KR20160093328A - Dumbbell-shaped oligonucleotides and method for detecting gene mutation using the same - Google Patents

Abstract

The present invention relates to an oligonucleotide having a dumbbell structure; a method for detecting a gene mutation, for example, single nucleotide polymorphisms (SNPs) of a gene, by a multi-amplification refractory mutation system (mARMS) based on DLP using an oligonucleotide having a dumbbell structure; and a method and a kit for predicting a risk of cancer occurrence of an entity by using the same. According to the present invention, SNPs of a gene related to several sorts of disease are rapidly and accurately detected through simple amplification without a conventional step of additionally treating a restriction enzyme or analyzing a base sequence. Also, through one-time inspection, multiple gene mutations can be simultaneously and accurately detected without an error.

Description

The oligonucleotide of the dumbbell structure and the method for detecting the mutation using the oligonucleotide of the present invention

The present invention relates to an oligonucleotide of a dumbbell structure and a method of detecting a gene mutation using the oligonucleotide. More particularly, the present invention relates to a method for detecting a gene by using a DLP-based multiple amplification refractory mutation system (mARMS) using an oligonucleotide of dumbbell structure A method for detecting a mutation such as single nucleotide polymorphisms (hereinafter abbreviated as "SNPs") of a gene, and a method and a kit for predicting the risk of cancer occurrence in an individual using the same.

The World Health Organization (WHO) International Cancer Institute estimates that by 2030, the number of new cancer patients will skyrocket to 21.3 million, of which 13.3 million will die. This is nearly twice the number of cancer deaths in 2008, when 12.7 million new cancer cases occurred among them, of which 7.6 million died. In 2008, 56% of new cancer patients and 63% of deaths occurred in developing countries. In Korea, three out of 10 Koreans die from cancer. According to a recent survey released by the National Statistical Office, cancer outbreaks are increasing every year, with 65,000 deaths, or 26.7% of the total deaths in 2006, of 246,000.

Since cancer is highly cured or cured when it is diagnosed early, studies on early diagnosis of cancer have been actively conducted in the industry. In 1995 ~ 2007, 7 cancer cases were analyzed to complete 'cancer metastasis' . These cancer metastasis maps are thought to reduce the fear of cancer and help to predict treatment.

Diagnosis of cancer is based on the results of medical history, physical examination, blood test, bone marrow test, histologic examination, and can predict tumor size by X-ray photograph or bone scan (breast or prostate cancer), tomography, magnetic resonance imaging It is possible. In addition, other signs of the tumor are quantitative changes in tumor products or markers that reflect the amount of tumor in the body, and these markers play an important role in the diagnosis of cancer.

Tumor markers are substances that demonstrate the presence of cancer cells. It is useful to examine the substance in blood, tissues, or excrements among substances that cancer cells make or normal cells in the body react with cancer cells. Material. Tumor markers include CEA and AFP, the fetal carcinomas present in normal fetuses, as well as glycoproteins, hormones, enzymes, and substances related to blood clotting.

Tumor characteristics have been discovered since the 1970s, with the development of molecular biology and the oncogenes and tumor suppressor genes being discovered, and the cancer has been identified as a disease caused by multistage gene mutations. In other words, unlike single gene deficiency disease, cancer has been suggested to have a cancerous mechanism that several genes are changed to malignant stage by a step change such as gene mutation, amplification, deficiency and substitution. So far, in the field of tumor genetics, we have examined the expression or mutation of certain 1-2 genes predicted under this molecular multi-level model, but it has not been effective in revealing the multistage model of the tumor or identifying the carcinogenic mechanism.

In the 21st century biotechnology field, the gene expression profile, genome-wide mutation analysis, large-scale protein analysis and bioinformatics techniques have been developed or are being developed to measure the expression of numerous genes at once, And is moving toward functional genomics that reveals the function and interaction of the genes.

Recently, SNP (single nucleotide polymorphism) has been suggested as the most useful marker for distinguishing between individual and racial susceptibility, depending on the genetic susceptibility of individuals. SNPs are the most frequent variants that occur once every 300 to 1000 bases and are notable in that they are highly stable and exhibit a low rate of variance compared to repeated nucleotide sequences as well as inducing most functional changes . Therefore, SNP research is actively carried out all over the world, but since there are differences among different ethnic groups, domestic SNP research is highly competitive internationally, and it is necessary to invest efficiently in systematic discovery and functional research of SNPs for various cancers .

In the conventional SNP screening methods, single strand conformation polymorphism (SSCP), polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and DNA sequencing sequencing, denaturing gradient gel electrophoresis, and the like have been used (Cotton, R. Trends Genet. 13: 43-46, 1997). However, these methods are labor intensive, require a lot of time, and have a difficulty in using as radioactive isotopes and cancer inducing factors as routine reagents.

In particular, the PCR reaction is carried out by a cycle of denaturation-annealing-extension, and the optimal annealing temperature and time of the primers depends on the template DNA binding site, GC base content ratio and length The precise annealing temperature can not be measured only with the primer sequence, and the optimum annealing temperature and time must be measured experimentally. If the annealing reaction is not carried out under the correct annealing conditions, a nonspecific PCR product is formed which doubts the PCR result and, in the case of PCR to detect cancer marker, results in cancer misdiagnosis. Therefore, in order to detect various genes, it is necessary to measure the optimum annealing condition for each primer, and if the optimum annealing condition is different, it is troublesome to perform several PCRs with different annealing conditions. Therefore, if annealing conditions of the primers for amplifying each gene are made the same and the amplification of the gene can be performed at the same PCR condition at once, much time and cost can be saved in diagnosis of cancer through detection of various genes.

