KR20170058780A - Method and Kit for Detecting Single- and Multi-Nucleotide Polymorphism - Google Patents

Abstract

The present invention relates to a method and kit for detecting a base mutation of a target nucleic acid or base polymorphism, wherein the method comprises the steps of: (a) hybridizing a nucleic acid oligomer for detection to a target nucleic acid; (b) polymerizing the target nucleic acid; and (c) detecting the target nucleic acid. The method and kit for detecting a base mutation of a target nucleic acid or base polymorphism according to the present invention can confirm several base mutations or polymorphic sites having similar positions through a primer for amplifying the target nucleic acid.

Description

[0001] The present invention relates to a method and a kit for detecting polymorphism in a nucleotide sequence,

The present invention relates to a method and a kit capable of detecting a base mutation or a base polymorphism in a base sequence, and more particularly, to a method and a kit for detecting a base mutation or a polymorphism base of a target nucleic acid, Hybridizing the nucleic acid oligomer for detection to a target nucleic acid; (b) adding a primer, a nucleic acid degrading enzyme and a 5 '→ 3' nucleic acid polymerase for amplification of the target nucleic acid to perform a polymerization reaction of the target nucleic acid; And (c) detecting the reaction of step (b) to detect the target nucleic acid. The present invention also relates to a detection kit and a detection kit for detecting a base mutation or a base polymorphism of a target nucleic acid.

Nucleic acid (DNA or RNA) is a genetic material present in living organisms. It is a nucleotide sequence consisting of four bases (A, T, G, C or A, U, G and C) Information is stored in a unique base sequence.

Molecular diagnosis is an in vitro diagnostic method based on genetic material, and is used in various fields such as genetic diseases, cancer diagnosis, infectious diseases and custom diagnosis. Representative molecular diagnostic techniques amplify the target region of nucleic acid in a short time by various methods including Polymerase Chain Reaction (PCR), and perform detection and analysis. In this case, for the amplification of the target site, Information about the nucleotide sequence of the subject to be diagnosed is obtained by using a nucleic acid oligomer capable of binding to the target nucleic acid.

Single nucleotide polymorphism (SNP) is a genetic mutation in which a single nucleotide sequence is substituted in the DNA base sequence, resulting in individual differences such as the cause of the disease or the response to a therapeutic agent. The detection of single nucleotide polymorphism is attracting attention because it leads to the development of new drugs as well as customized medicines.

For rapid detection of single nucleotide polymorphisms, various detection methods using real-time PCR technology have been developed. Representative methods include analysis using a DNA intercalating fluorescent substance, a method using a DNA probe, or a method using a PNA probe. However, it has limitations in using DNA intercalating fluorophores and has the disadvantage of using a program to analyze the melting curve (Kirk M. Ririe et al., Analytical Biochemistry 245: 154, 1997; U. Hladnik et al., Clin Exp Med. , 2: 105, 2002).

Particularly, nucleic acid oligomers complementary to the sequence of the target nucleic acid used in a general nucleic acid amplification technique can be used to target a single nucleotide polymorphism or a small number of multi-nucleotide polymorphism sites The nucleic acid amplification technique does not allow detection of a minute nucleotide sequence variation.

Sanger sequencing or next-generation sequencing is used as a method for confirming the base polymorphism. However, it is necessary to proceed the reaction process for nucleic acid amplification and base sequence determination, Therefore, there is a disadvantage that it takes a complicated and long time.

Recently, allele-specific PCR (AS PCR) has been used as a technique for confirming a minute sequence variation. This is because the 3 'end of the nucleic acid oligomer that binds to the target nucleic acid and causes the nucleic acid synthesis elongation is located at the polymorphic site of the target nucleic acid so that complementary binding of the 3' end of the nucleic acid oligomer does not occur when the nucleotide sequence is mutated, . However, since the position of the nucleic acid oligomer which causes the nucleic acid synthesis elongation is fixed, the AS PCR can not be arbitrarily changed, so that the improvement of the nucleic acid amplification efficiency and the securing of the specificity are limited. In addition, there is a disadvantage in that a plurality of nucleic acid amplification reactions and a plurality of nucleic acid oligomers are necessary in order to confirm the nucleotide sequence variation of a plurality of targets.

Recently, a clamping PCR method capable of selectively amplifying and detecting a gene mutation site has been used. This is a method of inhibiting the amplification of the wild type gene and allowing the amplification of the mutated gene by using a blocking primer having a nucleotide sequence complementary to the nucleotide sequence of the wild type gene. However, this method has limitations in that the amplification-inhibiting primer can bind to a target by discriminating a single nucleotide polymorphism or a plurality of nucleotide polymorphisms, and when using LNA (locked nucleic acid) or PNA (peptide nucleic acid) , Are not widely used due to the complex manufacturing process and high cost of such materials.

