KR20170010257A - Pharmaceutical Composition for Preventing or Treating Arthritis Comprising Inhibitors of Serotonin Receptore Expression or Serotonin Receptor Activity As Active Ingredient - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for alleviating, preventing or treating arthritis, and a method for screening a material for alleviating, preventing or treating arthritis. According to the present invention, the pharmaceutical composition for alleviating, preventing or treating arthritis effectively inhibits generation of inflammatory cytokine induced by IL-1.

Description

FIELD OF THE INVENTION The present invention relates to a pharmaceutical composition for improving, preventing or treating arthritis, which comprises an inhibitor of serotonin receptor expression or an inhibitor of serotonin receptor activity as an active ingredient.

The present invention relates to a pharmaceutical composition for improving, preventing or treating arthritis comprising an inhibitor of serotonin receptor expression or an inhibitor of serotonin receptor activity as an active ingredient.

Rheumatoid arthritis is one of the autoimmune diseases and one of the diseases that have not developed the exact cause and treatment method. Rheumatoid arthritis is known to be an inflammatory arthritis (Richardson B. et al., Clin Immunol, 109, 72-79, 2003), and it is known that rheumatoid arthritis is known to be a disease among many patients with chronic arthritis in addition to degenerative arthritis. The number of patients with rheumatoid arthritis in Korea is estimated at 1%.

Although the disease can be caused by various age groups, it is confirmed that the number of female patients is higher than that of male patients by gender, and the number of patients aged 35-50 is higher than the age of the patients. If the disease progresses chronically, it may be subject to various limitations in daily life. Disruption of social life due to pain can lead to depression, which can lead to social and economic losses.

There is no known precise cause of rheumatoid arthritis, but it is assumed that it is caused by genetic or social factors. Genetic factors include the human Leukocyte Antigen-DR (HLA-DR) gene, which determines the organism type of a person. Those who have a specific type of HLA-DR4 are more likely to have rheumatoid arthritis It is known that arthritis is more common and more severe, and autoimmune reactions to joints are more evident (Avouac et al., Ann. Rheum. Dis., 65 (7): 845-851, 2006).

Serotonin is one of the compounds produced by the breakdown of tryptophan in the body, and serotonin is produced in two places in the brain and intestines. About 90% of the serotonin produced is serotonin produced in the intestines. Serotonin is often known as a happy hormone. As mentioned earlier, serotonin is produced in the intestines and brain. The enzymes that synthesize the two serotonin synthases are different. The enzyme that makes serotonin in the brain is Tph2, and the enzyme that is produced in the intestines is the Tph1 hormone. Tryptophan, which is introduced into the body, is metabolized by serotonin, a compound that is finally metabolized by the Tph enzyme. The Tph2 hormone produced by the brain is not transported in the bloodstream by the lipid receptor in the brain (Relationship between central and peripheral serotonin indexes in depressed and suicidal psychiatric inpatients, Arch. Gen. Psychiatry 49, 442-446, 1992). The amount of serotonin produced in the brain is not known to be 5%. Serotonin, which travels in the bloodstream of the body, is a substance produced by the intestines that travels through the bloodstream to help the intestinal contraction and relaxation, or to affect platelets, thereby affecting blood clotting. In addition, serotonin is known to be secreted in a large amount when an inflammatory reaction occurs in the body. (The serotonin signaling system: from basic understanding to drug development for functional GI disorders Gastroenterology 132, 397-414.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to find a composition capable of effectively improving, preventing or treating arthritis, which is one of autoimmune diseases. As a result, it was confirmed that serotonin was overexpressed in arthritis, and that the expression of the receptor for serotonin was inhibited to prevent inflammation-related signal transduction, thereby improving, preventing or treating arthritis.

Accordingly, it is an object of the present invention to provide a pharmaceutical composition for improving, preventing or treating arthritis.

Another object of the present invention is to provide a screening method for substances for improving, preventing or treating arthritis.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, there is provided a pharmaceutical composition for improving, preventing or treating arthritis comprising an inhibitor of serotonin receptor expression or an inhibitor of serotonin receptor activity as an active ingredient.

The present inventors have sought to find a composition capable of effectively improving, preventing or treating arthritis, which is one of autoimmune diseases. As a result, it was confirmed that serotonin was overexpressed in arthritis, and it was confirmed that arthritis can be improved, prevented or treated by inhibiting the expression of the serotonin receptor and blocking inflammation-related signal transduction.

The serotonin receptor is a type of G protein-coupled receptor (GPCR) and a ligand-gated ion channel (LGIC), and is located in the central nervous system and peripheral nervous system.

According to one embodiment of the present invention, the serotonin receptor is at least one serotonin receptor selected from the group consisting of Htr1a, Htr1b, Htr1d, Htr1f, Htr2a, Htr2b, Htr2c, Htr3a, Htr3b, Htr4, Htr5a, Htr5b, Htr6 and Htr7 to be.

According to another embodiment of the present invention, the serotonin receptor is at least one serotonin receptor selected from the group consisting of Htrlb and Htr2a.

The pharmaceutical composition comprising the serotonin receptor expression inhibitor or the serotonin receptor activity inhibitor of the present invention as an active ingredient can improve, prevent or treat arthritis.

According to one embodiment of the present invention, the arthritis is selected from the group consisting of rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, degenerative arthritis, gout or spondylarthritis, to be.

According to another embodiment of the present invention, the arthritis is rheumatoid arthritis or pediatric rheumatoid arthritis.

Inhibitors of serotonin receptor expression inhibitors or serotonin receptors used as an active ingredient in the pharmaceutical composition of the present invention include antisense oligonucleotides, siRNA oligonucleotides, aptamers, antibodies, peptides, single chain variable region fragments of antibodies, small molecular weight compounds And natural extracts.

According to one embodiment of the present invention, the expression inhibitor of the serotonin receptor gene of the present invention is an antisense oligonucleotide or siRNA oligonucleotide that specifically binds to a serotonin receptor gene.

The term "antisense oligonucleotide " as used herein refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and binds to a complementary sequence in mRNA to inhibit translation of mRNA into a protein Antisense sequence refers to a DNA or RNA sequence that is complementary to a serotonin receptor mRNA and capable of binding to a serotonin receptor mRNA and is capable of translating serotonin receptor mRNA, translocating it into the cytoplasm, The antisense nucleic acid has a length of 6 to 100 bases, preferably 8 to 60 bases, more preferably 10 to 40 bases.

The antisense nucleic acid can be modified at one or more base, sugar or backbone locations to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5 (3): 343-55 (1995) ). The nucleic acid backbone can be modified with phosphorothioate, phosphotriester, methylphosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic biantennary bond, and the like. In addition, the antisense nucleic acid may comprise one or more substituted sugar moieties. The antisense nucleic acid may comprise a modified base. Modified bases include, but are not limited to, hypoxanthin, 6-methyladenine, 5-me pyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine . In addition, the antisense nucleic acid of the present invention may be chemically combined with one or more moieties or conjugates that enhance the activity and cytotoxicity of the antisense nucleic acid. A cholesterol moiety, a cholesteryl moiety, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, a polyamine, a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, octadecylamine, hexylamino- And liposoluble moieties such as Cole sterol moieties. Oligonucleotides, including liposoluble moieties, and methods of preparation are well known in the art (U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid may increase the stability to nuclease and increase the binding affinity of the antisense nucleic acid with the target mRNA.