Sensitivity is also an important factor to consider when detecting target genes to diagnose cancer. PCR technology allows large quantities of DNA to be obtained through amplification of multiple cycles even with small amounts of DNA. However, in the case of early or latent infection with a virus causing cancer, the target gene or its expression amount is out of the detection range of the PCR technique. Therefore, even when the cancer is not diagnosed as a cancer, Lt; / RTI >

To overcome this problem, a multiple amplification refractory mutation system (mARMS) based on DLP has been developed as a mutation detection technique for multiple genes. Since the system can simultaneously detect at least two kinds of nucleotide mutations of the target oligonucleotide, it can be effectively used not only for diagnosis of cancer but also for diagnosis of cancer development.

Therefore, the inventors of the present invention have conducted various studies to develop a primer for single base polymorphism based on a molecular genetic method for simultaneously diagnosing various types of cancer, and as a result, an oligonucleotide primer having a unique structure has been produced. The present inventors have completed the present invention by confirming that the mutation of ten kinds of tumor suppressor genes can be accurately detected without errors and that two or more kinds of mutations can be detected at the same time.

Accordingly, it is an object of the present invention to provide a primer exhibiting improved hybridization specificity with a target site in a polymerase chain reaction (PCR).

It is another object of the present invention to provide a method for amplifying a nucleic acid by a polymerase chain reaction using the primer.

It is still another object of the present invention to provide a method for detecting a gene mutation using the primer.

It is another object of the present invention to provide a method for predicting the risk of cancer of an individual using the primer.

Yet another object of the present invention is to provide a kit for predicting the risk of cancer of an individual, which comprises the primer.

According to this object, the present invention provides an oligonucleotide of a dumbbell structure represented by the following formula 1:

<Formula 1>

5'-A-B-C-3 '

In this formula,

A is a low T m specificity region comprising 3 to 15 nucleotides having a base sequence complementary to the 3'-terminal consecutive nucleotide sequence of the oligonucleotide;

B is a segmented region comprising 3 to 5 nucleotides with a universal base;

C is a high Tm specific region comprising 3 to 20 nucleotides with a base sequence complementary to the target nucleotide sequence of the template nucleic acid.

According to another aspect of the present invention, there is provided a method for amplifying a nucleic acid comprising the step of performing a polymerase chain reaction using an oligonucleotide of the dumbbell structure as a primer.

According to still another aspect of the present invention, there is provided a method for detecting a gene mutation, comprising detecting a gene mutation by a polymerase chain reaction using an oligonucleotide of the dumbbell structure as a primer.

According to another aspect of the present invention, there is provided a method for preparing a DNA fragment, comprising: (i) obtaining DNA from a sample of an individual; (ii) performing a polymerase chain reaction from the DNA using the oligonucleotide of the dumbbell structure of claim 9 as a primer; And (iii) analyzing the polymorphism of a gene selected from the group consisting of the following results of the polymerase chain reaction to predict the risk of developing cancer in an individual:

(1) 465899C / T polymorphism of the APC gene;

(2) IIe105Val, GSTT and GSTM polymorphisms of the GST gene;

(3) 579 G> T polymorphism of DNMT3B gene;

(4) T1799A polymorphism of the BRAF gene;

(5) the Arg194Trp polymorphism of the XRCC1 gene;

(6) 347 G> GA polymorphism of the CDH1 gene;

(7) -93 G > A polymorphism of MLH1 gene;

(8) the 938 C> A polymorphism of the BCL2 gene;

(9) 2014 G> A polymorphism of the ESR gene;

(10) C677T polymorphism of the MTHFR gene;

(11) Intron 17 of RB gene A> G polymorphism

(12) T790M polymorphism of the EGFR gene

(13) 7654 G> C, 1195 AA polymorphism of the COX2 gene;

(14) V617F polymorphism of the JAK2 gene; And

(15) IDT polymorphism of the FLT3 gene.

According to yet another object, the present invention provides a kit for predicting the risk of developing cancer in an individual comprising an oligonucleotide of the dumbbell structure.

Since the oligonucleotide of the dumbbell structure according to the present invention is excellent in hybridization specificity with the target site for detecting SNPs of various disease-related genes in the polymerase chain reaction, it can be used for detecting SNP more accurately, Through simple amplification without treatment or sequencing, two or more nucleotide mutations can be detected simultaneously and without errors.

In addition, the method and kit for predicting cancer risk according to the present invention were conducted to investigate the polymorphisms of 15 tumor suppressor genes identified as factors determining the susceptibility of multiple cancers in Korean, May be useful in predicting cancer risk in a simple way.

