KR20170051616A - Mutant Strain with improved isoleucine production having reduced by-product - Google Patents

Abstract

The present invention relates to a mutant strain with an improved isoleucine production function, a manufacturing method thereof, and a production method of isoleucine. The mutant strain with an improved isoleucine production function of the present invention does not generate norvaline at all compared to wild type strains, has a remarkably reduced generation of byproducts such as valine and -aminobutyric acid, thereby having an improved effect of isoleucine production. The present invention reduces the generation of byproducts, enables users to purify isoleucine with high purity, and increases the recovery rate of isoleucine, thereby remarkably reducing the production costs of isoleucine.

Description

{Mutant Strain with improved isoleucine production having reduced by-product}

The present invention relates to a mutant strain of isoleucine production capable of reducing the production of by-products.

L-isoleucine is a commercially significant product used in animal feed, human food additives and pharmaceuticals. For this reason, enhancing the production ability of L-isoleucine is important from an industrial standpoint.

L-isoleucine shares a major biosynthetic pathway with the branched chain amino acids L-valine and L-leucine. In particular, L-isoleucine and L-valine have very similar chemical properties such as chemical structure, isoelectric point and solubility, so that many steps and costs are required to produce a single amino acid in high purity to L-isoleucine And therefore, it is difficult to recover at a high yield. In order to lower the production cost of isoleucine, it is important to develop strains with low content of valine and aminobutyric acid, which are major by-products produced with isoleucine.

Byproducts such as norvaline, valine, and aminobutyric acid share a biosynthetic pathway with L-isoleucine, and increasing the yield of isoleucine in general increases the production of byproducts. These byproducts are similar in structure and characteristics to L-isoleucine, which is a target amino acid, and thus have difficulty in purification after production of the desired amino acid. Therefore, it is required to develop an increased strain of L-isoleucine by decreasing or blocking the formation of by-products as much as possible.

Methods for developing L-isoleucine producing strains have been various from the prior art. The most common methods for the production of amino acid producing strains include resistance to intermediate metabolites or end products using the mutagenesis method, and active deletion / enhancement of the gene for regulating production of the target product through chromosome mutation. That is, the mutation method can be applied to a method for screening mutants having resistance to a similar structure of threonine and isoleucine, which are major intermediate metabolites of isoleucine biosynthesis.

However, when a general amino acid strain development method such as the above-mentioned mutation method is applied to an isoleucine producing strain, it is possible to share a major biosynthetic process with isoleucine and to have a possibility of affecting the production of a by- Lt; / RTI >

Therefore, in order to increase the recovery yield of isoleucine and to lower the production cost, there is a need for a new strain development method which is capable of producing isoleucine and producing a major amount of a by-product.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have made efforts to develop a bacterial strain capable of efficiently producing isoleucine by reducing the production of by-products. As a result, the 3-isopropylmalate dehydrogenase of the isoleucine producing bacterium strain was inactivated and over-expressed by the α-isopropylmalate synthase, The production of by-products such as norvaline and? -Aminobutyric acid can be remarkably reduced and the production of isoleucine can be increased, thereby completing the present invention.

Therefore, an object of the present invention is to provide a mutant strain of isoleucine production.

Another object of the present invention is to provide a method for producing a mutant strain of isoleucine production.

It is another object of the present invention to provide a method for producing isoleucine.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a mutant strain of isoleucine production that includes an inactivated 3-isopropylmalate dehydrogenase and does not produce norvaline do.

The present inventors have made efforts to develop a bacterial strain capable of efficiently producing isoleucine by reducing the production of by-products. As a result, the 3-isopropylmalate dehydrogenase of the isoleucine producing bacterium strain was inactivated and over-expressed by the α-isopropylmalate synthase, norvaline, valine, α-aminobutyric acid, and the production of isoleucine can be increased.

The term " inactivated " used in expressing a mutant strain of isoleucine production in the present invention means suppression of protein expression by substitution, insertion, deletion, or a combination of nucleotides encoding the gene.