In the case of antisense oligonucleotides, they can be synthesized in vitro in a conventional manner and administered in vivo or in vivo to synthesize antisense oligonucleotides. One example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose recognition site (MCS) origin is in the opposite direction. Such antisense RNAs are preferably made such that translation stop codons are present in the sequence so that they are not translated into the peptide sequence.

The design of the antisense oligonucleotides that can be used in the present invention can be found in reference to the nucleotide sequences disclosed in Gene Bank Accession Numbers BC096207, BC069065, AB041370, AY225227, AK315325, AF498982, AK302787, BC096839, BC074849, BC074848, BC069576, BC069356, AK313741 and AK31412 (Weiss, B. (ed.): Antisense Oligodeoxynucleotides and Antisense RNA: Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997; Weiss, B., et al., Antisense RNA gene therapy for studying and modulating biological processes. Cell. Mol. Life Sci., 55: 334-358 (1999).

As used herein, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (see WO 00/44895, WO 01/36646, WO 99/32619, WO 01/29058, WO 99 / 07409 and WO 00/44914.) Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knockdown method or as a gene therapy method.

siRNA was first discovered in plants, insects, fruit flies and parasites, but recently siRNA has been developed and used in mammalian cell research.

When the siRNA molecule is used in the present invention, the sense strand (the corresponding sequence corresponding to the serotonin receptor mRNA sequence) and the antisense strand (the sequence complementary to the serotonin receptor mRNA sequence) are located on opposite sides to form a double stranded structure Or may have a single-stranded structure with self-complementary sense and antisense strands.

The siRNA is not limited to a complete pair of double-stranded RNA portions that are paired with each other, but is paired by a mismatch (the corresponding base is not complementary), a bulge (no base corresponding to one chain) May be included. The total length is 10 to 100 bases, preferably 15 to 80 bases, more preferably 20 to 70 bases.

The siRNA terminal structure can be blunt or cohesive, provided that the expression of the serotonin receptor gene can be inhibited by the RNAi effect. The sticky end structure can be a 3'-end protruding structure and a 5'-end protruding structure.

In the present invention, the siRNA molecule may have a form in which a short nucleotide sequence (e.g., about 5-15 nt) is inserted between self-complementary sense and antisense strands, in which case by expression of the nucleotide sequence The formed siRNA molecules form a hairpin structure by intramolecular hybridization and form a stem-and-loop structure as a whole. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

According to one embodiment of the present invention, the activity inhibitor of the serotonin receptor of the present invention is a serotonin receptor N- [3- [3- (dimethylamino) ethoxy] -4-methoxyphenyl Biphenyl] -4-carboxamide (SB216641) or (2-methyl-4'- R) - (2,3-dimethoxyphenyl) - [1- [2- (4-fluorophenyl) ethyl] -4-piperidyl] methanol (M100907).

The composition for improving, preventing or treating arthritis comprising an inhibitor of serotonin receptor expression of the present invention or an inhibitor of serotonin receptor activity as an active ingredient can be prepared from a pharmaceutical composition. The composition of the present invention comprises (a) a pharmaceutically effective amount of the above-described serotonin receptor expression inhibitor or serotonin receptor activity inhibitor of the present invention; And (b) a pharmaceutically acceptable carrier. As used herein, the term " pharmaceutically effective amount " means an amount sufficient to achieve efficacy or activity of an inhibitor of serotonin receptor expression or an inhibitor of serotonin receptor uptake.

When the composition of the present invention is manufactured from a pharmaceutical composition, the pharmaceutical composition of the present invention includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally.

The appropriate dosage of the pharmaceutical composition of the present invention may vary depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate, . Typical dosages of the pharmaceutical compositions of this invention are in the range of 0.001-100 mg / kg on an adult basis.

The pharmaceutical composition of the present invention may be formulated into a unit dose form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions, syrups or emulsions in oils or aqueous media, or in the form of excipients, powders, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

According to another aspect of the present invention, the present invention provides a method of screening a substance for improving, preventing or treating arthritis comprising the steps of:

(a) contacting a test substance to a cell comprising a serotonin receptor gene or a serotonin receptor; And

(b) measuring the expression level of the serotonin receptor gene, the amount of the serotonin receptor or the activity of the serotonin receptor, the amount of expression of the serotonin receptor gene, the amount of the serotonin receptor or the serotonin receptor activity as compared to the control, the test substance is judged to be a substance for improving, preventing or treating arthritis.

In the method for screening substances for improving, preventing or treating arthritis of the present invention, an inhibitor for inhibiting the activity of serotonin receptor can be carried out by inhibiting the activity of serotonin receptor or screening for a substance binding to serotonin receptor. In this case, as the serotonin receptor, any type such as a serotonin receptor in a separated form or a serotonin receptor contained in a cell can be used.

The screening method of the present invention can be carried out in various ways, and can be carried out in a high throughput manner according to various binding assays known in the art.

In the screening method of the present invention, the test substance or serotonin receptor may be labeled with a detectable label. For example, the detectable label may be a chemical label (e.g., biotin), an enzyme label (e.g., horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase, (Such as C14, I125, P32 and S35), fluorescent labels (e.g., coumarin, fluorescein, FITC (fluoresein Isothiocyanate), rhodamine 6G, rhodamine Rhodamine B, TAMRA (6-carboxytetramethyl-rhodamine), Cy-3, Cy-5, Texas Red, Alexa Fluor, DAPI (4,6-diamidino-2-phenylindole), HEX, TET, Dabsyl and FAM , A luminescent label, a chemiluminescent label, a fluorescence resonance energy transfer (FRET) label or a metal label (e.g., gold and silver).

Whether a serotonin receptor or a test substance is used with a detectable label is used to determine whether the bond between the serotonin receptor and the test substance has been detected by analyzing the signal from the label. For example, when alkaline phosphatase is used as a label, it is possible to use bromochloroindoleyl phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1-phosphate ) And enhanced chemifluorescence (ECF). When horseradish peroxidase is used as a label, it is preferable to use chlorinaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorpine benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazone), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD), and naphthol / pyronin.

Alternatively, the binding of the test substance to serotonin receptors may be assayed without labeling the interactants.

For example, a microphysiometer can be used to analyze whether a test substance binds to a serotonin receptor. The microphysiometer is an analytical tool that uses a light-addressable potentiometric sensor (LAPS) to measure the rate at which a cell acidifies its environment. Changes in the rate of acidification can be used as an indicator of the binding between the test substance and the serotonin receptor (McConnell et al., Science 257: 19061912 (1992)).

