharmaceutical composition for preventing or treating Edward's infectious disease of fish comprising Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

본 발명의 다른 하나의 목적은 상기 조성물을 어류에 투여하는 단계를 포함하는 에드워드 감염증의 예방 또는 치료방법을 제공하는 것이다. It is another object of the present invention to provide a method for preventing or treating Edward's infectious disease comprising administering the composition to fish.

본 발명의 다른 하나의 목적은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 조성물을 제공하는 것이다. Another object of the present invention is to provide a feed composition for preventing or ameliorating Edward's infectious disease of fish comprising Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

본 발명의 다른 하나의 목적은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 첨가제 조성물을 제공하는 것이다.Another object of the present invention is to provide a feed additive composition for preventing or ameliorating Edward's infectious disease of a fish containing Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

본 발명자들은 항염증 및 면역증진 효과를 나타내는 유용한 프로바이오틱스를 찾고자 다양한 연구를 수행하던 중, 락토코커스 락티스 BFE920(Lactococcus lactis BFE920)를 넙치에 식이한 결과, 항염증 또는 조절 면역 T 세포활성, 장내 밀착 연접 활성이 증가하고, 장내 투과율이 감소함을 확인하였다. 또한, 병원균인 에드워드시엘라 타르다(Edwardsiella tarda)이 감염된 넙치에 락토코커스 락티스 BFE920를 식이한 결과, 장내 투과율이 감소하고 이에 따라 넙치의 생존율을 증가함을 확인하여, 락토코커스 락티스 BFE920 균주가 어류의 항염증 또는 면역증진을 위하여 사용될 수 있음을 규명하였다. 락토코커스 락티스 BFE920 균주가 항염증 또는 면역증진 효과를 나타내는 것은 지금까지 전혀 알려지지 않았고, 본 발명자에 최초로 개발되었다는 점에서 그 의의가 매우 크다고 할 수 있다. The present inventors conducted various studies to find useful probiotics showing anti-inflammatory and immunity-enhancing effects. As a result of feeding Lactococcus lactis BFE920 to flounder, anti-inflammatory or regulated immune T cell activity, intestinal adhesion It was confirmed that the activity of synaptic activity was increased and the intestinal permeability was decreased. Also, it was confirmed that the intestinal permeability was decreased and the survival rate of the flounder was increased by lactoferriccoxyl lactis BFE920 fed to the flounder infected with the pathogenic Edwardsiella tarda . Thus, the Lactococcus lactis BFE920 strain Can be used for anti-inflammatory or immunological enhancement of fish. The Lactococcus lactis strain BFE920 exhibits antiinflammatory or immunostimulatory effects has not been known at all and can be said to be very significant in that it was first developed by the present inventor.

상기 과제를 해결하기 위하여 하나의 양태로서, 본 발명은 락토코커스 락티스 균주를 유효성분으로 포함하는 항염증 또는 면역증진용 조성물을 제공한다.In one aspect, the present invention provides an anti-inflammatory or immunomodulating composition comprising a lactococcus lactis strain as an active ingredient.

본 발명에서 사용된 용어 "락토코커스(Lactococcus)"는 일명 젖산균이라 불리는 스트렙토코커스 그룹 N1 속(genus Streptococcus Group N1)에 포함되는 락트산(젖산) 박테리아 속 균주이다. 글루코스 발효의 주된 또는 유일한 생산물, 구체적으로 락트산을 생산하는 호모퍼멘터(homofermentor)로 알려져 있다. 이들 균주는 치즈, 요구르트 등의 발효 유제품을 생산하는 낙농산업에 널리 사용되고 있다. The term " Lactococcus " used in the present invention is a lactic acid (lactic acid) bacterial strain contained in genus Streptococcus Group N1, also called lactic acid bacteria. It is known as the main or unique product of glucose fermentation, specifically a homofermentor that produces lactic acid. These strains are widely used in the dairy industry to produce fermented dairy products such as cheese, yogurt and the like.

상기 "락토코커스 락티스(Lactococcus lactis)"는 상기 락토코커스 종에 속하는 락트산(젖산) 박테리아 속 균주의 하나로, 산업적 유제품 즉, 치즈, 발효우유, 또는 유산 카제인의 생산에 이용될 수 있고, 프로바이오틱스로써 사용될 수 있다. The " Lactococcus & lactis "is one of lactic acid bacteria belonging to the above-mentioned lactococcus species and can be used for the production of industrial dairy products such as cheese, fermented milk or lactic casein and can be used as a probiotic.

본 발명에 있어서, 상기 락토코커스 락티스는 기탁번호 KCCM11383P로 기탁된 락토코커스 락티스 BFE920 균주일 수 있다.In the present invention, the Lactococcus lactis may be a Lactococcus lactis BFE920 strain deposited with the deposit number KCCM11383P.

본 발명에서 사용된 용어 "락토코커스 락티스 BFE920(Lactococcus lactis BFE920)"은 그램-양성균으로, 콩나물에서 분리된 락토코커스 락티스 균주를 의미하며, 연쇄상구균류에 대해 강한 항균활성을 가짐이 알려져 있다. As used herein, the term " Lactococcus lactis BFE920 " lactis BFE920 ) is a gram-positive bacterium, which means Lactococcus lactis strains isolated from bean sprouts and has strong antimicrobial activity against streptococci.

본 발명에 있어서, 상기 락토코커스 락티스 BFE920 균주는 IL-10, CD4-1, FOXP3, TGF-β 유전자의 상대적인 mRNA 발현을 증가시킬 수 있다.In the present invention, the Lactococcus lactis strain BFE920 can increase the relative mRNA expression of IL-10 , CD4-1 , FOXP3 and TGF-beta gene.

본 발명의 일 실시예에서, 넙치에 락토코커스 락티스 BFE920을 식이한 후 48시간 및 72시간 경과시 장내 CD4-1, IL-10, FOXP3 또는 TGF 유전자의 상대적인 mRNA 발현을 측정한 결과, 48시간 및 72시간 경과시 CD4-1, IL-10, FOXP3 또는 TGF-β 유전자의 상대적인 mRNA 발현이 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 상기의 상대적인 mRNA 발현량이 유의하게 증가함을 확인하였다(도 1). 또한, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이 한 후, 장내 IL-10, CD4-1, FOXP3, TGF 의 유전자의 상대적인 mRNA 발현을 측정한 결과, 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 상기의 상대적인 mRNA 발현량이 유의하게 증가함을 확인하였다(도 2). 따라서, 상기 락토코커스 락티스 BFE920이 면역 조절 T 세포의 활성을 증가시켜 면역 증진 활성을 나타냄을 확인하였다. In one embodiment of the present invention, relative mRNA expression of intestinal CD4-1 , IL-10 , FOXP3 or TGF- beta gene was measured 48 hours and 72 hours after lactoferriccoxyl lactis BFE920 was fed to the flounder, Relative mRNA expression of CD4-1 , IL-10 , FOXP3 or TGF-beta gene at 48 hours and 72 hours was significantly higher than that of control without Lactococcus lactis BFE920 (Fig. 1). In addition, after the lactobacillus lactis BFE920 was fed to the flounder for 30 days, intestinal IL-10 , CD4-1 , The relative mRNA expression of FOXP3 and TGF- beta genes was measured, and the relative mRNA expression level of the Lactococcus lactis BFE920 was significantly increased as compared with the control group (Fig. 2). Thus, it was confirmed that Lactococcus lactis BFE920 increased the activity of immunoregulatory T cells and exhibited immuno-promoting activity.

본 발명에 있어서, 상기 락토코커스 락티스 BFE920 균주는 밀착연접 활성을 증가시킬 수 있다. 구체적으로, 상기 락토코커스 락티스 BFE920 균주는 occludin 유전자의 상대적인 mRNA 발현을 증가시킬 수 있다. In the present invention, the Lactococcus lactis strain BFE920 can increase the tight junction activity. Specifically, the Lactococcus lactis strain BFE920 may increase the relative mRNA expression of the occludin gene.

상기 밀착연접은 밀봉 기능을 담당하는 세포 연접을 의미하는 것으로, 밀착연접 활성이 증가되는 경우, 이웃하는 세포끼리 원형질막이 밀착, 폐쇄되어 수용성 분자들이 세포 틈 사이로 누출되지 않는 효과를 나타낸다. 상기 밀착연접은 클라우딘(claudin)과 오클루딘(occludin) 단백질이 사슬 형태로 배열되어 두 세포 사이를 밀봉함으로써 연결될 수 있다.The tight junctions mean cell junctions responsible for the sealing function. When the tight junction activity is increased, the neighboring cells are in close contact with and close to the plasma membrane, so that the water-soluble molecules do not leak into the cell gap. The tight junction can be connected by sealing the two cells by arranging the claudin and occludin proteins in a chain.

본 발명의 일 실시예에서, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 장내 occludin 유전자의 상대적인 mRNA 발현을 측정한 결과, 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 발현량이 증가함을 확인하여 상기 락토코커스 락티스 BFE920이 장내 밀착 연접 활성을 증가시킴을 알 수 있었다(도 3). In one embodiment of the present invention, the relative mRNA expression of intestinal occludin gene was measured after 30 days of lacto-coccus lactis BFE920 in flounder, and the expression level of Lactococcus lactis BFE920 was increased compared to the control without the diet , It was found that the lactococcus lactis BFE920 increased intestinal adhesion activity (FIG. 3).

본 발명에 있어서, 상기 락토코커스 락티스 BFE920 균주는 장 내 투과율을 감소시킬 수 있다.In the present invention, the Lactococcus lactis strain BFE920 can reduce intramuscular permeability.

본 발명의 일 실시예에서, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 장내 투과율을 측정한 결과, 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 투과율이 감소함을 확인하여 락토코커스 락티스 BFE920이 장내 투과율을 감소시킴을 알 수 있었다(도 4). 또한, occludin 유전자의 상대적인 mRNA 발현의 증가에 따른 밀착연접 활성이 증가함을 확인하였으므로, 락토코커스 락티스 BFE920이 밀착연접을 증가시켜 장내 투과율이 감소됨을 알 수 있었다. In one embodiment of the present invention, the permeability of lactobacillus lactis BFE920 was measured after 30 days of feeding to the flounder, and as a result, it was confirmed that the permeability was lowered compared to the control group in which lactococcus lactis BFE920 was not fed, Lactis BFE920 was found to reduce intestinal permeability (Fig. 4). In addition, it was confirmed that the adhesion activity of occludin increased with increasing relative mRNA expression, so that intestinal permeability was decreased by increasing the tight junction of Lactococcus lactis BFE920.

