KR20170127800A - Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T Cell - Google Patents

Abstract

The present invention relates to a functional feed additive for fish culture, containing a Lactococcus lactis BFE920 strain capable of inducing immunoregulatory T cells. More specifically, the present invention relates to an anti-inflammatory or immune-boosting composition containing a Lactococcus lactis BFE920 strain as an active ingredient, and a use thereof. The composition containing the Lactococcus lactis BFE920 shows anti-inflammatory or immune-boosting effects, and thus the composition can be used as feed compositions or feed additives for immune-boosting functions or anti-inflammation in an individual.

Description

(Aquaculture functional feed additive comprising Lactococcus lactis BFE920 inducing regulatory T cell) which comprises an Lactococcus lactis strain BFE920 inducing immunoregulatory T cells.

The present invention relates to a functional food additive for aquaculture comprising Lactococcus lactis strain BFE920 which induces immunoregulatory T cells. Specifically, the present invention relates to an anti-inflammatory or immunomodulating composition comprising Lactococcus lactis strain BFE920 as an active ingredient And its use.

Flounder is the most important fish species in Korean aquaculture. However, in the case of aquaculture, aquaculture takes place in a limited space, and there are concerns such as the death of a group. In particular, the Edwards infection is Edwardsiella tarda ), the Edwardian elattarta is a worldwide disease of the epithelium of the world through the water from infectious agents (feces, water, mud) under inadequate environmental conditions such as high water temperatures, deterioration of water quality and eutrophication It is known to infect through wounds or intestines and cause serious systemic bacterial disease.

On the other hand, probiotics are defined as microbial agents or microbial components that help to balance microbes in the intestine, which have an etymological meaning as opposed to antibiotics, which means antibiotics. Typically, probiotics are lactic acid bacteria such as Lactobacillus and Bifidus . In addition, probiotics do not possess toxic genes for humans and animals, nor produce pathogenic substances, and are classified as GRAS (generally recognized as safe). Therefore, development of a feed additive using proven probiotics has been actively conducted.

For example, Korean Patent Laid-Open No. 10-2011-035554 discloses a mixed strain of novel Bacillus genus CMB L1 and Lactobacillus genus CMB201, a food composition for anticancer and immunity enhancement using the same, and a microorganism preparation having antimicrobial activity, Domestic Patent No. 10-0977407 discloses a method for producing a lytic extract of Zygosaccharomyces bailii which increases various activities of neutrophils, which are major phagocytic cells of animals, and enhances nonspecific defense against attack of pathogenic bacteria And an animal immunity enhancer and a feed additive containing the same. However, the practical immune activity of the feed additive using probiotics is insufficient, and studies on feed additive using probiotics still having excellent immunity activity are needed.

Under these circumstances, the present inventors have made intensive efforts to develop a feed additive having an anti-inflammatory and immunosuppressive effect. As a result, it has been found that Lactococcus lactis BFE920 enhances anti-inflammatory or regulated immune T cell activity and intestinal adhesion activity And the survival rate of flounder caused by infection with the pathogen, Edwardian elataarta, is increased. Thus, the present invention has been completed.

One object of the present invention is to provide a process for the preparation of Lactococcus lactis lactis ) as an active ingredient. The present invention also provides a composition for preventing or treating inflammation.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating Edward's infectious disease of fish comprising Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

It is another object of the present invention to provide a method for preventing or treating Edward's infectious disease comprising administering the composition to fish.

Another object of the present invention is to provide a feed composition for preventing or ameliorating Edward's infectious disease of fish comprising Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

Another object of the present invention is to provide a feed additive composition for preventing or ameliorating Edward's infectious disease of a fish containing Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

The present inventors conducted various studies to find useful probiotics showing anti-inflammatory and immunity-enhancing effects. As a result of feeding Lactococcus lactis BFE920 to flounder, anti-inflammatory or regulated immune T cell activity, intestinal adhesion It was confirmed that the activity of synaptic activity was increased and the intestinal permeability was decreased. Also, it was confirmed that the intestinal permeability was decreased and the survival rate of the flounder was increased by lactoferriccoxyl lactis BFE920 fed to the flounder infected with the pathogenic Edwardsiella tarda . Thus, the Lactococcus lactis BFE920 strain Can be used for anti-inflammatory or immunological enhancement of fish. The Lactococcus lactis strain BFE920 exhibits antiinflammatory or immunostimulatory effects has not been known at all and can be said to be very significant in that it was first developed by the present inventor.

In one aspect, the present invention provides an anti-inflammatory or immunomodulating composition comprising a lactococcus lactis strain as an active ingredient.

The term " Lactococcus " used in the present invention is a lactic acid (lactic acid) bacterial strain contained in genus Streptococcus Group N1, also called lactic acid bacteria. It is known as the main or unique product of glucose fermentation, specifically a homofermentor that produces lactic acid. These strains are widely used in the dairy industry to produce fermented dairy products such as cheese, yogurt and the like.

