KR20170023352A

KR20170023352A - An antibacterial peptide isolated from Hermetia illucens

Info

Publication number: KR20170023352A
Application number: KR1020150118154A
Authority: KR
Inventors: 여성문; 박순익
Original assignee: 단국대학교 천안캠퍼스 산학협력단
Priority date: 2015-08-21
Filing date: 2015-08-21
Publication date: 2017-03-03
Also published as: KR101726951B1

Abstract

The present invention relates to a composition for antibiosis against Gram-positive bacteria comprising DLP 4 which is an antibacterial peptide purified from Donghae et al.

Description

An antimicrobial peptide isolated from larvae of a duckweed (Hermetia illucens)

The present invention relates to a composition for antibiosis against Gram-positive bacteria comprising a peptide defined by the amino acid sequence represented by SEQ ID NO: 23. The present invention also relates to a method for producing an antimicrobial composition for Gram-positive bacteria, which comprises culturing a microorganism comprising the nucleotide sequence shown in SEQ ID NO: 22.

Most organisms are known to produce antimicrobial peptides and secrete them to prevent invasion from external microorganisms. These antimicrobial peptides have been isolated from many organisms since their first discovery in the epidermal fluid of frogs in 1962. Among them, the antimicrobial peptide isolated from vertebrates and invertebrates is called defensin.

On the other hand, antimicrobial peptides have also been isolated from insects, among which apidaecin was first found in the blood lymph of infected bees. Apidaecin is composed of 16 to 20 amino acids and does not show antimicrobial activity against Gram-positive bacteria, whereas Pseudomonas (International Journal of Industrial Entomology, 24 (1), 37-40, 2012), which is known to exhibit antibacterial activity against gram-negative bacteria including tolaasii .

Conventional antibiotics chemically inhibit synthesis of cell membrane components and cell activity, while antimicrobial peptides induce cell membrane breakdown by physical methods. As a result, unlike antibiotics, there is little risk of resistance to antimicrobial peptides, and since it has an advantage of being active against existing resistant strains, antimicrobial peptides are emerging as an alternative to the risk of antibiotic resistance. However, there are disadvantages in that the microorganisms exhibiting activity differ depending on the type of antimicrobial peptide found in each organism, and the degree of activity is lower than that of conventional antibiotics (Korean Society for Biotechnology and Bioengineering Journal, 27, 9-15 , 2012)

Thus, the present inventors have made intensive efforts to produce an antimicrobial peptide exhibiting an antimicrobial activity against gram-positive bacteria and an antimicrobial activity even at a low concentration. As a result, the antimicrobial peptides isolated from larvae in Dong- Thus, the present invention has been completed.

The main object of the present invention is to provide a composition for antibiotic against Gram-positive bacteria comprising a peptide defined by the amino acid sequence shown in SEQ ID NO: 23.

Another object of the present invention is to provide a method for producing an antimicrobial composition for Gram-positive bacteria, which comprises culturing a microorganism comprising a polynucleotide defined by the nucleotide sequence shown in SEQ ID NO: 22.

Still another object of the present invention is to provide a pharmaceutical composition for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising a peptide defined by the amino acid sequence shown in SEQ ID NO: 23.

Yet another object of the present invention is to provide a method for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising the step of administering the peptide of SEQ ID NO: 23 to a subject other than human.

Still another object of the present invention is to provide a quasi-drug composition for preventing or ameliorating a bacterial disease caused by Gram-positive bacteria, comprising the peptide of SEQ ID NO: 23.

In one aspect of the present invention, there is provided an antimicrobial composition for Gram-positive bacteria comprising a peptide defined by the amino acid sequence shown in SEQ ID NO: 23.

The term "peptide defined by the amino acid sequence represented by SEQ ID NO: 23" in the present invention can be used in the same sense as DLP-4 (depensin like peptide-4).

Here, the DLP-4 may be a protein that is typically encoded by the nucleotide sequence shown in SEQ ID NO: 22. However, the polynucleotide encoding the DLP-4 may have an amino acid sequence of the protein expressed from the coding region, due to codon degeneracy, or considering the codon preference in the organism to which the DLP-4 is to be expressed Various modifications can be made to the coding region within a range that does not change DLP-4, and DLP-4 can be coded by various nucleotide sequences in addition to the nucleotide sequence described in SEQ ID NO: 22.

In addition, in the present invention, the peptide defined by the amino acid sequence of SEQ ID NO: 23 has not only the amino acid sequence of SEQ ID NO: 22 but also at least 70%, preferably 80% or more, more preferably 90% , More preferably 95% or more, still more preferably 98% or more, and most preferably 99% or more homology with any of the peptides having substantially antimicrobial activity against Gram-positive bacteria , A sequence having such homology is an amino acid sequence having substantially the same or a corresponding biological activity as the peptide of SEQ ID NO: 23, it is also within the scope of the present invention that some sequences have amino acid sequences deleted, modified, substituted or added Included is self-explanatory.

The term "homology ", as used herein in connection with a sequence, refers to the degree to which it is consistent with a given amino acid sequence or base sequence and may be expressed as a percentage. In the present specification, its homologous sequence having the same or similar activity as a given amino acid sequence or base sequence is indicated as "% homology ". For example, standard software for calculating parameters such as score, identity and similarity, specifically BLAST 2.0, or by sequential hybridization experiments under defined stringent conditions, , And the appropriate hybridization conditions to be defined are within the skill of the art (see, for example, Sambrook et al., 1989, infra) and may be determined by methods well known to those skilled in the art.

The peptide (or the like Hermetia dongae illucens ) larvae.

For example, the peptide may have been isolated from immune-induced hemorrhoids and the like. The separation and purification methods used in the peptide separation and purification methods in the art can be used without limitation. For example, a chromatography method can be used.

The term " Hermetia " illucens "means an insect with a long, long shape with a length of 12-20 mm and a large translucent pattern of white or yellowish brown on the second round. The more detailed name is also known as" In addition to the scientific name ' Hermetia illucens' in English, it is also called 'black soldier fly'. It is reported to be useful for improving environmental pollution caused by organic matter, because it consumes various organic materials such as food waste and livestock manure.

The peptide may be isolated from the fat body of the larvae of the larvae.

In one embodiment of the present invention, the amount of peptides expressed by the tissues of the larvae and the changes of the amounts of the peptides before and after the immunization were examined, and the peptides were expressed in a large amount after immune induction in the larvae of the larvae 8B).

In the present invention, the term "Gram-positive bacteria" means a bacterium that appears to be violet colored by crystal violet as a result of staining with crystal violet. The cell walls of Gram-positive bacteria are composed of about 80 to about 90% of peptidoglycan, and the peptidoglycan has a thick layer to maintain the size and shape of the cell wall, It plays a role.

In the present invention, the Gram positive bacillus may be a bacterium belonging to the genus Staphylococcus or a bacterium belonging to the genus Bacillus. In particular, the bacterium belonging to the genus Staphylococcus is Staphylococcus aureus or Staphylococcus epi Staphylococcus epidermidis and the bacterium belonging to the genus Bacillus may be Bacillus subtilis . More specifically, the Staphylococcus aureus may be Methicillin resistant Staphylococcus aureus (MRSA) .

