KR20170071214A - ANTI-HELICOBACTER COMPOSITION CONTAINING LactIC ACID BACTERIA SEPARATED FROM KIMCHI - Google Patents

Abstract

The present invention relates to a Lactobacillus plantarum HD1 strain having an antimicrobial activity against Helicobacter pylori in a pH range of pH 3.66 to pH 6.0 derived from Kimchi and having a deposit number KFCC11512P having a curd- , KFCC11512P), an antimicrobial composition for Helicobacter pylori containing any one selected from the group consisting of a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof, a fermentation stator for producing milk products Fermented dairy products.
The Lactobacillus plantarum HD1 strain of the present invention and its culture medium have excellent anti-Helicobacter pylori activity, and have anti-helicobacter pylori activity even when the pH is changed unlike the existing kimchi-derived lactic acid bacteria. When the lactic acid bacteria are inoculated into milk, The present invention can be applied to the production of dairy products to prevent or ameliorate a disease caused by Helicobacter pylori, unlike the lactic acid bacteria of Kimchi, which is an existing plant-derived lactic acid bacterium. Therefore, , The industrial application has a very large and excellent effect due to the wide industrial utilization spectrum.

Description

(ANTI-HELICOBACTER COMPOSITION CONTAINING LACTIC ACID BACTERIA SEPARATED FROM KIMCHI) containing lactic acid bacteria derived from Kimchi as an active ingredient.

The present invention relates to an anti-Helicobacter pylori composition comprising lactic acid bacteria derived from kimchi as an active ingredient.

In the early 1970s, an Australian pathologist, Warren et al. Reported that type A, a type of autoimmune disease with malignant anemia, differs from type A in the distribution of gastritis and type B, in which there are no findings observed in malignant anemia Respectively. It has been found that spiral bacteria exist in the stomach mucosa of patients with type B gastritis, and a new theory has emerged that the cause of gastrointestinal diseases may be germs.

In 1982, Warren and his physician Marshall succeeded in the pure isolation and cultivation of the staphylococci in gastric mucosal tissues of patients with type B gastritis with the help of the microbiologist Goodwin. Afterwards, the staphylococci and gastritis, gastric ulcer and duodenal ulcer The study was carried out to confirm the relationship with others.

As a result of research by Marshall and other scholars, it has been confirmed that the Helicobacter pylori is a pathogenic bacterium that is not a member of normal bacterial flora inhabiting the human body but is an agent of B-type antral gastritis, But not in other animals or other organs of the human body.

The bacterium was first named Campylobacter pyloridis , but the name of the pylorus, which mainly resides in the shape and stomach of the body, is referred to as Helicobacter pylori ( Helicobacter pylori) pylori ).

The Helicobacter pylori is specific for humans and is found mainly in a specific location in the stomach. It is known that the Helicobacter pylori can be used for a long period of time in the gastric mucosa of a human being and for the treatment of peptic ulcer (e.g. gastric ulcer or duodenal ulcer), inflammation (e.g. gastritis) (Gastric cancer), MALT (mucosaassociated lymphoid tissue), lymphoid or chronic heart disease. In particular, in 1994, the International Agency for Research on Cancer (IARC) and the World Health Organization (WHO) defined Helicobacter pylori as a class I carcinogen and related to the prevention and diagnosis of stomach cancer, Helicobacter pylori Infection is considered to be a very important issue, and identification of infectious agents of Helicobacter pylori is an important issue for public health.

As a result of studies on gastrointestinal diseases and duodenal diseases caused by Helicobacter pylori, in particular, on the pathogenesis of inflammation induction, urease, which is an urease, can be a main factor.

Specifically, the Helicobacter pylori produces urease corresponding to 6% of the total protein. The urease produced decomposes the urea into ammonia and carbon dioxide to neutralize the environment of the bacteria, thereby preventing the attack of hydrochloric acid in the gastric lumen However, the ammonia accumulated in the gastric mucosa itself is cytotoxic to the gastric mucosal epithelium directly, resulting in gastric mucosal injury (Sidebotham RL, et al ., J. Clin. Pathol., 44, pp 52-57 (1991)).

Due to the action of the urease, gastric acid in the gastric lumen flows back below the mucosal layer, and gastric acid causes gastric mucosal epithelial cells to be extensively damaged, resulting in gastritis and gastric ulcer. In addition, ammonia itself inhibits the oxygen consumption of the gastric mucosal layer and the ATP production of mitochondria (Tsujii M., et al ., Gastroenterology, 102, pp. 1881-1888 (1992)), ultimately forming monochloroamine to generate reactive oxygen species, causing cell damage, causing chronic inflammation, (Hahm KB, et al ., Am. J. Gastroenterol., 92, pp 1853-1857 (1997)).

Infection by the Helicobacter pylori is carried out through an animal or a human, through carelessness during medical treatment or through various routes such as food (Dunn, BE, Cohen, H., and Blaser, MJ, Clinical Microbiology Reviews, 10 36: 356-369 (2002)), they are not easily eradicated once they become infected.

In particular, it has been reported that H. pylori infection occurs in many developing countries including Korea. According to the results of the National Epidemiological Survey conducted on 5,732 persons who do not have upper gastrointestinal symptoms, the H. pylori infection rate , 46.6% of the total population, and 69.4% of adults aged 16 years and over, especially 78.5% of those in their 40s (Korean Helicobacter Pylori Research Group, 1998). In a study of 1,031 patients with peptic ulcer, 66% of gastric ulcers and 79% of duodenal ulcers were found to be infected with Helicobacter pylori, and 71% of patients with gastric and duodenal ulcers were found to have Helicobacter pylori It was confirmed to be infected with pyrethroid.

Therefore, the development of treatment and prevention methods for Helicobacter pylori infection is very urgent. Studies on the treatment of Helicobacter pylori infection have been actively conducted, mainly using antibiotics, histamine H2 receptor antagonists, proton pump inhibitors or gastric acid remover.

For example, in the case of antibiotics, conventional triple therapy with bismuth formulation, metronidazole, tetracycline or amoxicillin, bismuth formulation, omeparazole, tetracycline And metronidazole have been reported.

However, it has been pointed out that the method using the above-mentioned antibiotics has a side effect of drugs, the appearance of resistant strains resistant to antibiotics, permeability of drugs in the stomach, and reproductive growth of bacteria in which growth has been suppressed after treatment.

In addition, cimetidine and its derivatives, which are representative drugs of histamine H2 receptor antagonists, exhibit excellent anti-ulcer effects, but have a disadvantage of high recurrence rate after discontinuation of drug administration. In particular, in case of cimetidine, Male gynecomastia, neutropenia and other side effects, including drug interactions are also represented.

In addition, omeprazole and lansoprazol, which are proton pump inhibitors, are known to inhibit acid secretion in gastric wall cells at the final stage, and thus they are known to exhibit a strong acid secretion inhibiting effect. However, in patients suffering from ulcer healing by these medicines The recurrence rate is not reduced and is known to have side effects such as diarrhea, fever, headache and fatigue.

Accordingly, development of a suitable antimicrobial substance or food using a natural material capable of inhibiting Helicobacter pylori, which can replace the drug treatment agent that causes the side effects and resistance of the human body, is required.

Lactic acid bacteria have been used for fermented milk products and fermented vegetables since ancient times. It is known that fermented foods have a flavor and food preservation effect. It is known that the food preservation function of lactic acid bacteria inhibits the propagation of harmful microorganisms due to various antibacterial substances such as H ₂ O ₂ and bacteriocin as well as pH decrease by organic acid produced by lactic acid bacteria.

The above-mentioned lactic acid bacteria are GRAS (generally recognized as safe) strains consumed together with fermented foods for a long time and because of the advantages regarding the functionality and safety of such lactic acid bacteria, attention is focused on the development of functional foods and medicines using the above- .