본 발명에 있어서, 상기 락토코커스 락티스 BFE920 균주는 병원균 감염시 증가된 장내 투과율을 감소시킬 수 있다.In the present invention, the Lactococcus lactis strain BFE920 can reduce the increased intestinal permeability upon pathogen infection.

상기 병원균은 구체적으로 에드워드시엘라 타르다(Edwardsiella tarda)일 수 있으나, 이에 제한되는 것은 아니며, 장내 투과율을 증가시키는 일반적인 병원균일 수 있다. The pathogen may be, but is not limited to, Edwardsiella tarda , and may be a general hospital uniform that increases intestinal permeability.

본 발명의 일 실시예에서 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 에드워드시엘라 타르다를 경구감염시켜 장내 투과율을 측정한 결과, 락토코커스 락티스 BFE920을 30일 동안 식이하지 않고, 에드워드시엘라 타르다만을 경구감염시킨 대조군에 비해 장내 투과율이 감소함을 확인하여, 락토코커스 락티스 BFE920이 장내막 기능 개선효과를 나타냄을 알 수 있었다(도 5). In one embodiment of the present invention, the flounder was infected with Lactococcus lactis BFE920 for 30 days and then oral infected with Edwards elata tara to determine intestinal permeability. As a result, Lactococcus lactis BFE920 was not fed for 30 days, It was confirmed that the intestinal permeability was decreased compared with the control group which was orally infected with the sihella tarda strain, and Lactococcus lactis BFE920 showed the effect of improving intestinal endocardial function (FIG. 5).

본 발명에서 사용된 용어 "항염증"은 염증을 억제하는 작용을 의미하고, 본발명에서 사용된 용어 "면역증진"은 생체 내 암, 염증 등 다양한 질환에 대한 신체 방어기전을 보강하는 모든 현상을 의미한다.The term " anti-inflammatory "as used in the present invention means an action to suppress inflammation, and the term" immunity enhancement " as used in the present invention encompasses all phenomena that reinforce body defense mechanisms against various diseases such as cancer, it means.

본 발명에 있어서, 상기 면역 증진은 면역조절 T 세포 활성 증가로 유도되는 것일 수 있다. 구체적으로, 상기 면역 증진은 IL-10, CD4-1, FOXP3 또는 TGF 유전자의 상대적인 mRNA 발현의 증가로 확인할 수 있다.In the present invention, the immunoenhancement may be induced by an increase in immunoregulatory T cell activity. Specifically, the immuno-enhancement can be confirmed by an increase in the relative mRNA expression of IL-10 , CD4-1 , FOXP3 or TGF- beta gene.

상기 면역조절 T 세포는 크게 기원에 따라 natrual regulatory T 세포와 adaptive regulatory T 세포로 구분될 수 있다. natural regulatory T 세포의 경우, thymus로부터 유도되어 높은 수준의 CD25와 cytotoxic T lymophocyte(CTLA4)나 glucocorticoid-induced TNF receptor family related protein(GITR)과 같은 공동-신호전달 물질 및 foxp3를 발현하고 있다. adaptive regulatory T 세포의 경우, IL-10 및 TGF-β와 같은 사이토카인을 분비하는 것으로 알려져 있다. 또한, 면역조절 T 세포는 CD4 및 CD25이 발현되어 있으므로, 상기 IL-10, CD4-1, FOXP3 또는 TGF-β 유전자의 상대적인 mRNA 발현의 증가를 통해 면역 증진활성을 확인할 수 있다. The immunoregulatory T cells may be classified into natrual regulatory T cells and adaptive regulatory T cells according to their origin. Natural regulatory T cells are derived from thymus and express high levels of CD25 and co-signaling substances such as cytotoxic T lymphocytes (CTLA4) or glucocorticoid-induced TNF receptor family related proteins (GITR) and foxp3. In adaptive regulatory T cells, it is known to secrete cytokines such as IL-10 and TGF-β. In addition, since immunoregulatory T cells express CD4 and CD25, the IL-10 , CD4-1 , FOXP3 Or by increasing the relative mRNA expression of the TGF-beta gene.

본 발명의 일실시예에서, 넙치에 락토코커스 락티스 BFE920을 식이하고 48시간 및 72시간 경과시 또는 락토코커스르 락티스 BFE920을 30일 동안 식이한 후, 장 내 IL-10의 유전자의 상대적인 mRNA 발현을 측정한 결과, 락토코커스 락티스 BFE920을 식이하지 않은 대조군과 비교하여 상대적인 mRNA 발현량이 유의하게 증가함을 확인하여, 상기 락토코커스 락티스 BFE920이 항염증 활성을 가짐을 알 수 있었다(도 1 및 도 2). In one embodiment of the invention, the expression is a Lactococcus lactis BFE920 Halibut and 48 hours and 72 hours during or Lactococcus Le lactis BFE920 the after diet for 30 days, chapter in IL-10 gene relative to mRNA of As a result of measurement of expression, it was confirmed that the relative amount of mRNA expression was significantly increased compared with the control group in which Lactococcus lactis BFE920 was not fed, and it was found that Lactococcus lactis BFE920 had anti-inflammatory activity (Fig. 1 And Fig. 2).

본 발명의 일 실시예에서, 넙치에 락토코커스 락티스 BFE920을 식이한 후 48시간 및 72시간 경과시 장내 CD4-1, IL-10, FOXP3 또는 TGF-β 유전자의 상대적인 mRNA 발현을 측정한 결과, 48시간 및 72시간 경과시 CD4-1, IL-10, FOXP3 또는 TGF-β 유전자의 상대적인 mRNA 발현이 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 상기의 상대적인 mRNA 발현량이 유의하게 증가함을 확인하였다(도 1). 또한, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이 한 후, 장내 IL-10, CD4-1, FOXP3, TGF-β의 유전자의 상대적인 mRNA 발현을 측정한 결과, 락토코커스 락티스 BFE920을 식이하지 않은 대조군에 비해 상기의 상대적인 mRNA 발현량이 유의하게 증가함을 확인하였다(도 2). 따라서, 상기 락토코커스 락티스 BFE920이 면역 조절 T 세포의 활성을 증가시켜 면역 증진 활성을 나타냄을 확인하였다. In one embodiment of the present invention, relative mRNA expression of intestinal CD4-1, IL-10, FOXP3 or TGF-beta gene was measured at 48 hours and 72 hours after lactose cocktail lactis BFE920 was fed to the flounder, Relative mRNA expression of CD4-1, IL-10, FOXP3 or TGF-beta gene at 48 hours and 72 hours was significantly higher than that of control without Lactococcus lactis BFE920 (Fig. 1). In addition, the relative mRNA expression of IL-10, CD4-1, FOXP3 and TGF-β genes in the intestines was measured after lactose cocktail lactis BFE920 was fed to the flounder for 30 days. As a result, Lactococcus lactis BFE920 The relative mRNA expression level was significantly increased as compared to the control group (Fig. 2). Thus, it was confirmed that Lactococcus lactis BFE920 increased the activity of immunoregulatory T cells and exhibited immuno-promoting activity.

본 발명에 있어서, 상기 항염증 또는 면역 증진은 장 내에서 유도되는 것을 특징으로 하는 것일 수 있다. In the present invention, the anti-inflammatory or immunological enhancement may be induced in the intestine.

본 발명에 있어서, 상기 조성물은 사료 조성물 또는 사료 첨가제 조성물일 수 있다. In the present invention, the composition may be a feed composition or a feed additive composition.

본 발명에서 사용된 용어 "사료"는 대상생물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분을 의미한다.The term "feed" as used in the present invention means any natural or artificial diet, single meal, etc., or ingredients of the above formula for eating, drinking and digesting the subject organism.

본 발명에서 사용된 용어 "사료첨가제"는 대상생물의 생산성 향상이나 건강을 증진시키기 위해서 사료에 첨가되는 물질을 의미한다. The term "feed additive " as used in the present invention means a substance added to the feed to improve the productivity or health of the target organism.

본 발명에서는 락토코커스 락티스 BFE920을 포함하는 사료 조성물 또는 사료 첨가제 조성물을 사용하여 대상생물의 항염증 활성 또는 면역증진 활성을 나타낼 수 있다.In the present invention, a feed composition or a feed additive composition containing Lactococcus lactis BFE920 may be used to exhibit anti-inflammatory activity or immunity enhancing activity of a subject organism.

사료 첨가제로서 이용될 경우, 본 발명의 락토코커스 락티스 BFE920 또는 이의 배양물은 20 내지 90wt% 고농축액이거나 분말 또는 과립형태로 제조될 수 있다. 상기 사료 첨가제는 구연산, 후말산, 아디픽산, 젖산, 사과산 등의 유기산이나 인산나트륨, 인산칼륨, 산성 피로인산염, 폴리인산염(중합인산염) 등의 인산염이나, 폴리페놀, 카테킨, 알파-토코페롤, 로즈마리 추출물, 비타민 C, 녹차 추출물, 감초 추출물, 키토산, 탄닌산, 피틴산 등의 천연 항산화제 중 어느 하나 또는 하나 이상을 추가로 포함할 수 있다. 사료로서 이용될 경우, 상기 조성물은 통상의 사료 형태로 제제화될 수 있으며, 통상의 사료 성분을 함께 포함할 수 있다.When used as a feed additive, the Lactococcus lactis BFE920 of the present invention or a culture thereof can be prepared in the form of a 20 to 90 wt% high concentrate or in the form of a powder or granules. The feed additive may be selected from the group consisting of organic acids such as citric acid, fumaric acid, adipic acid, lactic acid and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polymerized phosphate), polyphenol, catechin, alpha-tocopherol, Extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, phytic acid, and the like. When used as a feed, the composition may be formulated in conventional feed form and may contain conventional feed ingredients.