Under these technical backgrounds, the present inventors have made intensive efforts to develop a method for detecting a base mutation of a target nucleic acid, in particular, a polymorphic base. As a result, it has been found that the polymorphic base or base mutation site of the target nucleic acid is complementary to the base recognition site of the nucleic acid oligomer for detection The nucleotide sequence of the polymorphic base or the base mutation of the target nucleic acid can be discriminated by decomposition or inhibition of degradation of the 5 'terminal structure present in the nucleic acid oligomer for detection.

It is an object of the present invention to provide a polynucleotide which is simpler and quicker than conventional sequencing techniques and which is more accurate than AS PCR (allele-specific PCR) and clamping PCR methods and which is advantageous in detection sensitivity and specificity improvement Or a mutation of a nucleotide sequence, and a kit.

In order to accomplish the above object, the present invention provides a method for detecting a target nucleic acid, comprising the steps of: (a) hybridizing a target nucleic acid oligomer with a detecting nucleic acid oligomer recognizing a mutation or polymorphism base of a target nucleic acid to form a specific 5 'terminal structure; (b) adding a target nucleic acid amplification primer, a nucleic acid degrading enzyme, and a 5 '→ 3' nucleic acid polymerase to the target nucleic acid hybridized with the nucleic acid oligomer for detection to perform a polymerization reaction of the target nucleic acid; And (c) detecting the reaction of step (b) to detect the target nucleic acid.

(Iii) a base recognition site linked to the binding site and recognizing a mutation or polymorphism base of the target nucleic acid; (ii) (Ii) a nucleotide sequence complementary to the target nucleic acid, and (ii) a nucleotide sequence complementary to the target nucleic acid, wherein the target nucleotide and non-complementary region are located adjacent to the 5 'end and are linked by a nuclease- A nucleic acid oligomer for detection comprising a base located at the 3 'end of the binding site and inhibiting nucleic acid polymerization; And (b) a kit for detecting a base mutation or polymorphism of a target nucleic acid comprising a primer for amplifying a target nucleic acid, a nucleic acid degrading enzyme and a 5 '→ 3' nucleic acid polymerase.

A method for detecting a base mutation or a base polymorphism of a target nucleic acid according to the present invention and a kit for detecting a base mutation or polymorphism of a target nucleic acid according to the present invention can detect a base mutation or a polymorphic base through a nucleic acid oligomer for detection regardless of a target nucleic acid binding Base mutations or polymorphic sites can be identified through a primer for target nucleic acid amplification and the nucleic acid oligomers for detection labeled with a material comprising a reporter and / or a quencher are mixed and reacted simultaneously to form a single nucleic acid Multiplex detection of base polymorphism can be achieved by amplification alone. In contrast to the clamping PCR method and the AS-PCR (Allele-specific PCR) method using an amplification-inhibiting blocking primer under stringent conditions, the present invention is easy and inexpensive to detect the base mutation and base polymorphism with sensitivity and specificity There is an advantage of providing an improved detection method.

Fig. 1 shows a nucleic acid oligomer for detection and a primer which binds to a target nucleic acid.
2 shows a method for detecting a base polymorphism of a target nucleic acid.
FIG. 3 and FIG. 4 illustrate a method of detecting a base polymorphism of a target nucleic acid by fluorescent signal (expression) by labeling a nucleic acid oligomer for detection with a fluorescent substance and a small mineral.
Figure 5 shows the anticipated design content of a nucleic acid oligomer for detection for testing the ApoE genotype of Example 1.
FIG. 6 shows a result of using ApoE genotyping principle of Example 1 with a primer 1, a nucleic acid oligomer 1 for detection, and a nucleic acid oligomer 2 for detection.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

In one aspect of the present invention, for the purpose of analyzing a polymorphic base by selectively decomposing or inhibiting degradation of a nucleic acid oligomer for detection according to the type of base present in a polymorphism base region of a target nucleic acid, A nuclease-resistant bond, which is not cleaved by a nucleic acid degrading enzyme, is a nucleic acid degrading enzyme (hereinafter, referred to as " nucleic acid-decomposing enzyme ") when complementary to one or more recognition bases Terminus of the nucleic acid oligomer for detection that interferes with the reaction of the nucleic acid polymerase with the polynucleotide of the target nucleic acid and the recognition base of the nucleic acid oligomer for detection are formed in the 5 ' The nucleic acid-degrading enzyme and the nucleic acid polymerase are allowed to react with each other so that the 5'-terminal structure of the nucleic acid oligomer for detection Have developed a detection method using the nucleotide polymorphism chamber mechanism being. As a result, it was possible to efficiently detect the polymorphic base of the target nucleic acid by amplification of the nucleic acid, fluorescence measurement, or the like, while freely adjusting the positions and characteristics of the primer and the nucleic acid oligomer for detection binding to the target nucleic acid See Tables 1 and 2 and Figs. 1 to 6).