Recently, kimchi, which is a traditional fermented food in Korea unlike Western dairy products, has been recognized as a good report of useful lactic acid bacteria because it is involved in the fermentation of various kimchi lactic acid bacteria during fermentation. Studies on the antimicrobial activity of the Kimchi lactic acid bacteria have been actively conducted. However, Kimchi lactic acid bacteria are generally not suitable for producing dairy products because they can not produce curd when they are inoculated into milk as a plant fermentation strain. The antimicrobial activity of the Kimchi lactic acid bacteria including the antibacterial activity against Helicobacter pylori is mainly due to the low pH condition that is formed during the growth of the lactic acid bacteria. Therefore, the antibacterial activity of the Kimchi lactic acid bacterium is affected by the pH of the food, 6 to pH 8), it is necessary to improve these problems in order to apply the actual food.

Therefore, in order to utilize a wide range of lactic acid bacteria derived from kimchi, that is, to utilize lactic acid bacteria derived from kimchi not only in the production of kimchi but also in the production of various foods including dairy products, In order to prevent or treat the existing Helicobacter pylori, it is required to select and utilize a microorganism that maintains the antimicrobial activity against Helicobacter pylori even in a neutral or weakly alkaline condition, which is not an acidic condition.

KR 10-1178217 B KR 10-1234921 B KR 10-1255894 B

In order to solve the above problems, the present inventors have found that the prior is compared with the lactic acid bacteria publicly known and Helicobacter pylori significantly antimicrobial activity of the (Helicobacter pylori) to excellent, neutral or slightly acidic or slightly alkaline pH, particularly a pH of pH 6 to pH 8 , The antimicrobial activity against Helicobacter pylori is maintained and a strain capable of producing curd when milk is inoculated and cultured in order to be utilized in the production of dairy products is selected and provided by using the strain.

In order to achieve the above object, the present invention provides, in one aspect, a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori derived from kimchi and having a seeding ability KFCC11512P plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof, as an active ingredient. The present invention also provides an antimicrobial composition for Helicobacter pylori.

Lactobacillus plantarum HD1 strain ( Latobacillus < RTI ID = 0.0 > plantarum HD1, KFCC11512P) were cultivated in the pH range of pH 3.66 to pH 6.0 with Helicobacter pylori , that is, the antimicrobial activity against Helicobacter pylori is maintained in the pH range of pH 3.66 to pH 6.0.

In another aspect of the present invention, there is also provided a lactobacillus plantarium having an antimicrobial activity against Helicobacter pylori and having a seeding ability KFCC11512P derived from kimchi and having curd-producing ability at a pH range of pH 3.66 to pH 6.0. HD1 strain ( Latobacillus plantarum HD1, KFCC11512P), fermentation for the production of dairy products having antimicrobial activity against Helicobacter pylori containing any one selected from the group consisting of the culture of the strain, the concentrate of the culture, the dried product of the culture and the combination thereof And provides a stater.

In another aspect of the present invention, there is also provided a lactobacillus plantarium having an antimicrobial activity against Helicobacter pylori and having a seeding ability KFCC11512P derived from kimchi and having curd-producing ability at a pH range of pH 3.66 to pH 6.0. HD1 strain ( Latobacillus plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof.

The fermented food may be a dairy product.

The fermented food, specifically the dairy product, is obtained from lactic acid bacteria having lactic acid bacteria, lactic acid bacteria and lactic acid bacteria, which are derived from the kimchi in milk and have antimicrobial activity against Helicobacter pylori in the pH range of pH 3.66 to pH 6.0, Planta room HD1 strain ( Latobacillus plantarum HD1, KFCC11512P) and fermenting them.

In another aspect, the present invention also provides a method for producing lactobacillus plantarum, which has antimicrobial activity against Helicobacter pylori at a pH range of pH 3.66 to pH 6.0 derived from kimchi, and which has a seed producing ability KFCC11512P Room HD1 strain ( Latobacillus plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof, as an active ingredient.

The Lactobacillus plantarum HD1 strain according to the present invention has remarkably excellent antimicrobial activity against Helicobacter pylori strains as compared with kimchi-derived lactic acid bacteria having antimicrobial activity, and the antimicrobial activity is not only acidic but also weakly acidic or neutral And the fermentation proceeds in milk, unlike general kimchi-derived lactic acid bacteria, is a GRAS microorganism capable of producing a curd to produce a dairy product and having excellent safety for human body. Therefore, the Lactobacillus plantarum HD1 strain The culture can be utilized for the production of dairy products consumed for the purpose of improving or preventing Helicobacter pylori-related diseases, and thus its industrial use value is estimated to be very large.

1 is a view showing the base sequence of 16S rRNA of Lactobacillus plantarum HD1 strain according to an embodiment of the present invention.
FIG. 2 is a diagram showing phylogenetic relationships with other bacteria based on the base sequence of 16S rRNA of Lactobacillus plantarum HD1 strain according to an embodiment of the present invention.
FIG. 3 is a graph showing the anti-Helicobacter pylori activity of Kimchi lactic acid bacteria according to an embodiment of the present invention, that is, Helicobacter pylori ). The letters on the photograph indicate the strain name of each Kimchi lactic acid bacteria strain.
FIG. 4 is a graph showing the antihyperlipidic activity of lactic acid bacteria belonging to Lactobacillus plantarum according to an embodiment of the present invention, that is, the antimicrobial activity against Helicobacter pylori , The letter indicates the strain name of each Lactobacillus plantarum strain.
FIG. 5 is a graph showing the anti-Helicobacter pylori activity, that is, the antimicrobial activity against Helicobacter pylori according to the pH condition of Lactobacillus kimchi lactic acid bacteria according to an embodiment of the present invention. FIG. 5A is a photograph showing the result of frequency division of the MRS medium according to an embodiment of the present invention (control example), FIG. 5B is a graph showing the results of HD1 FIG. 5C is a photograph showing the results of frequency division of the culture supernatant of the strain SN31 according to an embodiment of the present invention, FIG. 5D is a photograph showing the results of fractionation of the culture supernatant of BU1 FIG. 5E is a photograph showing the results of frequency division of culture supernatant of WH1 strain according to an embodiment of the present invention, FIG. 5F is a photograph FIG. 6 is a photograph showing the results of the culture supernatant of YM3 strain according to an embodiment of the present invention. FIG.
FIG. 6 is a graph showing an anti-Helicobacter pylori activity according to pH conditions of lactic acid bacteria belonging to Lactobacillus plantarum according to an embodiment of the present invention, that is, Helicobacter pylori ). The letters on the photograph indicate the pH conditions of each culture supernatant. Fig. 6a shows the results of measuring the antimicrobial activity against Lactobacillus plantarum HD1 strain according to one embodiment of the present invention FIG. 6B is a photograph showing a result obtained by dividing the culture supernatant of Lactobacillus plantarum KFRI 464 strain according to an embodiment of the present invention, and FIG. 6C is a photograph showing the result of fractionation of the culture supernatant of the present invention FIG. 6D is a photograph showing a result obtained by dividing the culture supernatant of Lactobacillus plantarum YM3 strain according to an embodiment of the present invention. FIG. This is the picture shown.
FIG. 7 shows the ability of the Kimchi lactic acid bacteria to form milk curd, that is, the ability to produce curd when milk was inoculated and fermented according to an embodiment of the present invention. In each of the Kimchi lactic acid bacteria strains , And control represents the control group to which the MRS medium was added.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof. The present invention also relates to an antimicrobial composition for Helicobacter pylori comprising as an active ingredient any one selected from the group consisting of:

Lactobacillus plantarum HD1 strain ( Latobacillus < RTI ID = 0.0 > plantarum HD1, KFCC11512P) were cultivated in the pH range of pH 3.66 to pH 6.0 with Helicobacter pylori , that is, the antimicrobial activity against Helicobacter pylori is maintained in the pH range of pH 3.66 to pH 6.0.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), fermentation for the production of dairy products having antimicrobial activity against Helicobacter pylori containing any one selected from the group consisting of the culture of the strain, the concentrate of the culture, the dried product of the culture and the combination thereof To a stator.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof. The fermented food may be a dairy product. The fermented food, specifically the dairy product, is a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori derived from the above kimchi and having a seeding ability KFCC11512P, plantarum HD1, KFCC11512P) and fermentation.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof, as an active ingredient.