The " Lactococcus & lactis "is one of lactic acid bacteria belonging to the above-mentioned lactococcus species and can be used for the production of industrial dairy products such as cheese, fermented milk or lactic casein and can be used as a probiotic.

In the present invention, the Lactococcus lactis may be a Lactococcus lactis BFE920 strain deposited with the deposit number KCCM11383P.

As used herein, the term " Lactococcus lactis BFE920 " lactis BFE920 ) is a gram-positive bacterium, which means Lactococcus lactis strains isolated from bean sprouts and has strong antimicrobial activity against streptococci.

In the present invention, the Lactococcus lactis strain BFE920 can increase the relative mRNA expression of IL-10 , CD4-1 , FOXP3 and TGF-beta gene.

In one embodiment of the present invention, relative mRNA expression of intestinal CD4-1 , IL-10 , FOXP3 or TGF- beta gene was measured 48 hours and 72 hours after lactoferriccoxyl lactis BFE920 was fed to the flounder, Relative mRNA expression of CD4-1 , IL-10 , FOXP3 or TGF-beta gene at 48 hours and 72 hours was significantly higher than that of control without Lactococcus lactis BFE920 (Fig. 1). In addition, after the lactobacillus lactis BFE920 was fed to the flounder for 30 days, intestinal IL-10 , CD4-1 , The relative mRNA expression of FOXP3 and TGF- beta genes was measured, and the relative mRNA expression level of the Lactococcus lactis BFE920 was significantly increased as compared with the control group (Fig. 2). Thus, it was confirmed that Lactococcus lactis BFE920 increased the activity of immunoregulatory T cells and exhibited immuno-promoting activity.

In the present invention, the Lactococcus lactis strain BFE920 can increase the tight junction activity. Specifically, the Lactococcus lactis strain BFE920 may increase the relative mRNA expression of the occludin gene.

The tight junctions mean cell junctions responsible for the sealing function. When the tight junction activity is increased, the neighboring cells are in close contact with and close to the plasma membrane, so that the water-soluble molecules do not leak into the cell gap. The tight junction can be connected by sealing the two cells by arranging the claudin and occludin proteins in a chain.

In one embodiment of the present invention, the relative mRNA expression of intestinal occludin gene was measured after 30 days of lacto-coccus lactis BFE920 in flounder, and the expression level of Lactococcus lactis BFE920 was increased compared to the control without the diet , It was found that the lactococcus lactis BFE920 increased intestinal adhesion activity (FIG. 3).

In the present invention, the Lactococcus lactis strain BFE920 can reduce intramuscular permeability.

In one embodiment of the present invention, the permeability of lactobacillus lactis BFE920 was measured after 30 days of feeding to the flounder, and as a result, it was confirmed that the permeability was lowered compared to the control group in which lactococcus lactis BFE920 was not fed, Lactis BFE920 was found to reduce intestinal permeability (Fig. 4). In addition, it was confirmed that the adhesion activity of occludin increased with increasing relative mRNA expression, so that intestinal permeability was decreased by increasing the tight junction of Lactococcus lactis BFE920.

In the present invention, the Lactococcus lactis strain BFE920 can reduce the increased intestinal permeability upon pathogen infection.

The pathogen may be, but is not limited to, Edwardsiella tarda , and may be a general hospital uniform that increases intestinal permeability.

In one embodiment of the present invention, the flounder was infected with Lactococcus lactis BFE920 for 30 days and then oral infected with Edwards elata tara to determine intestinal permeability. As a result, Lactococcus lactis BFE920 was not fed for 30 days, It was confirmed that the intestinal permeability was decreased compared with the control group which was orally infected with the sihella tarda strain, and Lactococcus lactis BFE920 showed the effect of improving intestinal endocardial function (FIG. 5).

The term " anti-inflammatory "as used in the present invention means an action to suppress inflammation, and the term" immunity enhancement " as used in the present invention encompasses all phenomena that reinforce body defense mechanisms against various diseases such as cancer, it means.

In the present invention, the immunoenhancement may be induced by an increase in immunoregulatory T cell activity. Specifically, the immuno-enhancement can be confirmed by an increase in the relative mRNA expression of IL-10 , CD4-1 , FOXP3 or TGF- beta gene.

The immunoregulatory T cells may be classified into natrual regulatory T cells and adaptive regulatory T cells according to their origin. Natural regulatory T cells are derived from thymus and express high levels of CD25 and co-signaling substances such as cytotoxic T lymphocytes (CTLA4) or glucocorticoid-induced TNF receptor family related proteins (GITR) and foxp3. In adaptive regulatory T cells, it is known to secrete cytokines such as IL-10 and TGF-β. In addition, since immunoregulatory T cells express CD4 and CD25, the IL-10 , CD4-1 , FOXP3 Or by increasing the relative mRNA expression of the TGF-beta gene.