Thus, in one aspect, the present invention provides a method for detecting a nucleic acid molecule comprising: (a) hybridizing a nucleic acid oligomer for detection to a target nucleic acid to recognize a base mutation or polymorphism base of the target nucleic acid to form a specific 5 'terminal structure; (b) adding a primer, a nucleic acid degrading enzyme and a 5 '→ 3' nucleic acid polymerase for amplification of the target nucleic acid to perform a polymerization reaction of the target nucleic acid; And (c) detecting the reaction of step (b) to detect the target nucleic acid.

In the present invention, the confirmation of the reaction in the step (c) may be performed by an electrophoresis method or an optical measurement method, but is not limited thereto.

In the present invention, the polymerization reaction of the target nucleic acid is carried out by polymerase chain reaction (PCR), denaturation at 94 DEG C, annealing at 45 to 67 DEG C and extension at 72 DEG C The step may be repeated in one cycle for a certain period of time until the amplification product is produced, but is not limited thereto.

The electrophoresis method is a separation method according to the molecular weight of the amplification product produced by the polymerization reaction of the target nucleic acid, and the optical measurement method is performed by binding a reporter and a quencher to a nucleic acid oligomer for detection to be described later .

In another aspect, the present invention relates to a nucleic acid amplification method comprising the steps of: (a) amplifying a nucleic acid sequence comprising (i) a complementary binding site with a target nucleic acid, (ii) a nucleotide recognition site linked to the binding site and recognizing a base mutation or polymorphism of the target nucleic acid, (iii) a base adjacent to the 5 'end and linked by a nuclease-resistant bond that is not cleaved by a nucleic acid degrading enzyme, and (iv) a target nucleic acid and a target nucleic acid A nucleic acid oligomer for detection comprising a base which is located at the 3'-terminal of the complementary binding site with a nucleotide whose polymerization is inhibited; And (b) a kit for detecting a base mutation or a base polymorphism of a target nucleic acid comprising a primer for amplifying a target nucleic acid, a nucleic acid degrading enzyme and a 5 '→ 3' nucleic acid polymerase.

The kit of the present invention may optionally include reagents necessary for conducting a target amplification PCR reaction (e. G., Real-time PCR) such as a buffer, a DNA polymerase joiner and deoxyribonucleotide-5-triphosphate. In addition, the kit may include various polynucleotide molecules, reverse transcriptase, buffer and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the kit may be readily determined by those skilled in the art having the teachings herein to determine the optimal amount of reagent used in a particular reaction. Typically, the kit may be made in a separate package or compartment containing the aforementioned components.

The 'target nucleic acid' of the present invention refers to a nucleic acid sequence (DNA or RNA) to be detected, which is annealed or hybridized with a primer or a probe under hybridization, annealing or amplification conditions. The 'target nucleic acid' is not different from the term 'target nucleic acid', 'target nucleic acid sequence' or 'target sequence' as used herein, and is used in this specification.

In the present invention, the sample containing the target nucleic acid may be derived from a specific tissue or organ of an animal, including a human. Representative examples of such tissues include binding, skin, muscle or nervous tissue. Representative examples of the above-mentioned organs include, but are not limited to, eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testis, , Lines and inner blood vessels.

The sample of specimen includes any cell, tissue, fluid, or any other medium that can be well analyzed by the present invention from a biological source, which can be used to determine the consumption of human, animal, human or animal Samples from food prepared for this purpose are included. In addition, the sample to be analyzed includes a body fluid sample, which may be a sputum, blood, serum, plasma, lymph, milk, urine, feces, eye milk, saliva, semen, brain extract Spleen and tonsil tissue extracts.

"Hybridization" of the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

In the present invention, the nucleic acid oligomer for detection comprises a nucleotide sequence which is complementary to a nucleotide sequence of (i) a complementary binding site with a target nucleic acid, (ii) a base recognition site linked to the binding site, (iii) And a base linked to a nuclease-resistant bond which is not cleaved by a nucleic acid-degrading enzyme, and wherein the target nucleic acid and the non-target nucleic acid region are complementary to each other, and (iv) (3 'end), and includes a base in which nucleic acid polymerization is inhibited.

The 'complementary binding site with the target nucleic acid' refers to a complete nucleotide sequence complementary to the hybridization site of the target nucleic acid and the nucleic acid oligomer for detection.

In the present invention, the complementary binding site, the base recognition site or the non-complementary site may contain one or more bases.

In the present invention, the complementary binding site and base recognition site of the nucleic acid oligomer for detection may be a gene regulatory sequence or a gene coding sequence in the nucleotide sequence of the target nucleic acid.

The gene regulatory region may be selected from a promoter, a transcription enhancer, a 5 'non-translation region, a 3' non-translation region, a virus packaging sequence, and a selection marker.