상기 사료 첨가제 및 사료는 곡물, 예를 들면 분쇄 또는 파쇄된 밀, 귀리, 보리, 옥수수 및 쌀; 식물성 단백질 사료, 예를 들면 평지, 콩, 및 해바라기를 주성분으로 하는 사료; 동물성 단백질 사료, 예를 들면 혈분, 육분, 골분 및 생선분; 당분 및 유제품, 예를 들면 각종 분유 및 유장 분말로 이루어지는 건조 성분 등을 더 포함할 수 있으며, 이외에도 영양 보충제, 소화 및 흡수 향상제, 성장 촉진제 등을 추가로 포함할 수 있다.The feed additives and feeds may be selected from the group consisting of cereals, such as ground or crushed wheat, oats, barley, corn and rice; Feeds based on vegetable protein such as rapeseed, soybeans and sunflower; Animal protein feeds such as blood, meat, bone meal and fish meal; And dry ingredients such as various powdered milk and whey powders. In addition, nutritional supplements, digestion and absorption enhancers, growth promoters, and the like may be further included.

상기 사료 첨가제는 동물에게 단독으로 투여하거나 식용 담체 중에서 다른 사료 첨가제와 조합하여 투여할 수도 있다. 또한, 상기 사료 첨가제는 탑 드레싱으로서 또는 이들을 동물 사료에 직접 혼합하거나 또는 사료와 별도의 경구 제형으로 용이하게 동물에게 투여할 수 있다. 상기 사료 첨가제를 동물 사료와 별도로 투여할 경우, 당해 기술분야에 잘 알려진 바와 같이 약제학적으로 허용 가능한 식용 담체와 조합하여, 즉시 방출 또는 서방성 제형으로 제조할 수 있다. 이러한 식용 담체는 고체 또는 액체, 예를 들어 옥수수 전분, 락토오스, 수크로오스, 콩 플레이크, 땅콩유, 올리브유, 참깨유 및 프로필렌글리콜일 수 있다. 고체 담체가 사용될 경우, 사료 첨가제는 정제, 캡슐제, 산제, 트로키제 또는 함당정제 또는 미분산성 형태의 탑 드레싱일 수 있다. 액체담체가 사용될 경우, 사료 첨가제는 젤라틴 연질 캡슐제, 또는 시럽제나 현탁액, 에멀젼제, 또는 용액제의 제형일 수 있다. The feed additive may be administered to animals singly or in combination with other feed additives in edible carriers. The feed additives can also be administered to the animal either as a top dressing or they can be mixed directly with the animal feed or in a separate oral form separate from the feed. When the feed additive is administered separately from an animal feed, it can be prepared in an immediate release or sustained release formulation, in combination with a pharmaceutically acceptable edible carrier as is well known in the art. Such edible carriers may be solid or liquid, such as corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol. When a solid carrier is used, the feed additive can be a tablet, capsule, powder, troche or emulsion or top-dressing in finely divided form. When a liquid carrier is used, the feed additive can be a gelatin soft capsule, or a syrup or suspension, emulsion, or solution formulation.

상기 사료는 동물의 식이 욕구를 충족시키는데 통상적으로 사용되는 임의의 단백질-함유 유기 곡분을 포함할 수 있다. 이러한 단백질-함유 곡분은 통상적으로 옥수수, 콩 곡분, 또는 옥수수/콩 곡분 믹스로 주로 구성되어 있다. The feed may comprise any protein-containing organic fructose commonly used to meet an animal's dietary needs. These protein-containing flours usually consist mainly of corn, soy flour, or corn / soy flour mix.

또한, 상기 사료 첨가제 및 사료는 보조제, 예를 들어 보존제, 안정화제, 습윤제 또는 유화제, 용액 촉진제 등을 함유할 수 있다. 상기 사료 첨가제는 침투,분무 또는 혼합하여 동물의 사료에 첨가하여 이용될 수 있다.The feed additives and feeds may also contain adjuvants such as preservatives, stabilizers, wetting or emulsifying agents, solution promoters and the like. The feed additive may be used by being added to animal feed by infiltration, spraying or mixing.

다른 하나의 양태로, 본 발명은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 치료용 약학 조성물을 제공한다.In another aspect, the present invention provides a pharmaceutical composition for preventing or treating Edward's infectious disease in a fish containing Lactococcus lactis BFE920 (Accession No .: KCCM11383P) as an active ingredient.

본 발명에 있어서, 상기 어류는 뱀장어, 넙치(광어), 조피볼락, 우럭, 감성돔, 참돔, 능성어, 숭어, 농어, 전어, 고등어, 전갱이 또는 쥐치로 이루어진 군에서 선택된 1종 이상의 어류일 수 있다.In the present invention, the fish may be at least one fish selected from the group consisting of an eel, a flatfish, a rockfish, a shoal, a shrimp, a red sea bream, a lemur, a mullet, a perch, a mackerel, a horse mackerel or a rat.

본 발명에서 사용된 용어 "에드워드 감염증"는 장내 세균과에 속하는 에드워드시엘라 타르다(Edwardsiella tarda) 균에 의해서 발병하는 어류질환을 의미하는 것으로, 주로 고수온기인 초여름에서 가을까지 발생하고, 단기간에 대량폐사를 유발하지는 않지만, 장기간에 걸쳐 폐사를 가져올 수 있다. 상기 에드워드 감염증은 한국 수산양식에서 가장 중요한 어종인 넙치의 양식 산업에 큰 경제적 손실을 가져올 수 있다. 에드워드 감염증에 감염된 넙치는 복부팽만과 탈장이 특징적인 증상으로 나타나며, 복수에 혈액이 섞여있거나 유상으로 농이 관찰되고, 간은 갈색으로 고름집이 형성되며, 간, 신장은 비대하고 수막염을 수반할 수 있다.As used herein, the term " Edwards infection "refers to Edwardsiella < RTI ID = 0.0 > tarda ), which occurs mainly in the early summer, which is a high temperature, and does not induce mass mortality in a short time, but it can lead to long-term mortality. The Edwards infectious disease may cause a great economic loss to the aquaculture industry of the flounder, which is the most important species in Korean aquaculture. The flounder infected with Edwards infections is characterized by abdominal distension and hernia. The blood is mixed with ascites, the oily skin is observed, the liver is brown and the ovary is formed, and the liver and kidney are hypertrophied and may carry meningitis have.

상기 에드워드시엘라 타르다는 그람음성 세균이고, 온도 14 ℃ 내지 45 ℃, pH 4.0 내지 pH 10.0, 및 염화나트륨 0 내지 4 % 와 같이 넓은 생존 범위를 갖으며, 조건성 병원체이므로 완전히 제거하거나 감염을 철저하게 예방하기 어려운 특징을 갖는다. 에드워드시엘라 타르다는 세계적으로 담수어나 해산어에서 고수온, 수질악화, 부영양화와 같은 부적합한 환경 조건 아래에서 감염원 (배설물, 물, 진흙)으로부터 물을 통하여 상피의 상처 또는 장을 통해 감염되어 심각한 전신성 세균성 질병을 일으키는 것으로 알려져 있다.The Edwardian elata tara is a gram-negative bacterium and has a wide range of viability such as a temperature of 14 ° C to 45 ° C, a pH of 4.0 to a pH of 10.0, and a sodium chloride of 0 to 4% and is a conditional pathogen, It has characteristics that are difficult to prevent. Edward Celta Tarada is infected through wounds or intestinal epithelium from infected sources (feces, water, mud) through undesirable environments such as high water temperature, deteriorated water quality and eutrophication in freshwater or marine fishes worldwide, resulting in serious systemic bacterial diseases Is known to cause.

본 발명에 일 실시예에서 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 에드워드시엘라 타르다를 감염시켜 생존율을 측정한 결과, 락토코커스 락티스 BFE920을 30일 동안 식이하지 않고, 에드워드시엘라 타르다만을 감염시킨 대조군에 비해 생존율이 유의하게 증가됨을 확인하였다. 따라서, 락토코커스 락티스 BFE920이 에드워드시엘라 타르다로 유도되는 증상 및 폐사를 지연시키고 에드워드 감염증에 치료에 효과적임을 알 수 있었다(도 6). In one embodiment of the present invention, the survival rate of the flounder was measured by infecting Lepococcus lactis BFE920 for 30 days, followed by Edwardian elata tara. As a result, the survival rate of L. lactis BFE920 was not fed for 30 days, The survival rate was significantly increased compared to the control group infected with tarduam. Thus, it was found that Lactococcus lactis BFE920 is effective in treating Edwardian elataida-induced symptoms and mortality and treating Edward's infectious disease (Fig. 6).

본 발명에서 사용된 용어 "예방"은 상기 락토코커스 락티스 BFE920을 포함하는 조성물의 투여로 에드워드 감염증을 억제 또는 지연시키는 모든 행위를 의미한다. The term "prophylactic " as used herein refers to any action that inhibits or delays Edwardian infectious disease by administration of a composition comprising said Lactococcus lactis BFE920.

본 발명에서 사용된 용어 "치료"는 상기 락토코커스 락티스 BFE920을 포함하는 조성물의 투여로 에드워드 감염증이 호전되거나 완치되는 모든 행위를 의미한다.The term "treatment ", as used herein, refers to any action by which administration of a composition comprising Lactococcus lactis BFE920 improves or cures an Edwards infection.

상기 본 발명의 약학조성물은 약학적으로 허용가능한 담체를 추가로 포함할 수 있다. 본 발명의 용어 "약학적으로 허용가능한"이란 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다. 상기 담체는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제, 기제, 부형제, 윤활제 등 당업계에 공지된 것이라면 제한없이 사용할 수 있다.The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" of the present invention means that it exhibits properties that are not toxic to the cells or humans exposed to the composition. Such carriers may be used without limitation as long as they are known in the art such as buffers, preservatives, wetting agents, solubilizers, isotonic agents, stabilizers, bases, excipients and lubricants.

또한, 본 발명의 약학조성물은 각각 통상의 방법에 따라 산제, 과립제, 정제, 캡슐제, 현탁액, 에멀젼, 시럽, 에어로졸 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 나아가, 연고제, 로션제, 스프레이제, 패취제, 크림제, 산제, 현탁제, 겔제 또는 젤의 형태의 피부 외용제의 형태로 사용될 수 있다. 본 발명의 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.The pharmaceutical composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols or the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method . Furthermore, it can be used in the form of an external preparation for skin in the form of ointments, lotions, spray agents, patches, creams, powders, suspensions, gels or gels. Examples of carriers, excipients and diluents that can be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used.