In one embodiment of the present invention, the antimicrobial activity of peptides isolated from larvae against Gram-negative bacteria, Gram-positive bacteria, and fungi was measured. As a result, it was confirmed that the antimicrobial activity against Gram-positive bacteria such as MRSA, Staphylococcus aureus , and Staphylococcus epidermidis was superior to that against Gram-negative bacteria 3).

In another aspect, the present invention provides a method for producing an antimicrobial composition for Gram-positive bacteria, comprising culturing a microorganism or an insect cell comprising a polynucleotide defined by the nucleotide sequence shown in SEQ ID NO: 22.

The microorganism or insect cell may comprise a vector comprising the nucleotide sequence shown in SEQ ID NO: 22, wherein the activity of the DLP4 protein is introduced, maintained or enhanced. The microorganism or insect cell may be an example of a host cell.

The expression "introduction of the activity of the protein" means that the activity of the protein is externally imparted to a microorganism or an insect cell lacking the intrinsic protein. For example, it can be performed by introducing a gene from the outside. In addition, "enhancement of protein activity" may mean that the activity state of a protein retained by a microorganism or an insect cell is improved as compared with an intrinsically active state.

As a non-limiting example of the introduction or enhancement of the activity of the protein, it is possible to increase the activity of the protein itself present in the host by mutation or the like to elicit an effect beyond the original function and / or increase the intrinsic gene activity Including, but not limited to, intrinsic gene amplification from an internal or external factor, increase in the number of gene copies, additional introduction of an exogenous gene, increase of the activity by replacement or modification of a promoter, and the like.

The increase in the number of gene copies can be carried out in a form that is not particularly limited but is operably linked to a vector or inserted into a chromosome in a host cell. Specifically, a polynucleotide encoding the protein of the present invention may be operatively linked, and a vector capable of replicating and functioning independently of the host may be introduced into the host cell, or the polynucleotide may be operatively linked, A vector capable of inserting the polynucleotide into a chromosome in a cell may be introduced into the host cell to increase the number of copies of the polynucleotide in the chromosome of the host cell.

The modification of the expression control sequence so that the expression of the polynucleotide is increased is not particularly limited. However, the nucleic acid sequence may be deleted, inserted, non-conserved or conservative substitution or a combination thereof to further enhance the activity of the expression control sequence For example, by inducing a mutation in the sequence, or by replacing it with a nucleic acid sequence having a stronger activity. The expression control sequence may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating the termination of transcription and translation, and the like, though not particularly limited thereto.

The modification of the polynucleotide sequence on the chromosome is not particularly limited, but may include mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the polynucleotide sequence Or by replacing with an improved polynucleotide sequence so as to have stronger activity.

The term "vector" as used herein can refer to a DNA construct containing a nucleotide sequence of a polynucleotide encoding the desired protein operably linked to a suitable regulatory sequence so that it can be expressed in a suitable host . The regulatory sequence includes a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation. The vector may be transcribed into an appropriate host cell and then cloned or functioned independently of the host genome and integrated into the genome itself.

The vector used in the present invention is not particularly limited as long as it is replicable in the host cell, and any vector known in the art can be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in their natural or recombinant state. For example, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as the phage vector or cosmid vector, and pBR type, pUC type, pBluescriptII type , pGEM-based, pTZ-based, pCL-based, pET-based, and the like. The vector usable in the present invention is not particularly limited, and known expression vectors can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118 and pCC1BAC vectors can be used.

In addition, a polynucleotide encoding an intrinsic target protein in a chromosome can be replaced with a mutated polynucleotide through a vector for insertion of an intracellular chromosome. The insertion of the polynucleotide into the chromosome can be accomplished by any method known in the art, for example, homologous recombination. Since the vector of the present invention can be inserted into a chromosome by causing homologous recombination, it may further include a selection marker for confirming whether or not the chromosome is inserted. A selection marker is used to select a cell transformed with a vector, that is, to confirm insertion of a target polynucleotide, and it is provided with a selectable phenotype such as drug resistance, nutritional requirement, tolerance to a cytotoxic agent, May be used. In the environment treated with the selective agent, only the cells expressing the selectable marker survive or express different phenotypes, so that the transformed cells can be selected.

As used herein, the term "transformation" means introducing a vector comprising a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell have. The transformed polynucleotide may be either inserted into the chromosome of the host cell or located outside the chromosome, so long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced in any form as far as it is capable of being introduced into a host cell and expressed. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene construct containing all the elements necessary for its expression. The expression cassette typically includes a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. The polynucleotide may also be introduced into the host cell in its own form and operably linked to the sequence necessary for expression in the host cell.

In addition, the term "operably linked" in the above may mean that the gene sequence is functionally linked to a promoter sequence that initiates and mediates transcription of a polynucleotide encoding the protein of interest of the present invention.

Microorganism which can be used in the present invention is Escherichia genus (Escherichia sp.), Shigella genus (Shigella sp.), In bakteo a sheet (Citrobacter sp.), Salmonella in (Salmonella sp.), Enterococcus bakteo in (Enterobacter spores of the genus Yersinia sp., Klebsiella sp., Erwinia sp., Corynebacterium sp., Brevibacterium sp. , Lactobacillus sp., Selenomanas sp., Vibrio sp., Pseudomonas sp., Streptomyces sp., Akano sp. But are not limited to, microorganisms belonging to the genus Arcanobacterium sp., Alcaligenes sp, and the like. For example, the microorganism may be E. coli , but may be any microorganism widely used as a host cell in the art. In addition, the insect may be a family or the like. The recombinant vector can be introduced into the host cell to be introduced with codon optimization.

The step of "culturing a microorganism or an insect cell comprising the nucleotide sequence shown in SEQ ID NO: 22" can be carried out by a known batch-type culture method, a continuous culture method, a fed-batch culture method or the like have. At this time, the culture conditions are not particularly limited. However, the culture conditions may be adjusted by using a basic compound (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (for example, phosphoric acid or sulfuric acid) pH 6 to 8, most preferably pH 6.8), and an oxygen or oxygen-containing gas mixture can be introduced into the culture to maintain aerobic conditions, and the incubation temperature is 20 to 45 캜, 40 DEG C, and can be cultured for about 10 to 160 hours.

The medium used for the above-mentioned culture may be a carbon source such as sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose, fats and oils such as soybean oil, Alcohols such as glycerol and ethanol, and organic acids such as acetic acid, etc. may be used individually or in combination, and they may be used individually or in combination ; Examples of nitrogen sources include nitrogen-containing organic compounds such as peptone, yeast extract, juice, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, Ammonium nitrate) may be used individually or in combination; As the phosphorus source, potassium dihydrogenphosphate, dipotassium hydrogenphosphate and the corresponding sodium-containing salt may be used individually or in combination; Other metal salts such as magnesium sulfate or iron sulfate, amino acids and vitamins.

In one embodiment, the method may further include recovering the peptide of SEQ ID NO: 23 from the cultured microorganism, insect cell or culture thereof after the culturing.