According to one embodiment of the present invention, the inactivation of the present invention is inactivation by substitution, insertion, deletion, or a combination of nucleotide sequences encoding the leuB gene. According to another embodiment of the present invention, the inactivation of the present invention is the inactivation of the 2-isopropyl maleate dehydrogenase by complete or partial deletion of the nucleotide sequence encoding the leuB gene. In accordance with certain embodiments of the present invention, the inactivation of the present invention is the inactivation of 3-isopropyl maleate dehydrogenase by partial deletion of the nucleotide sequence encoding the leuB gene.

The 3-isopropyl maleate dehydrogenase to be inactivated was found and identified in various strains. In the following examples, 3-isopropyl maleate dehydrogenase of Escherichia coli of the first sequence of SEQ ID NO: 1 is exemplified, but various 3-isopropyl maleate dehydrogenase are also included in the present invention.

The mutant strain of the present invention is a strain in which 3-isopropyl maleate dehydrogenase is inactivated using a parent strain of isoleucine production capable of producing wild type or activated 3-isopropyl maleate dehydrogenase, Any strain that expresses the 3-isopropyl maleate dehydrogenase or contains the enzyme activity of the 3-isopropyl maleate dehydrogenase can be used without limitation as a parent strain.

According to one embodiment of the present invention, the isoleucine production mutant strain of the present invention is Escherichia genus. According to another embodiment of the present invention, the isoleucine production mutant strain of the present invention is selected from the group consisting of Escherichia coli , Escherichia albertii , Escherichia blattae , Escherichia fermusonii ( Escherichia hermannii ) or Escherichia vulneris strain. According to a specific embodiment of the present invention, the isoleucine production mutant strain of the present invention is Escherichia coli. According to another embodiment of the present invention, the Escherichia coli is Escherichia coli KCTC11602BP.

One of the main features of the present invention is that the isoleucine production mutant strain of the present invention does not produce norvaline at all.

According to one embodiment of the present invention, in the isoleucine production mutant strain comprising the inactivated 3-isopropyl maleate dehydrogenase of the present invention, the isoleucine production mutant strain does not produce norvaline. The isoleucine production ability strain containing the wild type or activated 3-isopropyl maleate dehydrogenase produces 0.001 to 0.100 wt% of norvaline as a fermentation product, while the inactivated 3-isopropyl maleate dehydrogenase of the present invention The isoleucine production mutant strain contained does not produce norvaline at all.

The norbaline is similar in structure and properties to isoleucine, and thus has difficulty in purifying isoleucine. The present invention has the advantage of saving the time and cost of purification of isoleucine by blocking the production of norvaline through the mutation of the strain.

The isoleucine production mutant strain of the present invention increases the production of the desired isoleucine while reducing or blocking the production of by-products such as norbaline and? -Aminobutyric acid, valine.

According to one embodiment of the present invention, in the isoleucine production mutant strain comprising the inactivated 3-isopropyl maleate dehydrogenase of the present invention, the isoleucine production mutant strain may be a wild type or an activated 3-isopropyl horse The productivity of isoleucine is increased by 3-30%, 5-30%, 7-30%, 7-25%, 7-23%, or 7-20% compared with the isoleucine production ability strain containing the lyase dehydrogenase Lt; / RTI >

Another important aspect of the present invention is that the isoleucine production mutant strain comprising the inactivated 3-isopropyl maleate dehydrogenase of the present invention is further characterized in that the isoleucine production activity mutant strain further comprises? An enzyme (? -Isopropylmalate synthase) is overexpressed,

According to one embodiment of the present invention, the a-isopropyl maleate synthase is encoded by the nucleotide sequence of the second sequence of the sequence listing.

In one embodiment of the present invention, the mutant strain comprising the inactivated 3-isopropyl maleate dehydrogenase and the over-expressing a-isopropyl maleate synthase may be a wild type or an activated 3-isopropyl maleate dehydrogenase and a wild type? - 34-60%, 34-58%, 34-56%, or 34%, respectively, of isoleucine production ability as compared with the isoleucine production ability strain containing the isopropyl myristate synthase -54% increased strains.

In one embodiment of the present invention, the mutant strain comprising the inactivated 3-isopropyl maleate dehydrogenase and the over-expressing a-isopropyl maleate synthase may be a wild type or an activated 3-isopropyl maleate dehydrogenase and a wild type? - 30-70%, 33-70%, 36-70% of the production ability of valine and? -Aminobutyric acid as compared with the isoleucine production ability strain containing isopropyl myristate synthase, 40-70%, 39-70%, 39-67%, 39-66%, or 39-63%.