In one embodiment of the invention, the expression is a Lactococcus lactis BFE920 Halibut and 48 hours and 72 hours during or Lactococcus Le lactis BFE920 the after diet for 30 days, chapter in IL-10 gene relative to mRNA of As a result of measurement of expression, it was confirmed that the relative amount of mRNA expression was significantly increased compared with the control group in which Lactococcus lactis BFE920 was not fed, and it was found that Lactococcus lactis BFE920 had anti-inflammatory activity (Fig. 1 And Fig. 2).

In one embodiment of the present invention, relative mRNA expression of intestinal CD4-1, IL-10, FOXP3 or TGF-beta gene was measured at 48 hours and 72 hours after lactose cocktail lactis BFE920 was fed to the flounder, Relative mRNA expression of CD4-1, IL-10, FOXP3 or TGF-beta gene at 48 hours and 72 hours was significantly higher than that of control without Lactococcus lactis BFE920 (Fig. 1). In addition, the relative mRNA expression of IL-10, CD4-1, FOXP3 and TGF-β genes in the intestines was measured after lactose cocktail lactis BFE920 was fed to the flounder for 30 days. As a result, Lactococcus lactis BFE920 The relative mRNA expression level was significantly increased as compared to the control group (Fig. 2). Thus, it was confirmed that Lactococcus lactis BFE920 increased the activity of immunoregulatory T cells and exhibited immuno-promoting activity.

In the present invention, the anti-inflammatory or immunological enhancement may be induced in the intestine.

In the present invention, the composition may be a feed composition or a feed additive composition.

The term "feed" as used in the present invention means any natural or artificial diet, single meal, etc., or ingredients of the above formula for eating, drinking and digesting the subject organism.

The term "feed additive " as used in the present invention means a substance added to the feed to improve the productivity or health of the target organism.

In the present invention, a feed composition or a feed additive composition containing Lactococcus lactis BFE920 may be used to exhibit anti-inflammatory activity or immunity enhancing activity of a subject organism.

When used as a feed additive, the Lactococcus lactis BFE920 of the present invention or a culture thereof can be prepared in the form of a 20 to 90 wt% high concentrate or in the form of a powder or granules. The feed additive may be selected from the group consisting of organic acids such as citric acid, fumaric acid, adipic acid, lactic acid and malic acid, phosphates such as sodium phosphate, potassium phosphate, acid pyrophosphate, polyphosphate (polymerized phosphate), polyphenol, catechin, alpha-tocopherol, Extract, vitamin C, green tea extract, licorice extract, chitosan, tannic acid, phytic acid, and the like. When used as a feed, the composition may be formulated in conventional feed form and may contain conventional feed ingredients.

The feed additives and feeds may be selected from the group consisting of cereals, such as ground or crushed wheat, oats, barley, corn and rice; Feeds based on vegetable protein such as rapeseed, soybeans and sunflower; Animal protein feeds such as blood, meat, bone meal and fish meal; And dry ingredients such as various powdered milk and whey powders. In addition, nutritional supplements, digestion and absorption enhancers, growth promoters, and the like may be further included.

The feed additive may be administered to animals singly or in combination with other feed additives in edible carriers. The feed additives can also be administered to the animal either as a top dressing or they can be mixed directly with the animal feed or in a separate oral form separate from the feed. When the feed additive is administered separately from an animal feed, it can be prepared in an immediate release or sustained release formulation, in combination with a pharmaceutically acceptable edible carrier as is well known in the art. Such edible carriers may be solid or liquid, such as corn starch, lactose, sucrose, soy flakes, peanut oil, olive oil, sesame oil and propylene glycol. When a solid carrier is used, the feed additive can be a tablet, capsule, powder, troche or emulsion or top-dressing in finely divided form. When a liquid carrier is used, the feed additive can be a gelatin soft capsule, or a syrup or suspension, emulsion, or solution formulation.

The feed may comprise any protein-containing organic fructose commonly used to meet an animal's dietary needs. These protein-containing flours usually consist mainly of corn, soy flour, or corn / soy flour mix.

The feed additives and feeds may also contain adjuvants such as preservatives, stabilizers, wetting or emulsifying agents, solution promoters and the like. The feed additive may be used by being added to animal feed by infiltration, spraying or mixing.

In another aspect, the present invention provides a pharmaceutical composition for preventing or treating Edward's infectious disease in a fish containing Lactococcus lactis BFE920 (Accession No .: KCCM11383P) as an active ingredient.

In the present invention, the fish may be at least one fish selected from the group consisting of an eel, a flatfish, a rockfish, a shoal, a shrimp, a red sea bream, a lemur, a mullet, a perch, a mackerel, a horse mackerel or a rat.