As used herein, a culture means a culture of a specific microorganism in a culture medium or a culture medium unless otherwise specified. The concentrate of the culture or culture is not limited in its formulation, for example, the formulation may be liquid or solid.

Unless specifically stated in the present specification, the term " medium " refers to a medium in which a microorganism to be cultivated, i.e., a cultivated microorganism, contains nutrients necessary for culturing a specific microorganism, have. The medium is also referred to as an incubator or a culture medium, and is a concept including both natural medium, synthetic medium and selective medium.

Unless otherwise specified in the present specification, dairy products refer to the livestock's milk, a product that is produced mainly by processing milk. Most of the dairy products are processed using milk as a raw material, and include concepts such as liquid dairy products, fatty dairy products, concentrated dairy products, dried dairy products, and frozen dairy products.

Unless otherwise specified in the present specification, curd means that an animal protein such as milk is solidified by an acid or a coenzyme. In a fermented milk product such as cheese, milk is fermented by a lactic acid bacterium, Casein or the like is solidified and formed.

Unless otherwise specified herein, the disc assay uses the principle that the size of the growth inhibition zone is correlated with the minimal inhibitory concentration (MIC), and thus, the antimicrobial activity against specific microorganisms Means the method used for measurement. The disk diffusion method is widely used because it can obtain accurate results on antimicrobial activity against specific microorganisms while consuming less time and effort. The disk diffusion method, which is mainly used in Korea, is standardized by the CLSI (Clinical Laboratory Standards Institute) guidelines based on the Bauer-Kirby disk diffusion method.

Unless otherwise specified herein, an antimicrobial composition may have the same meaning as an antibiotic, which is generically referred to as an antimicrobial agent, and may have the same meaning as an antifungal agent, a bactericide, an antiseptic, a preservative or a bactericidal agent, Which can prevent or suppress the development and the life function of Helicobacter pylori which is the cause of the disease.

The inventors of the present invention have been studying to produce a fermented product including a dairy product that can be edible for prevention or improvement of Helicobacter pylori. In the case of lactic acid bacteria having antibacterial activity or antifungal activity against existing harmful microorganisms, And the antimicrobial activity against most of the lactic acid bacteria against Helicobacter pylori is maintained only at the pH of the surrounding environment due to breeding of the lactic acid bacteria, that is, the acidic condition, and the antibacterial activity is lost at the neutral pH In the case of lactic acid bacteria derived from kimchi having a variety of functions and functions, milk is fermented using lactic acid bacteria derived from kimchi, so that no curd is formed and milk products can not be manufactured. Therefore, unlike vegetable fermented foods, It was confirmed that it was not suitable for manufacturing, While trying to perform experiments for different microorganisms with a traditional Kimchi derived antimicrobial activity In order to solve these problems, Lactobacillus Planta room strain HD1 (Latobacillus having the antibacterial and antifungal activity is superior deposit number KFCC11512P reported by the present inventors plantarum HD1 and KFCC11512P) have excellent antimicrobial activity against Helicobacter pylori. Also, unlike other lactic acid bacteria derived from kimchi, the antimicrobial activity is maintained at a neutral pH level. In particular, unlike other lactic acid bacteria derived from kimchi, It can be used in the production of dairy products unlike the previously reported Kimchi lactic acid bacteria. Thus, the present invention has been completed based on these facts.

Hereinafter, the present invention will be described in detail.

The present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof. The present invention also relates to an antimicrobial composition for Helicobacter pylori comprising as an active ingredient any one selected from the group consisting of: The curd productivity may be the ability to produce milk curd which is a fermentation product of milk fermentation.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof, as an active ingredient. The curd productivity may be the ability to produce milk curd which is a fermentation product of milk fermentation.

The Lactobacillus plantarum HD1 strain was isolated and identified and reported by the present inventor and was identified as a lactic acid bacterium isolated from kimchi which is a gram-positive bacterium and forms an opaque colony which is round, smooth and light yellow . The HD1 strain has the same potency against Rhamnos, D-turanose and D-arabitol, and has antibacterial activity and antifungal activity. In addition, the 16S rRNA sequence was 99% homologous to Lactobacillus plantarum NBRC15891 ^T and was identified as Lactobacillus plantarum. The 16S rRNA base sequence of the Lactobacillus plantarum HD1 strain was registered as JQ343914 in GenBank and the Lactobacillus plantarum HD1 strain was deposited at the Korean Microorganism Conservation Center on Apr. 1, 2011 to receive the accession number KFCC11512P .

The Lactobacillus plantarum HD1 strain can be grown on a conventional lactic acid bacterium culture medium. For example, the Lactobacillus plantarum HD1 strain can be cultured in an MRS liquid culture medium.

The Lactobacillus Planta room by Helicobacter pylori Antimicrobial activity of the (Helicobacter pylori) of HD1 strain compared to the other strains having antimicrobial activity against microorganisms for a common, Helicobacter pylori (Helicobacter The antimicrobial activity of the Lactobacillus plantarum HD1 strain against Helicobacter pylori is different from that of other lactic acid bacteria derived from Kimchi, Of the Lactobacillus plantarum in the pH range of 3.66 to 6.0, and thus the antibacterial effect of the Lactobacillus plantarum HD1 strain against Helicobacter pylori was remarkably superior to the existing strains.

Specifically, the Lactobacillus plantarum HD1 strain retained its antimicrobial activity not only in acidic pH of pH 3.66 after culturing but also in pH 5.0 and near neutral pH 6.0, as well as disappearance of antibacterial activity against Helicobacter pylori at pH 5.0 And this characteristic is considered to be an excellent effect in industry in that the antimicrobial activity against the Helicobacter pylori is maintained even in foods having various pH conditions.

In this respect, the antimicrobial composition may be such that the antimicrobial activity against Helicobacter pylori is maintained in the pH range of pH 3.66 to pH 6.0.

The cultured product may be a specific microorganism cultured in a culture medium or a culture solution. The concentrate of the culture or the culture is not limited in its formulation, and may be, for example, liquid or solid. The culture medium may contain nutrients required for culturing, that is, a microorganism to be cultured in order to cultivate a specific microorganism, and may be a mixture in which a substance for a special purpose is further added and mixed. The medium is also referred to as an incubator or a culture medium, and is a concept including both natural medium, synthetic medium and selective medium.

The antimicrobial composition may have the same meaning as an antibiotic, which is a generic term for an antimicrobial agent, and may have the same meaning as an antifungal agent, a bactericide, an antiseptic, a preservative or a bactericidal agent. Preferably, And a substance capable of inhibiting or suppressing a living function.

Wherein the lactic acid bacteria is selected from the group consisting of the Lactobacillus plantarum HD1 strain contained in the antimicrobial composition or the composition for suppressing Helicobacter pylori, the culture of the strain, the concentrate of the culture, the dried product of the culture, The content of the active ingredient may be 0.1 to 99% by weight, preferably 0.01 to 50% by weight, more preferably 1 to 30% by weight, based on the total weight of the composition, The content of the active ingredient can be appropriately controlled.

The antimicrobial composition or the composition for inhibiting H. pylori may contain carbohydrates, proteins, lipids, vitamins and minerals in addition to the active ingredients. The saccharide may be selected from the group consisting of honey, dextrin, sucrose, palatinose, glucose, fructose, starch syrup, sugar alcohol, , Sorbitol, xylitol and maltitol. The protein may be milk-derived proteins such as casein and whey protein, soybean proteins, animal-derived enzymes such as trypsin and pepsin of these proteins, neutrase, and alkylase. The lipid may be selected from the group consisting of primary saturated fatty acids, sunflower oil containing polyunsaturated fatty acids, rapeseed oil, olive oil, safflower oil, corn Derived fat such as oil, soybean oil, palm oil, and palm oil, middle-chain fatty acid, EPA, DHA, soybean-derived phospholipids, milk-derived phospholipids, The RAL fluids may be potassium phosphate, potassium carbonate, potassium chloride, sodium chloride, calcium lactate, calcium gluconate, calcium pantothenate, casein calcium, magnesium chloride, ferrous sulfate, sodium bicarbonate, but are not particularly limited by each example .