According to another aspect of the present invention, there is provided a method for producing a mutant strain of isoleucine production that does not produce norvaline, comprising the step of inactivating 3-isopropyl maleate dehydrogenase.

According to one embodiment of the present invention, the method further comprises over-expressing the alpha -isopropyl maleate synthase.

It is possible to inactivate 3-isopropyl maleate dehydrogenase by a known gene recombination method with an isoleucine production ability strain containing wild type or activated 3-isopropyl maleate dehydrogenase.

One step inactivation (Warner et al., PNAS, 6: 6640-6645) is used to delete the gene leuB encoding the 3-isopropyl maleate dehydrogenase involved in isoleucine biosynthesis on the chromosome. In addition, in order to introduce the gene leuA encoding the 3-isopropyl maleate dehydrogenase related to isoleucine biosynthesis on the chromosome and the gene leuA encoding the α-isopropyl maleate synthase on the chromosome, a one-step inactivation method (one step inactivation: Warner et al., PNAS, 6: 6640-6645).

In the present invention, the step of transforming an isoleucine production ability strain containing wild type or activated 3-isopropyl maleate dehydrogenase can be carried out by a known method. For example, it can be carried out by an electroporation method (van der Rest et al., Appl. Microbiol. Biotechnol., 52, 541-545, 1999).

In addition, the present invention includes a step of isolating and obtaining a mutant strain transformed from an isoleucine production ability strain comprising an untransformed wild-type or activated 3-isopropyl maleate dehydrogenase.

In the present invention, a selectably-labeled vector may be used in carrying out the step of isolating and obtaining a transformed strain from an isoleucine-producing ability strain that has not been transformed.

In addition, the vector used in the present invention includes, but is not limited to, a plasmid or a phage.

The selectable marker used in the present invention includes an antibiotic resistance gene such as kanamycin, ampicillin and levansucrase, which is a product of the SacB gene derived from Bacillus subtilis, commonly used in the art.

The production method of the present invention is a method for producing the same strain as the mutant strain of isoleucine production comprising the above-mentioned inactivated 3-isopropyl maleate dehydrogenase, wherein the protein to be inactivated (3- ( Lyotropic enzymes) and related genes ( leuB ), the common description between them is omitted in order to avoid the excessive complexity of the present specification.

According to still another aspect of the present invention, there is provided an isoleucine production method comprising culturing a mutant strain of isoleucine production ability of the present invention.

The present invention can be cultured through a known culture method for pre-culture or seed culture of an isoleucine production ability strain and a mutant strain.

As the carbon source of the culture medium, for example, glucose, sucrose, dextrin, glycerol, starch and the like can be used. As the nitrogen source, peptone, meat extract, yeast extract, dried Yeast, soybean cake, urea, thiourea, ammonium salt, nitrate and other organic or inorganic nitrogen-containing compounds may be used, but are not limited to these components.

Examples of inorganic salts contained in the medium include, but are not limited to, phosphates such as magnesium, manganese, potassium, calcium and iron, nitrates, carbonates, chlorides and the like.

Amino acids, vitamins, nucleic acids and related compounds may be added to the medium in addition to the carbon source, the nitrogen source and the components of the inorganic salt.

The present invention is a method for producing isoleucine using the same strain and strain production method as the isoleucine production ability mutant strain including the inactivated 3-isopropyl maleate dehydrogenase, In order to avoid excessive complexity of the specification, the description thereof is omitted.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a mutant strain of isoleucine production ability, a method for producing the same, and a method for producing isoleucine.

(b) The isoleucine production ability mutant strain of the present invention does not produce norvaline at all compared to the wild type strain, and the production of by-products such as valine and? -aminobutyric acid is remarkable And the production of isoleucine is increased.

(c) The present invention not only can purify isoleucine with high purity by decreasing the productivity of by-products, but also improve the recovery rate of isoleucine and greatly reduce the manufacturing cost of isoleucine.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1: leuB - Preparation of defective strains

The leuB gene is one step inactivation method. Warner et al., PNAS, 6: 6640-6645 (2000)), and the antibiotic resistance gene was removed. The nucleotide sequence of the leuB gene to be deleted is the same as Sequence Listing 1 sequence.