The ability of the test substances to bind to serotonin receptors can be analyzed using real-time bimolecular interaction analysis (Sjolander & Urbaniczky, Anal. Chem. 63: 23382345 (1991), and Szabo et al., Curr Opin. Struct. Biol. 5: 699705 (1995)). BIA is a technique for analyzing specific interactions in real time, and can be performed without labeling of interactants (e.g., BIAcore ™). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time reactions between molecules.

The screening method of the present invention can be carried out according to a two-hybrid analysis or a three-hybrid analysis method (US Pat. No. 5,283,317; Zervos et al., Cell 72, 223232, 1993; Madura et al. Bartel et al., BioTechniques 14, 920924, 1993; Iwabuchi et al., Oncogene 8, 16931696, 1993; and WO 94/10300). In this case, the serotonin receptor can be used as a bait protein. According to this method, substances binding to serotonin receptors, particularly proteins, can be screened. To-hybrid system is based on the modular nature of the transcription factor consisting of segmentable DNA-binding and activation domains. Briefly, this analysis method uses two DNA constructs. For example, in one construct, a serotonin receptor-encoding polynucleotide is fused to a DNA binding domain-coding polynucleotide of a known transcription factor (e.g., GAL-4). In another construct, a DNA sequence encoding a protein of interest ("prey" or "sample") is fused to a polynucleotide encoding the activation domain of the known transcription factor. If bait and prey interact to form a complex in vivo, the DNA-binding and activation domains of the transcription factor become adjacent, which triggers transcription of the reporter gene (e.g., LacZ). The expression of the reporter gene can be detected. This indicates that the protein to be analyzed can bind to the serotonin receptor. Consequently, the screening method of the present invention as a substance for improving, preventing or treating arthritis is detailed in each step Here's what it says:

Step (a): contacting the test substance with a cell comprising a serotonin receptor gene or a serotonin receptor

According to the screening method of the present invention, first, the test substance to be analyzed is brought into contact with a cell containing a serotonin receptor gene or a serotonin receptor.

The term " test substance " used in reference to the screening method of the present invention refers to an unknown substance used in screening in order to examine the expression amount of serotonin receptor gene, the amount of serotonin receptor or the activity of serotonin receptor it means.

Such test substances include, but are not limited to, chemicals, peptides, nucleotides, antisense-RNA, small interference RNA (siRNA) and natural product extracts.

The test substance to be analyzed by the screening method of the present invention may be a single compound or a mixture of compounds (e.g., a natural extract or a cell or tissue culture). The test substance can be obtained from a library of synthetic or natural compounds. Methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are commercially available from Maybridge Chemical Co., Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich (USA) ) And MycoSearch (USA).

The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, " 1-bead 1-compound " library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

Step (b): measuring the expression amount of the serotonin receptor gene, the amount of the serotonin receptor or the activity of the serotonin receptor

After the step (a), the amount of expression of the serotonin receptor gene, the amount of the serotonin receptor or the activity of the serotonin receptor is measured, and the expression amount of the serotonin receptor gene, the amount of the serotonin receptor or the serotonin receptor is decreased, When measured as being down-regulated, the test substance is judged to be a substance for improving, preventing or treating arthritis.

The measurement of the expression level of the serotonin receptor gene can be carried out by various methods known in the art. For example, RT-PCR (Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Northern blotting (Peter B. Kaufma et al., Molecular and Cellular Methods in Biology and Medicine (Sambrook et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) or in situ hybridization (Sambrook et al. , Molecular Cloning, A Laboratory Manual, 3rd ed., Cold Spring Harbor Press (2001)).

When carrying out according to the RT-PCR protocol, first, total RNA is isolated from the cells treated with the sample, and first strand cDNA is prepared using oligo dT primer and reverse transcriptase. Next, PCR is performed using the first strand cDNA as a template and a serotonin receptor gene-specific primer set. Serotonin receptor gene-specific primer sets are exemplified in Sequence Listing Nos. 1 to 28. Sequence Listing The first and second sequences are primer sets specific for serotonin receptor 1a and the third and fourth sequences in the Sequence Listing are primer sets specific for serotonin receptor 1b and Sequence Listing 5 and Sequence 6 Sequence Listing Nos. 7 and 8 are primer sets specific for serotonin receptor 1d, SEQ ID Nos. 9 and 10 are primer sets specific for serotonin receptor 2a, SEQ ID NO: 11 and SEQ ID NO: 12 are primer sets specific for serotonin receptor 2b, SEQ ID NO: 13 and SEQ ID NO: 14 are primer sets specific for serotonin receptor 2c, SEQ ID NO: 15 and SEQ ID NO: Sequence Listing Nos. 17 and 18 are primer set specific for serotonin receptor 3b, SEQ ID NO: 19 and SEQ ID NO: 20 are primer sets specific for serotonin receptor 4, SEQ ID NO: 21 and SEQ ID NO: 22 are primer sets specific for serotonin receptor 5a, SEQ ID NO: 23 and SEQ ID NO: Sequence Listing is a primer set specific for serotonin receptor 5b, Sequence Listing Nos. 25 and 26 are primer sets specific for serotonin receptor 6, Sequence Listing 27 and 28 sequences are primer set specific for serotonin receptor 7 to be.

Then, the PCR amplification product is electrophoresed, and the band formed is analyzed to measure changes in expression amount of the serotonin receptor gene.

Methods for measuring the amount of serotonin receptor can be performed according to various assay methods. For example, an antibody that specifically binds to a serotonin receptor can be used to measure the amount of a serotonin receptor in a variety of immunoassay formats.

Such immunoassay can be carried out according to various quantitative immunoassay protocols developed conventionally. Such immunoassay formats include, but are not limited to, radioimmunoassays, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hardwood analysis, sandwich assay, immunofluorescent staining and immunoaffinity purification But is not limited thereto. Methods of immunoassay or immunostaining are described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J.M. ed., Humana Press, NJ, 1984; And Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference. For example, when the method of the present invention is carried out according to a radioactive immunoassay, antibodies labeled with radioactive isotopes (e.g., C14, I125, P32 and S35) may be used to detect serotonin receptors.

When the method of the present invention is carried out by an ELISA method, a specific embodiment of the present invention comprises the steps of (i) coating the surface of a solid substrate with an unknown cell sample lysate to be analyzed; (Ii) reacting said cell lysate with a serotonin receptor-specific antibody as a primary antibody; (Iii) reacting the result of step (ii) with an enzyme-conjugated secondary antibody; And (iv) measuring the activity of the enzyme.

Suitable as said solid substrate are hydrocarbon polymers (e.g., polystyrene and polypropylene), glass, metal or gel, and most preferably microtiter plates.