The saccharide, protein, lipid, vitamins, and minerals may be contained in the composition as long as the antimicrobial activity of the composition is maintained. The content of each component is not limited as long as the antimicrobial activity is maintained , Preferably 0.1 to 15% by weight, preferably 0.5 to 10% by weight, based on the total composition.

In addition, the antimicrobial composition or the composition for inhibiting Helicobacter pylori may contain additives for the purpose of sterilizing Helicobacter pylori in addition to the above-mentioned effective ingredients, within the range that the effect of the present invention is maintained and side effects caused by the added ingredients are not issued May further comprise a substance that is recognized as having a fungicidal activity against Helicobacter pylori and the additional ingredients or additives may be provided so as not to be interfered with by other constituents of the composition.

The antimicrobial composition of the present invention or the composition for inhibiting the formation of Helicobacter pylori may be used for various purposes and applications requiring antimicrobial activity and specifically may be used for inhibiting the growth of Helicobacter pylori, For the treatment, prevention or amelioration of gastric duodenal disease caused by Helicobacter pylori.

More specifically, the antimicrobial composition of the present invention is recognized as having antimicrobial activity against Helicobacter pylori which is a cause of gastroduodenal diseases, and it is confirmed that the antimicrobial activity is maintained in a wide pH range. Thus, The present invention can be applied to a food composition for preventing or ameliorating gastroduodenal diseases.

As used herein, the term " food " means a natural product or a processed product containing one or more nutrients, preferably a state of being able to be eaten directly through a certain degree of processing, Food, beverage, food additive, and beverage additive.

The food of the present invention may be, for example, a variety of foods, beverages, gums, tea, a vitamin complex, a health functional food and the like, and preferably can be a dairy product in which the present invention can exhibit an effect different from other inventions.

In the present invention, the health functional food refers to a food group imparted with added value to function or express the function of the food by physical, biochemical, biotechnological techniques, etc., or to control the biological defense rhythm of the food composition, Means a food which is processed and designed so that the body control function related to restoration and the like is sufficiently expressed to the living body.

The health functional food may include food-acceptable food supplementary additives, and may further include suitable carriers, excipients and diluents conventionally used in the production of health functional foods.

In the present invention, beverage is a generic term for drinking or enjoying a taste, and is intended to include a health functional beverage. The beverage includes alcoholic beverages, soft drinks, water, syrups, tea, coffee, fruit drinks and the like, preferably lactic acid bacteria drinks. The lactic acid bacterium drink refers to a beverage obtained by culturing a lactic acid bacterium and fermenting it with lactic acid to dilute it with water and adding sugar or flavoring thereto. Preferably, the lactic acid bacterium is fermented by inoculating lactic acid bacteria in milk, have. The beverage is not particularly limited as long as it contains the antimicrobial composition as an active ingredient in an indicated ratio as an essential ingredient and may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages .

In the present invention, the health functional beverage includes a beverage group to which added value is imparted so that the function of the beverage functions to a specific purpose using physical, biochemical, biotechnological techniques, etc., Means a beverage which is processed by being designed so that the body control function related to recovery and the like is sufficiently expressed to a living body.

The health functional beverage is not particularly limited to the other components except for containing the antimicrobial composition of the present invention as an essential ingredient at the indicated ratio, and may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), fermentation for the production of dairy products having antimicrobial activity against Helicobacter pylori containing any one selected from the group consisting of the culture of the strain, the concentrate of the culture, the dried product of the culture and the combination thereof To a stator. The curd productivity may be the ability to produce milk curd which is a fermentation product of milk fermentation.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof. The curd productivity may be the ability to produce milk curd which is a fermentation product of milk fermentation.

Preferably, the fermented food is inoculated with lactobacillus plantarum HD1 strain having accession number KFCC11512P, which is derived from the above-mentioned kimchi and has antibacterial activity against Helicobacter pylori and has a curd-producing ability, . ≪ / RTI >

The Lactobacillus plantarum HD1 strain, as reported previously, is different from lactic acid bacteria derived from kimchi which can not produce a solid dairy product because it can not produce curd when it is fermented by inoculation into milk. When fermented by inoculation into milk, And can be used as a fermentation strain for dairy products. Therefore, when the Lactobacillus plantarum HD1 strain is used as a fermentation strain for the production of dairy products, not only the milk curd fermented with antibiotic activity against Helicobacter pylori remarkably excellent but also a dairy product prepared using the same, The pH of the product is maintained not only in beverages and liquid yogurt which have been changed to weak acidity or neutrality but also in the production of various dairy products since the milk curd is produced and thus the excellent industrial effect is recognized do.

When a fermented starter for the production of dairy products according to the present invention is added to a raw material containing milk or milk at the time of production of fermented dairy product to produce a fermented food, the fermented starter having the deposit number KFCC11512P contained in the fermentation starter for producing the dairy product A milk curd is formed from a raw material containing milk or milk to be fermented by at least one selected from the group consisting of Lactobacillus plantarum HD1 strain, culture of the strain, concentrate of the culture and dried product of the culture, It is possible to produce fermented dairy products. In addition, the fermented starter or the dairy product produced by the lactobacillus plantarum HD1 strain having accession number KFCC11512P having the curd-producing ability can be obtained either from the milk curd produced by the fermentation or from the milk product produced by processing the milk curd, Fermented foods or dairy products prepared by using the fermented starter or the lactobacillus plantarum HD1 strain having the seeding ability KFCC11512P having the curd-producing ability can contribute to the development of the food industry .

The fermentation starter may further contain additives commonly used.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P) as an active ingredient. The seed composition may further contain additives conventionally used.

Further, the present invention relates to a lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antibacterial activity against Helicobacter pylori derived from kimchi and having a deposit number KFCC11512P having a curd- plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof may be used as a fermented food.

The fermented food may be a dairy product. Preferably, the fermented food is lactobacillus plantarum HD1 strain (hereinafter referred to as " lactobacillus ") having an antimicrobial activity against Helicobacter pylori derived from the kimchi and having a seeding ability KFCC11512P Latobacillus plantarum HD1, KFCC11512P) and fermentation.

The food means a natural or processed product containing one or more nutrients, and may be, for example, a fermented food or a functional food. There is no particular proposal for other ingredients other than the above-mentioned active ingredients, and the food may contain various flavors or carbohydrates as an additional ingredient, but the present invention is not limited thereto.

The active ingredient may be added to the raw material at the time of manufacturing the food or may be added in a proper manner to the cooked food, and may be added together with a pharmaceutically acceptable food-aid additive. In this case, the amount of the active ingredient added to the food or beverage may be 0.01 to 90% by weight of the total food, and the beverage may be added at a rate of 0.02 to 20 g based on 100 ml of the beverage. For example, 1 x 10 ⁵ (1 x 10 ⁵ cfu) to 5 x 10 ⁸ (5 x 10 ⁸ cfu) per 10 kg, based on the total food weight.

The term " fermented food " in the present invention refers to a food prepared by adding one or more microorganisms such as lactic acid bacteria or yeast, preferably the kimchi lactic acid bacteria of the present invention and using the fermentation action of the microorganism. More specifically, Means a foodstuff prepared by adding a seedling seed and aging.

The fermented food may be a dairy product, and examples of the dairy product may be cheese, butter, yogurt, and the like.

Wherein the fermented food is one in which the lactobacillus plantarum HD1 strain ( Latobacillus plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, And can be used as a seed for fermented food.