The following experiment was carried out in order to prepare a leuB -deletion strain which is a gene encoding 3-isopropylmalate dehydrogenase. PCR reaction (total volume 50 μl, 5 minutes, 1 cycle at 95 ° C, after leukemia, leuB_PR primer pair and pKD13 plasmid (Genbank accession number AY048744) having partial sequence of leuB gene and partial sequences of pKD13 plasmid in Table 1 below, 30 sec at 95 占 폚, 30 sec at 58 占 폚, 2 min at 72 占 폚, 5 min at 72 占 폚 for 10 min at 12 占 폚 after a total of 30 cycles) to obtain an amplified fragment (1) of about 1.6 kb.

primer The base sequence (5'-3 ') leuB_HF1 CAGCCATTACGATGTAGGCG leuB_HR1 CAATGTCTGCACGCAGCGG leuB_PF CCGCTGCGTGCAGACATTGGTGTAGGCTGGAGCTGCTTC leuB_PR AGTGATCATTGCGCACTCGTCCTGTCAAACATGAGAATTAA leuB_HF2 GACGAGTGCGCAATGATCACT leuB_HR2 CGCATCATCGGCATCCAGG leuB-CF GCTGGATGCCGTGCGCA leuB_CR GCCACGGGCTAAATCCCC

leuB - and as a template the genomic (genomic) DNA of Escherichia coli MG1655 to obtain a front fragment of leuB gene using primers leuB_HF1 and leuB_HR1 in Table 1 PCR (total volume 50 ㎕, 95 ℃ 5 minutes to prepare a deletion strain After one cycle, about 260 bp amplified fragments (2) were obtained by performing 30 sec at 95 ° C, 30 sec at 58 ° C, 30 sec at 72 ° C, 5 min at 72 ° C after 30 cycles in total, and 10 min at 12 ° C) ≪ / RTI >

In order to obtain the rear fragment of the leuB gene, the genomic DNA of E. coli MG1655 was used as a template and subjected to PCR reaction using the primers leuB_HF2 and leuB_HR2 shown in Table 1 (total volume 50 μl, 95 ° C for 5 minutes, 1 cycle, , 30 seconds at 58 占 폚, 30 seconds at 72 占 폚, 10 minutes at 72 占 폚 and 12 占 폚 after a total of 30 cycles) to obtain an amplified fragment (3) of about 190 bp.

Each of the fragments (1), (2) and (3) amplified in the above experiment can be linked to one fragment due to the complementary sequence of the primer at the time of amplification. These fragments were subjected to a total volume of 50 占 퐇 except for the primer, after 1 cycle of 95 占 폚 for 5 minutes, for 30 seconds at 95 占 폚, for 30 seconds at 58 占 폚, for 2 minutes and 30 seconds at 72 占 폚 for 5 minutes at 72 占 폚 for a total of 30 cycles, Lt; 0 > C for 10 minutes to obtain an amplified fragment of about 2 kb in size.

The thus obtained DNA fragment was subjected to electrophoresis in Escherichia coli strain DS44 (KCTC 11602BP) containing pKD46 (GenBank accession number AY048746). After that, a kanamycin resistant cell line was subjected to PCR to confirm the deletion of the leuB gene. The reaction was carried out by using the leuB_CF and leuB_CR primers shown in Table 1, and after a cycle of 95 ° C for 5 minutes, a total volume of 20 μl, followed by 30 seconds at 95 ° C, 30 seconds at 55 ° C, 2 minutes and 30 seconds at 72 ° C, Lt; 0 > C for 5 minutes and 12 [deg.] C for 10 minutes. When the fragment was inserted into the chromosome, it was confirmed that about 2.2 kb was generated compared with 0.949 kb generated when the original leuB gene was present. FLP recombination was induced by introducing pCP20 plasmid to perform the process of removing the antibiotic resistant marker gene using a strain in which leuB gene deletion was confirmed. Then, the leuB deletion strain was cultured in the LB plate medium with or without antibiotics to confirm that the antibiotic resistant marker gene was removed.

Example 2: leuB - Evaluation of the production of isoleucine and byproducts of the deletion strain

In order to confirm the production amount of isoleucine and by-products of the leuB -deletion strain prepared in Example 1, the parent strain Escherichia coli DS44 (KCTC 11602BP) and the leuB deletion strain DS44ΔleuB isoleucine And by-product production.