FIG. 1 is a schematic diagram of a cancer gene analysis procedure using a DLP-based multiple amplification non-invasive mutagenesis system.
Figure 2 is a schematic diagram showing the principle of the dumbbell structure oligonucleotides of the present invention in a target-dependent extension reaction. (a) illustrates an environment in which amplification can not take place due to the high hybridization specificity of the dumbbell structure oligonucleotide under high stringency conditions, and (b) illustrates the successful extension reaction of the dumbbell structure oligonucleotide.
Fig. 3 shows the results of analysis of mutation of APC gene closely related to familial polyposis (colon cancer) using DLP-based multiple amplification non-mutagenic system.
FIG. 4 shows the results of analysis of the mutation of GST gene closely related to prostate cancer, thyroid cancer, lung cancer, breast cancer, and liver cancer using the DLP-based multiple amplification non-invasive mutation system. In the figure, (a) is the result of GSTP1 mutation analysis, and (b) is the result of mutation analysis of GST gene.
FIG. 5 shows the results of analyzing the mutation of DNMT3B gene closely related to lung cancer and liver cancer using DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 6 shows the results of analysis of the mutation of BRAF gene closely related to thyroid cancer using a DLP-based multiple amplification non-invasive mutation system.
FIG. 7 shows the results of analyzing the mutation of the XRCC1 gene closely related to colon cancer and thyroid cancer using DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 8 shows the results of analysis of CDH1 gene mutations closely related to gastric cancer and lobular breast cancer using the DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 9 shows the results of analysis of MLH1 gene mutations closely related to non-costal colorectal cancer using the DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 10 shows the results of analysis of the mutation of BCL2 gene closely related to follicular lymphoma and breast cancer using the DLP-based multiple amplification non-invasive mutation system.
Fig. 11 shows the results of analysis of mutation of ESR gene closely related to uterine cancer and breast cancer using DLP-based multiple amplification non-mutagenic system.
FIG. 12 shows the results of analysis of mutation of MTHFR gene closely related to cardiovascular disease using DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 13 shows the results of analysis of mutation of RB1 gene closely related to retinoblastoma, lung cancer, and colorectal cancer using DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 14 shows the results of analysis of mutation of EGFR gene closely related to lung cancer and drug susceptibility using DLP-based multiple amplification non-tolerance mutagenesis system. In this figure, (a) is the result of COX-2 -765G> C mutation analysis, and (b) is the result of mutation analysis of COX-2 1195 AA gene.
FIG. 16 shows the results of analyzing the mutation of the JAK2 gene closely related to chronic myelogenous leukemia using the DLP-based multiple amplification non-tolerance mutagenesis system.
FIG. 17 shows the results of analysis of mutation of FLT3 gene closely related to acute myelogenous leukemia using DLP-based multiple amplification non-tolerance mutagenesis system.

Hereinafter, the present invention will be described in detail.

The present invention provides oligonucleotides of the dumbbell structure represented by the following formula 1:

<Formula 1>

5'-A-B-C-3 '

In this formula,

A is a low T m specificity region comprising 3 to 15 nucleotides having a base sequence complementary to the 3'-terminal consecutive nucleotide sequence of the oligonucleotide;

B is a segmented region comprising 3 to 5 nucleotides with a universal base;

C is a high Tm specific region comprising 3 to 20 nucleotides with a base sequence complementary to the target nucleotide sequence of the template nucleic acid.

The oligonucleotide of the dumbbell structure is used as a primer in PCR to improve the hybridization specificity of PCR, and thus can be useful for detecting SNPs of a number of disease-related genes.

The basic structure of the oligonucleotide was first proposed by the present inventor and can be called a dumbbell structure or a dumbbell structure specificity and a primer having such a structure can be referred to as a dumbell-like primer (DLP) .

DLP is a novel concept primer developed by the present inventors and has a low Tm specificity portion (also referred to as a mutation adjacent specificity region) separated by a dividing region and a high Tm specificity portion (Also referred to as &lt; RTI ID = 0.0 &gt; regions). &Lt; / RTI &gt;

More specifically, when the primer is annealed to a target sequence comprising a nucleotide mutation, the specificity is not determined by the total length of the primer like the conventional primer, but is determined by the mutual adjacent specificity region and the mutation specificity region, . Thus, when the primer is annealed to the target sequence, it is annealed in a different manner than conventional primers, which can greatly improve the annealing specificity.

According to a preferred embodiment of the present invention, the length of the mutation adjacent specificity region is shorter than the mutation-specific region. The mutation adjacent specificity region preferably has a length of 3 to 15 nucleotides, more preferably 5 to 6 nucleotides. The variation specificity region preferably has a length of 3 to 20 nucleotides, more preferably 5 to 19 nucleotides, most preferably 6 to 18 nucleotides. The segment preferably has a length of 3-5 nucleotides.

According to a preferred embodiment of the present invention, the Tm of the mutation specificity region is lower than the Tm of the mutation specificity region, and the Tm of the divided region is lower than the Tm of the mutation adjacent specificity region and the Tm of the mutation specificity region.

Preferably, the mutation adjacent specificity region has a Tm of 10 to 35 占 폚, and preferably has a Tm of 5 to 12 占 폚. Preferably, the mutation specificity region has a Tm of 50-65 &lt; 0 &gt; C. The segment preferably has a Tm of 3 to 10 [deg.] C.

The variation specificity region of the oligonucleotide of the dumbbell structure of the present invention includes a nucleotide corresponding to or complementary to a target nucleotide variation. When the oligonucleotide is hybridized with the sense strand of the target nucleotide sequence as a primer, the mutation specificity region includes a nucleotide complementary to the nucleotide mutation and, when hybridized with the antisense strand, includes a nucleotide corresponding to the nucleotide mutation.