경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 락토코커스 락티스 BFE920 균주에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트, 탈크 같은 윤활제들도 사용된다. 경구를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는 데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성 용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈 61(tween 61), 카카오지, 라우린지, 글리세로제라틴 등이 사용될 수 있다.Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like. These solid preparations may contain at least one excipient such as starch, calcium carbonate, etc., in the Lactococcus lactis strain BFE920, Sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use may include various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are simple diluents commonly used in suspension, liquid solutions, emulsions and syrups have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

한편, 본 발명의 약학조성물은 약학적으로 유효한 양으로 투여한다. 본 발명의 용어 "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분하며 부작용을 일으키지 않을 정도의 양을 의미하며, 유효용량 수준은 환자의 건강상태, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 방법, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다. 본 발명의 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고, 종래의 치료제와 순차적으로 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여, 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.Meanwhile, the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount " of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, The severity, the activity of the drug, the sensitivity to the drug, the method of administration, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors involved in the formulation or concurrent use of the drug, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiply. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.

본 발명의 약학 조성물의 투여량은 사용목적, 질환의 중독도, 환자의 연령, 체중, 성별, 기왕력, 또는 유효성분으로 사용되는 물질의 종류 등을 고려하여 당업자가 결정할 수 있다. 예를 들어, 예를 들어, 본 발명의 약학 조성물은 성인 1인당 약 0.1 ng 내지 약 100 mg/kg, 구체적으로 1 ng 내지 약 10 mg/kg로 투여할 수 있고, 본 발명의 조성물의 투여빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있다. 그러나, 투여 경로, 질병의 중증도, 성별, 체중, 연령 등에 따라서 달라질 수 있으므로, 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다. The dosage of the pharmaceutical composition of the present invention can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction to the disease, the age, weight, sex, history, or the kind of the substance used as the active ingredient. For example, the pharmaceutical composition of the present invention can be administered, for example, in an amount of from about 0.1 ng to about 100 mg / kg, in particular from 1 ng to about 10 mg / kg, per adult, May be administered once a day or several times in divided doses, although it is not particularly limited thereto. However, the dosages do not limit the scope of the present invention in any way, as it may vary depending on the route of administration, severity of disease, sex, weight, age and the like.

다른 하나의 양태로, 본 발명은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 조성물을 제공한다.In another aspect, the present invention provides a feed composition for preventing or ameliorating Edward's infectious disease in a fish comprising Lactococcus lactis strain BFE920 (accession number: KCCM11383P) as an active ingredient.

상기 락토코커스 락티스 BFE920, 어류, 에드워드 감염증, 예방 또는 사료에 대한 정의는 상기한 바와 같다. The definition of Lactococcus lactis BFE920, fish, Edwards infectious disease, prevention or feed is as described above.

본 발명에서 사용된 용어 "개선"은 상기 락토코커스 락티스 BFE920을 포함하는 조성물의 투여로 에드워드 감염증 의심 및 발병 개체의 증상이 호전되거나 이롭게 되는 모든 행위를 의미한다.As used herein, the term "improvement" means any suspicion of Edwardian infectious disease by administration of a composition comprising said Lactococcus lactis BFE920 and any action that alleviates or alleviates symptoms of the onset individuals.

다른 하나의 양태로, 본 발명은 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 조성물을 어류에 투여하는 단계를 포함하는 에드워드 감염증의 예방 또는 치료방법을 제공한다. In another aspect, the present invention provides a method for preventing or treating Edward's infectious disease, comprising the step of administering to a fish a composition comprising Lactococcus lactis strain BFE920 (accession number: KCCM11383P) as an active ingredient.

상기 에드워드 감염증, 어류, 예방 또는 치료에 대한 정의는 상기한 바와 같다. The definition of Edward infectious disease, fish, prevention or treatment is as described above.

본 발명에서 사용된 용어 "투여"는 어떠한 적절한 방법으로 어류에게 소정의 물질을 도입하는 것을 의미하며, 상기 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 경구 투여, 국소 투여, 비 내 투여, 폐 내 투여, 직장 내 투여될 수 있으나, 이에 제한되지는 않는다. 구체적으로 경구투여일 수 있다. The term "administering" as used herein means introducing a predetermined substance into fish in any suitable manner, and the administration route of the composition can be administered through any conventional route as long as it can reach the target tissue. But are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrapulmonary, rectal. Specifically, it may be orally administered.

다른 하나의 양태로, 락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 첨가제 조성물을 제공한다. In another aspect, there is provided a feed additive composition for preventing or ameliorating Edward's infestation of a fish containing Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

상기 락토코커스 락티스 BFE920, 어류, 에드워드 감염증, 예방, 개선 또는 사료 첨가제에 대한 정의는 상기한 바와 같다. The definition of Lactococcus lactis BFE920, fish, Edwards infectious disease, prevention, improvement or feed additive is as described above.

본 발명은 락토코커스 락티스 BFE920를 포함하는 조성물이 항염증 또는 면역증진효과를 가지므로, 상기 조성물을 이용하면 개체의 항염증 또는 면역을 증진시킬 수 있는 사료 조성물 또는 사료 첨가제로써 이용될 수 있다. Since the composition comprising Lactococcus lactis BFE920 has an antiinflammatory or immunomodulating effect, the present invention can be used as a feed composition or feed additive that can enhance anti-inflammation or immunity of an individual.

도 1은 넙치에 락토코커스 락티스 BFE920(Lactococcus lactis BFE920)을 식이 후 48시간 및 72시간 경과시 장내 CD4-1, IL-10, TGF - β1 FOXP3 유전자에 대한 상대적인 mRNA 발현을 확인한 그래프이다.
도 2은 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이 후 장 내 CD4-1, IL-10, TGF - β1 FOXP3 유전자의 상대적인 mRNA 발현을 확인한 그래프이다.
도 3는 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이 후 장 내 occludin 유전자의 상대적인 mRNA 발현을 확인한 그래프이다.
도 4는 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이 후 장 내 투과율을 확인한 그래프이다.
도 5은 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 다음날 에드워드시엘라 타르다(Edwardsiella tarda)를 경구감염시킨 후 72시간 경과시 장 내 투과율을 확인한 그래프이다.
도 6은 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 다음날 에드워드시엘라 타르다를 경구감염시킨 후 20일 동안 생존율을 확인한 그래프이다.
Figure 1 shows that the flounder is supplemented with Lactococcus lactis BFE920 lactis BFE920) were cultured for 48 hours and 72 hours after feeding in intestinal CD4-1 , IL-10 , TGF - β1 And FOXP3 Gt; mRNA < / RTI >
Chapter 2 diet for 30 days after the Lactococcus lactis BFE920 Halibut in CD4-1, IL-10, TGF - β1 And the relative mRNA expression of the FOXP3 gene.
FIG. 3 is a graph showing relative mRNA expression of occludin gene in intestines after feeding for 30 days with Lactococcus lactis BFE920 in flounder.
FIG. 4 is a graph showing permeability of intestines after feeding for 30 days with Lactococcus lactis BFE920 in flounder. FIG.
FIG. 5 is a graph showing the intradermal permeability of 72 hours after oral administration of Edwardsiella tarda to the flounder on the day following the 30-day feeding of Lactococcus lactis BFE920.
FIG. 6 is a graph showing the survival rate for 20 days after oral administration of Lactococcus lactis BFE920 to the flounder after oral administration to Edwardian elata tara on the day after 30 days of dieting.

이하, 하기 실시예들을 통하여 보다 상세하게 설명한다. 그러나 이들 실시예들은 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these embodiments are intended to illustrate the present invention, and the scope of the present invention is not limited to these embodiments.

실시예Example 1. 실험동물의 사육 및 식이 1. Breeding and diet of experimental animals

본 발명에 사용될 실험동물은 다음과 같이 사육시켰다. The experimental animals to be used in the present invention were bred as follows.

구체적으로, 넙치 (42.7 ± 1.61 g)는 300L의 해수가 담긴 어항에서 유지시켰고, 실험 진행 전, 7일 동안 18 ℃에서 적응시켰다.Specifically, the flounder (42.7 ± 1.61 g) was maintained in a tank containing 300 L of seawater and was adapted at 18 ° C. for 7 days before the experiment.

또한, 락토코커스 락티스 BFE920(Lactococcus lactis BFE920)을 식이하지 않은 넙치군(대조군)과 락토코커스 락티스 BFE920을 식이한 넙치군(식이군)으로 나누어 상기 락토코커스 락티스 BFE920을 임의량(ad libitum)으로 하루에 두 번씩 식이하였다. 대조군의 경우, 상업적인 배합사료(EP, Flounder Bluechip; WOOSUNGFEED Co. Ltd., Daejeon, Korea)를 식이하였고, 식이군은 107 CFU/g의 락토코커스 락티스 BFE920이 코팅된 배합사료를 식이하였다. In addition, Lactococcus lactis BFE920 ( Lactococcus Lactococcus lactis BFE920 was fed twice a day as an ad libitum by dividing it into a group of flounder (control) and a group of flounder (diet group) fed Lactococcus lactis BFE920. In the control group, diets containing 10 7 CFU / g of Lactococcus lactis BFE920 were seeded in a commercial diets (EP, Flounder Bluechip; WOOSUNGFEED Co. Ltd., Daejeon, Korea).

실시예Example 2.  2. 락토코커스Lactococcus 락티스Lactis BFE920의BFE920's 식이에On the diet 따라 유도되는 항염증 및 면역조절 T 세포의 활성 Activity of anti-inflammatory and immunoregulatory T cells induced

실시예Example 2.1: RNA 추출 및 cDNA 합성 2.1: RNA extraction and cDNA synthesis

실시예 1의 식이군 및 대조군의 장에서 RNA 추출 및 cDNA를 합성하기 위하여, 넙치의 후장조직으로부터 RNA 추출한 후, 상기 RNA를 주형으로 cDNA를 합성하였다.In order to extract RNA and cDNA from the intestinal and control groups of Example 1, RNA was extracted from the posterior tissue of the flounder, and cDNA was synthesized using the RNA as a template.