As used herein, the term " Edwards infection "refers to Edwardsiella < RTI ID = 0.0 > tarda ), which occurs mainly in the early summer, which is a high temperature, and does not induce mass mortality in a short time, but it can lead to long-term mortality. The Edwards infectious disease may cause a great economic loss to the aquaculture industry of the flounder, which is the most important species in Korean aquaculture. The flounder infected with Edwards infections is characterized by abdominal distension and hernia. The blood is mixed with ascites, the oily skin is observed, the liver is brown and the ovary is formed, and the liver and kidney are hypertrophied and may carry meningitis have.

The Edwardian elata tara is a gram-negative bacterium and has a wide range of viability such as a temperature of 14 ° C to 45 ° C, a pH of 4.0 to a pH of 10.0, and a sodium chloride of 0 to 4% and is a conditional pathogen, It has characteristics that are difficult to prevent. Edward Celta Tarada is infected through wounds or intestinal epithelium from infected sources (feces, water, mud) through undesirable environments such as high water temperature, deteriorated water quality and eutrophication in freshwater or marine fishes worldwide, resulting in serious systemic bacterial diseases Is known to cause.

In one embodiment of the present invention, the survival rate of the flounder was measured by infecting Lepococcus lactis BFE920 for 30 days, followed by Edwardian elata tara. As a result, the survival rate of L. lactis BFE920 was not fed for 30 days, The survival rate was significantly increased compared to the control group infected with tarduam. Thus, it was found that Lactococcus lactis BFE920 is effective in treating Edwardian elataida-induced symptoms and mortality and treating Edward's infectious disease (Fig. 6).

The term "prophylactic " as used herein refers to any action that inhibits or delays Edwardian infectious disease by administration of a composition comprising said Lactococcus lactis BFE920.

The term "treatment ", as used herein, refers to any action by which administration of a composition comprising Lactococcus lactis BFE920 improves or cures an Edwards infection.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" of the present invention means that it exhibits properties that are not toxic to the cells or humans exposed to the composition. Such carriers may be used without limitation as long as they are known in the art such as buffers, preservatives, wetting agents, solubilizers, isotonic agents, stabilizers, bases, excipients and lubricants.

The pharmaceutical composition of the present invention may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols or the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method . Furthermore, it can be used in the form of an external preparation for skin in the form of ointments, lotions, spray agents, patches, creams, powders, suspensions, gels or gels. Examples of carriers, excipients and diluents that can be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like. These solid preparations may contain at least one excipient such as starch, calcium carbonate, etc., in the Lactococcus lactis strain BFE920, Sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral use may include various excipients such as wetting agents, sweetening agents, fragrances, preservatives, etc. in addition to water and liquid paraffin, which are simple diluents commonly used in suspension, liquid solutions, emulsions and syrups have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

Meanwhile, the pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount " of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, The severity, the activity of the drug, the sensitivity to the drug, the method of administration, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors involved in the formulation or concurrent use of the drug, and other factors well known in the medical arts. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiply. Taking all of the above factors into consideration, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage of the pharmaceutical composition of the present invention can be determined by those skilled in the art in consideration of the purpose of use, the degree of addiction to the disease, the age, weight, sex, history, or the kind of the substance used as the active ingredient. For example, the pharmaceutical composition of the present invention can be administered, for example, in an amount of from about 0.1 ng to about 100 mg / kg, in particular from 1 ng to about 10 mg / kg, per adult, May be administered once a day or several times in divided doses, although it is not particularly limited thereto. However, the dosages do not limit the scope of the present invention in any way, as it may vary depending on the route of administration, severity of disease, sex, weight, age and the like.

In another aspect, the present invention provides a feed composition for preventing or ameliorating Edward's infectious disease in a fish comprising Lactococcus lactis strain BFE920 (accession number: KCCM11383P) as an active ingredient.

The definition of Lactococcus lactis BFE920, fish, Edwards infectious disease, prevention or feed is as described above.

As used herein, the term "improvement" means any suspicion of Edwardian infectious disease by administration of a composition comprising said Lactococcus lactis BFE920 and any action that alleviates or alleviates symptoms of the onset individuals.

In another aspect, the present invention provides a method for preventing or treating Edward's infectious disease, comprising the step of administering to a fish a composition comprising Lactococcus lactis strain BFE920 (accession number: KCCM11383P) as an active ingredient.

The definition of Edward infectious disease, fish, prevention or treatment is as described above.

The term "administering" as used herein means introducing a predetermined substance into fish in any suitable manner, and the administration route of the composition can be administered through any conventional route as long as it can reach the target tissue. But are not limited to, intraperitoneal, intravenous, intramuscular, subcutaneous, intradermal, oral, topical, intranasal, intrapulmonary, rectal. Specifically, it may be orally administered.