According to a preferred embodiment of the present invention, the nucleotide corresponding to the nucleotide mutation or complementary nucleotide is located at a position separated by 1 to 2 bases from the 3'-terminal or 3'-terminal of the mutation specificity region, Lt; RTI ID = 0.0 &gt; 1 &lt; / RTI &gt; to 2 bases from the 3 &apos; -end of the specificity region. Most preferably, the nucleotide corresponding to or complementary to the nucleotide variation is located at or near the center of the variation specificity region. For example, when the mutation-specific region is separated by 1-2 bases from the 3'-terminus, the nucleotide corresponding to or complementary to the nucleotide mutation is located at a position where the 5'-terminal of the mutation-specific region is also separated by 1-2 bases.

In the mutation-specific region of the primer, the nucleotide corresponding to the nucleotide mutation is located at a position separated by 1-2 bases from the 3'-terminal of the mutation-specific region, and the 5'-terminal of the complementary nucleotide mutation- When located at a position spaced apart by two bases, the following advantageous effects are produced.

For example, when a SNP is detected using a common primer, the mutation site is located at the 3'-terminal. In this case, when the 3'-terminal base is not annealed to the target sequence (that is, The Tm value of the matching is not significantly different. Therefore, even in the case of mismatching, an amplification reaction occurs due to annealing, and a false positive result tends to occur. On the other hand, when the mutation site is located at a center, the Tm values are largely different from each other when the mutation site is annealed to the target sequence (that is, when mismatching) Enzymes also catalyze polymerization reactions at mismatched sites, resulting in false positive results.

According to the present invention, the above-described problems of the conventional art can be completely overcome. For example, when a nucleotide corresponding to or complementary to a nucleotide mutation is located in the center of a mutation-specific region, if mismatching occurs at this position, mismatching occurs at the center of the mutation-specific region alone , The Tm value of the mutation specificity region is greatly reduced as compared with the case where the Tm value is matched. In the entire primer structure, the heat-stable polymerase simultaneously catalyzes the polymerization reaction I never do that. Thus, when mismatching, false positive results are not generated.

The cleavage site of the oligonucleotide of the dumbbell structure according to the present invention comprises 3 to 5 nucleotides with a universal base. The universal base located in the segmented region may be selected from the group consisting of deoxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'- OMeinosine, And combinations of the above bases, more preferably deoxyinosine, inosine, or 5-nitroindole, and most preferably dioxyinosine.

Oligonucleotides of the dumbbell structure according to the present invention can be used to detect polymorphisms of various cancer-associated genes. Examples of the oncogenic genes include APC gene, GST gene, DNMT3B gene, BRAF gene, XRCC1 gene, CDH1 gene, MLH1 gene, BCL2 gene, ESR gene, MTHFR gene, RB gene, EGFR gene, COX2 gene, JAK2 gene and FLT3 gene .

The oncogenic genes are as follows.

1) APC gene: A gene that causes epithelial cells to adhere to surrounding cells and coexist with each other. This mutation and methylation abnormality of the gene prevents the development of cancer in the large intestine, gastric mucosa or airways. (30-80%) in colon and stomach, esophagus and airway cancer and precancerous lesions. Therefore, APC genetic testing is essential for the diagnosis of congenital colorectal cancer (FAP) and for screening in patients' families. Furthermore, APC genetic testing is also helpful for the diagnosis of acquired colorectal cancer, lung cancer, esophageal cancer, stomach cancer, pancreatic cancer and liver cancer. In Western Europe, specimens such as feces and blood are used to diagnose various gastrointestinal cancers such as colon cancer (Johns Hopkins. No.175100. Familial adenomatous spolyposis; Feam head NSetal.J Natl Cancer Inst. ): 1805-1811)

2) GST gene: The GST gene is involved in the prevention of carcinogenesis by metabolizing carcinogens. Especially, it plays an important role in inhibition of steroidal carcinogenesis, and when there is mutation and methylation abnormality of this gene, The risk of cancer is increased in the endocrine system such as cancer, liver cancer, kidney cancer, breast cancer, thyroid cancer (Polymorphisms of glutathione-S-transferase M1, T1 and P1 and the risk of prostate cancer: Monika Sivoov, Iveta Waczulkov , Duan Dobrota, Tatiana Matkov, Jozef Hatok, Peter Raay and Jn Kliment, Journal of Experimental & Clinical Cancer Research 2009, 28:32).

3) DNMT3B gene: DNMT genes are overexpressed in various carcinomas (Robertson, KD, et al., Nucleic Acids Res., 27, 2291-2298,1999; Belinsky, SA, et al., Proc. Natl. Genetic disruption of DNMT1 and DNMT3B in human cancer cells has been associated with a wide range of genetic mutations and, (Rhee, I., et al., Nature, 416, 552-556, 2002; and Rhee, I., et al., Nature, 404, 1003-1007, 2000). These results indicate that DNMTs expression and activity abnormalities result in abnormal mutations in the cancers (DNMT3B 579 G> T promoter polymorphism and risk of esophagus carcinoma in Chinese Hong Kong, Dong-Sheng Liu, Shu-Hong Zhang, Jia-Bo Hu, Feng Zhang, Zhu-Jiang Zhao, World J Gastroenterol 2008 April 14; 14 (14): 2230-2234.).