구체적으로, 락토코커스 락티스 BFE920을 식이한 넙치의 초기단계에서 항염증 활성 및 면역조절 T 세포의 활성을 확인하기 위하여, 락토코커스 락티스 BFE920을 넙치에 식이한 후, 48시간 및 72시간 경과시에 해당하는 식이군 및 락토코커스 락티스 BFE920을 식이하지 않은 대조군을 4마리씩 희생시켰다. 또한, 락토코커스 락티스 BFE920을 30일 동안 식이한 넙치의 항염증 활성 및 면역조절 T 세포의 활성을 확인하기 위하여는, 락토코커스 락티스 BFE920를 30일 동안 식이한 식이군 및 락토코커스 락티스 BFE920을 식이하지 않은 대조군을 3마리씩 희생시켰다. Specifically, in order to confirm the anti-inflammatory activity and the activity of the immunoregulatory T cells in the early stage of the flounder fed with Lactococcus lactis BFE920, Lactococcus lactis BFE920 was inoculated into the flounder, and after 48 hours and 72 hours elapsed And the control group without Lactococcus lactis BFE920 were sacrificed by 4 mice. In order to confirm the anti-inflammatory activity and immunoregulatory T cell activity of the flounder fed with Lactococcus lactis BFE920 for 30 days, Lactococcus lactis BFE920 was inoculated into a diet group for 30 days and Lactococcus lactis BFE920 Were sacrificed by 3 control groups.

다음으로, 각 군의 후장조직을 750 mL RNAlater® (Life technology, USA) 용액이 포함된 1.5 mL 마이크로튜브에 넣어 후장조직 샘플을 제조한 후, 10 mg의 후장조직 샘플을 350 uL의 RLT buffer(AllPrep DNA/RNA/Protein Mini Kit, Qiagen, USA)에 넣고, T10 basic handheld homogenizer (IKA®, 중국)을 사용하여 균질화시켰다. 상기 균질화된 용액은 AllPrep DNA/RNA/Protein Mini KiT를 사용하여 RNA를 분리한 후, 상기 RNA를 주형으로 SuperScript® III reverse transcriptase (Invitrogen, USA)를 사용하여 cDNA를 합성하였다. Next, the posterior tissue of each group was placed in a 1.5 mL microtube containing 750 mL of RNAlater ® (Life technology, USA), and 10 mg of the retinal tissue sample was added to 350 μL of RLT buffer AllPrep DNA / RNA / Protein Mini Kit, Qiagen, USA) and homogenized using a T10 basic handheld homogenizer (IKA®, China). The homogenized solution was subjected to RNA isolation using AllPrep DNA / RNA / Protein Mini KiT, and cDNA was synthesized using SuperScript® III reverse transcriptase (Invitrogen, USA) as a template.

실시예Example 2.2: 합성된 cDNA를 이용한 정량적 실시간  2.2: Quantitative real time using synthesized cDNA PCRPCR 분석 analysis

상기 식이군 및 대조군의 장에서 상대적인 mRNA 발현을 확인하기 위하여, 상기 실시예 3.1에 따라 합성된 cDNA를 주형으로 qRT-PCR을 수행하였다. QRT-PCR was performed using the cDNA synthesized according to Example 3.1 as a template in order to confirm the relative mRNA expression in the field of the dietary group and the control group.

구체적으로, 각 군의 넙치 조직으로부터 합성된 20 ng의 cDNA을 주형으로 프라이머를 사용하여 최종 반응량을 20 uL로 하여 증폭시켰고, 이때 사용한 기기는 Applied Biosystems 7500 PCR System (Life Technology, USA)를 사용하였다. PCR 사이클은 다음과 같은 과정으로 수행하였다. 먼저, 94 ℃에서 10분 동안 변성(denaturation)시키고, 94 ℃에서 15초 동안의 변성(denaturation), 62 ℃에서 42초 동안의 결합(annealing) 및 연장(extension)을 포함하는 사이클을 40번 반복하였다. 이에 따른 qRT-PCR 결과는 대조군인 β-actin ΔCT를 이용한 2-△CT 방법으로 상대적인 mRNA 발현으로 나타내었다.Specifically, 20 ng of cDNA synthesized from the flounder tissues of each group was amplified using a primer with a final reaction volume of 20 uL. The instrument used was Applied Biosystems 7500 PCR System (Life Technology, USA) Respectively. The PCR cycle was performed as follows. First, denaturation at 94 DEG C for 10 minutes, denaturation at 94 DEG C for 15 seconds, annealing at 42 DEG C for 42 seconds, and extension were repeated 40 times Respectively. The qRT-PCR result was shown by relative mRNA expression using the 2 - ΔCT method using the control group β-actin ΔCT.

또한, 상기 qRT-PCR에 사용된 프라이머는 하기와 같다. The primers used in the qRT-PCR were as follows.

프라이머primer 서열(5'->3')Sequences (5 '-> 3') 타겟 유전자Target gene OF-β-actin-RT-F
(서열번호 1)
OF-beta-actin-RT-F
(SEQ ID NO: 1)
TGCAGAAGGAGATCACAGCCTGCAGAAGGAGATCACAGCC β-actinβ-actin
OF-β-actin-RT-R
(서열번호 2)
OF-beta-actin-RT-R
(SEQ ID NO: 2)
ACTCCTGCTTGCTGATCCACACTCCTGCTTGCTGATCCAC β-actinβ-actin
OF-CD4-1-RT-F
(서열번호 3)
OF-CD4-1-RT-F
(SEQ ID NO: 3)
AGTGAGCACGGACAATGGAGAGTGAGCACGGACAATGGAG CD4-1CD4-1
OF-CD4-1-RT-R
(서열번호 4)
OF-CD4-1-RT-R
(SEQ ID NO: 4)
CACGATGACTGAAGCGATGCCACGATGACTGAAGCGATGC CD4-1CD4-1
OF-FOXP3-RT-F
(서열번호 5)
OF-FOXP3-RT-F
(SEQ ID NO: 5)
CACACTGGGTTGAGGACAGGCACACTGGGTTGAGGACAGG FOXP3FOXP3
OF-FOXP3-RT-R
(서열번호 6)
OF-FOXP3-RT-R
(SEQ ID NO: 6)
AGCCATGCTGGGATAACTCCAGCCATGCTGGGATAACTCC FOXP3FOXP3
OF-IL10-RT-F
(서열번호 7)
OF-IL10-RT-F
(SEQ ID NO: 7)
GCCTCACGTGGAGTCCATACAGCGCCTCACGTGGAGTCCATACAGC IL-10IL-10
OF-IL10-RT-R
(서열번호 8)
OF-IL10-RT-R
(SEQ ID NO: 8)
GCTCGCCCATGGCTTTATATAGACCGCTCGCCCATGGCTTTATATAGACC IL-10IL-10
OF-TGF-β-RT-F
(서열번호 9)
OF-TGF-? -RT-F
(SEQ ID NO: 9)
CAGCGAACACGAGCCAAACACCAGCGAACACGAGCCAAACAC TGF-β1TGF-β1
OF-TGF-β-RT-R
(서열번호 10)
OF-TGF-? -RT-R
(SEQ ID NO: 10)
TGTTCTGAGGGATGGACATGGTGTGTTCTGAGGGATGGACATGGTG TGF-β1TGF-β1

실시예Example 2.3:  2.3: 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 식이한Dietary 후 초기단계에서 유도되는 항염증 및 면역 조절 T 세포의 활성  The activity of anti-inflammatory and immunoregulatory T cells induced in early stage

넙치에 락토코커스 락티스 BFE920을 식이한 후 초기단계에서 락토코커스 락티스 BFE920이 항염증 및 면역 조절 T 세포의 활성에 미치는 영향을 확인하기 위하여, 락토코커스 락티스 BFE92 식이 후 48시간 및 72시간마다 식이군의 장에서 CD4-1, IL-10, TGF - β1 FOXP3 유전자의 상대적인 mRNA 발현을 확인하고, 이를 락토코커스 락티스 BFE920을 식이하지 않은 대조군과 비교하였다. To investigate the effect of Lactococcus lactis BFE920 on the activity of anti-inflammatory and immunoregulatory T cells in the initial stage after lacto-coccus lactis BFE920 was fed to the flounder, 48 hours and 72 hours after the Lactococcus lactis BFE92 diet In the intestinal tract , CD4-1 , IL-10 , TGF - β1 And the relative mRNA expression of the FOXP3 gene were compared and compared with the control group in which Lactococcus lactis BFE920 was not fed.

구체적으로, 실시예 2.1 및 실시예 2.2의 방법으로 후장조직을 추출하여 얻어진 RNA로 cDNA를 합성하고, 이를 주형으로, qRT-PCR을 수행하여, 각 유전자에 대한 상대적인 mRNA 발현을 확인하였다. Concretely, cDNA was synthesized from the RNA obtained by extracting the posterior tissues by the methods of Example 2.1 and Example 2.2, and qRT-PCR was performed using the RNA as a template to confirm mRNA expression relative to each gene.

실험결과, 넙치에 락토코커스 락티스 BFE920을 식이한 후 48시간 경과시 상기 CD4-1, IL-10, TGF - β1 FOXP3 유전자에 대한 상대적인 mRNA 발현이 대조군과 비교하여 증가됨을 확인하였고, 특히 IL-10 유전자에 대한 상대적인 mRNA 발현은 대조군과 비교하여 약 6배 이상 증가됨을 확인하였다(도 1). As a result of the experiment, when 48 hours after the lactobacillus lactis BFE920 was fed to the flounder, the CD4-1, IL-10, TGF - β1 And FOXP3 genes were increased in comparison with the control group. In particular, mRNA expression relative to the IL-10 gene was increased by about 6-fold compared to the control group (FIG. 1).

또한, 넙치에 락토코커스 락티스 BFE920을 식이한 후, 72시간 경과시 CD4-1 유전자의 상대적인 mRNA 발현이 대조군과 비교하여 약 2배, IL-10, TGF - β1 FOXP3 유전자의 상대적인 mRNA 발현이 대조군과 비교하여 약 3배 이상 증가됨을 확인하였다(도 1).In addition, the relative mRNA expression of CD4-1 gene was about twice that of the control group after 72 hours of lacto-coccus lactis BFE920 fed to the flounder, and IL-10 , TGF - β1 And the relative mRNA expression of the FOXP3 gene was increased by about 3 times as compared with the control group (Fig. 1).