The strains were cultured in a 5 L fermenter with the medium composition shown in Table 2.

ingredient density Additional medium concentration glucose 8% 55% Corn dip 2% - Ammonium sulfate 2% 0.1% Phosphoric acid 1.5% 0.1% Fumaric acid 0.1% - Sodium glutamate 0.7% - Sodium citrate 0.1% - Choline-HCl 0.1% - Pyridoxine-HCl 10 ppm - Thiamine-HCl 5 ppm - Nicotinic acid 5 ppm - Biotin 5 ppm - Calcium chloride 5 ppm - Cobalt chloride 5 ppm - Iron sulfate 20 ppm - Manganese sulfate 5 ppm - Zinc sulfate 5 ppm - Copper sulfate 5 ppm - L-lucine 0.08% - Sodium hydroxide One % -

2 L of the initial medium and 610 mL of the additional medium were added under the above conditions, and the mixture was cultured at 31 ° C at a stirring speed of 600 rpm and aeration amount of 1.0 vvm. As a result, it was confirmed that no by-product, norvaline, as shown in Table 3 was produced.

Strain name Isoleucine (%) Balin (%) V / I ratio (%) ? -aminobutyric acid (%) AB / I ratio (%) Norvaline (%) NV / I ratio
(%) DS44 2.21 0.31 14 0.122 5.5 0.048 2.17 DS44 △ leuB 2.54 0.33 13 0.110 4.3 0 0

(V / I: proportion of valine in total isoleucine, AB / I: proportion of? -Aminobutyric acid in total isoleucine, NV / I: proportion of norvaline in total isoleucine)

Example 3: leuA  Production of a mutant strain into which a gene is introduced

Of Example 2 at the same time as the leuB gene disrupted based on the results strengthen the leuA gene by one step the introduction leuA genes and leuB crushed to inhibit the flow of carbon as a by-product to reduce the valine and α- amino-butyric acid inactivation method ( one step inactivation Warner et al., PNAS, 6: 6640-6645 (2000)). As in Example 1, the antibiotic resistance gene was removed after introduction of leuA at the same time as the leuB disruption. The nucleotide sequence of the leuA gene to be introduced is the same as Sequence Listing 2.

The following experiment was carried out in order to delete leuB , which is a gene encoding 3-isopropyl maleate dehydrogenase, and to introduce leuA gene coding for isopropylmalate synthase (α-isopropylmalate synthase). PCR reaction (total volume 50 μl, 50 μl) was performed using leuB_PF, a partial sequence of pKD13 and a partial sequence of leuA promoter and a pair of leuB_PR2 and pKD13 plasmid (Genbank Accession No. AY048744) having partial sequence of leuB gene and partial sequence of pKD13 plasmid in Table 4 below, After 5 cycles of 95 ° C for 5 minutes, 30 cycles of 95 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 2 minutes, 72 ° C for 5 minutes and 30 cycles after 30 cycles, and 10 minutes at 12 ° C) (1) was obtained.

primer The base sequence (5'-3 ') leuB_PF CCGCTGCGTGCAGACATTGGTGTAGGCTGGAGCTGCTTC leuB_PR2 GCGATTTTTTTTGATATTGATTTCTGTCAAACATGAGAATTAA leuA_pro_F AAATCAATATCAAAAAAAATCGC leuA_pro_R TAAATCAGCTCCAGATGAATGCG leuA_F ATTCATCTGGAGCTGATTTAATGAGCCAGCAAGTCATTAT leuA_R AGTGATCATTGCGCACTCGTCTCACACGGTTTCCTTGTTGTTTTC leuB_HF1 CAGCCATTACGATGTAGGCG leuB_HR1 CAATGTCTGCACGCAGCGG leuB_HF2 GACGAGTGCGCAATGATCACT leuB_HR2 CGCATCATCGGCATCCAGG leuB-CF GCTGGATGCCGTGCGCA leuB_CR GCCACGGGCTAAATCCCC

In order to amplify the promoter sequence of the leuA gene, the genomic DNA of the E. coli strain MG1655 was used as a template and PCR reaction (total volume 50,, 95 캜) using the primers leuA_Pro_F and leuA_Pro_R shown in Table 4 After 5 minutes and 1 cycle, the amplified fragments of about 310 bp were amplified by performing 30 cycles of 95 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 30 seconds, a total of 30 cycles, 72 ° C for 5 minutes and 12 ° C for 10 minutes (2).