The gene region may be an exon or an intron and the gene region may be within 10, 5, 3, or 1 kb or 500, 300, or 200 bp of the transcription start site of the gene, for example, upstream ) Or downstream (downstream).

The optimal number of bases (base sequence length) of the base recognition site is determined by the phenotype according to the base mutation or base polymorphism of the target nucleic acid-derived individual, and the number of bases exhibiting the highest expression accuracy empirically (Base sequence length). These phenotypes are adverse traits and include, but are not limited to, diseases, disorders, conditions, symptoms, and the like. For example, the disease, condition, or symptom may be a cancer, a tumor, a chronic disease, an infectious disease, a neurological disease, a metabolic disease, an immunological disease, an inflammatory disease, a cardiovascular disease, a respiratory disease, a bone disease, a thyroid disease, But are not limited to, eye diseases, dermatological diseases, dental diseases, endocrine disorders, gastrointestinal disorders, genetic diseases, musculoskeletal disorders, arthritis, obesity, neurological diseases (Alzheimer's disease) and hyperlipemia. Expression accuracy can be measured by, but not limited to, the incidence of the disease, the therapeutic response (e.g., drug responsiveness), or the expression of the biomarker associated with the prevalence of the disease.

Recognizing bases of the nucleic acid oligomers for detection of the present invention are bases which are complementary to only one base (Nucleotide (N): A, T, C, G) that can exist in the base mutation or base polymorphism site, It is preferable to include it in the recognition site.

In the present invention, there are one or more bases connected by a nuclease-resistant bond which is not cleaved by a nucleic acid degrading enzyme of a nucleic acid oligomer for detection, and 10 bp and 5 bases from the base recognition site toward the 3 ' Terminal bg and 5 bp in the 5 'terminal direction, more preferably within 1 bp in the 3' terminal direction and 2 bp in the 5 'terminal direction within 20 bp of the 3' terminal direction, have.

In the present invention, a nuclease-resistant bond that is not cleaved by a nucleic acid degrading enzyme may be a phosphorothioate bond, but is not limited thereto.

In the present invention, the base in which the nucleic acid polymerization is inhibited may be an amine group, a phosphate group, an alkyl group, an alkane-diol, a phosphorothioate, ), Biotin, non-nucleotide linker, C3-18 spacer, di-deoxynucleotide triphosphate (ddNTP), reverse deoxynucleotide triphosphate but is not limited to, at least one selected from the group consisting of inverted deoxynucleotide triphosphate (inverted dNTP) and inverted di-deoxynucleotide triphosphate (inverted ddNTP).

The C3-18 spacer (C3-18 spacer) can be formed by, for example, a C3 spacer (a structure in which three carbons are connected in series), a C6 spacer (a structure in which six carbons are connected in series), a C12 spacer (A structure in which 12 carbon atoms are connected in series), and a C18 spacer (a structure in which 18 carbon atoms are connected in series). However, the present invention is not limited thereto.

In the present invention, the nucleic acid degrading enzyme may have an activity of 5 '→ 3' exonuclease and endonuclease, but it is not limited thereto, Flap endonuclease (FENs).

The Flap endonuclease is also referred to as a 5 'nucleic acid degrading enzyme and has the activity of a 5' → 3 'exonuclease and a structure-specific endonuclease. In particular, Flap endo nuclease is involved in biological processes such as DNA replication, DNA repair, and DNA recombination (Liu Y et al., Annu Rev Biochem , 73: 589-615, 2004; Ceska T et al., Trends Biochem Sci ., 23 (9): 331-36,1998). Flap endonucleases act on DNA double strands with a single strand of 5 'overhang to facilitate the hydrolysis of phosphodiester bonds at the junctions of single and double strands (Harrington JJ et al., EMBO J , 13 (5): 1235-46, 1994).

The Flap endonuclease may be selected from the group consisting of Sulfolobus solfataricus , Pyrobaculum aerophilum), Thermococcus litoralis (Thermococcus bus litoralis), Ake Ogle Venetian blood kusu (Archaeaglobus veneficus), Anders bus Pro phone by Ake Ogle (Archaeaglobus profundus), Aki dia Taunus disadvantage young (Acidianus brierlyi), Aki dia Taunus Envy Valens (Acidianus ambivalens), disulfonic Pro Lactococcus amyl utility as coarse (Desulfurococcus amylolyticus), disulfonic Pro Lactococcus Mobilis (Desulfurococcus mobilis), fatigue Dick tium part key (Pyrodictium brockii), Thermo Lactococcus pick Canary Earth (Thermococcus gorgonarius), Thermo Caucus jilrigi (Thermococcus zilligii), methane Opie loose Khan Delhi (Methanopyrus kandleri), methane, five caucuses swings mouse (Methanococcus igneus), Pyrococcus leg kosiyi (Pyrococcus horikoshii) and Aero wave yirum spread Knicks (Aeropyrum pernix) ≪ RTI ID = 0.0 > and / or < / RTI >

In the present invention, the nucleic acid degrading enzyme and the 5 '→ 3' nucleic acid polymerase may be composed of a single complex.