In another aspect, there is provided a feed additive composition for preventing or ameliorating Edward's infestation of a fish containing Lactococcus lactis BFE920 strain (Accession No. KCCM11383P) as an active ingredient.

The definition of Lactococcus lactis BFE920, fish, Edwards infectious disease, prevention, improvement or feed additive is as described above.

Since the composition comprising Lactococcus lactis BFE920 has an antiinflammatory or immunomodulating effect, the present invention can be used as a feed composition or feed additive that can enhance anti-inflammation or immunity of an individual.

Figure 1 shows that the flounder is supplemented with Lactococcus lactis BFE920 lactis BFE920) were cultured for 48 hours and 72 hours after feeding in intestinal CD4-1 , IL-10 , TGF - β1 And FOXP3 Gt; mRNA < / RTI >
Chapter 2 diet for 30 days after the Lactococcus lactis BFE920 Halibut in CD4-1, IL-10, TGF - β1 And the relative mRNA expression of the FOXP3 gene.
FIG. 3 is a graph showing relative mRNA expression of occludin gene in intestines after feeding for 30 days with Lactococcus lactis BFE920 in flounder.
FIG. 4 is a graph showing permeability of intestines after feeding for 30 days with Lactococcus lactis BFE920 in flounder. FIG.
FIG. 5 is a graph showing the intradermal permeability of 72 hours after oral administration of Edwardsiella tarda to the flounder on the day following the 30-day feeding of Lactococcus lactis BFE920.
FIG. 6 is a graph showing the survival rate for 20 days after oral administration of Lactococcus lactis BFE920 to the flounder after oral administration to Edwardian elata tara on the day after 30 days of dieting.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these embodiments are intended to illustrate the present invention, and the scope of the present invention is not limited to these embodiments.

Example  1. Breeding and diet of experimental animals

The experimental animals to be used in the present invention were bred as follows.

Specifically, the flounder (42.7 ± 1.61 g) was maintained in a tank containing 300 L of seawater and was adapted at 18 ° C. for 7 days before the experiment.

In addition, Lactococcus lactis BFE920 ( Lactococcus Lactococcus lactis BFE920 was fed twice a day as an ad libitum by dividing it into a group of flounder (control) and a group of flounder (diet group) fed Lactococcus lactis BFE920. In the control group, diets containing 10 ⁷ CFU / g of Lactococcus lactis BFE920 were seeded in a commercial diets (EP, Flounder Bluechip; WOOSUNGFEED Co. Ltd., Daejeon, Korea).

Example  2. Lactococcus Lactis BFE920's On the diet  Activity of anti-inflammatory and immunoregulatory T cells induced

Example  2.1: RNA extraction and cDNA synthesis

In order to extract RNA and cDNA from the intestinal and control groups of Example 1, RNA was extracted from the posterior tissue of the flounder, and cDNA was synthesized using the RNA as a template.

Specifically, in order to confirm the anti-inflammatory activity and the activity of the immunoregulatory T cells in the early stage of the flounder fed with Lactococcus lactis BFE920, Lactococcus lactis BFE920 was inoculated into the flounder, and after 48 hours and 72 hours elapsed And the control group without Lactococcus lactis BFE920 were sacrificed by 4 mice. In order to confirm the anti-inflammatory activity and immunoregulatory T cell activity of the flounder fed with Lactococcus lactis BFE920 for 30 days, Lactococcus lactis BFE920 was inoculated into a diet group for 30 days and Lactococcus lactis BFE920 Were sacrificed by 3 control groups.

Next, the posterior tissue of each group was placed in a 1.5 mL microtube containing 750 mL of RNAlater ^® (Life technology, USA), and 10 mg of the retinal tissue sample was added to 350 μL of RLT buffer AllPrep DNA / RNA / Protein Mini Kit, Qiagen, USA) and homogenized using a T10 basic handheld homogenizer (IKA®, China). The homogenized solution was subjected to RNA isolation using AllPrep DNA / RNA / Protein Mini KiT, and cDNA was synthesized using SuperScript® III reverse transcriptase (Invitrogen, USA) as a template.

Example  2.2: Quantitative real time using synthesized cDNA PCR  analysis

QRT-PCR was performed using the cDNA synthesized according to Example 3.1 as a template in order to confirm the relative mRNA expression in the field of the dietary group and the control group.

Specifically, 20 ng of cDNA synthesized from the flounder tissues of each group was amplified using a primer with a final reaction volume of 20 uL. The instrument used was Applied Biosystems 7500 PCR System (Life Technology, USA) Respectively. The PCR cycle was performed as follows. First, denaturation at 94 DEG C for 10 minutes, denaturation at 94 DEG C for 15 seconds, annealing at 42 DEG C for 42 seconds, and extension were repeated 40 times Respectively. The qRT-PCR result was shown by relative mRNA expression using the 2 ^- ΔCT method using the control group β-actin ΔCT.