As used herein, the term "culture" is a substance obtained as a result of microbial cultivation, and may include both the medium, the microorganism to be cultured, and the substance secreted from the cultured microorganism. Such as inorganic salt components, amino acids, vitamins, nucleic acids, and / or other components which may generally be contained in the culture medium (or culture medium) in addition to the nutrient sources necessary for culturing the cells, for example, carbon sources, Can be. For example, enzymes produced and secreted by cells may be included.

Since the peptide produced by cultivation may be secreted into the medium or may remain in the cell, the culture may contain the peptide produced by culturing microorganisms or insect cells.

The method for recovering the peptide produced in the culturing step of the present invention can be carried out by collecting the peptide from the culture solution using a suitable method known in the art according to a culture method, for example, a batch type, a continuous type or a fed-batch type culture method .

In another aspect, the present invention provides a pharmaceutical composition for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising the peptide represented by SEQ ID NO: 23.

In the present invention, the bacterial diseases caused by Gram-positive bacteria include food poisoning, impetigo, cellulitis, scalded skin syndrome, mastitis, bacteremia, sepsis, Staphylococcal pneumonia, endocarditis, heart failure, osteomyelitis, Staphylococci sepsis, circulatory collapse, and Toxic shock syndrome. , But the present invention is not limited thereto.

As used herein, the term "prevention" may mean all actions that inhibit or delay the onset of bacterial disease caused by gram-positive bacteria by administering the peptide of SEQ ID NO: 23 according to the present invention to the individual.

As used herein, the term "treatment" may be used to mean that the peptide of the present invention is administered to a subject susceptible to the occurrence of a bacterial disease caused by Gram-positive bacteria to improve or improve the symptoms of the disease .

As used herein, the term "individual" may refer to all animals, including humans, who have developed or are likely to develop bacterial diseases caused by gram-positive bacteria. The animal may be, but is not limited to, a mammal such as a cow, a horse, a sheep, a pig, a goat, a camel, a nutrient, a dog, a cat,

The pharmaceutical composition of the present invention can be used as a single agent and can be used as a combined preparation containing a drug known to have a therapeutic effect on bacterial diseases caused by Gram-positive bacteria, Or may be prepared by unit dosage form by using an excipient or by inserting it into a multi-dose container.

As used herein, the term "pharmaceutically acceptable carrier" may mean a carrier or diluent that does not disturb the biological activity and properties of the compound being injected, without irritating the organism. The type of the carrier that can be used in the present invention is not particularly limited, and any carrier conventionally used in the art and pharmaceutically acceptable may be used. Non-limiting examples of the carrier include saline, sterilized water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol and the like. These may be used alone or in combination of two or more. The carrier may comprise a non-naturally occuring carrier.

In addition, if necessary, other conventional additives such as an antioxidant, a buffer and / or a bacteriostatic agent can be added and used. A diluent, a dispersant, a surfactant, a binder, a lubricant, Pills, capsules, granules or tablets, and the like.

In addition, the pharmaceutical composition of the present invention may contain a pharmaceutically effective amount of the peptide of SEQ ID NO: 23. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and is generally in the range of 0.001 to 1000 mg / kg, preferably 0.05 To 200 mg / kg, more preferably 0.1 to 100 mg / kg, may be administered once a day to several times per day. For purposes of the present invention, however, the specific therapeutically effective amount for a particular patient will depend upon the nature and extent of the reaction to be achieved, the specific composition, including whether or not other agents are used, the age, weight, Sex and diet of the patient, the time of administration, the route of administration and the rate of administration of the composition, the duration of the treatment, the drugs used or concurrently used with the specific composition, and similar factors well known in the medical arts.

The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with another therapeutic agent, and may be administered sequentially or simultaneously with conventional therapeutic agents. And can be administered singly or multiply. It is important to take into account all of the above factors and to administer an amount that can achieve the maximum effect in a minimal amount without causing side effects, and can be readily determined by those skilled in the art.

The term "administering" as used herein refers to the introduction of a pharmaceutical composition of the present invention to a patient by any suitable method, and the route of administration of the composition of the present invention may be oral or parenteral May be administered via various routes.

The mode of administration of the pharmaceutical composition according to the present invention is not particularly limited and may be conventionally used in the art. As a non-limiting example of such a mode of administration, the compositions may be administered orally or parenterally. The pharmaceutical composition according to the present invention can be manufactured into various formulations according to the intended administration mode.

The frequency of administration of the composition of the present invention is not particularly limited, but it may be administered once a day or divided into several doses.

In another aspect, the present invention provides a method for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising the step of administering the peptide represented by SEQ ID NO: 23 to a subject other than a human.

In the present invention, the preventive or therapeutic method may specifically include administering the peptide in a pharmaceutically effective amount to a subject suffering from or susceptible to a bacterial disease caused by Gram-positive bacteria.

The terms used in the present invention are the same as those described above.

In another aspect, the present invention provides a quasi-drug composition for preventing or ameliorating a bacterial disease caused by Gram-positive bacteria, comprising the peptide of SEQ ID NO: 23.

As used herein, the term "improvement" may mean any action that at least reduces the degree of symptom associated with the condition being treated.

Since the antimicrobial composition of the present invention exhibits an antimicrobial effect on Gram-positive bacteria, it can be used for the prevention or treatment of bacterial diseases caused by Gram-positive bacteria.

Fig. 1 is a graph showing the peaks of the antimicrobial peptide purified from hemoglobin and the like on reversed-phase chromatography using a Shim-pack VP-ODS column.
FIG. 2 is a graph showing the mass of antimicrobial peptides purified from hemoglobin proteasomes, using MALDI-TOF MS.
Fig. 3 is a photograph showing the whole cDNA sequence and deduced amino acid sequence of the DLP1 gene isolated from larvae, such as immune-induced homozygous.
Fig. 4 is a photograph showing the whole cDNA sequence and deduced amino acid sequence of the DLP2 gene isolated from larvae, such as immune-induced homozygous.
FIG. 5 is a photograph showing the entire cDNA sequence and deduced amino acid sequence of the DLP3 gene isolated from larvae, such as immune-induced homozygous.
FIG. 6 is a photograph showing the whole cDNA sequence and deduced amino acid sequence of the DLP4 gene isolated from larvae in immunoinducing dams and the like.
Fig. 7 is a photograph showing the degree of similarity between the amino acid sequences of DLP1 to DLP4 and insulin-derived diphenshine known in the art.
FIG. 8A is a graph comparing the expression rate of the DLP4 gene after immune induction in larvae and the like.
8B is a graph comparing the mRNA transcription amount of the DLP4 gene for each tissue before and after induction of immune induction in larvae and the like.

Hereinafter, the constitution and effects of the present invention will be described in more detail with reference to Examples and Experimental Examples. These Examples and Experimental Examples are only for illustrating the present invention, and the scope of the present invention is not limited by these Examples and Experimental Examples.

Example One: Of Induction of immunity

H. illucens larvae were raised in a growth chamber HB-301S (Hanbai, Korea) at 31 ° C, 60% relative humidity, and in dark conditions, and 4 to 5 larvae were used as experimental material Respectively. S. aureus (KCCM 40881) and methicillin resistant staphylococcus aureus (MRSA) were used to induce immunity.

Specifically, the bacteria were centrifuged at 4,000 × g and concentrated (OD ₆₀₀ = 2.4). Then, the bacteria were infiltrated deeply in the direction of the hair on the side of the tenth segment of the larvae. Thereafter, immunity to dams and the like was induced for 24 hours.