따라서, 넙치에 락토코커스 락티스 BFE920을 식이하여 장 내 상기 CD4-1, IL-10, TGF - β1 FOXP3 유전자의 상대적인 mRNA 발현이 대조군에 비해 증가됨을 확인하여, 넙치에서 락토코커스 락티스 BFE920의 식이에 따라 항염증 및 면역 조절 T 세포의 활성 증가가 유도됨을 알 수 있었다. Therefore, the flounder was inoculated with Lactococcus lactis BFE920 to induce CD4-1, IL-10 , TGF - β1 And FOXP3 The relative mRNA expression of the gene was found to be increased compared with the control group, and it was found that the activity of anti-inflammatory and immunoregulatory T cells was induced by the diet of Lactococcus lactis BFE920 in flounder.

실시예Example 2.4:  2.4: 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 30일 동안  For 30 days 식이한Dietary 후의 유도되는 항염증 및 면역조절 T 세포의 활성 Activity of anti-inflammatory and immunoregulatory T cells

넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 락토코커스 락티스 BFE920이 항염증 및 면역 조절 T 세포의 활성에 미치는 영향을 확인하였다.The effect of Lactococcus lactis BFE920 on the activity of anti - inflammatory and immunoregulatory T cells was determined after feeding 30 days of lactococcus lactis BFE920 to flounder.

구체적으로, 락토코커스 락티스 BFE920을 30일 동안 식이한 후, 실시예 2.3의 방법으로 장 내 CD4-1, IL-10, TGF - β1 FOXP3 유전자의 상대적인 mRNA 발현을 확인하고, 이를 락토코커스 락티스 BFE920을 식이하지 않은 대조군과 비교하였다.Specifically, Lactococcus lactis after BFE920 a diet for 30 days, chapter by way of example 2.3 in CD4-1, IL-10, TGF - β1 And the relative mRNA expression of the FOXP3 gene were compared and compared with the control group in which Lactococcus lactis BFE920 was not fed.

실험결과, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 장내 CD4-1, IL-10, TGF - β1 FOXP3 유전자에 대한 상대적인 mRNA 발현이 대조군과 비교하여 유의하게 증가함을 확인하였다(도 2). As a result, the flounder was fed with Lactococcus lactis BFE920 for 30 days and intestinal CD4-1 , IL-10 , TGF - β1 And mRNA expression relative to the FOXP3 gene was significantly increased compared to the control (Fig. 2).

따라서, 상기 결과를 통해, 락토코커스 락티스 BFE920가 항염증 활성 및 면역 조절 T 세포의 활성을 유도함을 알 수 있었다. Thus, from the above results, it was found that Lactococcus lactis BFE920 induces anti-inflammatory activity and activity of immunoregulatory T cells.

실시예Example 3.  3. 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 30일 동안  For 30 days 식이한Dietary 후의  Later 장내막Intestinal intestine 기능 개선  Improvements

실시예Example 3.1:  3.1: 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 30일 동안  For 30 days 식이한Dietary 후의 밀착연접 활성 Adhesion activity

넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 락토코커스 락티스 BFE920이 장 내막에서 밀착연접 활성에 미치는 영향을 확인하였다. The effect of Lactococcus lactis BFE920 on the adhesion activity in the intestinal lining after 30 days of lacto - coccus lactis BFE920 was determined.

구체적으로, 락토코커스 락티스 BFE920을 30일 동안 식이한 후, 실시예 2.3의 방법으로 장 내 occludin 유전자의 상대적인 mRNA 발현을 확인하고, 이를 락토코커스 락티스를 식이하지 않은 대조군과 비교하였다. 이때, 상기 occludin 유전자의 상대적인 mRNA 발현을 확인하기 위하여, occludin 유전자에 대한 프라이머로 OF-OCLN-RT-F(5'-TCTTTGCTCTGAAGACCCGC-3', 서열번호 11) 및 OF-OCLN-RT-R(5'-ATTGTTCACCCATGCCTCCA-3', 서열번호 12)를 이용하였고, 대조군인 β-actin ΔCT를 이용한 2-△CT 방법으로 상대적인 mRNA 발현으로 나타내었다.Specifically, after lactose cocktail lactis BFE920 was fed for 30 days, the relative mRNA expression of the occludin gene in the intestine was confirmed by the method of Example 2.3 and compared with the control group in which Lactococcus lactis was not fed. In order to confirm the relative mRNA expression of the occludin gene, OF-OCLN-RT-F (5'-TCTTTGCTCTGAAGACCCGC-3 ', SEQ ID NO: 11) and OF- '-ATTGTTCACCCATGCCTCCA-3', SEQ ID NO: 12) and relative mRNA expression by the 2 - ΔCT method using the control group β-actin ΔCT.

실험 결과, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 장내 occludin 유전자에 대한 상대적인 mRNA 발현이 대조군과 비교하여 유의하게 증가함을 확인하였다(도 3).As a result of the experiment, it was confirmed that relative mRNA expression in the intestinal occludin gene was significantly increased after the lactobacillus lactis BFE920 was fed to the flounder for 30 days (FIG. 3).

따라서, 상기 결과를 통해, 넙치에서 락토코커스 락티스 BFE920가 장내 밀착 연접 활성을 증가시킴을 알 수 있었다. Therefore, it was found from the above results that the lactococcus lactis BFE920 increased the intestinal adhesion activity in the flounder.

실시예Example 3.2:  3.2: 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 30일 동안  For 30 days 식이한Dietary 후 장내 투과율 After-field transmittance

넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후, 장 내막에서 밀착 연접 활성이 증가함을 확인하였으므로, 상기 활성을 통해 락토코커스 락티스 BFE920이 장내 투과율에 영향을 미치는지 확인하였다.After 30 days of lacto-coccus lactis BFE920 was fed to the flounder, it was confirmed that the tight junction activity increased in the intestinal lining. Therefore, it was confirmed through the above activity that Lactococcus lactis BFE920 had an effect on intestinal permeability.

구체적으로, 락토코커스 락티스 BFE920을 30일 동안 식이한 후 FITC-dex 4 kDa(fluorescein isothiocyanate-dextran 4,000 Da; Sigma-Aldrich, St. Louis, USA)를 사용하여 장내 투과율을 확인하고, 이를 락토코커스 락티스 BFE920을 식이하지 않은 대조군과 비교하였다.Specifically, Lactococcus lactis BFE920 was inoculated for 30 days and then the intestinal permeability was determined using FITC-dex 4 kDa (fluorescein isothiocyanate-dextran 4,000 Da; Sigma-Aldrich, St. Louis, USA) Lactis BFE920 was compared to a non-dietary control.

상기 장내 투과율 실험은 다음과 같이 수행하였다. 락토코커스 락티스 BFE920을 30일 동안 식이한 후 6시간 동안 굶기고 나서, 위관영양법(oral gavage)을 통해 500 mg/kg의 FITC- dex 4 kDa를 대조군 및 식이군의 4마리에 주입하였다. 한 시간 경과 후, 상기 넙치로부터 600 uL의 혈액 샘플을 1.5 mL 마이크로튜브에 수집하였다. 13000 rpm, 4 ℃에서 10분 동안 상기 혈액샘플을 원심분리하여 혈장 샘플을 얻었고, 1:1 비율로 인산 완충 용액(phosphate buffered saline, PBS)으로 희석시켰다. 100 uL의 상기 희석된 혈장 샘플은 Corning™ Costar™ 96-well black solid plate (Thermo Fisher Scientific Inc., USA)에 두었다. 각 샘플의 형광강도는 485 nm/535 nm 범위에서 VICTOR2 D fluorometer를 사용하여 측정하였다. The intestinal permeability experiment was performed as follows. Lactococcus lactis BFE920 was fed for 30 days and then starved for 6 hours. FITC-dex 4 kDa of 500 mg / kg was injected via oral gavage into 4 of the control and dietary groups. One hour later, 600 uL blood samples from the flounder were collected in 1.5 mL microtube. The blood samples were centrifuged at 13000 rpm, 4 ° C for 10 minutes to obtain plasma samples, which were diluted 1: 1 with phosphate buffered saline (PBS). 100 uL of the diluted plasma samples were placed in a Corning (TM) Costar (TM) 96-well black solid plate (Thermo Fisher Scientific Inc., USA). Fluorescence intensity of each sample was measured using a VICTOR 2 D fluorometer at 485 nm / 535 nm.

실험 결과, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이한 후 장내 투과율은 2.30±0.02 ug/mL로, 4.16±0.23 ug/mL의 투과율을 나타내는 대조군과 비교하여 유의하게 낮음을 확인하였다(도 4).As a result of the experiment, it was confirmed that the permeability of intestines was 2.30 ± 0.02 ug / mL when the lactobacillus lactis BFE920 was fed to the flounder for 30 days, which was significantly lower than that of the control group which had a permeability of 4.16 ± 0.23 ug / mL 4).

따라서, 상기 결과를 통해서, 락토코커스 락티스 BFE920의 식이에 따라 장 내막에서 밀착 연접 활성이 증가하고 이에 의해 장내 투과율이 감소됨을 알 수 있었다. Therefore, it was found from the above results that the intestinal lining activity was increased in the intestinal lining according to the diet of Lactococcus lactis BFE920, thereby reducing intestinal permeability.

실시예Example 3.3:  3.3: 락토코커스Lactococcus 락티스Lactis BFE920을BFE920 30일 동안  For 30 days 식이한Dietary  after 에드워드시엘Edward Siegel 라 타르다(La Tarda ( Edwardsiella tardaEdwardsiella tarda )의 경구 감염에 따른) Due to oral infection 장내 투과율Intestinal permeability

에드워드시엘라 타르다는 lipopolisaccahride (LPS)를 가지는 그람음성 병원균이고, 장내에서 염증을 유발할 수 있는 능력을 가지고 있으므로, 병원균으로 선택하였고 상기 병원균의 감염에 따른 장내 투과율에 있어 락토코커스 락티스 BFE920이 미치는 영향을 확인하였다. Edward Celta Tarada is a gram-negative pathogen with lipopolisaccahride (LPS) and has the ability to induce inflammation in the intestine. Therefore, it was selected as a pathogen and the effect of Lactococcus lactis BFE920 on intestinal permeability Respectively.