4) BRAF gene: V559E mutation in the BRAF gene was detected in 28/78 (35.8%) of papillary thyroid carcinoma (PTC) [Kimura et al 2003], 51/207 (24.6%) [Namba et al 2003] Found. It is not found in other types of thyroid cancer. This mutation is also associated with metastasis and clinical stages, which is helpful in predicting prognosis [Namba et al 2003]. This mutation is also found in other malignant melanomas and colon cancer. Cancer with BRAF gene mutation is more sensitive to diagnosis than goat biopsy and is useful in differential diagnosis with other thyroid cancer. In addition, the BRAF gene mutation is highly correlated with cell differentiation and cancer tissue size, and thus the differential diagnosis and prognosis of papillary thyroid carcinoma can be made by this test. (Prevalence of B raf kinase V600E mutation in cytologically indeterminate thyroid nodules: correlation Jae-Sup Yun, Jin-Hee Sohn, Dong-Hoon Kim, Eun Chul Chung, Seong Hyeong Choi, Seong Hyeong Choi, Myong-Ho Rho, Korean Journal of Radiology Vol. 66, No. 1 (January 2012) pp.17-26 1738-2637).

5) XRCC1 gene: XRCC1 gene mutation is 1.58 times higher, so drinking two bottles of shochu (equivalent to 80 g of alcohol) a week and the mutation of a specific gene together, the probability of getting colon cancer is up to 7 times higher It came out. The XRCC1 gene has been known to be associated with colorectal cancer, and this study has proven its relevance in Korea. The researchers also found that the XRCC1 gene mutation was 1.58 times more likely to have a colorectal cancer than the normal one, even when drinking less than two bottles of soju a week. Conversely, drinking more than 80 grams of alcohol per week would increase the likelihood of colorectal cancer by 2.6 times, even without genetic mutations. (XRCC1 Polymorphism and Acute Complication of Chemoradiation Therapy in Patients with Colorectal Cancer) Kim Woo Chul, Hong Yoon Cheol, Choi Sun Keun, , Journal of Radiation Oncology, Vol. 24, No. 1 (2006. 3) pp.30-36 1229-8719).

6) CDH1 gene: A cadherin gene that is expressed in epithelial cells and bone marrow cells. It is involved in the signaling of cell adhesion, communication, proliferation and differentiation, and inhibits the invasion and metastasis of cancer cells. These high-grade cancers include gastric cancer (70%), breast cancer (30-75%), esophageal cancer (84%), liver cancer (40-70%) and colon cancer (2000) reported that the CDH1 gene mutation test is a useful adjunctive diagnostic method for these cancers (Guilford, P. J et al., Hum C. Mutat (1999), 14: 249-255, 1999. Machado JC et al. 20 (12): 1525-1528; Droufakou S et al. Int J Cancer (2001) 92 (3): 404-408).

MLH1 gene: MLH1 gene is a gene that inhibits mutation or carcinogenesis by repairing damaged DNA. The mutation of this gene is found in colon cancer (45%), endometrial cancer (44%), gastric cancer (32% (HNPCC predisposing mutation in MLH1. P Hutter, J Wijnen, C Rey-Berthod, I Thiffault, P Verkuijlen, D Farber, N Hamel, B Bapat , SN Thibodeau, J Burn, J Wu, E MacNamara, K Heinimann, G Chong, WD Foulkes. J Med Genet 2002; 39: 323327)

8) BCL2 gene: Bcl-2 is a primary oncogene and an important regulator of apoptosis. It is located in the long arm of chromosome 18 and synthesizes 26 kd protein. This protein is located in the inner membrane of the mitochondria, in the perinuclear membrane and endoplasmic reticulum, acting at the final stage of apoptosis, suspending the tumor cells in the G0 / G1 phase of the cell cycle, or apoptosis through the APO-1 / (Bcl-2 Expression in Endometrial Hyperplasia and Carcinoma), which has been reported to inhibit cell proliferation (Bcl-2 Expression in Endometrial Hyperplasia and Carcinoma). 1998.12) pp.1207-1218 0496-6872).

9) ESR gene: The ESR (estrogen receptor) gene plays a key role in regulating the development, differentiation and proliferation of endometrial and breast cells. Dysfunctions due to the mutation of the ESR gene in endometrial cancer, breast cancer, lung cancer, colorectal cancer, and blood cancer of the human body are observed. In particular, it is present in the majority of endometrial cancers (94%) and in about half of breast cancers, which is a strong diagnostic marker for endometrial cancer and breast cancer (Nass SJ et al. Cancer Res (2000) 60: 4346-8; Yoshida T et al. Carcino genesis (2000) 21: 2193-2201; Sasaki Metal. Cancer Res (2001) 61: 3262-6).

10) MTHFR gene: The MTHFR gene makes an enzyme involved in the metabolism of homocysteinemia. When the mutation (c.677C> T) occurs, the activity of the enzyme decreases and hyperhomocysteinemia can be induced (Meta-analysis of MTHFR 677T allele. &lt; / RTI &gt; DB Victorino, MF Godoy, EM Goloni-Bertollo, EC Pavarino, Molecular Biology Reports Volume 41, Number 8, 5491-5504).