In the present invention, the nucleic acid degrading enzyme and the 5 '- > 3' nucleic acid polymerase are selected from the group consisting of thermus aquaticusThermus aquaticus ,Taq), Summers Thermophilus (Thermus thermophilus ,Tth), Summers Filipomis (Thermus filiformis ), Summers Plabus (Thermus flavus ), Summers Anthranikiani (Thermus antranikianii ), Summers Caldophilus (Thermus caldophilus), ≪ / RTI > Summers Kilia < RTI ID = 0.0 &Thermus chliarophilus ), Summers Ignita (Thermus igniterrae ), Summers Rocketh (Thermus lacteus ), Summers Oshima (Thermus oshimai ), Summers Louver (Thermus ruber ), Summers Rubens (Thermus rubens), Summers Sokoto Douctas (Thermus scotoductus ), Summers Silvanus (Thermus silvanus), Summers species Z05 (Thermus species Z05), Summers species 17Thermus species 17), Surotho maritime (Thermotoga maritima , Tma ), ≪ / RTI >Thermotoga neapolitana ), Thermosipo africanus (Thermosipho africanus ), Thermococcus littoralis (Thermococcus litoralis ), Thermococcus baraci (Thermococcus barossi), Thermococcus gorgonarius (Thermococcus gorgonarius ), Pyrococcus furiosus (Pyrococcus furiosus ,Pfu), Pyrokocus Uusai (Pyrococcus woesei ), Pyrokokusu Horikoshi (Pyrococcus horikoshii ), Pyrokokkusabi (Pyrococcus abyssi), Pyrodictium okoltum (Pyrodictium occultum ), Aquifex pyrophyllulose (Aquifex pyrophilus ) And aciphex aeolicus (Aquifex aeolicus)≪ RTI ID = 0.0 > and / or < / RTI >

In the present invention, a base mutation or base polymorphism of a target nucleic acid means a difference in base sequence that can be found when comparing an individual-to-individual genome sequence. The base polymorphism may be caused by inherited or acquired genetic mutation (base mutation), but is not limited thereto. Preferably, the base mutation or base polymorphism of the target nucleic acid is substitution, deletion or insertion of a base .

In the present invention, the primer may bind to an upstream base sequence closer to the 5 'terminal than the base sequence of the target nucleic acid to hybridize with the nucleic acid oligomer for detection, but is not limited thereto.

In the present invention, whether or not the target nucleic acid is polymerized is determined by the presence or absence of the 5 'terminal structure present in the nucleic acid oligomer for detection by the complementarity between the base mutation or the base polymorphism site of the target nucleic acid and the base recognition site of the nucleic acid oligomer for detection. Terminus structure of the nucleic acid oligomer for detection is maintained and the polymerization reaction of the target nucleic acid is inhibited. In the case of non-complementary nucleic acid, the 5'-terminal nucleotide structure of the nucleic acid oligomer for detection is disappeared and the 5'- And the polymerization reaction of the target nucleic acid by the polymerase is promoted.

In the present invention, the retention of the 5'-terminal structure of the nucleic acid oligomer for detection is preferably carried out in such a manner that a nuclease-resistant bond, which is not cleaved by a nucleic acid degrading enzyme existing adjacent to the base recognition site, And is positioned so as to inhibit decomposition of the nucleic acid oligomer.

 In the present invention, the disappearance of the 5'-terminal structure of the nucleic acid oligomer for detection is determined by detecting a nuclease-resistant bond, which is not cleaved by a nucleic acid degrading enzyme existing adjacent to the base recognition site, It is characterized in that the 5 'end of the nucleic acid oligomer for detection is liberated and the subsequent base-to-base bond is decomposed by a nucleic acid degrading enzyme.

In the present invention, the nucleic acid oligomer for detection may further be characterized by binding with a reporter and a quencher. The quencher is capable of quenching a reporter signal (e.g., fluorescence).

In one embodiment, the nucleic acid oligomer for detection containing a reporter (fluorescence) and a quencher is hybridized with a target nucleic acid, and then hybridized with a reporter (fluorescent) according to whether decomposition or decomposition of the 5 'terminal structure existing in the nucleic acid oligomer for detection is inhibited. The presence or absence of a base mutation or base polymorphism of the target nucleic acid can be detected as a signal is generated or lost.

In the present invention, the reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) , EDANS (5- (2'-aminoethyl) amino-1-naphthalenesulfuric acid), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, FITC, Cy3, Antibody, and preferably FAM, HEX, Texas Red, and Cy5 are used, but not limited thereto.