Next, in order to obtain leuA gene fragment, PCR was performed using genomic DNA of strain DS44 as a template, leuA_F having a partial sequence of leuA promoter and partial sequence of leuA, leuA partial sequence and leuA partial sequence having leuB partial sequence shown in Table 4 (50 占 퐇 total volume, 95 占 폚 for 5 minutes, followed by 30 seconds at 95 占 폚 for 30 seconds, 58 占 폚 for 30 seconds, 72 占 폚 for 2 minutes, 72 占 폚 for 5 minutes at 12 占 폚 for 10 minutes) To obtain an amplified fragment (3) of about 1.6 kb.

PCR reaction using primers leuB_HF1 and leuB_HR1 in order to obtain the front piece of the leuB gene in the genomic DNA of E. coli MG1655 as the template in Table 1 (total volume 50 ㎕, 95 ℃ 5 minutes for 1 cycle, 30 sec at 95 ℃, 30 sec at 58 ° C, 30 sec at 72 ° C, 5 min at 72 ° C and 10 min at 12 ° C after a total of 30 cycles) to obtain a fragment (4) amplified by about 260 bp.

PCR was performed using primer leuB_HF2 and leuB_HR2 shown in Table 1 with a genomic DNA of Escherichia coli MG1655 as a template in order to obtain the rear fragment of the leuB gene (total volume 50 μl, 95 ° C for 5 minutes, 1 cycle, Sec, 30 sec at 58 캜, 30 sec at 72 캜, 5 min at 72 캜 for 10 min at 12 캜 after a total of 30 cycles) to obtain an amplified fragment (5) of about 190 bp.

Each of the fragments (1), (2), (3), (4) and (5) amplified in the above experiment can be connected to one fragment due to the complementary sequence of the primer at the time of amplification. (1), (2) and (3), except for the primers, were subjected to a total volume of 50 占 퐇, 95 占 폚 for 5 minutes and 1 cycle, followed by 30 seconds at 95 占 폚, 30 seconds at 58 占 폚, 72 占 폚, After a total of 30 cycles, PCR was performed at 72 ° C for 5 minutes and 12 ° C for 10 minutes to obtain one amplified fragment (6) having a size of about 3.5 kb. After one cycle of 95 ° C for 5 minutes and a total volume of 50 μl except for the remaining fragments (4) and (5) and the primer, the amplified single fragment (6) C for 4 min, for a total of 30 cycles, followed by 5 min at 72 < 0 > C and 10 min at 12 [deg.] C to obtain one amplified fragment of about 4 kb size.

The DNA fragment thus obtained was introduced into Escherichia coli DS44 (KCTC 11602BP) cells containing pKD46 (GeneBank No. AY048746) by electroporation. Since by doing a PCR reaction with the target cell line showing kanamycin resistance it was confirmed whether or not the introduction of deletions and leuA gene of the leuB gene. The reaction was carried out in a total volume of 20 μl using the leuB_CF and leuB_CR primers shown in Table 4. After 1 cycle at 95 ° C for 5 minutes, the reaction was carried out at 95 ° C for 30 seconds, at 55 ° C for 30 seconds, at 72 ° C for 10 seconds, 5 min and 12 < 0 > C for 10 min. When a fragment was inserted into the chromosome, it was confirmed that about 4.1 kb was generated compared with 0.949 kb generated when the original leuB gene was present. FLU recombination was induced by introducing the pCP20 plasmid to remove the antibiotic resistant marker gene using a strain in which the leuB gene was deleted and the leuA gene was confirmed to be introduced. After that, leuB deletion and leuA introduced strains were cultured in LB plate medium with or without antibiotics, and it was confirmed that the antibiotic resistant marker gene was removed.

Example 4: leuB - Fruiting and leuA - Evaluation of isoleucine and by-product yield of the introduced strain

Escherichia coli, DS44; KCTC 11602BP) and leuB deletion and leuA introduced strains DS44 (Escherichia coli, DS44 and KCTC 11602BP) were used to confirm the production of isoleucine and byproducts from the leuB gene deletion and leuA gene- The production of isoleucine and by-products of △ leuB :: leuA was compared.