The enzyme bound to the secondary antibody may include an enzyme catalyzing a chromogenic reaction, a fluorescence reaction, a luminescent reaction, or an infrared reaction, but is not limited thereto. For example, an alkaline phosphatase,? -Galactosidase, Radish peroxidase, luciferase, and cytochrome P450. When alkaline phosphatase is used as an enzyme that binds to the secondary antibody, it is preferable to use, as a substrate, bromochloroindole phosphate (BCIP), nitroblue tetrazolium (NBT), naphthol-AS-B1 chromophore and ECF (enhanced chemifluorescence) are used. When horseradish peroxidase is used, chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N (10-acetyl-3,7-dihydroxyphenox), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine ), ABTS (2,2'-Azine-di [3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol / pyronin, glucose oxidase and nitroblue tetrazolium and m-PMS methosulfate) can be used. All.

When the method of the present invention is carried out in the Capture-ELISA mode, a specific embodiment of the present invention comprises: (i) coating the surface of a solid substrate with an antibody to a serotonin receptor as a capturing antibody; (Ii) reacting the capture antibody with a cell sample; (Iii) reacting the result of step (ii) with a detecting antibody which is labeled with a signal generating label and specifically reacts with a serotonin receptor; And (iv) measuring a signal originating from said label.

The detection antibody has a label that generates a detectable signal. The label may be a chemical (e.g., biotin), an enzyme (alkaline phosphatase,? -Galactosidase, horseradish peroxidase and cytochrome P450), a radioactive material (such as C14, I125, P32 and S35 But are not limited to, fluorescent materials (e.g., fluorescein), luminescent materials, chemiluminescent materials and fluorescence resonance energy transfer (FRET). Various labels and labeling methods are described in Ed Harlow and David Lane , ≪ / RTI > Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999.

In the ELISA method and the capture-ELISA method, measurement of the activity of the final enzyme or measurement of the signal can be performed according to various methods known in the art. Detection of these signals enables quantitative analysis of serotonin receptors. If biotin is used as a label, it can be easily detected by streptavidin. When luciferase is used, luciferin can easily detect a signal.

If the signal to the serotonin receptor in the sample is weaker than the untreated control sample, it is judged to be a candidate for improvement, prevention or treatment of arthritis.

The method for improving, preventing or treating arthritis of the present invention is similar to that of the pharmaceutical composition for improving, preventing or treating arthritis described above in order to avoid the excessive complexity of the present invention.

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a pharmaceutical composition for improving, preventing or treating arthritis and a method for screening a substance for improving, preventing or treating arthritis.

(b) The pharmaceutical composition for improving, preventing or treating arthritis of the present invention effectively inhibits the production of IL-1β-induced inflammation-inducing cytokines.

FIGS. 1A to 1F show the expression of Tph1 in Hif-2α-overexpressing synovial membrane. FIG. 1A shows the results of intra-articular administration of 1 × 10 ⁹ PFU Ad-Mock, Ad-Hif1α or Ad-Hif2α to synovial fluid of C57BL / (Intra-articular injection) for 3 weeks and then H & E staining. Figure 1B shows the degree of damage of the joints through Safranin-O staining. FIG. 1c shows the expression of Hif2a and the expression of Tph1 by immunochemical staining using a synovial membrane (RA) of patients with degenerative arthritis (OA) and rheumatoid arthritis. FIG. 1d shows the expression of Hif2a and Tph1 by immunochemical staining using NI (no induced) and CIA (collagen induced arthritis) synovium of a collagen-induced mouse model. Figure 1e shows the expression of Hif2a, Tph1 and DAPI in synovial cells using immunochemical staining. FIG. 1F shows the expression of Hif2α and Tph1 by immunochemical staining after 3 weeks of intra-articular administration of 1 × 10 ⁹ PFU of Ad-Hif2α and Ad-Mock to DBA1 / J mouse synovial fluid.
2A to 2E show Tph1 expression of Hib2 alpha over-expressing synoviocyte (FLS) cells. FIG. 2A shows the results of RT-PCR, Western blot and qPCR of Hif2a, Tph1 and Gapdh expression after Ad-Hif2a treatment of synovial fibroblasts after 24 h of cell separation in synovial membrane of C57BL / 6 mice . FIG. 2B shows the results of RT-PCR, Western blot and qPCR of Hif2α, Tph1 and Gapdh expression after IL-1β was allowed to react with synovial fibroblasts for 24 hours. FIG. 2c shows the results of immunofluorescence staining for Hif-2α after Ad-Hif2α was treated with synovial fibroblasts for 24 hours. FIG. 2d shows the result of immunofluorescence staining of Tph1 after 24 hours of treatment with Ad-Hif2a in synovial fibroblasts. FIG. 2E shows the results of immunofluorescence staining of Hif-2α and Tph1 together with Ad-Hif2α after 24 hours of treatment with synovial fibroblasts. FIGS. 3C to 3E show the result of confirming the expression of Hif-2α and Tph1 by immunochemical staining after reacting Ad-Hif2α 800 MOI for 24 hours with synovial fibroblast cells.
Figures 3a to 3g show Tph1 expression in Tph1 overexpressed synovial fibroblast cells. FIG. 3A shows the results of RT-PCR and Western blot analysis of expression of Hif2a, Tph1, Cox2, iNos, IL-6 and Gapdh after Ad-Tph1 was reacted with synovial fibroblast cells for 24 hours. FIG. 3B shows the results of confirming expression of Hif2α, Tph1, Cox2, iNos and Gapdh using RT-PCR after 24 hours of reaction with IL-1β. FIGS. 3C to 3D show the results of RT-PCR and qPCR of expression of Hif2α, Tph1, IL-6, Cox2 and iNos after Tph1 siRNA was reacted with synoviocyte for 24 hours. Figure 3E shows the results of RT-PCR after serotonin was reacted for 24 hours. FIGS. 3f to 3g show the results of RT-PCR of iNOS, IL-6 and Gapdh after IL-1β and serotonin were reacted together for 24 hours, and Mmp3, Mmp9, Mmp12, Mmp13, Adamts4, Adamts5, Cox2, 6, Cox2 by qPCR, and Cox2 and IL-6 by Western blot.
Figures 4A-4D show the expression of serotonin in chondrocytes. FIG. 4A shows that chondrocytes were isolated from ICR-born 5-day old mice. Expression of Col2a1, Mmp3, Mmp9, Mmp12, Mmp13, Adamts4, Adamts5, Cox2, iNos, IL-6 and Gapdh is shown by RT-PCR after serotonin is reacted to isolated chondrocytes for 24 hours. 4b to 4c show the expression of Col2a1, Mmp3, Mmp9, Mmp12, Mmp13, Adamts4, Adamts5, Cox2, iNos, IL-6 and Gapdh after RT- Expression of IL-6, iNos and Cox2 was confirmed by qPCR. FIG. 4d shows the results of confirming the expression of Cox2 and Erk using qPCR and PGE2 analysis after 24 hours of treatment with serotonin and IL-1β. 5A to 5E show the results of confirming the expression of the receptor in synovial fibroblast cells.
Fig. 5A shows the results of confirming the expression of serotonin receptor after IL-1? Treatment for 24 hours. 5b to 5c show the expression of serotonin receptors Htr1b, Htr2a, Htr6 and Gapdh after treatment with IL-1? For 24 hours and the expression of Htr1b, Htr2a, Htr6 and Gapdh after treatment with Ad- -PCR and < RTI ID = 0.0 > qPCR. ≪ / RTI > Figure 5d shows the results of experiments using inhibitors of the receptor. The results of RT-PCR for the expression of Cox2, iNos, IL-6 and Gapdh after treatment with IL-1β, serotonin and Htr1b inhibitor SB216641 and Htr2a inhibitor M100907 for 24 hours are shown.
Figures 6a to 6e show receptor expression in chondrocytes. 6A shows the results of confirming the expression of serotonin receptor after IL-1 beta treatment for 24 hours. FIGS. 6B to 6C show the expression of Htr1b and Htr2a in cartilage tissue of a rheumatoid arthritis patient of a human, and the results of confirming the expression of Htr1b and Htr2a in cartilage of an animal model of rheumatoid arthritis. FIG. 6D shows the results of confirming the expression of serotonin receptors Htr1b, Htr2a and Gapdh by RT-PCR and qPCR after treatment with IL-1β for 24 hours. FIG. 6E shows the results of experiments in which each receptor is suppressed. The results of RT-PCR and Western blotting of Cox2, iNos, Htr1b, Htr2a, Mmp13 and Gapdh expression after IL-1β, serotonin and Htr1B siRNA or Htr2A siRNA treatment for 24 hours are shown.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Isolation and culture of fibroblast-like synoviocyte (FLS)