Example 2: Immunization induced From Donga Antibacterial Peptides detach

Example 2-1: Immune-induced From Donga Hemolymph Harvesting and tissue extraction

In order to extract the blood lymph from the dorsal roots, etc., the central portion of the back of the third trunk, which is located near the heart of the larva, was immersed with silver pin. Thereafter, hemolymphs in the dorsal column and the like were collected in a cold tube containing a small amount of phenylthiourea (PTU). The collected blood lymph was centrifuged at 12,000 x g for 10 minutes at 4 DEG C, and the supernatant was stored at -70 DEG C. [

On the other hand, the internal organs of Dongae were extracted using a dissecting microscope. The internal organs were then washed with cold Ringer's solution (pH 6.2), placed in a 1.5 mL tube, and stored at -70 ° C.

Example 2 -2: From Bleaching Pro Antimicrobial peptide purification

In order to purify the antimicrobial peptide from the immune-induced diphtheria, etc., the hemolymph collected in Example 2-1 was mixed with 0.1% TFA (trifluoroacetic acid) at a ratio of 1: 1 (v / v) Lt; / RTI > The cells were centrifuged at 12,000 × g for 10 minutes at 4 ° C. and then partially purified by solid-phase extraction (SPE) using a Sep-Pak C18 cartridge, followed by rapid purification using a Resource RPC column (GE Healtcare, USA) Reversed phase chromatography was performed using fast performance liquid chromatography (FPLC) (Pharmacia LKB, Sweden) apparatus. For final purification, reverse phase chromatography was performed on a Shim-pack VP-ODS column using an HPLC apparatus.

Specific methods of using the device are as follows:

(1) SPE using Sep-Pak C18 cartridge

Sep-Pak C18 column was activated with methanol and equilibrated with 0.05% TFA. Meanwhile, the hemolymph collected in Example 2-1 was mixed with 0.1% TFA at a ratio of 1: 1 (v / v) and then acidified at 4 ° C for 12 hours. Thereafter, 3 mL of the acidified hemolymph was injected into the column at a rate of 1 mL / min. Thereafter, 10 mL of the eluate was collected by 10%, 30%, 50%, 100% ACN (acetonitrile) containing 0.05% TFA in the column at a rate of 1 mL / min for 10 minutes, homogenized by vortexing Respectively. To confirm the antimicrobial activity against MRSA and Escherichia coli, 100 μL of each fraction was lyophilized and concentrated 10 times, and then confirmed by inhibition zone assay. The rest was stored at -70 ° C. The 30% ACN fraction with the highest antimicrobial activity was collected in 30 mL (3 times) and lyophilized.

(2) FPLC using Resource RPC

The 30% ACN fraction with the strongest antimicrobial activity from SPE was equilibrated with 2% ACN containing 0.05% TFA. Thereafter, the solution was gradient-wise to an ACN concentration of 17.5 to 26.5% using a Resource RPC column (3 mL) and purified by reversed phase chromatography (Pharmacia LKB, Sweden) using a fast performance liquid chromatography (FPLC) The antimicrobial peptides were isolated by performing the gelation. The absorbance of the protein eluted at this time was measured at a UV 226 nm wavelength. On the other hand, 50 μL of each fraction was lyophilized and concentrated 10 times, followed by inhibition zone assay for antimicrobial activity against MRSA and E. coli. Thereafter, sections having antimicrobial activity against MRSA were lyophilized and stored at -70 ° C.

(3) HPLC using Shim-pack VP-ODS column

The fractions separated by RPC were equilibrated with 10% ACN containing 0.05% TFA in order to purify the fractions with high purity. Then, the equilibrated fractions were subjected to reversed phase chromatography using a Shim-pack VP-ODS column at a concentration gradient of 10 to 30% for 50 minutes at a flow rate of 1 mL / min by HPLC. The absorbance of the protein eluted at this time was measured at a UV 214 nm wavelength. The fraction eluted was 500 μL per fraction, and the antimicrobial activity was determined by inhibition zone assay after lyophilizing 100 μL of each fraction, followed by concentration 10 times. Thereafter, an antimicrobial peptide having antimicrobial activity was isolated and purified only for MRSA. The antimicrobial peptide was stored at -70 ° C. and used for analysis (FIG. 1).

Example 3: Immune-induced From Donga Molecular weight measurement of purified antimicrobial peptide

Molecular weight was measured by Matrix Assisted Laser Desorption Ionization-Flight Time-Mass Spectrometry (MALDI-TOF-MS) using Autoflex II (Burker Daltonics, Germany) in order to measure the exact molecular weight of the purified antimicrobial peptide in Example 2 above.

As a result of the measurement, it was confirmed that the molecular weight of the purified antimicrobial peptide was 4,267 Da (FIG. 2).

Example 4: Immune-induced From Donga Analysis of gene sequences of purified antimicrobial peptides

Example 4-1: Gene specific Degenerated Primer device

The N-terminal amino acid sequence of the antimicrobial peptide isolated in Example 2 was confirmed by the Edman degradation method using an ABI492 protein sequencer (Applied Biosystems, USA).

Then, protein amino acid sequences are aligned using MEGA5 (Molecular Evolutionary Genetics Analysis; Tamura et al., 2011) program, and then a portion showing high similarity and a portion having low degeneracy of codon designating amino acid (DLP1-4-3RACE) for 3'-RACE PCR was prepared. In order to identify the 5'-terminal region sequence, a gene-specific primer (DLP1 to 45RACE) to be used for 5'-RACE PCR was constructed based on the 3'-terminal sequence identified by 3'-RACE One). In the meantime, Y, R, W and S mean nucleotide sites in which CG, AG, AT and GC are mixed in a degenerated primer, and V means a site represented by any one of A, C and G , And N denotes a region represented by any one of A, C, G, and T. Furthermore, X means a sequence not disclosed.

Name of the primer Primer sequence DLP1-3RACE 5'-CTCGATCAGGCAGTGGAACT-3 '(SEQ ID NO: 1) DLP2-3RACE 5 ' -CCTGGATACGCACTGGAACT-3 ' (SEQ ID NO: 2) DLP3-3RACE 5 ' -GCWACCTGTGACCTSTTG-3 ' (SEQ ID NO: 3) DLP4-3RACE 5 ' -TTYAARCCAGTAGARAARTTY-3 ' (SEQ ID NO: 4) DLP1-5RACE 5 ' -TGCGCAGGCGGCATGACCCACYTTGAA-3 ' (SEQ ID NO: 5) DLP2-5RACE 5 ' -TGCGCAGGCGGCATGACCCACYTTGAA-3 ' (SEQ ID NO: 6) DLP3-5RACE 5 ' -AACGGCTCGATCATCGCAC-3 ' (SEQ ID NO: 7) DLP4-5RACE 5 ' -GTCGACAACTAAAGGTTCAGACAAAC-3 ' (SEQ ID NO: 8) Actin-qRT-F 5 ' -AAGGACTCGTACGTGGGTG-3 ' (SEQ ID NO: 9) Actin-qRT-R 5 ' -GCCAACCGTGAGAAGATG-3 ' (SEQ ID NO: 10) DLP4-qRT-F 5 ' -GCAACCTGTGACCTSTTG-3 ' (SEQ ID NO: 11) DLP4-qRT-R 5 ' -GTGCGATGATCGAGCCGTT-3 ' (SEQ ID NO: 12) SMARTER IIA oligo 5 ' -AAGCAGTGGTATCAACGCAGAGTACXXXXX-3 ' (SEQ ID NO: 13) 5'-RACE CDS Primer 5 '- (T) 25VN-3' (SEQ ID NO: 14) 3 ' -RACE CDS Primer 5 ' -AAGCAGTGGTATCAACGCAGAGTAC (T) 30VN-3 ' (SEQ ID NO: 15)