The fermented food seed bacterium may preferably be a seed of a dairy product. At this time, the amount of the seed bacterium can be appropriately controlled depending on the kind of the fermented food and the kind of the bacterium.

The Lactobacillus plantarum HD1 strain ( Latobacillus plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, or a combination thereof, is used for the production of dairy products, the Lactobacillus plantarum HD1 strain Milk curd is generated from milk to produce a variety of dairy products unlike conventional Kimchi lactic acid bacteria, which are plant-derived lactic acid bacteria.

In the present invention, the functional food refers to a food group which is imparted with added value to function and express the function of the food by using physical, biochemical, biotechnological techniques and the like, the regulation of the biological defense rhythm of the food composition, Means a food which is processed and designed so that the body control function regarding the body is sufficiently expressed to the living body.

In the present invention, drink refers to a general term for drinking thirst or for enjoying a taste, and includes alcoholic beverages, soft drinks, water, syrup, tea, coffee, fruit drinks and the like. The lactic acid bacteria drink refers to a drink in which sterilized water is added to lactic acid bacteria cultured and fermented with lactic acid and diluted with sugar and flavor. The beverage is not particularly limited to other components other than those containing the active ingredient as an essential ingredient at the indicated ratio, and may contain various flavors or natural carbohydrates as additional ingredients such as ordinary beverages.

Hereinafter, examples of the present invention will be described. The following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

< Example 1 > Isolation and Identification of Strain

The fungicidal activities of 91 kinds of kimchi lactic acid bacteria isolated from the kimchi of the optimum age, which were collected from more than 80 places such as home, famous house, restaurant or temple in the whole country including Gwangju and Jeonnam province were confirmed.

The above-mentioned 91 kinds of Kimchi lactic acid bacteria were inoculated into the MRS liquid medium and cultured at 30 DEG C for 24 hours to prepare a concentrated culture supernatant in order to select lactic acid bacteria having inhibitory activity against fungi, especially, the membrane yeast in the Kimchi lactic acid bacteria. A paper disc assay for fungi was performed using the concentrated culture supernatant to confirm fungal activity.

More specifically, the present inventors have found that the acid bacteria which are separated from the kimchi by the present inventor and stored in the laboratory, as a indicator bacteria for confirming the fungicidal activity, in particular, Issatchenkia ( Ischarchenkia sp.) and Saccharomyces sp., which are isolated from kimchi, which is an acid membrane yeast isolated directly from the present inventors by the inventors of the present invention, exhibit rough amorphous colonies. orientalis GY1) or Pichia kudryav GY1 ( Pichia yeast strain named kudriavzevii GY1) and a yeast named Saccharomyces servazzii DY2 (yeast indicating a smooth and round colony) were selected and cultured on a disk. The 91 kinds of lactic acid bacteria were tested for their antifungal activity Using the disk cultured in the indicator microorganism, the growth inhibition activity of the indicator microorganism was confirmed. The results are shown in Table 1 below .

No. Lactobacillus Inhibition of growth No. Lactobacillus Inhibition of growth GY1 DY2 GY1 DY2 One Kumho 4 - 11.80 47 Hwasun 4 - - 2 BU1 - 9.54 48 Wall 1 - 11.39 3 NJ1 - 12.09 49 Wall 10 - 12.33 4 Chinese cabbage C - 11.33 50 Wall 14 - 11.82 5 HJ5 - 11.57 51 Folk C section 6 - 11.72 6 HJC - 10.83 52 CB1 - 11.23 7 NJ2 - 10.59 53 CB2 - - 8 YY4 - 11.15 54 CB3 - - 9 Oyster 2 - 11.10 55 Week 8 - 11.53 10 SI3 - 11.70 56 Glory 21 - - 11 Prefecture C2 - 11.14 57 Production 5 - 11.92 12 WH1 - 10.28 58 Mass production 9 - 12.00 13 Vs C3 - 10.90 59 Progress III-3 - 11.54 14 Fire C1 - 9.78 60 Progress III-12 - 12.18 15 BM5 - 11.30 61 Imam-dong 3 - 12.03 16 Kumho 1 - 10.46 62 Naju 6 - 11.21 17 Curvature 1 - 10.77 63 Naju 11 - 12.05 18 Curvature 2 - 10.46 64 Bongsaengsa 1 - 11.68 19 Curvature 3 - 10.84 65 Feng Shui 2 - 11.84 20 Curvature 4 - 10.20 66 Feng Shui 3 - 11.12 21 Gospel 2 - 10.71 67 Achievement 1 - 11.73 22 Expansion 1 - 10.46 68 Achievement 2 - - 23 Jungheung 2 - 11.12 69 Shim Chiang 12 - 11.71 24 Guilin 4 - 11.09 70 Unusual 1 - 11.46 25 Sunchang 1 - 11.19 71 Unobusa 5 - 11.44 26 Sunchang 4 - 11.53 72 All rights reserved. - 12.02 27 1 - 11.78 73 Bongseon 8 - - 28 Week 3 - 11.89 74 Cabbage D - 11.19 29 HD1 10.78 12.43 75 GJ3 - 11.12 30 Folklore CA1 - 11.62 76 GJ6 - 11.94 31 Folk CA2 - 11.85 77 YY4 - 11.13 32 Folk C Section 1 - 11.08 78 Abalone 5 - 11.32 33 Folk C Section 2 - 10.97 79 Abalone 9 - 11.26 34 Folk C Section 3 - 10.73 80 Abalone 10 - 11.23 35 Folk C Section 4 - 11.06 81 Or C3 - 11.25 36 CA3 - 11.29 82 I M2 - - 37 CA4 - - 83 Choi M1 - 12.32 38 HA2 - 11.91 84 Choi M3 - 11.30 39 School 4 - 12.07 85 Choi M4 - - 40 Jindo C3 - - 86 Choi M6 - - 41 Progress C11 - - 87 Progress 12 - 11.80 42 Progress C14 - 12.15 88 Baekyangsa MB2 - 10.85 43 Yongbong 9 - - 89 Baekyangsa MC1 - 11.03 44 Yongbong 10 - 11.14 90 Baekyangsa MC2 - 10.96 45 Yongbong 13 - 11.32 91 Baekyangsa MC4 - 12.46 46 Bongseon 9 - 11.84

In the above Table 1, GY1 means Isochenia orientalis GY1, DY2 means Saccharomyces cerevisiae DY2, the unit is mm in the growth inhibition zone, , - means that no growth inhibition loop is formed.

As shown in Table 1, as a result of measuring the antifungal activity against fungi, it was confirmed that various lactic acid bacteria formed inhibitory rings against Saccharomyces cerevisiae DY2 to have antifungal activity, while the acid yeast, In the case of Leish GY1, most of the lactic acid bacteria did not have antifungal activity. Only the HD1 strain was found to have antifungal activity by forming growth inhibition ring. Thus, HD1 strain was selected as a strain having antifungal activity against acid yeast.

In order to identify the strain HD1 isolated as a strain having an antifungal activity against the above-mentioned browning yeast, morphological characteristics were firstly observed. The morphological characteristics were examined by observing whether or not Gram stain was observed and the morphology of the bacteria using a microscope. The results are shown in Table 2 below.

Characteristics The strain (HD1) Gram-stain Positive (+) Cell morphology Rod Colony Circular Colony surface Smooth Colony color Light yellow (light-yellow) Colony opacity opacity

As shown in Table 2 above, it was confirmed that the isolated HD1 strain was a Gram-positive bacterium and formed a round, smooth, and bright yellow colony.

Biochemical investigations were performed to identify the isolates. Biochemical studies were carried out by using the API 50 CHL system (BioMerieux, Marcy IEtoile, France), and then by using the strain identification program (http://apiweb.biomerieux.com). The results of glucose tolerance test using the API 50CHL system are shown in Table 3 below.