The synovial membrane of C57BL / 6 mice (8 weeks old, male) was cut into small pieces and 2 ㎎ / ml collagenase type Ⅰ was cultured in DMEM (Dulbecco's Modified Eagle Medium) for 4 hours. After the cells were collected, they were cultured in DMEM using a 5% CO ₂ incubator and a humidity 5% incubator. Experiments were performed using 4-8 series synovial cells.

Collagen-induced arthritis animal model

Small intestine type II collagen (2 mg / ml) was dissolved in 0.05 M acetic acid and emulsion (1: 1 ratio) was emulsified with CFA (Complete Freund's Adjuvant), and then 0.1 ml (subcutaneously injected) DBA1 / J mice were administered. Three weeks after the first administration, the second administration was carried out in the same manner. The administration was performed after the emulsion (1: 1 ratio) with IFA (Incomplete Freund's Adjuvant) unlike the first administration. After the second administration, the onset of inflammation of the joints of the mice and the degree of edema were observed every 2 days for 6 weeks. The mice were sacrificed and the joints were collected and fixed with 10% NBF (Neutral Buffered Formalin), and then demineralized and embedded in paraffin.

Virus-induced arthritis animal model

1 × 10 ⁹ PFU (Plaque Forming Unit) / 10 μl of adenovirus Ad-mock (control), Ad-Hif2α or Ad-Tph1 was administered to the synovial fluid. After injecting once a week, the mice were observed for three weeks at the beginning of inflammation of joints and swelling degree every 2 days. The mice were sacrificed and the joints were collected, fixed with 10% NBF, and then passed through the demineralization process and embedded with paraffin.

Immunohistochemical analysis

Fixed knee specimens from human or mouse were embedded in 10% NBF and cut into 4 ㎛ size. After deparaffinization and hydration the sections were run. (1: 200; Vector Laboratories, Burlingame, Calif.) For 1 hour at room temperature in a 4 < 0 > C humidity chamber with anti- And cultured at room temperature. Then, ABC (Avidin Botin Complex) solution was treated for 30 minutes, and a chromogen was detected using a DAB (Diaminobenzidine) kit (Vector Laboratories).

The tissue sections were observed under a microscope and pictures of the representative sections were taken.

Western blot analysis

After stimulation with IL-1β, Ad-Hif2α and Ad-Tph1, chondrocytes and synovial fibroblasts were homogenized with a lysis buffer and analyzed using Pierce BCA (Bicinchoninic acid) protein assay (Thermo, USA) Were measured. The same amount of protein was separated using an 8% polyacrylamide-SDS gel, transferred to a nitrocellulose membrane, blocked with 5% skim milk for 1 hour and washed in TBS (PBS containing 0.01% Tween-20) 20 < / RTI > and incubated overnight at < RTI ID = 0.0 > 4 C < / RTI > The primary antibody against ERK (BD), Hif-2? (Santa Cruz Biotechnology) or Tph1 (Thermo) was diluted 1: 1000 with 0.01% Tween-20 in TBS. Membranes were washed and incubated with HRP-conjugated secondary antibody (1: 2000; Cell Signaling Technology) and confirmed with an ECL detection kit (GE Healthcare, Buckinghamshire, U.K.).

Safranin O staining

Fixed knee specimens from mice were embedded in 10% NBF and cut into 5 ㎛ size. After deparaffinization and hydration the sections were run. Nuclei were first stained with Harris Hematoxylin. After hydration, the surrounding tissues were stained with 0.01% fast green, washed with 0.1% acetic acid, and stained with 0.1% safranin O to confirm the joint area.

RT-PCR

The cells were cultured in a 35 mm dish at 3 × 10 ⁵ cells / well, treated with each concentration, and reacted for 24 hours. Cells were subjected to RNA extraction using a trizol reagent, and then 1 μg of RNA was amplified using Improm II kit (promega), and cDNA was synthesized with dT primer. RT-PCR was performed using the synthesized cDNA. RT-PCR reaction buffer (AmpONE, geneall) was treated with 10 pMol of primer. The primers used (5 'to 3' direction) are as follows:

GAPDH (Forward-TCACTGCCACCCAGAAGA, Reverse-TGTAGGCCATGAGGTCCA), Tph1 (Forward-ACAAGGAGAACAAAGAGAACAAAGACC, Reverse-ACAGTCTCCATAACGTCTTCCTTC), Hif-2α (Forward-AGAAGAGCAAAGACGTGTCCACCGAG, Reverse-GTAGAACTCATAGGCAGAGCGTCCAAG), Col2a1 (Forward-CACACTGGTAAGTGGGGCAAGACCG, Reverse-GGATTGTGTTGTTTCAGGGTTCGGG), Mmp3 (Forward- CTGTGTGTGGTTGTGTGCTCATCCTAC, Reverse-GGCAAATCCGGTGTATAATTCACAATC), Mmp9 (Forward-TGCACTGGGCTTAGATCATTCC, Reverse-CCGTCCTTGAAGAAATGCAGAG), Mmp12 (Forward-CCCAGAGGTCAAGATGGATG, Reverse-GGCTGGATAGAGAA), Mmp13 (Forward-TGATGGACCTTCTGGTCTTCTGGC, Reverse-CATCCACATGGTTGGGAAGTTCTG), Adamts4 (Forward-ACTTCCTGGACAATGGTTATGGGC, Reverse-ATGAAGTCCTTGAGCTGGTCCACG) , Adamts5 (Forward-GCCATTGTAATAACCCTGCACC, Reverse-TCAGTCCCATCCGTAACCTTTG), Cox2 (Forward-CCAAACCAGCAGACTCATACTCATAG, Reverse-CATCTCTCTGCTCTGGTCAATGGAG), iNOS (Forward-TCACTGGGACAGCACAGAAT, Reverse-TGTGTCTGCAGATGTGCTGA), IL-6 (Forward-AGAGATACAAAGAAATGGATGC, Reverse-CTAGGTTTGCCGAGTAGATCTC), Htr1A [Forward -CTCACTTGGCTCATTGGCTTTCTC (SEQ ID NO: Forward-ATGTCCCCTCCAAACCAGTCCCTAG (Sequence Listing)], Htr1B [Forward-CCTCTCACCAACCTCTCCCACAAC (Sequence Listing 3rd sequence), Reverse-AGCACTGCAACAGGTGATATCCGAC (Sequence Listing 4 sequence)], Htr1D [Forward-ATGTCCCCTCCAAACCAGTCCCTAG (Sequence Listing)], Reverse-AGAAAGCGCCGAAAGTGGAGTAGATG 5 sequence), Htr1F [Forward-GAGGAACTGTTAAACCGAATGCCATC (Sequence Listing 7 sequence), Reverse-GGGCATCACCAGGACAGCTACAAG (Sequence Listing 8 sequence)], Htr2A [Forward-CATTGCGGGAAACATACTGGTCATC (Sequence Listing)], Reverse-CACCACGAGCGAGATTCTGAGAGC 9 sequence), Htr2B [Forward-CATTGCGGGAAACATACTGGTCATC (SEQ ID NO: 11 sequence), Reverse-TGGACACGGGCATGACAAGGAAAC (SEQ ID NO: 12 sequence)], Htr2C [Forward-TGGCAGTAAGCATGGAGAGAAAC (Sequence Listing 10)], Reverse-TGGACACGGGCATGACAAGGAAAC 13 sequence), Htr3A [Forward-GATACCACCCAGCCTGCTCTACTAAG (Sequence Listing 15 sequence), Reverse-CATCAATGGAGACAGTAGTAGGCTTC (Sequence Listing 16 sequence)], Htr3B [Forward-ATGATTCTTCTGTGGTCCTGC (Sequence Listing 14)], Reverse-GGGCACAAATATCTAGGTAAAGGC CTC (Sequence Listing 17 Sequence), Reverse-TAAAGAGCTGCCTGGTGAGACGGTG (Sequence Listing 18 Sequence), Htr4 [Forward-AAAGGAAATTCAGCCACAACTCTAAC (Sequence Listing 19 Sequence), Reverse-CTCCTTAGCAGTGACATAGATCG (Sequence Listing 20 Sequence) Forward-GTCGCCGAGCAACAGTAACCTTC (SEQ ID NO: 23 sequence), Reverse-AAGCACAAACACGCCAATCAAGATC (SEQ ID NO: 24 sequence)], Htr6 [Forward-GTCGCCGAGCAACAGTAACCTTC (SEQ ID NO: 23 sequence)], Reverse-TGGAACCTAACCGCAGCTTGGACAC (SEQ ID NO: 21 sequence), Reverse-TGTGTGGTACTCGGTGGAAGGTGC GGGATACTGTAATAGCACCATGAACC (Sequence Listing 25 sequence), Reverse-ACGAAGAAGTTGACCACAGTAGGG (Sequence Listing 26 sequence), Htr7 [Forward-CTGGTGGTGATCTCGGTGTGCTTTG (Sequence Listing 27 sequence), Reverse-TGCAGAAGAAGTGGCCGAAGATCC (Sequence Listing 28 sequence)].

Real-time PCR

The cells were cultured in a 35 mm dish at 3 × 10 ⁵ cells / well, treated with each concentration, and reacted for 24 hours. Cells were subjected to RNA extraction using a trizol reagent, and then 1 μg of RNA was amplified using Improm II kit (promega), and cDNA was synthesized with dT primer. Real-time PCR was performed using the SYBR Green PCR Master Mix (ABI) and a StepOnePlus Real-time PCR instrument was used. The primers used (5 'to 3' direction) are as follows:

GAPDH (Forward-TCACTGCCACCCAGAAGA, Reverse-TGTAGGCCATGAGGTCCA), Tph1 (Forward-ACAAGGAGAACAAAGAGAACAAAGACC, Reverse-ACAGTCTCCATAACGTCTTCCTTC), Hif-2α (Forward-AGAAGAGCAAAGACGTGTCCACCGAG, Reverse-GTAGAACTCATAGGCAGAGCGTCCAAG), Cox2 (Forward-CCAAACCAGCAGACTCATACTCATAG, Reverse-CATCTCTCTGCTCTGGTCAATGGAG), iNOS (Forward- TCACTGGGACAGCACAGAAT, Reverse-TGTGTCTGCAGATGTGCTGA), IL-6 (Forward-AGAGATACAAAGAAATGGATGC, Reverse-CTAGGTTTGCCGAGTAGATCTC), Htr1B (Forward-CCTCTCACCAACCTCTCCCACAAC, Reverse-AGCACTGCAACAGGTGATATCCGAC), Htr2A (Forward-CATTGCGGGAAACATACTGGTCATC, Reverse-TGGACACGGGCATGACAAGGAAAC), Htr6 (Forward-GGGATACTGTAATAGCACCATGAACC, Reverse- ACGAAGAAGTTGACCACAGTAGGG).

Transfection

Cells were cultured in a 35 mm dish at 3 × 10 ⁵ cells / well, and then experiments were conducted using lipofectamine 2000 (Invitrogen). Lipofectamine was added to the DMEM medium and reacted for 10 minutes. At this time, the reaction was induced by mixing 1: 1 siRNA into DMEM medium. Lipofectamine mixture and siRNA mixture were mixed and reacted for 15 minutes. After treatment with the dish, the cells were cultured for 3 hours. After 3 hours, the medium was removed, and the medium was replaced with DMEM supplemented with 1% penicillin / streptomycin, followed by culturing for 24 hours. The siRNAs used are as follows:

Tph1 (Thermo, SMARTpool), Hif2? (Dharmacon), Htr1B (Dharmacon) and Htr2A (Dharmacon).

Inhibitor treatment

Cells were cultured in a 35 mm dish at 3 × 10 ⁵ cells / well, and cultured for 30 minutes in DMEM medium supplemented with 1% penicillin / streptomycin at a concentration of SB216641 and M100907, respectively. Then, IL-β and serotonin are treated at the same time and cultured for 24 hours.