구체적으로, 락토코커스 락티스 BFE920을 30일동안 식이한 다음날 상기 병원균을 감염시킨 후, 72시간 경과시에 FITC-dex 4 kDa을 사용하여 장내 투과율을 측정하였다. 한편, 락토코커스 락티스 BFE920을 30일 동안 식이하지 않고 다음날 상기 병원균을 감염시킨 넙치를 대조군으로 사용하였다.Specifically, intestinal permeability was measured using FITC-dex 4 kDa at 72 hours after infecting the pathogens the day after lactose cocktail lactis BFE920 was fed for 30 days. On the other hand, a flounder infected with the above pathogenic bacteria was used as a control group for the next day without lactating Lactococcus lactis BFE920 for 30 days.

상기 병원균인 에드워드시엘라 타르다의 감염은 다음과 같이 수행하였다. 먼저, 에드워드시엘라 타르다는 brain heart infusion(BHI) 배지(Beckton, Dickinson and Company, Sparks, USA)에서 30 ℃, 200 rpm으로 교반하여 밤새도록 배양하였다. 식이 31일 경과시에 각 그룹마다 임의로 선택된 4마리의 넙치에 상기 밤새도록 배양시킨 에드워드시엘라 타르다(1 - 2 X 105 CFU/g fish)를 경구투여하여 감염시킨 후, 72시간 경과시에 상기 실시예 3.2의 방법으로 장내 투과율 실험을 수행하였다.The infection of the above pathogen Edwardian elataarda was performed as follows. First, Edward Celta Tarda was incubated overnight at 30 ° C with 200 rpm in brain heart infusion (BHI) medium (Beckton, Dickinson and Company, Sparks, USA). At the end of the 31st day of the experiment, 4 groups of flounders randomly selected for each group were orally administered with the above Edwardian elata tara (1 - 2 X 10 5 CFU / g fish) The intracavity transmittance experiment was performed by the method of Example 3.2 above.

실험 결과, 넙치에 락토코커스 락티스 BFE920을 30일 동안 식이하고, 다음날 에드워드시엘라 타르다를 경구로 감염시킨 후 72시간 경과시 식이군의 장내 투과율은 혈장 FITC-dex 4 kDa의 값이 2.35 ± 0.04 ug/mL로, 락토코커스 락티스 BFE920을 30일 동안 식이하지 않고, 다음날 에드워드시엘라 타르다를 경구로 감염시킨 후 72시간 경과시 대조군의 장내 투과율(혈장 FITC-dex 4 kDa의 값: 14.98 ± 3.95 ug/mL)과 비교하여 감소됨을 확인하였다(도 5).As a result of the experiment, the intestinal permeability of the diet group was 2.35 ± 0.04 in plasma FITC-dex 4 kDa at 72 hours after oral administration of Lactococcus lactis BFE920 to the flounder for 30 days and oral administration of Edwardian elata tara the following day (plasma FITC-dex 4 kDa value: 14.98 +/- 3.95 (mg / mL) in the control group at 72 hours after oral administration of Lactococcus lactis BFE920 for 30 days and the next day by oral administration of Edwardian elata tara ug / mL) (FIG. 5).

따라서, 따라서, 상기 결과를 통해서, 병원균으로 유도되는 장내 투과율의 증가를 락토코커스 락티스 BFE920의 식이를 통해 회복시킴에 따라 락토코커스 락티스 BFE920이 장내막 기능 개선 효과를 나타냄을 알 수 있었다. Therefore, through the above results, it was found that Lactococcus lactis BFE920 exhibited an intestinal endothelial function-improving effect as an increase in intestinal permeability induced by pathogens was restored through the diet of Lactococcus lactis BFE920.

실시예Example 4.  4. 에드워드시엘라Edward Sierra 타르다 감염에 대한 질병 저항성 Disease resistance to tara infection

락토코커스 락티스 BFE920이 병원균인 에드워드시엘라 타르다 감염에 따른 질병 저항성에 미치는 영향을 확인하였다. The effect of Lactococcus lactis BFE920 on disease resistance following infection with the pathogen, Edwards Celta tara, was confirmed.

구체적으로, 넙치에 락토코커스 락티스 BFE920을 30일동안 식이한 다음날 상기 병원균을 경구감염시킨 후 20일 동안의 생존율을 측정하였다. 한편, 상기 락토코커스 락티스 BFE920을 30일 동안 식이하지 않고, 병원균을 감염시시킨 넙치를 대조군으로 사용하였다. Specifically, the survival rate of the flounder was measured for 20 days after oral administration of the above-mentioned pathogens after lactose cocktail lactis BFE920 was fed for 30 days. On the other hand, the flukes infected with the pathogens without feeding for 30 days were used as a control group for the Lactococcus lactis BFE920.

에드워드시엘라 타르다의 감염은 락토코커스 락티스 BFE920을 30일 동안 식이하고, 31일째에 각 그룹마다 임의로 선택된 20마리씩의 넙치에 경구투여하여 감염시켰다. The infection of Edwardian elata tara was induced by feeding Lactococcus lactis BFE920 for 30 days and by oral administration to flounders of 20 animals randomly selected for each group on the 31st day.

실험 결과, 락토코커스 락티스 BFE920을 30일동안 식이한 후 에드워드시엘라 타르다를 감염시킨 식이군의 20일 동안의 생존율은 70 %로, 락토코커스 락티스 BFE920을 30일동안 식이하지 않고, 에드워드시엘라 타르다를 감염시킨 대조군의 생존율인 10 %과 비교하여, 유의하게 증가하였다(도 6). As a result of the experiment, the survival rate of the diet group in which the Lactococcus lactis BFE920 was inoculated for 30 days and then the Edwardian elata tara group was 20 days, the survival rate was 70%, the Lactococcus lactis BFE920 was not fed for 30 days, (Fig. 6), as compared to the survival rate of 10% of the control group infected with Elatata.

따라서, 상기 결과를 통해서 넙치에서 락토코커스 락티스 BFE920의 식이를 통해 에드워드시엘라 타르다로 유도되는 증상 및 폐사가 지연되는 것을 알 수 있었다. Thus, the above results show that the diet induced by Lactococcus lactis BFE920 in the flounder was delayed in Edwardian elata tara-induced symptoms and mortality.

실시예Example 5. 통계 분석 5. Statistical Analysis

락토코커스 락티스 BFE920을 식이한 후 초기단계의 넙치를 이용한 qRT-PCR 결과는 two-way ANOVA with Bonferroni’s posttest를 사용하였다. 락토코커스 락티 BFE920을 30일 동안 식이한 넙치를 이용한 qRT-PCR 결과 및 장내 투과율 실험 결과의 유효성 평가는 Graph Pad Prism 5 software을 사용하여 Turkey’s multiple comparison test와 함께 two-tailed student’s T-test 및 ANOVA(one-way analysis of variance)로 확인하였다. 락토코커스 락티스 BFE920을 식이한 후, 에드워드시엘라 타르다의 경구 감염에 따른 생존률은 생존곡선으로 나타내었고, 상기 생존곡선에 대한 유효성 평가는 Log-rank (Mantel-Cox) test을 통해 수행하였다. Two-way ANOVA with Bonferroni's posttest was used for the qRT-PCR results using flounder in the initial stage after lacto-coccus lactis BFE920. The validity of the results of qRT-PCR and intestinal permeability test using the flounder fed with Lactococcus lactis BFE920 for 30 days was evaluated using two-tailed student's T-test and ANOVA one-way analysis of variance. After Lactococcus lactis BFE920 was fed, the survival rate according to the oral infection of Edwardian elata tara was expressed by the survival curves, and the efficacy of the survival curves was evaluated by log-rank (Mantel-Cox) test.

본 명세서는 본 발명의 기술 분야에서 통상의 지식을 가진 자이면 충분히 인식하고 유추할 수 있는 내용은 그 상세한 기재를 생략하였으며, 본 명세서에 기재된 구체적인 예시들 이외에 본 발명의 기술적 사상이나 필수적 구성을 변경하지 않는 범위내에서 보다 다양한 변형이 가능하다. 따라서 본 발명은 본 명세서에서 구체적으로 설명하고 예시한 것과 다른 방식으로 실시될 수 있으며, 이는 본 발명의 기술 분야에 통상의 지식을 가진 자이면 이해할 수 있는 사항이다.It is to be understood that both the foregoing general description and the following detailed description of the present invention are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. More variations are possible within a range that does not. Accordingly, the present invention may be embodied in other ways than those specifically described and illustrated herein, and it may be understood by those skilled in the art.

한국미생물보존센터(국외)Korea Microorganism Conservation Center (overseas) KCCM11383PKCCM11383P 2013022120130221

<110> IMMUNUS Co., Ltd. <120> Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell <130> KPA160268-KR <160> 12 <170> KopatentIn 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-b-actin-RT-F <400> 1 tgcagaagga gatcacagcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-b-actin-RT-R <400> 2 actcctgctt gctgatccac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-F <400> 3 agtgagcacg gacaatggag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-R <400> 4 cacgatgact gaagcgatgc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-FOXP3-RT-F <400> 5 cacactgggt tgaggacagg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-FOXP3-RT-R <400> 6 agccatgctg ggataactcc 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-F <400> 7 gcctcacgtg gagtccatac agc 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-R <400> 8 gctcgcccat ggctttatat agacc 25 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-F <400> 9 cagcgaacac gagccaaaca c 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-R <400> 10 tgttctgagg gatggacatg gtg 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-F <400> 11 tctttgctct gaagacccgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-R <400> 12 attgttcacc catgcctcca 20 <110> IMMUNUS Co., Ltd. <120> Aquaculture functional feed additive comprising Lactococcus          lactis BFE920 inducing regulatory T Cell <130> KPA160268-KR <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OF-b-actin-RT-F <400> 1 tgcagaagga gatcacagcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <230> OF-b-actin-RT-R <400> 2 actcctgctt gctgatccac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-F <400> 3 agtgagcacg gacaatggag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-R <400> 4 cacgatgact gaagcgatgc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OF-FOXP3-RT-F <400> 5 cacactgggt tgaggacagg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-FOXP3-RT-R <400> 6 agccatgctg ggataactcc 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-F <400> 7 gcctcacgtg gagtccatac agc 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-R <400> 8 gctcgcccat ggctttatat agacc 25 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-F <400> 9 cagcgaacac gagccaaaca c 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-R <400> 10 tgttctgagg gatggacatg gtg 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-F <400> 11 tctttgctct gaagacccgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-R <400> 12 attgttcacc catgcctcca 20