11) RB gene: The most common genetic modification of epithelial solid tumors is the loss of heterozygosity (LOH). LOH of RB1 gene is frequently observed in various cancers such as colon cancer. The test for LOH can be confirmed by PCR using a microsatellite marker to confirm the loss of heterozygosity. This test may change the stage, clinical features, and prognosis of LOH in some tumors. (Rb) Gene Polymorphisms in Relation to Lung Cancer in Koreans. (Korean J Thorac Cardiovasc Surg 1998; 26: 233-248) Respiratory Society; Korea Tuberculosis Association, 1997).

12) EGFR gene: EGF is a key gene that receives the signal that induces the proliferation of EGF and delivers it into the cell. When this gene is mutated, it overexpresses and promotes cancer development. Especially in lung cancer, mutation occurs at a high frequency, and exon 19 is most frequently observed as in this case. EGF receptor mutations have a high response rate to IRESSA chemotherapy. (Rapid Polymerase Chain Reaction-Based Detection of Epidermal Growth Factor Receptor Gene Mutations in Lung Adenocarcinomas. Qiulu Pan, * William Pao, and Marc Ladanyi, Journal of Molecular Diagnostics, Vol. 7, No. 3, August 2005).

13) COX2 gene: It has been shown that C> G polymorphism, the 765 base of COX2 gene, is associated with the occurrence of various diseases such as gastric cancer, esophageal cancer, prostate cancer, asthma, myocardial infarction and stroke. In addition, it has been confirmed that the risk of developing ovarian cancer has been increased to twice as high in recent years. In women with C allele, the incidence of ovarian cancer has doubled, with a three-fold increase over the age of 53 (-765G> C). The COX-2 polymorphism may be a susceptibility marker for gastric adenocarcinoma in patients with Atrophy or intestinal metaplasia. Carina Pereira, Hugo Sousa, Paula Ferreira, Maria Fragoso, Lus Moreira-Dias, Carlos Lopes, Rui Medeiros, Mrio Dinis-Ribeiro, World J Gastroenterol 2006 September 14; 12 (34): 5473-5478; The COX-2-1195AA Genotype Is Associated with Diffuse-Type Gastric Cancer in Korea Woon Geon Shin *, Ha Jung Kim, Sung Jin Cho, Hyoung Su Kim *, Myoung Kuk Jang *, Jin Heon Lee *, and Hak Yang Kim, Gut and Liver, Vol. 6, No. 3, July 2012, pp. 321-327).

14) JAK2 gene: The JAK2 V617F mutation test is used to diagnose myeloproliferative disorders. Sequencing methods for JAK2 V617F may not detect 5-10% of mutations in test sensitivity, and allele-specific PCR is highly sensitive (Screening for hotspot mutations in PI3K, JAK2, FLT3 and NPM1 in patients with myelodysplastic syndromes Joao Agostinho Machado-Neto, Fabiola Traina, Mariana Lazarini, Paula de Melo Campos, Katia Borgia Barbosa Pagnano, Irene Lorand-Metze, Fernando Ferreira Costa, Sara T Olalla Saad, CLINICS 2011; 66 (5): 793- 799)

15) FLT3 gene: FLT3 gene mutation is the most common in acute myelogenous leukemia. Two types of mutations are known: intracellular second TKD (D835) mutation and internal tandem duplication (ITD) mutation. The D835 mutation appears in exon 20, and the ITD mutation occurs in exon 14 and exon 15, all of which occur independently of one another due to somatic mutations and occur in different alleles, even when present. The FLT3 gene mutation induces ligand-independent receptor activity in many hematopoietic cells, leading to cell proliferation as well as inhibiting apoptosis (FLT3 Gene Mutations as a Prognostic Factor for MD, Jang Soo Suh, MD, Jang Soo Suh, MD, J Lab Med 2006; 26: 233-40) Acute Myeloid Leukemia:

Preferably, the oligonucleotides of the dumbbell structure according to the invention can be used to detect polymorphisms of a gene selected from the group consisting of:

(1) 465899C / T polymorphism of the APC gene;

(2) IIe105Val, GSTT and GSTM polymorphisms of the GST gene;

(3) 579 G> T polymorphism of DNMT3B gene;

(4) T1799A polymorphism of the BRAF gene;

(5) the Arg194Trp polymorphism of the XRCC1 gene;

(6) 347 G> GA polymorphism of the CDH1 gene;

(7) -93 G > A polymorphism of MLH1 gene;

(8) the 938 C> A polymorphism of the BCL2 gene;

(9) 2014 G> A polymorphism of the ESR gene;

(10) C677T polymorphism of the MTHFR gene;

(11) Intron 17 of RB gene A> G polymorphism

(12) T790M polymorphism of the EGFR gene

(13) 7654 G> C, 1195 AA polymorphism of the COX2 gene;

(14) V617F polymorphism of the JAK2 gene; And

(15) IDT polymorphism of the FLT3 gene.

The dumbbell structure oligonucleotide may have a base sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 52 (see Table 1).

On the other hand, the present invention provides a method for amplifying a nucleic acid comprising the step of performing a polymerase chain reaction using an oligonucleotide of the dumbbell structure described above as a primer.

In addition, the present invention provides a method for detecting a gene mutation, which comprises detecting a gene mutation by a polymerase chain reaction using an oligonucleotide of the dumbbell structure as a primer.