Experiment result

Expression of Tph1 in overexpressed synovial membrane of Hif-2α

Intraarticular injection of adenovirus into C57BL / 6 mouse synovial fluid was performed. Ad-Mock (control), Ad-Hif-1α or Ad-Hif-2alpha virus was administered at 1 × 10 ⁹ PFU / 10 μl of IA. A total of three doses were administered once a week. Thereafter, the cells were fixed with 10% NBF, demineralized with 0.5 M EDTA (Ethylenediaminetetraacetic Acid), and embedded in paraffin. After cutting the tissue to 5 쨉 m, the distribution of the cells was confirmed by H & E staining (Fig. 1A). We could not confirm that the distribution of cells was increased by confirming the structure of Ad-Mock. Ad-Hif1α also obtained the same result. However, it was observed that the number of synovial cells was increased in the tissue of Ad-Hif2a (Fig. 1A). Safranin O staining was performed to confirm whether the joints were damaged (FIG. 1B). The cartilage damage was not observed in the Ad-Mock and Ad-Hif1α tissues with the same H & E results as the cells. However, the tissue of Ad-Hif2α showed that the cartilage was damaged and the cartilage layer became thinner, and the Mankin score (Mankin score for osteoarthritis, J Orthop Res. 1992 Jan; 10 (1): 58-61), it was confirmed that the degree of cartilage damage in Ad-Hif2α was significantly increased compared to other tissues (FIG. The expression of Hif-2α was confirmed by immunochemical staining of synovial tissues in patients with degenerative arthritis and synovial tissues (donated tissues from Wonkwang University Hospital under the consent of patients) in patients with rheumatoid arthritis. The results showed that the fibroblasts were present in the outermost part of the synovial tissues and the expression was increased at the site (Fig. 1C). The joint tissue part of the collagen - induced mouse model of rheumatoid arthritis animal model was confirmed by immunochemical staining. Hif-2? Was expressed in a large amount and Tph1 was expressed in a similar region where Hif-2? Was expressed (Fig. 1d). In order to confirm the expression sites of Hif-2α and Tph1 in synovial tissues, double staining was performed and the same results were obtained (FIG. 1e). Expression of Hph-2 alpha and Tph1 in the synovial tissues administered with IA (intra-articular) using adenovirus was confirmed by immunochemical method and Tph1 was expressed (Fig. 1 (f)). In conclusion, the results of Fig. 1 confirm that the expression of Tph1 is increased in a region similar to that of Hif-2α.

Expression of Tph1 in Hif-2α overexpressed synovial fibroblasts

The synovial membrane of C57BL / 6 mice (8 weeks old, multirescience) was cut into small pieces and 2 ㎎ / ㎖ type Ⅰ collagenase was cultured in DMEM for 4 hours. Then, the cells were collected and cultured in DMEM containing 10% FBS and 1% penicillin / streptomycin using 5% humidity and 5% CO ₂ incubator. Experiments were performed using 4-8 series synovial cells. Hif2α and Tph1 were expressed in the synovial fibroblasts after 24 hours of treatment with Ad-Hif2α, and the expression of Hif2α and Tph1 was increased in a concentration-dependent manner by RT-PCR, Western blot and qPCR (FIG. 2a) . As a result of confirming the expression of Hif2a and Tph1 after 24 hours of treatment with IL-1β, the expression of Hif2α and Tph1 was increased in a concentration-dependent manner by RT-PCR, Western blot and qPCR (FIG. Ad-Hif2a was reacted for 24 hours using immunochemical staining, and then the expression of Hif-2 alpha and Tph1 was confirmed (FIGS. 2c to 2f). Hif2a is a substance that exists in large amounts in the chromatin, and Tph1 is a substance that exists in the nucleus. In the staining photograph, it was confirmed that the expression of Hph2a was increased in the nucleus and that of Tph1 in the nucleus was increased. As a result of confirmation by using double staining method, the same result was obtained. Based on the results, it was found that the expression of Tph1 was increased as the expression of Hif2α was increased.

Tph1 expression in synovial fibroblast cells overexpressing Tph1

Ad-Tph1 was treated with synovial fibroblasts for 24 hours, and the expression of Tph1, IL-6, Cox2 and iNos was confirmed (Fig. 3a). It was confirmed that expression of Tph1 was increased in a concentration-dependent manner of Ad-Tph1. IL-6, Cox2 and iNos were also increased in a concentration-dependent manner of Ad-Tph1. After treatment with IL-1? For 24 hours, the expression of Hif2 ?, Tph1, IL-6, Cox2 and iNos was confirmed (Fig. It was confirmed that HIF2? Expression was increased in a concentration-dependent manner of IL-1 ?. Expression of Hif2a, Tph1, IL-6, Cox2 and iNos was confirmed in an environment in which Tph1 was inhibited (Fig. 3c and 3d). After treatment of Tph1 siRNA with IL-1β for 24 hours, the expression of Tph1, IL6, Ptgs2 and Nos2 was decreased in a concentration-dependent manner (FIG. 3c, d). However, the expression of Hif2α was not changed. As a result, Tph1 is regulated by Hif2α. The final product to which Tph1 is metabolized is serotonin (5-HT). Synovial fibroblast cells were treated with serotonin only for 24 hours and then their expression was confirmed (FIG. 3E). As a result, the expression of Mmp3, Mmp9, Mmp12, Mmp13, Adamts4, Cox2, iNos and IL-6 was not confirmed. Serotonin was treated with IL-1β for 24 hours and then its expression was confirmed (FIG. 3f). Expression of Mmp3, Mmp9, Mmp12, Mmp13 and Adamts4 could not be confirmed by serotonin, but Cox2, iNos and IL-6 increased expression by serotonin concentration. As a result of this study, it was found that substances that are expected to cause an immune response are increased by serotonin.

Serotonin expression in chondrocytes

Only the joints were isolated from ICR 5-day-old mice. Treated with 1% type II collagenase and allowed to react for 3 hours. After separating cartilage, the cells were treated with 1% type II collagenase and reacted for 2 hours in DMEM containing 10% FBS and 1% penicillin / streptomycin. The cells were then seeded to obtain chondrocytes. The chondrocytes were treated with serotonin only for 24 hours to confirm their expression (Fig. 4A). The expression of Col2a1, Mmp3, Mmp9, Mmp12, Mmp13, Adamts4, Adamts5, Cox2, iNOs and IL-6 was not detected. IL-1? And serotonin were reacted together for 24 hours to confirm expression (Fig. 4B). MMP3, Mmp9, Mmp12, Mmp13, Adamts4 and Adamts5 did not change expression by serotonin. However, Cox2, iNos and IL-6 were found to be increased by serotonin (Figs. 4c and 4d). These results suggest that the serotonin - induced increase in the amount of the substances known to cause an immune response in chondrocytes as well as synovial cells.