Claims (15)

락토코커스 락티스(Lactococcus lactis) 균주를 유효성분으로 포함하는 항염증 또는 면역증진용 조성물.
Lactococcus lactis ) as an active ingredient.
제1항에 있어서, 상기 락토코커스 락티스는 기탁번호 KCCM11383P로 기탁된 락토코커스 락티스 BFE920 균주인 것인, 항염증 또는 면역 증진용 조성물.
The anti-inflammatory or immunomodulating composition according to claim 1, wherein the lactococcus lactis is a lactococcus lactis BFE920 strain deposited with the deposit number KCCM11383P.
제2항에 있어서, 상기 락토코커스 락티스 BFE920 균주는 IL-10, CD4-1, FOXP3, TGF 유전자의 mRNA 발현을 증가시키는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
3. The composition according to claim 2, wherein the Lactococcus lactis BFE920 strain is characterized in that mRNA expression of the IL-10 , CD4-1 , FOXP3 , and TGF- beta genes is increased.
제2항에 있어서, 상기 락토코커스 락티스 BFE920 균주는 밀착연접 활성을 증가시키는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
The anti-inflammatory or immunomodulating composition according to claim 2, wherein the Lactococcus lactis strain BFE920 is characterized by increasing the tight junction activity.
제4항에 있어서, 상기 밀착연접 활성의 증가는 occludin 유전자의 mRNA 발현을 증가시키는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
5. The composition for anti-inflammatory or immunomodulatory purposes according to claim 4, wherein the increase in the tight junction activity increases mRNA expression of the occludin gene.
제2항에 있어서, 상기 락토코커스 락티스 BFE920 균주는 장 내 투과율을 감소시키는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
3. The composition according to claim 2, wherein said Lactococcus lactis strain BFE920 is characterized by decreasing the intestinal permeability.
제2항에 있어서, 상기 락토코커스 락티스 BFE920 균주는 병원균 감염시 증가된 장 내 투과율을 감소시키는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
3. The composition of claim 2, wherein said Lactococcus lactis strain BFE920 is characterized by reduced increased intestinal permeability upon pathogen infection.
제7항에 있어서, 상기 병원균은 에드워드시엘라 타르다(Edwardsiella tarda)인 것인, 항염증 또는 면역 증진용 조성물.
8. The composition of claim 7, wherein the pathogen is Edwardsiella tarda .
제1항에 있어서, 상기 면역 증진은 면역조절 T 세포 활성 증가로 유도되는 것인, 항염증 또는 면역 증진용 조성물.
The composition according to claim 1, wherein said immunological enhancement is induced by an increase in immunoregulatory T cell activity.
제1항에 있어서, 상기 항염증 또는 면역 증진은 장 내에서 유도되는 것을 특징으로 하는 것인, 항염증 또는 면역 증진용 조성물.
The composition according to claim 1, wherein the anti-inflammatory or immunological enhancement is induced in the intestine.
제1항에 있어서, 상기 조성물은 사료 조성물 또는 사료 첨가제 조성물인 것인, 항염증 및 면역증진용 조성물.
2. The composition of claim 1, wherein the composition is a feed composition or a feed additive composition.
락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 치료용 약학 조성물.
A pharmaceutical composition for preventing or treating Edward's infectious disease in fish comprising Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.
락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 포함하는 상기 약학 조성물을 어류에 투여하는 단계를 포함하는, 에드워드 감염증 예방 또는 치료 방법.
A method for preventing or treating Edwards infection, comprising the step of administering to a fish a pharmaceutical composition comprising the Lactococcus lactis BFE920 strain (Accession No: KCCM11383P).
락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 조성물.
A feed composition for preventing or ameliorating Edward's infestation in a fish containing Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.
락토코커스 락티스 BFE920 균주(기탁번호: KCCM11383P)를 유효성분으로 포함하는 어류의 에드워드 감염증 예방 또는 개선용 사료 첨가제 조성물.A feed additive composition for preventing or ameliorating Edward's infestation of a fish containing Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.
KR1020160058402A 2016-05-12 2016-05-12 Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell KR101898138B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020160058402A KR101898138B1 (en) 2016-05-12 2016-05-12 Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell
PCT/KR2017/004974 WO2017196140A2 (en) 2016-05-12 2017-05-12 Aquaculture functional feedstuff additive comprising lactococcus lactis bfe920 strain inducing immunomodulatory t-cell.

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160058402A KR101898138B1 (en) 2016-05-12 2016-05-12 Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell

Publications (2)

Publication Number Publication Date
KR20170127800A true KR20170127800A (en) 2017-11-22
KR101898138B1 KR101898138B1 (en) 2018-09-12

Family

ID=60266661

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160058402A KR101898138B1 (en) 2016-05-12 2016-05-12 Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell

Country Status (2)

Country Link
KR (1) KR101898138B1 (en)
WO (1) WO2017196140A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102381353B1 (en) * 2021-05-31 2022-04-04 한국식품연구원 Novel lactococcus lactis wikim0124 having anti-obesity and immune-promoting activities and uses thereof

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102154254B1 (en) * 2020-04-29 2020-09-09 (주)녹십자웰빙 Novel Lactic Acid Bacteria with Excellent Immune function enhancing effect and Food Composition Containing the Same and Health Functional Food Composition Containing the Same and Probiotics comprising the Same
KR102470357B1 (en) 2022-02-15 2022-11-25 주식회사 큐옴바이오 Composition for enhancing immunity comprising of lactococcus lactis Q1

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4598954B2 (en) * 1998-10-20 2010-12-15 フラームス・インテルウニフェルシタイル・インステイチュート・フォール・ビオテヒノロヒー・ヴェーゼットウェー(ヴェーイーベー・ヴェーゼットウェー) Use of cytokine-producing Lactococcus strains for the treatment of colitis
KR20150019934A (en) * 2013-08-16 2015-02-25 한동대학교 산학협력단 Method for enhancing immunity of fish using lactococcus lactis

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB201102857D0 (en) * 2011-02-18 2011-04-06 Danisco Feed additive composition
KR101616530B1 (en) * 2013-01-10 2016-04-28 한국생명공학연구원 Lactococcus lactis KR-W.W-2 as a novel strain with antibacterial activity and use thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4598954B2 (en) * 1998-10-20 2010-12-15 フラームス・インテルウニフェルシタイル・インステイチュート・フォール・ビオテヒノロヒー・ヴェーゼットウェー(ヴェーイーベー・ヴェーゼットウェー) Use of cytokine-producing Lactococcus strains for the treatment of colitis
KR20150019934A (en) * 2013-08-16 2015-02-25 한동대학교 산학협력단 Method for enhancing immunity of fish using lactococcus lactis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Turkish Journal of Veterinary and Animal Sciences, 2014, Vol.38, pp.257-263 (2014. 4. 21.) *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102381353B1 (en) * 2021-05-31 2022-04-04 한국식품연구원 Novel lactococcus lactis wikim0124 having anti-obesity and immune-promoting activities and uses thereof

Also Published As

Publication number Publication date
WO2017196140A3 (en) 2018-08-09
KR101898138B1 (en) 2018-09-12
WO2017196140A2 (en) 2017-11-16

Similar Documents

Publication Publication Date Title
KR101614262B1 (en) Novel lactic acid bacterium, drug, food or drink, and feed which contain the novel lactic acid bacterium
JP5709883B2 (en) Novel Lactobacillus plantarum and composition containing the same
KR100878799B1 (en) Bacillus amyloliquefaciens K317 for suppressing the growth of antibiotics-resistant pathogenic microorganism or enteropathogenic microorganism
KR101750468B1 (en) Composition comprising Lactobacillus fermentum MG901 or Lactobacillus plantarum MG989
JP5031249B2 (en) Bacteria-containing composition having anti-inflammatory effect
KR102240196B1 (en) Novel lactobacillus paracasei strain
JP5300772B2 (en) Novel lactic acid bacteria and pharmaceuticals, foods and drinks, and feeds containing the novel lactic acid bacteria
JP2012510291A (en) Novel Lactobacillus plantarum and composition containing the same
KR102123505B1 (en) Lactobacillus sakei WIKIM0109 having anti-arthritis activity and composition for comprising the same
WO2018168449A1 (en) Composition for promoting production of peptidoglycan recognition protein
KR20190051771A (en) Lactobacillus plantarum WiKim0062 having anti-obesity activity and composition comprising the same
KR101749065B1 (en) Enterococcus faecium MSS2 capable of fermenting at room temperature and composition for comprising the same
KR101898138B1 (en) Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell
JP2010202557A (en) Nk activity enhancer
KR102344838B1 (en) Lactobacillus Plantarum YG1102 Strain Having Antimicrobial and Anti-Obesity Activity and Uses thereof
KR101075558B1 (en) Novel Lactobacillus plantarum and compositions comprising the same
JP5646124B1 (en) Novel lactic acid bacteria and pharmaceuticals, foods and drinks, and feeds containing the novel lactic acid bacteria
KR20160007964A (en) Lactobacillus plantarum WIKIM18 and composition for comprising the same
KR101836365B1 (en) Kimchi seasoning containing Leuconostoc mesenteroides WiKim32 and kimchi prepared by using the same
WO2017022560A1 (en) Plasmacytoid dendritic cell proliferation promoter
KR20200135145A (en) Lactobacillus paracasei wikim0110 having antibacterial activity against clostridioides difficile and composition comprising the same
KR20160039097A (en) Pediococcus pentosaceus w i k i m20 and composition comprising the same
KR102244732B1 (en) Probiotic acetic acid bacteria Acetobacter pasteurianus MGLV and its immunomodulatory effect
JPWO2020111172A1 (en) Composition for promoting antibacterial peptide production
KR102546973B1 (en) Composition for enhancing immunity comprising Bacillus velenzensis Kh2-2

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
GRNT Written decision to grant