Sugar Metabolism Sugar Metabolism Glycerol - Salicine + Erythritol - Cellobiose + D-Arabinose - Maltose + L-Arabinose + Lactose + Ribose + Melibiose + D-Xylose - Saccharose + L-Xylose - Trehalose + Adonitol - Inuline - β-Methyl-xyloside - Melezitose + Galactose + D-Raffinose - D-Glucose + Amidon - D-Fructose + Glycogen - D-Mannose + Xylitol - L-Sorbose - β-Gentiobiose + Rhamnose + D-Turanose + Dulcitol - D-Lyxose - Inositol - D-Tagatose - Manitol + D-Fucose - Sorbitol + L-Fucose - a-Methyl-D-mannoside - D-arabitol + a-Methyl-D-glucoside - L-Arabitol - N-Acetyl-glucosamine + Gluconate + Amygdaline + 2-keto-gluconate - Arbutine + 5-keto-gluconate - Esculine +

In Table 3, "-" or "+" is determined on the basis of the current ability or the sugar-using ability, and when there is no ability in the present day for each party, it is indicated as "+".

As shown in Table 3 above, the HD1 strain was found to contain the following components: galactose, D-glucose, D-proctose, D-mannose, rhamnose, mannitol, sorbitol, arbutin, maltose, lactose, D- It is confirmed that it has the ability of the contemporary.

The result of the identification showed 99% homology with Lactobacillus plantarum , and the HD1 strain was presumed to be Lactobacillus plantarum .

As a result of the biochemical identification, 16S rRNA sequencing analysis was performed to finally identify the strain HD1 estimated as Lactobacillus plantarum . Specifically, the 16S rRNA nucleotide sequence of HD1 was determined and 16S rRNA sequencing was performed by comparing it with the nucleotide sequence of other strains registered in GenBank.

The base sequence of 16S rRNA of the isolated strain was performed as follows. After isolating the chromosomal DNA of the isolated strain using a genomic DNA purification kit (Q-Biogene, U.S.A.), PCR was performed using a primer having the sequence shown in Table 4 below.

Primers The sequence (5 '- &gt; 3') 518F CCAGCAGCCGCGGTAATACG 800R TACCAGGGTATCTAATCC

The PCR was carried out by pre-denaturation at 95 ° C for 5 minutes, followed by 30 cycles of 30 seconds at 95 ° C, 30 seconds at 53 ° C, and 1 minute and 30 seconds at 72 ° C, Followed by post-elongation after 10 minutes. The amplified PCR product was cloned into a pGEM-T easy vector (Promega Co., USA), and the base sequence was determined using an ABI PRISM 3730 DNA analyzer (Applied Biosystems, Foster City, CA, USA) As a result, as shown in Fig. 1, a total nucleotide sequence of 1,368 bp was confirmed.

The determined nucleotide sequence was compared with the nucleotide sequence registered as a ribosomal RNA gene sequence in GenBank using the BLASTN program. The homology between the nucleotide sequences was compared using Clustal X program. Based on the results of the comparative analysis, phylogenetic relationships with other bacteria are shown in Fig.

As shown in FIG. 2, the 16S rRNA base sequence of the HD1 strain is the Lactobacillus plantarum NBRC 15891 ^T strain ( Lactobacillus plantarum NBRC 15891 ^T ). Thus, finally the HD1 strain Lactobacillus Planta room (Lactobacillus plantarum) in sympathy, and the HD1 strain Lactobacillus Planta rooms HD1 (Lactobacillus plantarum HD1).

The above-mentioned Lactobacillus plantarum HD1 ( Lactobacillus plantarum HD1) was registered in GenBank as JQ343914, and the 16S rRNA sequence of the Lactobacillus plantarum HD1) was deposited with the Korean Society for Microbiological Conservation, April 1, 2011, and granted accession number KFCC11512P.

< Example 2 > Kimchi lactic acid bacteria  medium Anti-Helicobacter Pyory  Isolation of active lactic acid bacteria

2-1. Anti-Helicobacter Pyory  Isolation of Active Lactic Acid Bacteria pre - screening )

Among the lactic acid bacteria isolated from Kimchi collected from Gwangju and Jeonnam regions by the present inventors, 31 kinds of lactic acid bacteria that have been confirmed to have excellent antimicrobial activity against harmful microorganisms were tested for antibacterial activity against Helicobacter pylori.

Specifically, the strain MRS medium except for sodium acetate and Tween 80 in the MRS medium was inoculated with 31 kinds of lactic acid bacteria having antimicrobial activity against the above-mentioned microorganism, and the culture supernatant was obtained. The culture supernatant was concentrated 25 times and the anti-helicobacter pylori activity was measured by a paper disc assay using a paper disc (8.0 mm diameter, 1.5 mm thickness, ADVANTEC, Japan) The results are shown in Table 5 below.

no Strain name
(Isolate) Gram positive shape
(Morphology) Inhibition ring size
(inhibition zone, mm) One DC1 + rod 15.85 2 DC2 + 샤로 15.78 3 DC3 + 샤로 15.92 4 DC4 + rod 14.59 5 JO1 + 샤로 12.49 6 JO2 + 샤로 12.54 7 JO3 + rod 14.62 8 JO4 + rod 14.93 9 HD1 + rod 24.10 10 ENC1 + 샤로 14.81 11 ENC2 + 샤로 14.46 12 ENC3 + 샤로 15.17 13 SN31 + rod 16.98 14 HWU3 + 샤로 13.42 15 NMC2 + 샤로 14.97 16 NMC3 + 샤로 15.03 17 NMC5 + rod 14.73 18 NMC7 + 샤로 15.09 19 BU1 + rod 17.02 20 UC1 + 샤로 14.13 21 UC2 + 샤로 13.04 22 UC3 + rod 13.70 23 UC4 + 샤로 14.29 24 UC5 + 샤로 14.28 25 UC6 + 샤로 13.72 26 WH1 + rod 16.95 27 HY1 + 샤로 11.79 28 HY2 + cocci 14.88 29 HY3 + cocci 13.77 30 HY4 + cocci 14.41 31 HY5 + 샤로 15.09 32 YM3 + rod 15.26

As shown in Table 5 above, Lactobacillus plantarum HD1 ( Lactobacillus plantarum (17.02 mm) of 19, SN31 (16.98 mm) of 13, and WH1 of 16 (16.98 mm), which were found to be the most effective antihelical activator, (16.95 mm), and YM3 (15.26 mm), which is 32, in order.

Five kinds of lactic acid bacteria having high anti-helicobacter activity were selected and further experiments were conducted.

2-2. Isolated Anti-Helicobacter Pyory  Identification of active lactic acid bacteria

Each of the five strains having the anti-Helicobacter pylori activity isolated in Example 2-1 was subjected to sequencing using the API kit and sequencing using 16S rRNA nucleotide sequence to identify each strain again.

The above-mentioned performance analysis was performed using an API kit (50CHL, BioMerieux, Marcy I'Etoile, France), and the results are shown in Table 6 below.