The primers used in the qRT-PCR were as follows.

primer Sequences (5 '-> 3') Target gene OF-beta-actin-RT-F
(SEQ ID NO: 1) TGCAGAAGGAGATCACAGCC β-actin OF-beta-actin-RT-R
(SEQ ID NO: 2) ACTCCTGCTTGCTGATCCAC β-actin OF-CD4-1-RT-F
(SEQ ID NO: 3) AGTGAGCACGGACAATGGAG CD4-1 OF-CD4-1-RT-R
(SEQ ID NO: 4) CACGATGACTGAAGCGATGC CD4-1 OF-FOXP3-RT-F
(SEQ ID NO: 5) CACACTGGGTTGAGGACAGG FOXP3 OF-FOXP3-RT-R
(SEQ ID NO: 6) AGCCATGCTGGGATAACTCC FOXP3 OF-IL10-RT-F
(SEQ ID NO: 7) GCCTCACGTGGAGTCCATACAGC IL-10 OF-IL10-RT-R
(SEQ ID NO: 8) GCTCGCCCATGGCTTTATATAGACC IL-10 OF-TGF-? -RT-F
(SEQ ID NO: 9) CAGCGAACACGAGCCAAACAC TGF-β1 OF-TGF-? -RT-R
(SEQ ID NO: 10) TGTTCTGAGGGATGGACATGGTG TGF-β1

Example  2.3: Lactococcus Lactis BFE920 Dietary  The activity of anti-inflammatory and immunoregulatory T cells induced in early stage

To investigate the effect of Lactococcus lactis BFE920 on the activity of anti-inflammatory and immunoregulatory T cells in the initial stage after lacto-coccus lactis BFE920 was fed to the flounder, 48 hours and 72 hours after the Lactococcus lactis BFE92 diet In the intestinal tract , CD4-1 , IL-10 , TGF - β1 And the relative mRNA expression of the FOXP3 gene were compared and compared with the control group in which Lactococcus lactis BFE920 was not fed.

Concretely, cDNA was synthesized from the RNA obtained by extracting the posterior tissues by the methods of Example 2.1 and Example 2.2, and qRT-PCR was performed using the RNA as a template to confirm mRNA expression relative to each gene.

As a result of the experiment, when 48 hours after the lactobacillus lactis BFE920 was fed to the flounder, the CD4-1, IL-10, TGF - β1 And FOXP3 genes were increased in comparison with the control group. In particular, mRNA expression relative to the IL-10 gene was increased by about 6-fold compared to the control group (FIG. 1).

In addition, the relative mRNA expression of CD4-1 gene was about twice that of the control group after 72 hours of lacto-coccus lactis BFE920 fed to the flounder, and IL-10 , TGF - β1 And the relative mRNA expression of the FOXP3 gene was increased by about 3 times as compared with the control group (Fig. 1).

Therefore, the flounder was inoculated with Lactococcus lactis BFE920 to induce CD4-1, IL-10 , TGF - β1 And FOXP3 The relative mRNA expression of the gene was found to be increased compared with the control group, and it was found that the activity of anti-inflammatory and immunoregulatory T cells was induced by the diet of Lactococcus lactis BFE920 in flounder.

Example  2.4: Lactococcus Lactis BFE920  For 30 days Dietary  Activity of anti-inflammatory and immunoregulatory T cells

The effect of Lactococcus lactis BFE920 on the activity of anti - inflammatory and immunoregulatory T cells was determined after feeding 30 days of lactococcus lactis BFE920 to flounder.

Specifically, Lactococcus lactis after BFE920 a diet for 30 days, chapter by way of example 2.3 in CD4-1, IL-10, TGF - β1 And the relative mRNA expression of the FOXP3 gene were compared and compared with the control group in which Lactococcus lactis BFE920 was not fed.

As a result, the flounder was fed with Lactococcus lactis BFE920 for 30 days and intestinal CD4-1 , IL-10 , TGF - β1 And mRNA expression relative to the FOXP3 gene was significantly increased compared to the control (Fig. 2).

Thus, from the above results, it was found that Lactococcus lactis BFE920 induces anti-inflammatory activity and activity of immunoregulatory T cells.

Example  3. Lactococcus Lactis BFE920  For 30 days Dietary  Later Intestinal intestine  Improvements

Example  3.1: Lactococcus Lactis BFE920  For 30 days Dietary  Adhesion activity

The effect of Lactococcus lactis BFE920 on the adhesion activity in the intestinal lining after 30 days of lacto - coccus lactis BFE920 was determined.