Expression of receptors in synovial fibroblasts

There are 14 known receptors for serotonin. The expression of HTR1B, Htr2A and Htr6 was confirmed to increase in the synovial fibroblast cells after treatment with IL-1β for 24 hours (FIG. 5A). The expression of Htr1B, Htr2A and Htr6 was increased in a concentration-dependent manner after IL-1β treatment for 24 hours (FIGS. 5B to 5C). The results suggest that receptors affecting synovial fibroblasts among 14 serotonin receptors are Htr1B, Htr2A and Htr6. The Htr1B inhibitor, SB216641 or Htr2A inhibitor M100907, was treated with IL-1β and serotonin for 24 hours and then the expression of Cox2, iNos and IL-6 was confirmed (FIG. 5d). As a result, the inhibitor of Htr1B could not be confirmed, but the inhibitor of Htr2A showed a decrease in expression in a concentration dependent manner. These results indicate that the expression of Cox2, iNos, and IL-6, which increase the immune response when Htr2A is inhibited, is decreased.

Expression of receptors in cartilage cells

The expression of Htr1B and Htr2A was confirmed to be increased in the chondrocytes after 24 hours of treatment with IL-1β (FIG. 6A). Expression of Htr1B and Htr2A was confirmed in the cartilage of rheumatoid arthritis patients (Fig. 6B). Htr1B and Htr2A were increased. As shown in the animal model of rheumatoid arthritis, it was confirmed that the expression of Htr1b and Htr2a was increased (FIG. 6C). The expression of Htr1B and Htr2A was increased in a concentration-dependent manner after confirming the expression of each receptor after treating IL-1β with chondrocytes for 24 hours (FIG. 6d). Expression was confirmed in an environment in which the receptor was inhibited using Htr1B siRNA (Fig. 6E). After treatment with Htr1B siRNA, IL-1 beta and serotonin for 24 hours, the expression of Htr1B, Cox2, iNos and Mmp13 was decreased, and Htr2A expression was not changed. Expression was confirmed in an environment in which the receptor was inhibited using Htr2A siRNA (Fig. 6 (f)). After treatment with Htr2a siRNA, IL-1 beta and serotonin for 24 hours, the expression of Htr2A, Cox2, iNos and Mmp13 was decreased, and Htr1B expression was not changed. In conclusion, inhibition of Htr1B and Htr2A inhibited the expression of Cox2, iNos and IL-6, which induce an immune response in chondrocytes.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the same is by way of illustration and example only and is not to be construed as limiting the scope of the present invention. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Pharmaceutical Composition for Preventing or Treating Arthritis          Comprising Inhibitors of Serotonin Receptor Expression or          Serotonin Receptor Activity As Active Ingredient <130> PN150320 <160> 28 <170> Kopatentin 2.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr1A forward primer <400> 1 ctcacttggc tcattggctt tctc 24 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr1A reverse primer <400> 2 agaaagcgcc gaaagtggag tagatg 26 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr1B forward primer <400> 3 cctctcacca acctctccca caac 24 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr1B reverse primer <400> 4 agcactgcaa caggtgatat ccgac 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr1D forward primer <400> 5 atgtcccctc caaaccagtc cctag 25 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr1D reverse primer <400> 6 caccacgagc gagattctga gagc 24 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr1F forward primer <400> 7 gaggaactgt taaaccgaat gccatc 26 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr1F reverse primer <400> 8 gggcatcacc aggacagcta caag 24 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr2A forward primer <400> 9 cattgcggga aacatactgg tcatc 25 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr2A reverse primer <400> 10 tggacacggg catgacaagg aaac 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr2B forward primer <400> 11 cattgcggga aacatactgg tcatc 25 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr2B reverse primer <400> 12 tggacacggg catgacaagg aaac 24 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Htr2C forward primer <400> 13 tggcagtaag catggagaga aac 23 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr2C reverse primer <400> 14 gggcacaaat atctaggtaa aggc 24 <210> 15 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr3A forward primer <400> 15 gataccaccc agcctgctct actaag 26 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr3A reverse primer <400> 16 catcaatgga gacagtagta ggcttc 26 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr3B forward primer <400> 17 atgattcttc tgtggtcctg cctc 24 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr3B reverse primer <400> 18 taaagagctg cctggtgaga cggtg 25 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr4 forward primer <400> 19 aaaggaaatt cagccacaac tctaac 26 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Htr4 reverse primer <400> 20 ctccttagca gtgacataga tcg 23 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr5A forward primer <400> 21 tggaacctaa ccgcagcttg gacac 25 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr5A reverse primer <400> 22 tgtgtggtac tcggtggaag gtgc 24 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Htr5B forward primer <400> 23 gtcgccgagc aacagtaacc ttc 23 <210> 24 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr5B reverse primer <400> 24 aagcacaaac acgccaatca agatc 25 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Htr6 forward primer <400> 25 gggatactgt aatagcacca tgaacc 26 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr6 reverse primer <400> 26 acgaagaagt tgaccacagt aggg 24 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Htr7 forward primer <400> 27 ctggtggtga tctcggtgtg ctttg 25 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Htr7 reverse primer <400> 28 tgcagaagaa gtggccgaag atcc 24

Claims (10)

A pharmaceutical composition for improving, preventing or treating arthritis comprising an inhibitor of serotonin receptor expression or an inhibitor of serotonin receptor activity as an active ingredient.
The method according to claim 1, wherein the serotonin receptor is at least one serotonin receptor selected from the group consisting of Htr1a, Htr1b, Htr1d, Htr1f, Htr2a, Htr2b, Htr2c, Htr3a, Htr3b, Htr4, Htr5a, Htr5b, Htr6 and Htr7 &Lt; / RTI &gt;
2. The pharmaceutical composition according to claim 1, wherein the serotonin receptor is at least one serotonin receptor selected from the group consisting of Htr1B, Htr2A and Htr6.
2. The pharmaceutical composition according to claim 1, wherein the expression inhibitor of the serotonin receptor is an antisense oligonucleotide or an siRNA oligonucleotide.
The method of claim 1, wherein the activity inhibitor of the serotonin receptor is selected from the group consisting of N- [3- [3- (dimethylamino) ethoxy] -4- methoxyphenyl] -2'- Yl) - [1,1'-biphenyl] -4-carboxamide (SB216641) or (R) - (2,3- dimethoxyphenyl) - [1- [2- (4-fluorophenyl) ethyl] -4-piperidyl] methanol (M100907).
The method of claim 1, wherein the arthritis is characterized by rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, degenerative arthritis, gout, or spondylarthritis .
The composition of claim 1, wherein the arthritis is rheumatoid arthritis or juvenile rheumatoid arthritis.
A screening method for improving, preventing or treating arthritis, comprising the steps of:
(a) contacting a test substance to a cell comprising a serotonin receptor gene or a serotonin receptor; And
(b) measuring the expression level of the serotonin receptor gene, the amount of the serotonin receptor or the activity of the serotonin receptor, the amount of expression of the serotonin receptor gene, the amount of the serotonin receptor or the serotonin receptor activity as compared to the control, the test substance is judged to be a substance for improving, preventing or treating arthritis.
The method of claim 1, wherein the arthritis is characterized by rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, degenerative arthritis, gout, or spondylarthritis Lt; / RTI &gt;
2. The method of claim 1, wherein the arthritis is rheumatoid arthritis or juvenile rheumatoid arthritis.

Images