Further, the present invention relates to a method for producing a DNA fragment comprising: (i) obtaining DNA from a sample of an individual; (ii) performing a polymerase chain reaction from the DNA using the oligonucleotide of the dumbbell structure of claim 9 as a primer; And (iii) analyzing the polymorphism of a gene selected from the group consisting of the following results of the polymerase chain reaction to predict the risk of developing cancer in an individual:

(1) 465899C / T polymorphism of the APC gene;

(2) IIe105Val, GSTT and GSTM polymorphisms of the GST gene;

(3) 579 G> T polymorphism of DNMT3B gene;

(4) T1799A polymorphism of the BRAF gene;

(5) the Arg194Trp polymorphism of the XRCC1 gene;

(6) 347 G> GA polymorphism of the CDH1 gene;

(7) -93 G > A polymorphism of MLH1 gene;

(8) the 938 C> A polymorphism of the BCL2 gene;

(9) 2014 G> A polymorphism of the ESR gene;

(10) C677T polymorphism of the MTHFR gene;

(11) Intron 17 of RB gene A> G polymorphism

(12) T790M polymorphism of the EGFR gene

(13) 7654 G> C, 1195 AA polymorphism of the COX2 gene;

(14) V617F polymorphism of the JAK2 gene; And

(15) IDT polymorphism of the FLT3 gene.

In the polymerase chain reaction of the step (i), a pair of primers (UP), which can amplify wild type and mutant sequences in common to detect at least two kinds of nucleotide mutations at the same time, A mutant primer (MP) capable of specifically binding to a mutation site and a wild primer (WP) having only a wild-type sequence and capable of specifically binding to a site where mutation does not occur And the three pairs of primers may be the primers of the dumbbell structure described above.

The method of the present invention can simultaneously detect various nucleotide mutations or SNPs (nucleotide polymorphisms) in the nucleotide sequence, and in particular, mutations at the same base or the same codon in the nucleotide sequence simultaneously.

To date, no method has been practically developed that can simultaneously detect two or more nucleotide mutations, particularly two or more mutations in the same base or the same codon, by a simple amplification reaction (for example, PCR). The present invention provides a practical method for identifying such simultaneous mutation detection with a simple amplification reaction.

The presence of the genotype of any one of the genes selected from the following group in step (iii) predicts that the risk of cancer development is high:

(1) the 465899C / T CC genotype of the APC gene;

(2) IIe105Val GG genotype, GSTT null and GSTM null polymorphism of the GST gene;

(3) 579 G> T TT genotype of the DNMT3B gene;

(4) T1799A AA genotype of the BRAF gene;

(5) Arg194Trp CC genotype of XRCC1 gene

(6) CDH1 gene 347 G> GA AA genotype

(7) -93 G> A GG genotype of MLH1 gene

(8) 938 C> A CC genotype of the BCL2 gene

(9) 2014 G> A GG genotype of the ESR gene;

(10) C677T TT genotype of the MTHFR gene;

(11) Intron 17 of RB gene A> G AA genotype;

(12) T790M AA genotype of the EGFR gene;

(13) 7654 G> C GG genotype and 1195 AA genotype of COX2 gene

(14) the V617F genotype of the JAK2 gene; And

(15) IDT genotype of FLT3 gene.

The above-mentioned method can be used for the treatment of leukemia or cardiovascular diseases other than cancer, such as gastric cancer, prostate cancer, colon cancer, thyroid cancer, ovarian cancer, breast cancer, pancreatic cancer, pancreatic cancer, lung cancer, liver cancer, thyroid cancer, The risk of the onset of the disease.

Hereinafter, an example of a method for predicting the risk of developing colorectal cancer according to the present invention will be described with reference to FIG.

The following operations are all performed manually by the operator.

The operator starts the prediction by taking a sample such as a blood sample from the subject to be predicted. In step 2a, the collected sample is treated with purification and extraction as necessary, and then the genotypes of 15 genes in the sample are determined. Then proceed to step 2b.

In step 2b, the genotypes of the 15 genes determined in step 2a are determined as wild-type homozygotes or mutated heterozygotes and homozygous changes. As a result of the determination, if the genotype is G / T or T / T, the process proceeds to step 2c. If the genotype is G / G, the process proceeds to step 2d.

In step 2c, from the judgment result of step 2b, it is predicted that the individual has a high risk of developing colon cancer, and all prediction processes are terminated.

In step 2d, from the judgment result of step 2b, it is predicted that the individual does not have a high risk of developing colorectal cancer, and the entire prediction process is terminated.

The means for determining the genotype of the polymorphism that can be used in the present invention can be carried out using any means known per se. For example, a genotype can be determined by preparing a nucleic acid containing a desired polynucleotide from a sample obtained from an individual subject.

The subject of the method of the present invention may be any mammal including humans, dogs, cats, cattle, goats, pigs, sheep and monkeys, but humans, especially Asians, are the most preferred.

The sample used here refers to biological samples such as blood, serum, lymph, tissue, hair and ear wax collected from biological specimens. In addition, the sample may be a sample obtained by subjecting the biological sample to any necessary pretreatment such as homogenization and extraction, if necessary. Such pretreatment may be selected by those skilled in the art depending on the biological sample of interest.