Specifically, after lactose cocktail lactis BFE920 was fed for 30 days, the relative mRNA expression of the occludin gene in the intestine was confirmed by the method of Example 2.3 and compared with the control group in which Lactococcus lactis was not fed. In order to confirm the relative mRNA expression of the occludin gene, OF-OCLN-RT-F (5'-TCTTTGCTCTGAAGACCCGC-3 ', SEQ ID NO: 11) and OF- '-ATTGTTCACCCATGCCTCCA-3', SEQ ID NO: 12) and relative mRNA expression by the 2 ^- ΔCT method using the control group β-actin ΔCT.

As a result of the experiment, it was confirmed that relative mRNA expression in the intestinal occludin gene was significantly increased after the lactobacillus lactis BFE920 was fed to the flounder for 30 days (FIG. 3).

Therefore, it was found from the above results that the lactococcus lactis BFE920 increased the intestinal adhesion activity in the flounder.

Example  3.2: Lactococcus Lactis BFE920  For 30 days Dietary  After-field transmittance

After 30 days of lacto-coccus lactis BFE920 was fed to the flounder, it was confirmed that the tight junction activity increased in the intestinal lining. Therefore, it was confirmed through the above activity that Lactococcus lactis BFE920 had an effect on intestinal permeability.

Specifically, Lactococcus lactis BFE920 was inoculated for 30 days and then the intestinal permeability was determined using FITC-dex 4 kDa (fluorescein isothiocyanate-dextran 4,000 Da; Sigma-Aldrich, St. Louis, USA) Lactis BFE920 was compared to a non-dietary control.

The intestinal permeability experiment was performed as follows. Lactococcus lactis BFE920 was fed for 30 days and then starved for 6 hours. FITC-dex 4 kDa of 500 mg / kg was injected via oral gavage into 4 of the control and dietary groups. One hour later, 600 uL blood samples from the flounder were collected in 1.5 mL microtube. The blood samples were centrifuged at 13000 rpm, 4 ° C for 10 minutes to obtain plasma samples, which were diluted 1: 1 with phosphate buffered saline (PBS). 100 uL of the diluted plasma samples were placed in a Corning (TM) Costar (TM) 96-well black solid plate (Thermo Fisher Scientific Inc., USA). Fluorescence intensity of each sample was measured using a VICTOR ² D fluorometer at 485 nm / 535 nm.

As a result of the experiment, it was confirmed that the permeability of intestines was 2.30 ± 0.02 ug / mL when the lactobacillus lactis BFE920 was fed to the flounder for 30 days, which was significantly lower than that of the control group which had a permeability of 4.16 ± 0.23 ug / mL 4).

Therefore, it was found from the above results that the intestinal lining activity was increased in the intestinal lining according to the diet of Lactococcus lactis BFE920, thereby reducing intestinal permeability.

Example  3.3: Lactococcus Lactis BFE920  For 30 days Dietary  after Edward Siegel La Tarda ( Edwardsiella tarda ) Due to oral infection Intestinal permeability

Edward Celta Tarada is a gram-negative pathogen with lipopolisaccahride (LPS) and has the ability to induce inflammation in the intestine. Therefore, it was selected as a pathogen and the effect of Lactococcus lactis BFE920 on intestinal permeability Respectively.

Specifically, intestinal permeability was measured using FITC-dex 4 kDa at 72 hours after infecting the pathogens the day after lactose cocktail lactis BFE920 was fed for 30 days. On the other hand, a flounder infected with the above pathogenic bacteria was used as a control group for the next day without lactating Lactococcus lactis BFE920 for 30 days.

The infection of the above pathogen Edwardian elataarda was performed as follows. First, Edward Celta Tarda was incubated overnight at 30 ° C with 200 rpm in brain heart infusion (BHI) medium (Beckton, Dickinson and Company, Sparks, USA). At the end of the 31st day of the experiment, 4 groups of flounders randomly selected for each group were orally administered with the above Edwardian elata tara (1 - 2 X 10 ⁵ CFU / g fish) The intracavity transmittance experiment was performed by the method of Example 3.2 above.

As a result of the experiment, the intestinal permeability of the diet group was 2.35 ± 0.04 in plasma FITC-dex 4 kDa at 72 hours after oral administration of Lactococcus lactis BFE920 to the flounder for 30 days and oral administration of Edwardian elata tara the following day (plasma FITC-dex 4 kDa value: 14.98 +/- 3.95 (mg / mL) in the control group at 72 hours after oral administration of Lactococcus lactis BFE920 for 30 days and the next day by oral administration of Edwardian elata tara ug / mL) (FIG. 5).

Therefore, through the above results, it was found that Lactococcus lactis BFE920 exhibited an intestinal endothelial function-improving effect as an increase in intestinal permeability induced by pathogens was restored through the diet of Lactococcus lactis BFE920.

Example  4. Edward Sierra  Disease resistance to tara infection

The effect of Lactococcus lactis BFE920 on disease resistance following infection with the pathogen, Edwards Celta tara, was confirmed.