In the present invention, the reporter may be further combined with a binding agent for inducing color development, but not limited thereto, preferably the binding agent is Streptavidine.

In the present invention, the reporter may be differentially labeled according to the type of the base mutation or the base polymorphism, and may be characterized by detecting two or more base mutations or base polymorphisms. That is, it is possible to detect not only a single target nucleic acid but also a base mutation or a base polymorphism contained in a multiplex target nucleic acid, or simultaneously detect one or more base mutations or base polymorphisms present in a target nucleic acid, It is not.

In the present invention, the quencher may be at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example  1: human ApoE  Genotype diagnosis design of gene

The ApoE gene is a gene encoding apolipoprotein E in the human body and has three different forms (E2, E3, E4) due to the nucleotide polymorphism present at codon 112 and codon 158 of the gene, (E2 / E3, E3 / E3, E4 / E4; heterotypic genotypes: E2 / E3, E2 / E4, E3 / E4) have been reported. The ApoE gene polymorphism is known to be closely related to the incidence of cardiovascular disease and Alzheimer's dementia, among which E4 is a risk factor for the development of coronary artery disease and dementia.

In order to diagnose the above-described genotype of the ApoE gene by only one nucleic acid amplification reaction, nucleic acid oligomer 1 and oligomer 2 for detection were designed to confirm the base polymorphism (presence of base T or C at the polymorphism position) present in codon 112 , And nucleotide oligomer 3 and oligomer 4 for detection to confirm the base polymorphism present at codon 158 (presence of base T or C at the polymorphic position). The detection nucleic acid oligomer 1 was FAM, the detection nucleic acid oligomer 2 was HEX, the detection nucleic acid oligomer 3 was Texas Red, and the detection nucleic acid oligomer 4 was Cy5 in the 5 'end of each detection nucleic acid oligomer. And a small mineral substance was attached to the 3 'end.

The nucleic acid oligomer for detection 1 is cleaved to a polymorphic position of codon 112 (SEQ ID NO: 2) such that the nucleic acid oligomer 1 for detection is degraded to a FAM fluorescence signal when the base C is not present at the polymorphic position of codon 112 The nucleic acid oligomer 3 for detection is cleaved when the base C is absent at the polymorphic position of codon 158 (i.e., when the base C is not present) (i.e., when the base C is present) T is present), the nucleic acid oligomer 4 for detection is decomposed to remove the Cy5 fluorescent signal when the base T is not present at the polymorphic position of codon 158 (i.e., when the base C is present) . The design content of each nucleic acid oligomer for detection is shown in Fig.

Also, two pairs of primers for causing a nucleic acid amplification reaction are designed, wherein primer 1 and primer 2 are designed to amplify a target nucleic acid containing a binding site of the nucleic acid oligomer 1 for detection and the nucleic acid oligomer 2 for detection and codon 112, Primer 3 and Primer 4 were designed to amplify a target nucleic acid containing the binding site of the nucleic acid oligomer 3 for detection and the nucleic acid oligomer 4 for detection and the codon 158.

The nucleotide sequences of primers 1 to 4 and oligonucleotides 1 to 4 for detection are shown in Table 1.

name SEQ ID NO: The base sequence (5 '-> 3') Primer 1 SEQ ID NO: 1 GCTGTCCAAGGAGCTGCAGG Primer 2 SEQ ID NO: 2 GCAGCTCCTCGGTGCTCTG Primer 3 SEQ ID NO: 3 CGATGCCGATGACCTGCAG Primer 4 SEQ ID NO: 4 CTGTTCCACCAGGGGCCC Nucleic Acid Oligomer for Detection 1
(oligomer 1) SEQ ID NO: 5 [FAM] AA * C GCGGCCGCCTGGTGCAGTACC [Quencher] Nucleic Acid Oligomer 2 for Detection
(oligomer 2) SEQ ID NO: 6 [HEX] AA * T GCGGCCGCCTGGTGCAGTACC [Quencher] Nucleic Acid Oligomer 3 for Detection
(oligomer 3) SEQ ID NO: 7 [Texas Red] TT * C GCCTGGCAGTGTACCAGGCCGG [Quencher] Nucleic Acid Oligomer 4 for Detection
(oligomer 4) SEQ ID NO: 8 [Cy5] TT * T GCCTGGCAGTGTACCAGGCCGG [Quencher]

In the nucleotide sequence shown in Table 1, * indicates a nuclease-resistant bond which is resistant to a nucleic acid degrading enzyme. In the present embodiment, it means a phosphorothioate linkage, and the nucleotide sequence of the underlined portion is Polymorphic base.

Real-time PCR was performed using primers 1 to 4 and nucleic acid oligomers 1 to 4 for detection in a reaction tube using a genomic DNA of the subject as a template and real-time PCR was performed. Different ApoE genotypes can be identified, and the expected results are shown in Table 2 below.