The strain was cultured using the same medium composition and culture conditions as in Example 2.

Strain name Isoleucine (%) Balin (%) V / I ratio (%) ? -aminobutyric acid (%) AB / I ratio (%) Norvaline (%) NV / I ratio
(%) DS44 2.17 0.29 13.5 0.126 5.4 0.054 2.50 DS44 △ leuB :: leuA 3.14 0.14 4.4 0.063 2.0 0 0

(V / I: proportion of valine in total isoleucine, AB / I: proportion of? -Aminobutyric acid in total isoleucine, NV / I: proportion of norvaline in total isoleucine)

As shown in Table 5, according to the present invention, it was confirmed that the V / I ratio was reduced by about 67%, the AB / I ratio was reduced by about 50%, and no norvaline was detected in comparison with the parent strain.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> DAESANG CORPORATION <120> Mutant Strain with improved isoleucine production using reduced reduced          by-product <130> PN150475 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 1092 <212> DNA <213> E. coli MG1655 leuB <400> 1 atgtcgaaga attaccatat tgccgtattg ccgggggacg gtattggtcc ggaagtgatg 60 acccaggcgc tgaaagtgct ggatgccgtg cgcaaccgct ttgcgatgcg catcaccacc 120 agccattacg atgtaggcgg cgcagccatt gataaccacg ggcaaccact gccgcctgcg 180 acggttgaag gttgtgagca agccgatgcc gtgctgtttg gctcggtagg cggcccgaag 240 tgggaacatt taccaccaga ccagcaacca gaacgcggcg cgctgctgcc tctgcgtaag 300 cacttcaaat tattcagcaa cctgcgcccg gcaaaactgt atcaggggct ggaagcattc 360 tgtccgctgc gtgcagacat tgccgcaaac ggcttcgaca tcctgtgtgt gcgcgaactg 420 accggcggca tctatttcgg tcagccaaaa ggccgcgaag gtagcggaca atatgaaaaa 480 gcctttgata ccgaggtgta tcaccgtttt gagatcgaac gtatcgcccg catcgcgttt 540 gaatctgctc gcaagcgtcg ccacaaagtg acgtcgatcg ataaagccaa cgtgctgcaa 600 tcctctattt tatggcggga gatcgttaac gagatcgcca cggaataccc ggatgtcgaa 660 ctggcgcata tgtacatcga caacgccacc atgcagctga ttaaagatcc atcacagttt 720 gacgttctgc tgtgctccaa cctgtttggc gacattctgt ctgacgagtg cgcaatgatc 780 actggctcga tggggatgtt gccttccgcc agcctgaacg agcaaggttt tggactgtat 840 gaaccggcgg gcggctcggc accagatatc gcaggcaaaa acatcgccaa cccgattgca 900 caaatccttt cgctggcact gctgctgcgt tacagcctgg atgccgatga tgcggcttgc 960 gccattgaac gcgccattaa ccgcgcatta gaagaaggca ttcgcaccgg ggatttagcc 1020 cgtggcgctg ccgccgttag taccgatgaa atgggcgata tcattgcccg ctatgtagca 1080 gaaggggtgt aa 1092 <210> 2 <211> 1572 <212> DNA <213> E. coli MG1655 leuA <400> 2 atgagccagc aagtcattat tttcgatacc acattgcgcg acggtgaaca ggcgttacag 60 gcaagcttga gtgtgaaaga aaaactgcaa attgcgctgg cccttgagcg tatgggtgtt 120 gacgtgatgg aagtcggttt ccccgtctct tcgccgggcg attttgaatc ggtgcaaacc 180 atcgcccgcc aggttaaaaa cagccgcgta tgtgcgttag ctcgctgcgt ggaaaaagat 240 atcgacgtgg cggccgaatc cctgaaagtc gccgaagcct tccgtattca tacctttatt 300 gccacttcgc caatgcacat cgccaccaag ctgcgcagca cgctggacga ggtgatcgaa 360 cgcgctatct atatggtgaa acgcgcccgt aattacaccg atgatgttga attttcttgc 420 gaagatgccg ggcgtacacc cattgccgat ctggcgcgag tggtcgaagc ggcgattaat 480 gccggtgcca ccaccatcaa cattccggac accgtgggct acaccatgcc gtttgagttc 540 gccggaatca tcagcggcct gtatgaacgc gtgcctaaca tcgacaaagc cattatctcc 600 gtacataccc acgacgattt gggcctggcg gtcggaaact cactggcggc ggtacatgcc 660 ggtgcacgcc aggtggaagg cgcaatgaac gggatcggcg agcgtgccgg aaactgttcc 720 ctggaagaag tcatcatggc gatcaaagtt cgtaaggata ttctcaacgt ccacaccgcc 780 attaatcacc aggagatatg gcgcaccagc cagttagtta gccagatttg taatatgccg 840 atcccggcaa acaaagccat tgttggcagc ggcgcattcg cacactcctc cggtatacac 900 caggatggcg tgctgaaaaa ccgcgaaaac tacgaaatca tgacaccaga atctattggt 960 ctgaaccaaa tccagctgaa tctgacctct cgttcggggc gtgcggcggt gaaacatcgc 1020 atggatgaga tggggtataa agaaagtgaa tataatttag acaatttgta cgatgctttc 1080 ctgaagctgg cggacaaaaa aggtcaggtg tttgattacg atctggaggc gctggccttc 1140 atcggtaagc agcaagaaga gccggagcat ttccgtctgg attacttcag cgtgcagtct 1200 ggctctaacg atatcgccac cgccgccgtc aaactggcct gtggcgaaga agtcaaagca 1260 gaagccgcca acggtaacgg tccggtcgat gccgtctatc aggcaattaa ccgcatcact 1320 gaatataacg tcgaactggt gaaatacagc ctgaccgcca aaggccacgg taaagatgcg 1380 ctgggtcagg tggatatcgt cgctaactac aacggtcgcc gcttccacgg cgtcggcctg 1440 gctaccgata ttgtcgagtc atctgccaaa gccatggtgc acgttctgaa caatatctgg 1500 cgtgccgcag aagtcgaaaa agagttgcaa cgcaaagctc aacacaacga aaacaacaag 1560 gaaaccgtgt ga 1572