Specifically, the survival rate of the flounder was measured for 20 days after oral administration of the above-mentioned pathogens after lactose cocktail lactis BFE920 was fed for 30 days. On the other hand, the flukes infected with the pathogens without feeding for 30 days were used as a control group for the Lactococcus lactis BFE920.

The infection of Edwardian elata tara was induced by feeding Lactococcus lactis BFE920 for 30 days and by oral administration to flounders of 20 animals randomly selected for each group on the 31st day.

As a result of the experiment, the survival rate of the diet group in which the Lactococcus lactis BFE920 was inoculated for 30 days and then the Edwardian elata tara group was 20 days, the survival rate was 70%, the Lactococcus lactis BFE920 was not fed for 30 days, (Fig. 6), as compared to the survival rate of 10% of the control group infected with Elatata.

Thus, the above results show that the diet induced by Lactococcus lactis BFE920 in the flounder was delayed in Edwardian elata tara-induced symptoms and mortality.

Example  5. Statistical Analysis

Two-way ANOVA with Bonferroni's posttest was used for the qRT-PCR results using flounder in the initial stage after lacto-coccus lactis BFE920. The validity of the results of qRT-PCR and intestinal permeability test using the flounder fed with Lactococcus lactis BFE920 for 30 days was evaluated using two-tailed student's T-test and ANOVA one-way analysis of variance. After Lactococcus lactis BFE920 was fed, the survival rate according to the oral infection of Edwardian elata tara was expressed by the survival curves, and the efficacy of the survival curves was evaluated by log-rank (Mantel-Cox) test.

It is to be understood that both the foregoing general description and the following detailed description of the present invention are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. More variations are possible within a range that does not. Accordingly, the present invention may be embodied in other ways than those specifically described and illustrated herein, and it may be understood by those skilled in the art.

Korea Microorganism Conservation Center (overseas) KCCM11383P 20130221

<110> IMMUNUS Co., Ltd. <120> Aquaculture functional feed additive comprising Lactococcus          lactis BFE920 inducing regulatory T Cell <130> KPA160268-KR <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OF-b-actin-RT-F <400> 1 tgcagaagga gatcacagcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <230> OF-b-actin-RT-R <400> 2 actcctgctt gctgatccac 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-F <400> 3 agtgagcacg gacaatggag 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-CD4-1-RT-R <400> 4 cacgatgact gaagcgatgc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > OF-FOXP3-RT-F <400> 5 cacactgggt tgaggacagg 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-FOXP3-RT-R <400> 6 agccatgctg ggataactcc 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-F <400> 7 gcctcacgtg gagtccatac agc 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> OF-IL10-RT-R <400> 8 gctcgcccat ggctttatat agacc 25 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-F <400> 9 cagcgaacac gagccaaaca c 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> OF-TGF-b-RT-R <400> 10 tgttctgagg gatggacatg gtg 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-F <400> 11 tctttgctct gaagacccgc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OF-OCLN-RT-R <400> 12 attgttcacc catgcctcca 20

Claims (15)

Lactococcus lactis ) as an active ingredient.
The anti-inflammatory or immunomodulating composition according to claim 1, wherein the lactococcus lactis is a lactococcus lactis BFE920 strain deposited with the deposit number KCCM11383P.
3. The composition according to claim 2, wherein the Lactococcus lactis BFE920 strain is characterized in that mRNA expression of the IL-10 , CD4-1 , FOXP3 , and TGF- beta genes is increased.
The anti-inflammatory or immunomodulating composition according to claim 2, wherein the Lactococcus lactis strain BFE920 is characterized by increasing the tight junction activity.
5. The composition for anti-inflammatory or immunomodulatory purposes according to claim 4, wherein the increase in the tight junction activity increases mRNA expression of the occludin gene.
3. The composition according to claim 2, wherein said Lactococcus lactis strain BFE920 is characterized by decreasing the intestinal permeability.
3. The composition of claim 2, wherein said Lactococcus lactis strain BFE920 is characterized by reduced increased intestinal permeability upon pathogen infection.
8. The composition of claim 7, wherein the pathogen is Edwardsiella tarda .
The composition according to claim 1, wherein said immunological enhancement is induced by an increase in immunoregulatory T cell activity.
The composition according to claim 1, wherein the anti-inflammatory or immunological enhancement is induced in the intestine.
2. The composition of claim 1, wherein the composition is a feed composition or a feed additive composition.
A pharmaceutical composition for preventing or treating Edward's infectious disease in fish comprising Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.
A method for preventing or treating Edwards infection, comprising the step of administering to a fish a pharmaceutical composition comprising the Lactococcus lactis BFE920 strain (Accession No: KCCM11383P).
A feed composition for preventing or ameliorating Edward's infestation in a fish containing Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.
A feed additive composition for preventing or ameliorating Edward's infestation of a fish containing Lactococcus lactis strain BFE920 (Accession No .: KCCM11383P) as an active ingredient.

Images