Example 4-2: RNA isolation and first Synthesis of Strand cDNA

RNA was isolated from the immune-derived somatic cells of Example 1 using the RNeasy ^® plus Mini kit (QIAGEN, USA). Prior to the experiment, all the supernatants used for RNA isolation were treated with 0.1% diethyl pyrocarbonate (DEPC) at 37 ° C for 12 hours and sterilized at 120 ° C for 30 minutes. The experimental apparatus was also treated with RNaseZap ^® (Ambion, USA).

To generate 5'-RACE-Ready cDNA, 2.75 μL of the separated RNA (100 ng / μL), 1 μL of 5'-CDS primer A, and 1 μL of SMARTer II A oligo 1) was added to finally prepare a mixture of 4.75 μL. In addition, 3.75 μL of the separated RNA (100 ng / μL) and 1 μL of 3'-CDS primer A (Table 1) were mixed in a sterilized 0.5 mL tube to make 3'-RACE-Ready cDNA, A mixture of 4.75 [mu] L was prepared. Thereafter, the mixtures were reacted at 72 ° C for 3 minutes, respectively, and then cooled in ice for 2 minutes. Thereafter, 2 μL of 5X first strand buffer (250 mM Tris-HCl pH 8.3, 375 mM KCl, 30 mM MgCl ₂ ), 1 μL of 20 mM dithiothreitol (DTT), 1 μL of 10 mM dNTP, 0.25 μL of RNase Inhibitor, and 1 μL of SMARTer Scribe ^™ reverse transcriptase were added to each mixture to make a total of 10 μL of the mixture. The 10 μL of the mixture was carefully mixed with a pipette, reacted at 42 ° C. for 1 hour and 30 minutes, and then heat-treated at 70 ° C. for 10 minutes to prepare first strand cDNA. Subsequently, the reacted samples were diluted with 100 μL of Tricine-EDTA buffer (10 mM Tricine-KOH pH 8.5, 1.0 mM EDTA) and stored in a -20 ° C freezer until each RACE PCR was performed.

Example 4- 3: 3 'And 5'-RACE PCR Conduct and analysis of base sequences

3'-RACE PCR and 5'-RACE PCR were performed using 5'-RACE-Ready cDNA and 3'-RACE-Ready cDNA prepared in Example 4-2, which were diluted in Trincine-EDTA buffer, and Taq Polymerase was obtained from Advantage ^® 2 (Clontech, Canada). To perform PCR, 19 μL master mixes were prepared by mixing 2.5 μL of 10 × PCR reaction buffer, 2.5 μL of dNTP (20 mM EA.), 0.5 μL of Advantage ^® 2 Polymerase mix and 13.5 μL of distilled water.

To proceed with the 3'-RACE PCR reaction, 2.5 μL of the template cDNA prepared in Example 4-2 was added to 19 μL of the master mix, and the 3'-RACE primer prepared in Example 4-1 1 μL (10 pmol / μL) and 2.5 μL of 10 × Universal Primer A Mix (UPM) to make a total volume of 25 μL and amplify the gene using MiniCycler ^™ (MJ Research, USA).

To proceed with the 5'-RACE PCR reaction, 19 μL of the previously prepared master mix was added with 2.5 μL of the template cDNA prepared in Example 4-2, and 2.5 μL of 10 × UPM and 4-1 1 μL (10 pmol / μL) of the prepared 5'-RACE primer was added to make a total volume of 25 μL, and the gene was amplified using MiniCycler ^™ (MJ Research, USA). PCR product purification, DNA recombination and transformation, and sequencing were carried out in the same manner for the cloning of 3'-RACE PCR and 5'-RACE PCR products, respectively.

On the other hand, plasmid DNA extracted through cloning of the 3'- and 5'-RACE PCR products was subjected to macrophage (Macrogen, Korea) in order to confirm the mRNA of the purified antimicrobial peptide from the immune- Respectively. The nucleotide sequences of the antimicrobial peptides were analyzed using the 3730xl DNA Analyzer (Applied Biosystems, USA) using an automated sequencer using a capillary method, and the amino acid sequences and mature amino acid sequences were analyzed (Table 2, 3 to 6).