Sugar HD1 SN31 BU1 WH1 YM3 Sugar HD1 SN31 BU1 WH1 YM3 control - - - - - Esculine + + + + + Glycerol - - - - - Salicine + + + - + Erythritol - - - - - Cellobiose + + + + + D-Arabinose - - - - - Maltose + - + + + L-Arabinose + + - + + Lactose + + + + + Ribose + + + + + Melibose + + - + + D-Xylose - - + - - Saccharose + + - + + L-Xylose - - - - - Trehalose + + + - + Adonitol - - - - - Inuline - - - - - β-Methyl-xyloside - - - - - Melezitose + - + - + Galactose + + + + - D-Raffinose - - - - - D-Glucose + + + + + Amidon - - + - - D-Fructose + + + + + Glycogene - - - - - D-Mannose + + + + + Xylitol - - - - - L-Sorbose - - - - - β-Gentiobiose + + + - + Rhmnose + - - - - D-Turanose + - - - + Dulcitol - - - - - D-Lyxose - - - - - Inositol - - - - - D-Tagatose - - + - - Mannitol + - - - + D-Fucose - - - - - Sorbitol + - - - + L-Fucose - - - - - alpha -Methyl-D-mannoside - - - - - D-arabitol + - - - - alpha -Methyl-D-Glucoside - - + - - L-Arabitol - - - - - N-Acetyl glucosamine + + + + + Gluconate + + + + - Amygdaline + - + - + 2-keto-gluconate - - - - - Arbutine + - + - + 5-keto-gluconate - - - - -

As a result of 16S rRNA sequence analysis, the total 16S rRNA of HD1 strain was 1,368 bp, which was analyzed using Lactobacillus plantarum NBRC 15891 and exhibits a homology of 99%, Lactobacillus Planta was confirmed to be a volume, 16S rRNA of SN31 strains was analyzed using a total of 1,379 bp, it Lactobacillus sakei subsp. The 16S rRNA of BU1 strain was 1,378 bp, which was 99% homologous with Lactobacillus curvatus NBRC 15884, which was 99% homologous with 23K of sakei 23K and confirmed to be Lactobacillus casei. Lactobacillus sativus was confirmed, and the 16S rRNA of WH1 strain was 1,381 bp total, which was analyzed using Lactobacillus sakei subsp. Sakei 23K was 99% homologous with Lactobacillus casei. The 16S rRNA of YM3 strain was 1,375 bp, which was analyzed by Lactobacillus and showed 99% homology with plantarum NBRC 15891, confirming lactobacyral plutarium.

2-3. Isolated lactic acid bacteria Anti-Helicobacter Pyory  Verify Active

The anti-Helicobacter pylori activity of the five kinds of Kimchi lactic acid bacteria isolated in Example 2-1 and identified in Example 2-2 was confirmed as follows.

First, the culture supernatant for confirming the anti-helicobacter pylori activity was obtained by inoculating 1% (v / v) of the culture medium of the above five kinds of Kimchi lactic acid bacteria into the modified MRS medium used in Example 2-1, After culturing, the cultured medium was centrifuged at 9,950 × g and 4 ° C. for 15 minutes, filtered through 0.45 μm filter paper (0.45 μm membrane filter), and lyophilized. The lyophilized culture was concentrated 10 times and used in the experiment.

The anti-Helicobacter pylori activity was performed in the following manner.

First, the Helicobacter pylori strain to be subjected to the antimicrobial activity was inoculated with 1% (v / v) Helicobacter pylori culture medium in a liquid medium of Brucella (Difco CO., France) supplemented with 10% horse serum (Gibco Co., USA) 10% CO ₂ and 37 ° C for 24 hours. The culture medium was diluted and plated on a Brucella solid medium at 1.0 × 10 ⁷ CFU / plate. A paper disc (8.0 mm diameter, 1.5 mm thickness, ADVANTEC, Japan) was placed on a solid medium, 100 [mu] L each of the cultured lactic acid bacteria was dispensed. Thereafter, the cells were incubated at 37 DEG C for 12 hours to measure the antimicrobial activity. The results are shown in Fig.

As shown in Fig. 3, Lactobacillus plantarum HD1 ( Lactobacillus plantarum HD1) was measured to be 20.02 mm, which showed the best anti-Helicobacter pylori activity. Lactobacillus SA31 ( Lactobacillus sakei SN31, 16.20 mm), Lactobacillus buccal BU1 ( Lactobacillus curvatus BU1, 15.90 mm), Lactobacillus case WH1 ( Lactobacillus sakei WH1, 15.80 mm), Lactobacillus plantaum YM3 ( Lactobacillus plantarum YM3, and 9.03 mm), respectively, in order of anti-helicobacter pylori activity.

From the above confirmation results, in order to confirm whether Lactobacillus plantarum is generally superior to the anti-helicobacter pylori activity, Lactobacillus plantarum, together with the above isolated HD1 strain and YM3 strain, were cultured in the presence of Lactobacillus strain 464 as a published strain belonging to Lactobacillus plantarum Bacillus Planta Room KFRI 464 ( Lactobacillus plantarum KFRI 464) and Lactobacillus plantarum KFRI 236 ( Lactobacillus &lt; RTI ID = 0.0 &gt; plantarum KFRI 236) were tested for anti-Helicobacter pylori activity. The anti-Helicobacter pylori activity was performed as described above, and the results are shown in FIG.

As shown in FIG. 4, the inhibitory ring size of HD1 was measured to be 20.02 mm, and it exhibited the best anti-Helicobacter pylori activity. KFRI 464 (16.32 mm), KFRI 236 (16.12 mm) and YM3 In order, indicating anti-Helicobacter pylori activity. From the above results, it was confirmed that the strain HD1 has remarkably excellent anti-Helicobacter pylori activity as compared with Lactobacillus plantarum, as well as various kimchi lactic acid bacteria isolated from kimchi. In addition, the antimicrobial activity against Helicobacter pylori is distinguished from the antimicrobial activity against harmful microorganisms such as Escherichia coli. In contrast to other microbes exhibiting excellent antimicrobial activity against the harmful microorganism, the HD1 strain has a remarkably superior Helicobacter pylori activity .

2-4. Isolated lactic acid bacteria pH In accordance Anti-Helicobacter Pyory  Verify Active

The correlation between the anti-Helicobacter pylori activity and the pH confirmed in Example 2-3 was confirmed as follows. This is because the antibacterial activity of a conventional lactic acid bacterium is largely due to changes in the pH of the surrounding environment to an acidic condition due to the organic acid secreted during the growth and metabolism of the lactic acid bacterium. In this case, when the pH environment is changed, And the antibacterial activity is not exhibited at a pH of slightly acidic or neutral pH, which is a pH of the product, and industrial use of the product may be restricted.

First, the above-mentioned five kinds of Kimchi lactic acid bacteria were inoculated 1% (v / v) in the modified MRS medium used in Example 2-1, and cultured for 24 hours at 30 DEG C, and then the pH of the cultured medium was measured And the change in the peripheral pH with the cultivation of the lactic acid bacteria was confirmed. The measurement results are shown in Table 7 below.

Strain HD1 SN31 BU1 WH1 YM3 PH after incubation 3.66 4.00 4.05 4.04 4.13

As shown in Table 7, it was confirmed that the five kinds of Kimchi lactic acid bacteria in which the anti-Helicobacter pylori activity was confirmed to change the pH of the culture medium to acidic, and in particular, HD1, which has the highest antimicrobial activity, (PH 4.00), BU1 (pH 4.05), WH1 (pH 4.04), and YM3 (pH 4.13) were found to be the lowest in the pH range of pH 3.66 and the acidity of the medium was found to be stronger . The antimicrobial activity of the lactic acid bacteria culture medium was determined according to the pH condition to ascertain the degree of acidification of the culture medium, that is, the cause of the antibacterial activity of the organic acid.

Specifically, the pH of the culture supernatant prepared in Example 2-3, which was 10-fold concentrated, was adjusted to pH 4.0, pH 5.0 and pH 6.0 using 5 N HCl or 5 N NaOH, In the same manner, the cells were incubated at 37 ° C for 12 hours to confirm anti-Helicobacter pylori activity. The results are shown in FIG. As a control group, a culture supernatant without pH adjustment was used as a comparative group, and the experiment was performed using a modified MRS medium as a control group (FIG. 5A).

As shown in FIG. 5, most of the lactic acid bacteria lose the anti-helicobacter pylori activity as pH increases, and most of the lactic acid bacteria at pH 5 and all of the other lactic acid bacteria except HD1 lose the anti-helicobacter pylori activity at pH 6 However, HD1 showed the highest anti-Helicobacter pylori activity at all pH conditions, and anti-Helicobacter pylori activity was maintained even at pH 6, although the anti-Helicobacter pylori activity decreased with increasing pH.