The principle of this result is shown in FIG. 6, and for the sake of understanding, only primer 1, detection nucleic acid oligomer 1, and detection nucleic acid oligomer 2 are shown, and the remaining primer and nucleic acid oligomer for detection are omitted.

ApoE
Genotype Codon 112
Genotype Codon 158
Genotype Fluorescent signal FAM HEX Texas Red Cy5 E2 / E2 TT TT detection Not detected detection Not detected E2 / E3 TT TC detection Not detected detection detection E2 / E4 TC TC detection detection detection detection E3 / E3 TT CC detection Not detected Not detected detection E3 / E4 TC CC detection detection Not detected detection E4 / E4 CC CC Not detected detection Not detected detection

The conditions of the detection of the fluorescent signal in Table 2 and the conditions of the real-time PCR reaction used herein may vary depending on the target nucleic acid or the target gene, and the detection of the fluorescence signal is performed by confirming fluorescence above a predetermined threshold value within a predetermined PCR cycle number , And conversely, non-detection means that fluorescence less than a predetermined threshold value in a predetermined number of PCR cycles is confirmed. If the result of the fluorescence signal in Table 2 is not detected yet, the PCR is regarded as failed.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

&Lt; 110 > PaxGenBio Co., Ltd. <120> Method and Kit for Detecting Single- and Multi-Nucleotide          Polymorphism <130> P15-B317 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer 1 <400> 1 gctgtccaag gagctgcagg 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer 2 <400> 2 gcagctcctc ggtgctctg 19 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer 3 <400> 3 cgatgccgat gacctgcag 19 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer 4 <400> 4 ctgttccacc aggggccc 18 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> oligomer 1 <400> 5 aacgcggccg cctggtgcag tacc 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> oligomer 2 <400> 6 aatgcggccg cctggtgcag tacc 24 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> oligomer 3 <400> 7 ttcgcctggc agtgtaccag gccgg 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> oligomer 4 <400> 8 tttgcctggc agtgtaccag gccgg 25

Claims (22)