cDNA sequence DLP 1 cDNA
Base sequence GATCAGTCTAGTGAAAGGCAACTGCTAGAATACAGATCCAGCTTCAGCTTTTTCTTCAACCCAAAGCTTCGATCTTTAACTAAAGCCAAAATGCGTTCCGTTCTCGTCTTGGGTTTAATTGTCCGCGCTTTTGCTGTCTACACCTCAGCACAACCCTATCAGTTACAATACGAGGAAGATGGTCTCGATCAGGCAGTGGAACTTCCTATTGAAGAAGAACAACTTCCGAGTCAGGTGGTGGAGCAGCATTACCGTGCGAAACGTGCAACCTGTGATCTCTTGAGTCCCTTCAAAGTGGGTCATGCCGCCTGCGCACTTCATTGTATTGCTTTGGGACGTCGTGGAGGCTGGTGCGATGGTCGAGCCGTTTGTAATTGCAGACGTTAATTTAAAGTGCTTCTATTATTAATACAACACCAATTTGTTATTTATTCATCCAAATTTTATTAGTAGTTGTTATTTTGGTTAAAAAAATTTATTTGGGAAAATAAATTATTATTTTTTTTTTAAATTG (SEQ ID NO: 16) amino acid
Sequence (mature peptide sequence is underlined) MRSVL VLGLI VAAFA VYTSA QPYQL QYEED GLDQA VELPI EEEQL PSQVV EQHYR AKR AT CDLLS PFKVG HAACA LHCIA LGRRG GWCDG RAVCN CRR (SEQ ID NO: 17) DLP 2 cDNA
Base sequence ATCAGTCCAGACAACGACTACTCATAGAACACAGATTAAGCTCCAGCTTTTCTTTTCTTCAATTTAAAGTTTTATTCTGAATCTAAAAGTCAAAATGCGTTCTATTCTCGTCTTGGGTTTAATTGTTGCCGCTTTTGCCGTCTACACCTCAGCACAACCT TATCAGTTACAATACGAGGAAGATGGTCCT GGATACGCACTGGAACTCCCTAGCGAAGAAGAAGGACTTCCTAGCCAAGTAGTGGAACAACATTACCGGGCGAAACGTGCAACCTGTGACCTCTTGAGTCCCTTCAAAGTGGGTCATGCTGCCTGCGCACTTCATTGTATTGCCATGGGACGACGAGGAGGCTGGTGCGATGGTCGAGCCGTTTGTAATT GCAGACGCTAATCTAAAGTGATTGTATTACTAATAGAGCTCTAGTTTGTTATTTATTCACAAAATTTTTATTATTTATCAATTGTTGATTGTTGTTTTGAATAAATTTTTTTTTTAGTTCTT (SEQ ID NO: 18)
amino acid
Sequence (mature peptide sequence is underlined) MRSIL VLGLI VAAFA VYTSA QPYQL QYEED GPGYA LELPS EEEGL PSQVV EQHYR AKR AT CDLLS PFKVG HAACA LHCIA MGRRG GWCDG RAVCN CRR (SEQ ID NO: 19) DLP 3 cDNA
Base sequence AGTCCAGAGAACGACTACCCATAGAACACAGATTAAGCTCCAGCTTTTCTTTTCTTCAATTTAAAGTTTTATTCTGAACCTAAAAGTCAAAATGCGTTCTATTCTCGTCTTGGGTTTAATTGTTGCCGTTTTTGGCGTCTACACCTCAGCACAACCCTATCAGCTACAATATGAGGAAGATGGTCCTGAA TACGCGCTGGTACTCCCTATTGAAGAAGAAGAACTTCCTAGTCAGGTAGTGGAGCAGCATTATCGGGCAAAACGTGCCACCTGTGACCTCTTGAGCCCCTTCGGCGTGGGTCATGCCGCCTGCGCAGTGCATTGTATTGCCATGGGACGACGCGGAGGCTGGTGCGATGATCGAGCCGTT TGTAACTGCA GACGTTAATCTAAAGTGCTTGTATTACTAATACAGCTCTAGTTTGTTATTTATTCACAAAATTTTTATTATTTGTCAATTGTTGATTGCTGTTTTGAATAAATTTTTGTTTTGGTTGTGT (SEQ ID NO: 20) amino acid
Sequence (mature peptide sequence is underlined) MRSIL VLGLI VAVFG VYTSA QPYQL QYEED GPEYA LVLPI EEEEL PSQVV EQHYR AKR AT CDLLS PFGVG HAACA VHCIA MGRRG GWCDD RAVCN CRR (SEQ ID NO: 21) DLP 4 cDNA
Base sequence TTCCAATTCAACCTCCCATTGGAAGATACAATTCACCAGCCCTTAAAGATACTTTGTGCTTTTTAAAGAACGTACAAAATGCGTGTGACCGTGTGTCTATTCAGTGTCGTTGCCTTATTTGCAATGGTCCATTGCCAACCTTTCCAACTCGAGACGGAAGGTGACCAACAGCTGGAACCAGTCGTTGCTG AAGTAGACGATGTTGTCGATTTGGTAGCTATTCCAGAACATACACGAGAAAAACGAGCAACCTGTGACCTGTTGAGCCCTTTTAAAGTTGGTCATGCCGCATGCGCTGCTCATTGTATCGCAAGGGGCAAACGAGGAGGATGGTGTGACAAAAGAGCTGTTTGCAACTGCCGGAAATAGGAGTACTATTT AAAATAGGAGTACTATTTAAGTTTGTCTGAACCTTTAGTTGTCGACAAATATTCAATAATGTAATATAACGTTCTATTCTTTTAACTTAAGTATAATAAACCATCATATAGTATTGCAAAAAAAAAAAAA (SEQ ID NO: 22) amino acid
Sequence (mature peptide sequence is underlined) MRVTV CLFSV VALFA MVHCQ PFQLE TEGDQ QLEPV VAEVD DVVDL VAIPE HTREK R ATCD LLSPF KVGHA ACAAH CIARG KRGGW CDKRA VCNCR K (SEQ ID NO: 23)

As a result of the analysis, it was confirmed that DLP1 to DLP4 consist of 514 bp, 502 bp, 500 bp and 497 bp nucleotides excluding poly (A) tail. It was confirmed that the 5'-terminal non-translated region [UTR] consisted of 90 bp, 94 bp, 91 bp and 78 bp nucleotides in DLP1 to 4, respectively. The reading frame [ORF] was 297 bp in DLP1-3 and 291 bp in DLP4. As a result of confirming the KR splitting site using the Prop1.0 program, DLP1-3 consisted of a putative signal sequence (174 bp) encoding 58 amino acid sequences and a stop codon (TAA). In the case of DLP4, it consisted of an estimated signal sequence consisting of 168 bp encoding a 56 amino acid sequence and a termination codon (TAG). In common, DLPs 1 to 4 all consisted of a 123 bp mature peptide sequence encoding 40 amino acids. In addition, 3'-UTR was found to contain 127 bp, 111 bp, 112 bp, and 128 bp nucleotide sequences in DLP1 to 4, respectively. In all four peptides, the polyadenylation signal AATAAA . The theoretical molecular weights of DLP1-4 were 4259.01, 4277.04, 4249.93 and 4275.05, respectively, and the pI values were 8.98, 8.98, 8.37 and 9.38, respectively.

Example 5: From Donga Identification of similarity between the purified antimicrobial peptide and the existing antimicrobial peptide New Determination of antimicrobial peptides

The sequence of the antimicrobial peptide revealed in Example 4 was confirmed by NCAI (National Center for Biotechnology Information) through Basic Local Alignment Search Tool (BLAST).

As a result of the homology analysis, the peptide most similar to the antimicrobial peptide purified in Example 2 was Phelebotomus duboscqi diffenzin , and the similarity was confirmed to be 72.5 to 75% (Fig. 7). This means that the antimicrobial peptide is a novel peptide.

Meanwhile, when comparing the N-terminal amino acid sequence analysis result of the antimicrobial peptide purified in Example 2 with the deduced amino acid sequence of DLP 1 to 4 identified through RACE, it was confirmed that each amino acid sequence in the mature peptide portion Were exactly the same. In addition, the theoretical molecular weight of DLP 4 considering 3 disulfide bonds was 4,269.05 Da, which was very close to the experimental molecular weight 4,267 Da measured in Example 3 of the purified antimicrobial peptide. Thus, it can be seen that the novel antimicrobial peptide isolated from Donghae and the like is DLP 4.

Example 6: From Donga Measurement of antimicrobial activity of isolated antimicrobial peptides

The antimicrobial activity of the novel antimicrobial peptide DLP 4 identified in Example 5 was measured among the antimicrobial peptides isolated from Dongae and the like in Example 2 above. Measurement of antimicrobial activity against bacteria Gram-negative bacteria used in the experiment were Escherichia coli (KCCM 11234), Enterobacter aerogenes (KCCM 12177), and P. aeruginosa (KCCM 11328), Gram-positive bacteria are MRSA, S. aureus (KCCM 40881), S. aureus (KCCM 12256), Bacillus subtilis (KCCM 11316), Kocuria rhizophila (KCCM 11236), Micrococcus luteus (KCCM 11326), and Staphylococcus epidermidis (KCCM 35494), the fungus is Candida albicans (KCCM 11282) was used. As a sample for confirming the antimicrobial activity, DLP 4 isolated in Example 2, methicillin and ampicillin, which are known antibiotics, were used.