Specifically, when the pH was adjusted to 4.0, HD1 showed the strongest activity at 18.77 mm and the order of WH1 (14.59 mm), SN31 (14.40 mm), BU1 (14.02 mm) and YM3 , And it was confirmed that the anti-Helicobacter pylori activity of the HD1 strain was the most excellent. In the modified MRS medium in which the pH was adjusted to pH 4.0, the anti-Helicobacter pylori activity did not appear, and the Helicobacter pylori It was confirmed that it can not be inhibited only by changing the growth environment under a simple acid condition.

In addition, HD1 (16.50 mM) retained excellent anti-helicobacter pylori activity and the anti-helicobacter pylori activity was found to be the most excellent. However, YM3 lost anti-helicobacter pylori activity and WH1 8.80 mm), and the SN31 (12.51 mm) and BU1 (11.58 mm) were also somewhat lost in anti-helicobacter pylori activity.

In addition, HDI (13.01 mm) was found to maintain excellent anti-helicobacter pylori activity, while the pH was adjusted to 6.0, while the remarkably reduced anti-Helicobacter pylori activity was confirmed In the case of kimchi lactic acid bacteria, it was confirmed that anti - helicobacter pylori activity was lost.

From the above results, it can be seen that the anti-Helicobacter pylori activity of the general lactic acid bacteria is lost or significantly decreased by the change of the pH condition, that is, the change of the pH environment to the weak acidity or neutrality, And the antimicrobial activity was maintained.

From the above confirmation results, in order to confirm whether or not the maintenance of the anti-Helicobacter pylori activity according to the pH is a general feature of Lactobacillus plantarum, in the same manner as in Example 2-3, the HD1 strain and the YM3 strain, together with Lactobacillus planta Additional experiments were carried out on 464 and 236 isolates belonging to the room.

First, the respective strains were cultured as described above, and then the pH of the culture medium was measured. The results are shown in Table 8.

Strain HD1 KFRI 464 KFRI 236 YM3 PH after incubation 3.66 3.58 3.61 4.13

As shown in Table 8, all of the lactobacilli flutaram that had anti-Helicobacter pylori activity in the above examples were found to change the pH of the culture medium to acidic, and the specificities thereof were 464 (pH 3.58) 236 (pH 3.61) was lower than that of HD1, which has the highest antimicrobial activity.

The anti-Helicobacter pylori activity according to the change of pH was confirmed by the above-mentioned method, and the results are shown in Fig.

As shown in FIG. 6, the anti-helicobacter pylori activity of the HD1 strain remained in spite of the pH change, while the other strains 464 and 236, which were lower in the pH of the culture medium, In the case of pH 6, all of the lactic acid bacteria other than HD1 lost the anti-helicobacter pylori activity, and this characteristic of HD1 is that the species belonging to the corresponding strain, that is, Lactobacillus plantarum was found to be different from the general characteristics of Lactobacillus plantarum.

Specifically, when the pH was adjusted to 4.0, HD1 showed the strongest activity of 18.77 mm, and the antimicrobial activity was exhibited in the order of 464 (16.32 mm), 236 (16.12 mm) and YM3 (10.25 mm) It was confirmed that the anti-helicobacter pylori activity of the HD1 strain was the most excellent. In addition, 464 strains and 236 strains, which were the published strains, also had excellent anti-helicobacter pylori activity.

On the other hand, when the pH was adjusted to 5.0, it was confirmed that HD1 (16.50 mm) retained excellent anti-helicobacter pylori activity while 464 (12.51 mm) and 236 (11.58 mm) decreased anti-helicobacter pylori activity , YM3 was found to have lost the activity of anti-helicobacter pylori. As a result of measurement by adjusting the pH to 6.0, it was confirmed that the strains other than HD1 lost anti-helicobacter pylori activity.

From the above results, it can be seen that the HD1 strain has remarkably superior anti-Helicobacter pylori activity as compared to lactic acid bacteria derived from kimchi or Lactobacillus plantarum which is known to have excellent antimicrobial activity, and that other lactic acid bacteria have a change in pH condition, The anti-Helicobacter pylori activity of the HD1 strain is maintained, despite the pH change, while the anti-Helicobacter pylori activity is lost or lost according to the change of the pH environment to neutrality, and the anti-Helicobacter pylori activity of the HD1 strain is maintained Respectively.

2-5. Isolated lactic acid bacteria Milk curd Generation  Verify Active

Generally, lactic acid bacteria derived from kimchi, which are vegetable lactic acid bacteria, have diverse physiological activities. However, unlike lactic acid bacteria derived from milk products, which are animal lactic acid bacteria, there is a disadvantage in that they can not produce milk products, The application is limited.

Regarding this problem, in order to confirm the applicability of Kimchi lactic acid bacteria to dairy products, five kinds of isolated lactic acid bacteria were inoculated into milk and cultured to confirm whether or not milk curd was produced.

Specifically, the culture broths of the above five kinds of Kimchi lactic acid bacteria were inoculated 1% (v / v) in MRS liquid medium (Difco Co., France) and cultured for 24 hours at 30 ° C. (V / v) of the milk used to confirm whether or not the strain of the strain of the present invention produced the milk curd was separated and the cells were recovered. Each of the obtained cells was washed with third distilled water, and the cells were inoculated into milk. The cells were cultured at 30 ° C for 48 hours. After the culturing, the formation of milk curd was visually observed. The above observation result is shown in Fig.

As shown in FIG. 7, the HD1 produced milk curd well enough so that the surface of the curd produced after incubation was parallel to the inlet or bottom surface of the test tube in an inclined laboratory tube, while in the case of other lactic acid bacteria, the MRS medium It was confirmed that a slanted laboratory tube, like a control, was described to coincide with the surface of the experimental dish, not the experimental tube, so that the milk curd was not formed.

As described above, in case of Kimchi lactic acid bacteria confirmed in the experiment, it is not possible to form milk curds. On the other hand, HD1 is added to the culture solution corresponding to 1% (v / v) , It was confirmed that milk curd was sufficiently formed even when cultured for 48 hours at a temperature of 50-150 ° C, which is suitable for the production of dairy products by lactic acid fermentation.

Because HD1 has excellent anti-helicobacter pylori activity, pH is maintained in anti-Helicobacter pylori activity, and milk curd productivity is excellent, HD1 is a disease caused by Helicobacter pylori, unlike lactic acid bacteria of Kimchi, It is estimated that the industrial application is very large due to the wide industrial utilization spectrum, unlike the conventional production of vegetable fermented foods such as kimchi, since it can be utilized actively in the production of dairy products for prevention or improvement

Korea Microorganism Conservation Center (Domestic) KFCC11512P 20110401

Claims (6)

Lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori in pH range of pH 3.66 to pH 6.0 and having a seeding ability KFCC11512P derived from Kimchi plantarum HD1, KFCC11512P), fermentation for the production of dairy products having antimicrobial activity against Helicobacter pylori containing any one selected from the group consisting of the culture of the strain, the concentrate of the culture, the dried product of the culture and the combination thereof Stater. Lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori in pH range of pH 3.66 to pH 6.0 and having a seeding ability KFCC11512P derived from Kimchi plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof. 3. The method of claim 2,
Wherein the fermented food is a dairy product. The method of claim 3,
The fermented food is a lactobacillus plantarum HD1 strain having an antimicrobial activity against Helicobacter pylori in a pH range of pH 3.66 to pH 6.0 derived from the above-mentioned kimchi in milk and having a deposit number KFCC11512P having a curd- ( Latobacillus plantarum HD1, KFCC11512P) and fermenting the fermented food. Lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori in pH range of pH 3.66 to pH 6.0 and having a seeding ability KFCC11512P derived from Kimchi plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof as an active ingredient. Lactobacillus plantarum HD1 strain ( Latobacillus strain) having an antimicrobial activity against Helicobacter pylori in pH range of pH 3.66 to pH 6.0 and having a seeding ability KFCC11512P derived from Kimchi plantarum HD1, KFCC11512P), a culture of the strain, a concentrate of the culture, a dried product of the culture, and a combination thereof.

Images