A method for detecting a base mutation or base polymorphism of a target nucleic acid comprising the steps of:
(a) hybridizing a target nucleic acid oligomer to a target nucleic acid to recognize a base mutation or polymorphism of the target nucleic acid to form a specific 5 'terminal structure;
(b) adding a primer, a nucleic acid degrading enzyme and a 5 '→ 3' nucleic acid polymerase for amplification of the target nucleic acid to perform a polymerization reaction of the target nucleic acid; And
(c) detecting the reaction of step (b) and detecting the target nucleic acid.
2. The method of claim 1, wherein the nucleic acid oligomer for detection is selected from the group consisting of (i) a complementary binding site with a target nucleic acid, (ii) a base recognition site linked to the binding site, (iii) (Ii) a nucleotide sequence complementary to the target nucleic acid, and (iii) a nucleotide sequence complementary to the target nucleic acid, wherein the nucleotide sequence comprises a base linked to a nuclease-resistant bond that is not cleaved by a nucleic acid degrading enzyme, And a base located at the terminal (3 'end) and inhibiting nucleic acid polymerization.
3. The detection method according to claim 2, wherein the complementary binding site, the base recognition site or the non-complementary site contains one or more bases.
3. The method according to claim 2, wherein one or more bases linked by a nuclease-resistant bond are present in the nucleic acid oligomer of the detection nucleic acid, Is located within 20 bp in the 5 'terminal direction.
5. The detection method according to claim 4, wherein the nuclease-resistant bond which is not cleaved by the nucleic acid degrading enzyme is a phosphorothioate bond.
3. The method according to claim 2, wherein the base in which the nucleic acid polymerization is inhibited is selected from the group consisting of an amine group, a phosphate group, an alkyl group, an alkane-diol, phosphorothioate, biotin, non-nucleotide linker, C3-18 spacer, di-deoxynucleotide triphosphate (ddNTP), reverse deoxynucleotide triphosphate Wherein at least one selected from the group consisting of phosphate (inverted deoxynucleotide triphosphate, inverted dNTP) and inverted di-deoxynucleotide triphosphate (inverted ddNTP) is attached.
The detection method according to claim 1, wherein the nucleic acid degrading enzyme has an activity of 5 '→ 3' exonuclease and endonuclease.
The detection method according to claim 1, wherein the nucleic acid degrading enzyme and the 5 '→ 3' nucleic acid polymerase are composed of a complex.
[Claim 4] The method according to claim 1, wherein the nucleic acid degrading enzyme and the 5 ' - &gt; 3 &apos; nucleic acid polymerase are Thermus aquaticus , Taq), Thermus thermophilus ( Thermus thermophilus , Tth), Thermus filipomis ( Thermus filiformis), sseomeoseu Playa booth (Thermus flavus), anthracyclines sseomeoseu Nikki No (Thermus antranikianii), sseomeoseu filler knife switch (Thermus caldophilus), sseomeoseu to kill Leah's pillar (Thermus chliarophilus ) , Thermus Ignatella ( Thermus igniterrae), sseomeoseu Rock Proteus (Thermus lacteus), sseomeoseu Oshima (Thermus oshimai), sseomeoseu Lou Berger (Thermus ruber ), Thermus rubens ( Thermus rubens) , Thermus scotoductus), sseomeoseu Silva Augustine (Thermus silvanus), sseomeoseu species Z05 (Thermus species Z05), sseomeoseu kind 17 (Thermus species 17), a motto written Marittima (Thermotoga maritima , Tma ) , Thermotoga neapolitana), Thermo Seaport africanus (Thermosipho africanus), Thermococcus litoralis (Thermococcus litoralis), Thermo caucus immediately upon (Thermococcus barossi), Thermo Caucus chooses Sahib Earth (Thermococcus gorgonarius), fatigue nose Nukus sewage Fury's (Pyrococcus furiosus, Pfu), fatigue nose wooseyi Syracuse (Pyrococcus woesei ) , Pyrococcus horikoshii), pie Rocco's father, Syracuse (Pyrococcus abyssi), fatigue Dick tium five kultum (Pyrodictium occultum , Aquifex &lt; RTI ID = 0.0 & gt ; pyrophilus , and Aquifex aeolicus. &lt; RTI ID = 0.0 &gt; 11. & lt ; / RTI &gt;
3. The method according to claim 1, wherein the base mutation or base polymorphism of the target nucleic acid is substitution, deletion or insertion of a base.
The detection method according to claim 1, wherein the primer is bound to an upstream base sequence close to the 5 'terminal end of the target nucleic acid sequence hybridized with the detection nucleic acid oligomer.
The detection method according to claim 1, wherein the step (c) is performed by an electrophoresis method or an optical measurement method.
13. The method according to any one of claims 1 to 12, wherein the polymerization reaction of the target nucleic acid is present in a nucleic acid oligomer for detection by complementarity between a base mutation or a base polymorphism site of the target nucleic acid and a base recognition site of the nucleic acid oligomer for detection. Terminus structure of the nucleic acid oligomer for detection is determined, and the 5 'terminal structure of the nucleic acid oligomer for detection is maintained to inhibit the polymerization reaction of the target nucleic acid. In case of non-complementary nucleic acid oligomer, Is eliminated and the polymerization reaction of the target nucleic acid by the 5 ' - &gt; 3 ' nucleic acid polymerase is promoted.
14. The method according to claim 13, wherein the retention of the 5'terminal structure of the nucleic acid oligomer for detection is carried out by detecting a nuclease-resistant bond which is not cleaved by a nucleic acid degrading enzyme existing adjacent to the base recognition site, Wherein the nucleic acid oligomer is placed so as to inhibit degradation of the nucleic acid oligomer.
14. The method according to claim 13, wherein the disappearance of the 5'terminal structure of the nucleic acid oligomer for detection is carried out by detecting a nuclease-resistant bond which is not cleaved by a nucleic acid degrading enzyme present adjacent to the base recognition site, Wherein the 5 'end of the nucleic acid oligomer for detection is released and the subsequent base-to-base bond is decomposed by a nucleic acid degrading enzyme.
The detection method according to claim 1, wherein the detecting nucleic acid oligomer further binds to a reporter and a quencher.
17. The method of claim 16 wherein the reporter is selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Biotin, EDANS (5- (2'-aminoethyl) amino-1-naphthalene sulfate), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, FITC, Cy3, Cy5 And an antibody. &Lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt;
18. The detection method according to claim 17, wherein the reporter further binds to a binding agent that induces color development.
19. The method according to claim 18, wherein the binding agent is Streptavidine.
17. The detection method according to claim 16, wherein the reporter is differentially labeled according to a base mutation or a base polymorphism, and detects two or more base mutations or base polymorphisms.
17. The detection method according to claim 16, wherein the quencher is one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl.
(ii) a base recognition site linked to the binding site and recognizing a base mutation or polymorphism of the target nucleic acid; (iii) a base recognition site which recognizes a base mutation or base polymorphism at the 5 ' (Ii) a nucleotide sequence complementary to the target nucleic acid, and (iii) a nucleotide sequence complementary to the target nucleic acid, wherein the target nucleotide and the non-complementary nucleotide sequence are located adjacent to each other and are linked by a nuclease- A nucleic acid oligomer for detection comprising a base located at the 3 'end and inhibiting nucleic acid polymerization; And
(b) a kit for detecting a base mutation or base polymorphism of a target nucleic acid comprising a primer for amplifying a target nucleic acid, a nucleic acid degrading enzyme and a 5 '- &gt;3' nucleic acid polymerase.

Images