Specifically, the bacteria or fungi grown in the liquid medium were diluted to 5 x 10 ⁵ cells / mL and dispensed into 96-well plates in an amount of 90 μL each. Thereafter, the samples diluted by the serial dilution method were injected by 10 [mu] L per concentration. On the other hand, in order to prevent the evaporation of the medium, the absorbance (OD ₆₀₀ ) was measured at 2 hour intervals in an incubator at 37 ° C for 24 hours at a high humidity. In the control group, distilled water was used.

As a result of the experiment, it was found that MRSA of S. aureus , S. aureus 40881, S. aureus 12256, S. epidermidis, B. and antibacterial activity The minimum concentration (MIC) for subtilis, for each 5 μg / mL, 5 μg / mL, 10 μg / mL, 5 μg / mL, Gram-positive bacteria to 0.15625 μg / mL Showed strong antimicrobial activity. On the other hand, the antimicrobial activity of Gram-negative bacteria such as E. coli , E. aerogenes , and P. aeruginosa was not observed even at the maximum concentration of 20 μg / mL (Table 3).

Target microorganism Kinds Minimum inhibitory concentration (μg / mL) DLP4 Methicillin Ampicillin Gram
Positive bacteria MRSA Clinical separation 5 > 80 > 80 Staphylococcus aureus KCCM 40881 5 80 2.5 Staphylococcus aureus KCCM 12256 10 2.5 2 Staphylococcus epidermidis KCCM 35494 5 > 80 10 Bacillus subtilis KCCM 11316 0.15625 0.078125 0.078125 Gram
Negative bacteria Escherichia coli KCCM 11234 > 20 > 80 20 Enterobacter aerogenes KCCM 12177 > 20 > 80 > 80 Pseudomonas aeruginosa KCCM 11328 > 20 - -

MRSA (clinical isolated) showed resistance at 80 μg / mL of methicillin (Met) and 80 μg / mL of ampicillin (Amp) at the maximum MIC experimental conditions. DLP4 showed 5 μg / mL of MIC for MRSA And the antimicrobial activity was excellent. In particular, DLP4 exhibits excellent antimicrobial activity against Gram-positive bacteria Staphylococcus aureus and Staphylococcus epidermidis even at a low concentration of 5 to 10 μg / mL, which is superior to antimicrobial agents such as methicillin and ampicillin, .

Example 7: Dong Ae Measurement of the expression level of antimicrobial peptides by larval tissues

In order to confirm the changes in DLP4 expression level and DLP4 expression level before and after immunization after inducing immune system in the same manner as in Example 1, fat, FB, MG, Quantitative real-time PCR was performed on each of the trachea (MT), the muscle (Mu), the organ (Tr), and the whole body (WB).