Claims (11)

A mutant strain of isoleucine production that contains an inactivated 3-isopropylmalate dehydrogenase and does not produce norvaline.
2. The method of claim 1, wherein the inactivation of the 3-isopropyl maleate dehydrogenase is leuB Wherein the nucleotide sequence is inactivated by substitution, insertion, deletion, or a combination of nucleotide sequences encoding the gene.
The mutant strain according to claim 1, wherein the isoleucine production mutant strain is Escherichia genus.
The method according to claim 3, wherein the strain is selected from the group consisting of Escherichia coli , Escherichia albertii , Escherichia blattae , Escherichia fergusonii ( Escherichia hermannii ) Or a strain of Escherichia vulneris .
2. The method according to claim 1, wherein the isoleucine production mutant strain including the inactivated 3-isopropyl maleate dehydrogenase is compared with an isoleucine production ability strain including wild type or activated 3-isopropyl maleate dehydrogenase And the productivity of isoleucine is increased by 3-30%.
The mutant strain according to claim 1, wherein the isoleucine production ability mutation strain further comprises an overexpressed? -Isopropylmalate synthase.
7. The mutant strain according to claim 6, wherein said alpha -isopropyl malate synthase is encoded by a nucleotide sequence of SEQ ID NO: 2.
7. The method according to claim 6, wherein the mutant strain is a mutant strain having an ability to produce isoleucine at 30- &lt; RTI ID = 0.0 &gt; A mutation strain characterized by a 60% increased strain.
7. The method according to claim 6, wherein the mutant strain is selected from the group consisting of valine and alpha-isopropyl malate dehydrogenase and wild-type alpha-isopropyl maleate synthase, A mutant strain characterized by a 30-70% reduced ability to produce an aminobutyric acid.
A method for producing an isoleucine producing ability mutant strain that does not produce norvaline, which comprises the step of inactivating 3-isopropylmalate dehydrogenase.
11. The method of claim 10, wherein the method further comprises over-expressing an alpha -isopropylmalate synthase.