The increase in gene expression rate after immunization induction was calculated by the 2 ^- ^CT method, which showed an increase of 13,000 times in fat body, 7,000 times in muscle, and 36,000 times in organ (Fig. 8A). However, when the mRNA was transferred, the amount of immune-induced fat was the highest at 7.5 × 10 ⁶ , 1.3 × 10 ⁵ for the immunoreactive muscle, 5.3 × 10 ³ for the immune-induced organs, In the tissues, a very low value of 400 or less appeared (FIG. 8B). As a result, it was confirmed that DLP4 is expressed in a large amount after immune induction in larval body of larvae such as Donga.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Dankook University Cheonan Campus Industry Academic Cooperation Foundation <120> An antibacterial peptide isolated from Hermetia illucens <130> KPA150514-KR <160> 23 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DLP1-3RACE <400> 1 ctcgatcagg cagtggaact 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DLP2-3RACE <400> 2 cctggatacg cactggaact 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> DLP3-3RACE <400> 3 gcwacctgtg acctsttg 18 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DLP4-3RACE <400> 4 ttyaarccag tagaraartt y 21 <210> 5 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DLP1-5RACE <400> 5 tgcgcaggcg gcatgaccca cyttgaa 27 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> DLP2-5RACE <400> 6 tgcgcaggcg gcatgaccca cyttgaa 27 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DLP3-5RACE <400> 7 aacggctcga tcatcgcac 19 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> DLP4-5RACE <400> 8 gtcgacaact aaaggttcag acaaac 26 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Actin-qRT-F <400> 9 aaggactcgt acgtgggtg 19 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Actin-qRT-R <400> 10 gccaaccgtg agaagatg 18 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> DLP4-qRT-F <400> 11 gcaacctgtg acctsttg 18 <210> 12 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> DLP4-qRT-R <400> 12 gtgcgatgat cgagccgtt 19 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> SMARTer 2A oligo <400> 13 aagcagtggt atcaacgcag agtac 25 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 5'-RACE CDS Primer <400> 14 tttttttttt tttttttttt tttttvn 27 <210> 15 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> 3'-RACE CDS Primer <400> 15 aagcagtggt atcaacgcag agtacttttt tttttttttt tttttttttt tttttvn 57 <210> 16 <211> 514 <212> DNA <213> Artificial Sequence <220> <223> DLP 1 cDNA <400> 16 gatcagtcta gtgaaaggca actgctagaa tacagatcca gcttcagctt tttcttcaac 60 ccaaagcttc gatctttaac taaagccaaa atgcgttccg ttctcgtctt gggtttaatt 120 gtccgcgctt ttgctgtcta cacctcagca caaccctatc agttacaata cgaggaagat 180 ggtctcgatc aggcagtgga acttcctatt gaagaagaac aacttccgag tcaggtggtg 240 gagcagcatt accgtgcgaa acgtgcaacc tgtgatctct tgagtccctt caaagtgggt 300 catgccgcct gcgcacttca ttgtattgct ttgggacgtc gtggaggctg gtgcgatggt 360 cgagccgttt gtaattgcag acgttaattt aaagtgcttc tattattaat acaacaccaa 420 tttgttattt attcatccaa attttattag tagttgttat tttggttaaa aaaatttatt 480 tgggaaaata aattattatt ttttttttaa attg 514 <210> 17 <211> 98 <212> PRT <213> Artificial Sequence <220> <223> DLP 1 amino acid <400> 17 Met Arg Ser Val Leu Val Leu Gly Leu Ile Val Ala Ala Phe Ala Val 1 5 10 15 Tyr Thr Ser Ala Gln Pro Tyr Gln Leu Gln Tyr Glu Glu Asp Gly Leu 20 25 30 Asp Gln Ala Val Glu Leu Pro Ile Glu Glu Glu Gln Leu Pro Ser Gln 35 40 45 Val Val Glu Gln His Tyr Arg Ala Lys Arg Ala Thr Cys Asp Leu Leu 50 55 60 Ser Pro Phe Lys Val Gly His Ala Ala Cys Ala Leu His Cys Ile Ala 65 70 75 80 Leu Gly Arg Arg Gly Gly Trp Cys Asp Gly Arg Ala Val Cys Asn Cys 85 90 95 Arg Arg <210> 18 <211> 502 <212> DNA <213> Artificial Sequence <220> <223> DLP 2 cDNA <400> 18 atcagtccag acaacgacta ctcatagaac acagattaag ctccagcttt tcttttcttc 60 aatttaaagt tttattctga atctaaaagt caaaatgcgt tctattctcg tcttgggttt 120 aattgttgcc gcttttgccg tctacacctc agcacaacct tatcagttac aatacgagga 180 agatggtcct ggatacgcac tggaactccc tagcgaagaa gaaggacttc ctagccaagt 240 agtggaacaa cattaccggg cgaaacgtgc aacctgtgac ctcttgagtc ccttcaaagt 300 gggtcatgct gcctgcgcac ttcattgtat tgccatggga cgacgaggag gctggtgcga 360 tggtcgagcc gtttgtaatt gcagacgcta atctaaagtg attgtattac taatagagct 420 ctagtttgtt atttattcac aaaattttta ttatttatca attgttgatt gttgttttga 480 ataaattttt tttttagttc tt 502 <210> 19 <211> 98 <212> PRT <213> Artificial Sequence <220> <223> DLP 2 amino acid <400> 19 Met Arg Ser Ile Leu Val Leu Gly Leu Ile Val Ala Ala Phe Ala Val 1 5 10 15 Tyr Thr Ser Ala Gln Pro Tyr Gln Leu Gln Tyr Glu Glu Asp Gly Pro 20 25 30 Gly Tyr Ala Leu Glu Leu Pro Ser Glu Glu Glu Glu Leu Pro Ser Gln 35 40 45 Val Val Glu Gln His Tyr Arg Ala Lys Arg Ala Thr Cys Asp Leu Leu 50 55 60 Ser Pro Phe Lys Val Gly His Ala Ala Cys Ala Leu His Cys Ile Ala 65 70 75 80 Met Gly Arg Arg Gly Gly Trp Cys Asp Gly Arg Ala Val Cys Asn Cys 85 90 95 Arg Arg <210> 20 <211> 500 <212> DNA <213> Artificial Sequence <220> <223> DLP 3 cDNA <400> 20 agtccagaga acgactaccc atagaacaca gattaagctc cagcttttct tttcttcaat 60 ttaaagtttt attctgaacc taaaagtcaa aatgcgttct attctcgtct tgggtttaat 120 tgttgccgtt tttggcgtct acacctcagc acaaccctat cagctacaat atgaggaaga 180 tggtcctgaa tacgcgctgg tactccctat tgaagaagaa gaacttccta gtcaggtagt 240 ggagcagcat tatcgggcaa aacgtgccac ctgtgacctc ttgagcccct tcggcgtggg 300 tcatgccgcc tgcgcagtgc attgtattgc catgggacga cgcggaggct ggtgcgatga 360 tcgagccgtt tgtaactgca gacgttaatc taaagtgctt gtattactaa tacagctcta 420 gtttgttatt tattcacaaa atttttatta tttgtcaatt gttgattgct gttttgaata 480 aatttttgtt ttggttgtgt 500 <210> 21 <211> 98 <212> PRT <213> Artificial Sequence <220> <223> DLP 3 amino acid <400> 21 Met Arg Ser Ile Leu Val Leu Gly Leu Ile Val Ala Val Phe Gly Val 1 5 10 15 Tyr Thr Ser Ala Gln Pro Tyr Gln Leu Gln Tyr Glu Glu Asp Gly Pro 20 25 30 Glu Tyr Ala Leu Val Leu Pro Ile Glu Glu Glu Glu Leu Pro Ser Gln 35 40 45 Val Val Glu Gln His Tyr Arg Ala Lys Arg Ala Thr Cys Asp Leu Leu 50 55 60 Ser Pro Phe Gly Val Gly His Ala Ala Cys Ala Val His Cys Ile Ala 65 70 75 80 Met Gly Arg Arg Gly Gly Trp Cys Asp Asp Arg Ala Val Cys Asn Cys 85 90 95 Arg Arg <210> 22 <211> 510 <212> DNA <213> Artificial Sequence <220> <223> DLP 4 cDNA <400> 22 ttccaattca acctcccatt ggaagataca attcaccagc ccttaaagat actttgtgct 60 ttttaaagaa cgtacaaaat gcgtgtgacc gtgtgtctat tcagtgtcgt tgccttattt 120 gcaatggtcc attgccaacc tttccaactc gagacggaag gtgaccaaca gctggaacca 180 gtcgttgctg aagtagacga tgttgtcgat ttggtagcta ttccagaaca tacacgagaa 240 aaacgagcaa cctgtgacct gttgagccct tttaaagttg gtcatgccgc atgcgctgct 300 cattgtatcg caaggggcaa acgaggagga tggtgtgaca aaagagctgt ttgcaactgc 360 cggaaatagg agtactattt aaaataggag tactatttaa gtttgtctga acctttagtt 420 gtcgacaaat attcaataat gtaatataac gttctattct tttaacttaa gtataataaa 480 ccatcatata gtattgcaaa aaaaaaaaaa 510 <210> 23 <211> 96 <212> PRT <213> Artificial Sequence <220> <223> DLP 4 amino acid <400> 23 Met Arg Val Thr Val Cys Leu Phe Ser Val Val Ala Leu Phe Ala Met 1 5 10 15 Val His Cys Gln Pro Phe Gln Leu Glu Thr Glu Gly Asp Gln Gln Leu 20 25 30 Glu Pro Val Ala Glu Val Asp Asp Val Val Asp Leu Val Ala Ile 35 40 45 Pro Glu His Thr Arg Glu Lys Arg Ala Thr Cys Asp Leu Leu Ser Pro 50 55 60 Phe Lys Val Gly His Ala Ala Cys Ala Ala His Cys Ile Ala Arg Gly 65 70 75 80 Lys Arg Gly Gly Trp Cys Asp Lys Arg Ala Val Cys Asn Cys Arg Lys 85 90 95

Claims

23. The antimicrobial composition for Gram-positive bacteria comprising a peptide defined by the amino acid sequence shown in SEQ ID NO: 23.

The method of claim 1, wherein the peptide is (Hermetia like dongae RTI ID = 0.0 > illucens &lt; / RTI > larva.

3. The composition of claim 2, wherein the peptide is isolated from the plague of the larvae.

The composition according to claim 1, wherein the gram-positive bacteria are bacteria of the genus Staphylococcus or genus of the genus Bacillus.

5. The bacterium according to claim 4, wherein the bacterium belonging to the genus Staphylococcus is Staphylococcus aureus or Staphylococcus epidermidis , and the bacterium belonging to the genus Bacillus subtilis is Staphylococcus aureus or Staphylococcus epidermidis . &Lt; / RTI >

6. The composition of claim 5, wherein the Staphylococcus aureus is Methicillin resistant Staphylococcus aureus (MRSA).

22. A method for producing an antimicrobial composition for Gram-positive bacteria, comprising culturing a microorganism or an insect cell comprising a polynucleotide defined by the nucleotide sequence shown in SEQ ID NO: 22.

8. The method according to claim 7, wherein the insect is homosexual or the like.

23. A pharmaceutical composition for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising a peptide defined by an amino acid sequence represented by SEQ ID NO: 23.

23. A method for preventing or treating a bacterial disease caused by Gram-positive bacteria, comprising the step of administering the peptide represented by SEQ ID NO: 23 to a subject other than human.

A quasi-drug composition for preventing or ameliorating a bacterial disease caused by Gram-positive bacteria, comprising the peptide of SEQ ID NO: 23.