The nucleic acid produced from the sample can be prepared from DNA. For example, as a means for preparing a genomic DNA sample from a subject, all commonly used means such as a method of extracting DNA using a kit commercially available from hemocytes such as leukocytes, mononuclear cells, lymphocytes and granulocytes in peripheral blood obtained from the subject .

When the amount of the nucleotide is small, an operation for amplifying the nucleotide can be carried out if necessary. The amplification can be carried out by a polymerase chain reaction (hereinafter abbreviated as PCR) using an enzyme such as a DNA polymerase. If necessary, the genotype of the above 15 genes is determined after the extraction operation and / or the amplification operation is carried out.

As the means for determining the genotype, sequencing can be carried out after cloning, and all commonly used means such as direct sequence analysis, SSCP, oligonucleotide hybridization and specific primer can be used. More preferred methods for determining the genotypes include PCR-SSO (Sequence Listing) in which PCR-RFLP (restriction fragment length polymorphism) method, PCR-SSP (specific sequence primer) method, dot plot method and PCR are combined using restriction enzymes Specific oligonucleotides) and PCR-SSCP methods can be used. However, the present invention is not limited to these.

By determining the genotype of the 15 genes by the above method, the risk of various cancer outbreaks can be predicted based on the results. In addition, the genotype of the above-mentioned 15 genes is determined, and the genotype of other known cancer-related genes is determined, and from these results, the risk of cancer development can be comprehensively estimated. Such a method is also within the scope of the present invention. In the case of these methods, on the basis of the determined genotypes, for example, by searching a table showing information associating the genotypes of the genotypes with the risk of cancer, the risk rate of cancer development is extracted, Can be predicted.

As described above, the onset of various cancers depends on the genotype of the 15 genes. That is, based on the genotype of the 15 genes, the risk of various cancer outbreaks in an individual can be predicted with high probability. However, the onset of cancer will not be solely related to the genotype of the 15 genes, but will be influenced by a combination of other genetic factors and various environmental factors.

Therefore, it may be predicted by adding information on genetic factors besides information on the cancer-related genes. Such information may be, for example, information on other cancer-related genes or information on environmental factors such as age, food intake tendency, and taste. In the case of such a method, a table showing information correlating these factors with the risk of cancer development can be used. Such prediction methods are also included within the scope of the present invention.

Also, the method according to the present invention described above can be modified within the scope of the present invention as desired.

The present invention, on the other hand, provides a kit for predicting the risk of developing cancer in an individual, including oligonucleotides of the dumbbell structure described above.

The present invention also provides a pre-operative molecular genetic diagnostic method and a diagnostic kit capable of accurately predicting cancer prognosis, cancer presence, degree of cancer metastasis as well as prognosis of various types of cancer through molecular biology.

Mutations have been reported in 70% to 80% of cancer patients, and the difference between normal and tumors is so large that they can be used to diagnose cancer. The genes involved in the diagnosis of cancer are the 15 tumor suppressor genes shown in Table 1, and oligonucleotides such as APC, GSTP1, CDH1, ESR, DNMT3B, MLH1, BCL2, BRAF, EGFR, MTHFR, XRCC1, RB, COX2, JAK2 and FLT3 .

In order to measure the degree of DNA mutation, a step of measuring the polymorphism of each gene from the DNA extracted from the sample and a step of comparing the measured polymorphism frequency with the control group to obtain a correlation.

The sample may be a secretion obtained from a patient such as blood, saliva, urine, etc., and it is preferable to use blood, but not limited thereto, and all parts of the body capable of extracting DNA may be used. Preferably, the sample DNA is extracted through a general serum separation method after blood collection.

In a preferred embodiment of the present invention, when the polymorphism of 15 tumor suppressor genes is significantly different from that of many carcinomas, the genotype was determined as a genetic factor that can be determined to have a high risk of cancer development.

Analysis of 15 polymorphisms of tumor suppressor genes revealed that the polymorphism of each gene was closely related to the risk of multiple cancers. In addition, it is thought that the histological type-specific differences in the risk of occurrence caused by these polymorphisms are due to the different histological types of various cancers being caused by different carcinogenesis processes (Gu, J., et al. And Liu, G., et al., Cancer Res., 61 (1986), pp. , 8718-8722, 2001)

As a result, each gene acts as a genetic factor that determines the risk of developing multiple carcinomas. Due to the difference in gene expression depending on the polymorphism of these genes, the difference in expression ability Resulting in differences in susceptibility to the development of multiple cancers.

Hereinafter, the present invention will be described in detail with reference to examples, but it should be understood that the present invention is not limited thereto.

Example  1: DNA extraction

300 μl of blood, 3 volumes of RBC buffer were added, vortexed, and left on ice for 10 minutes. After centrifugation at 6.000xg (> 8,000 rpm) for 1 minute, the supernatant was removed and white blood cells were taken. 300 μl of TG buffer (20 mg / ml) was added to the precipitated cells, followed by reaction at 70 ° C. for 15 minutes. After completion of the reaction, 400 μl of TB buffer (80% ethanol solution) The mixture was transferred to a column, centrifuged at 6,000 × g for 1 minute, and the column was transferred to a new tube. After adding 500 μl of washing buffer, centrifuge for 1 minute at full speed, discard the collected solution in the tube, After centrifugation for 2 min, the column was transferred to a new 1.5 ml tube, and 100 μl elution buffer was placed in the center of the column, left at room temperature for 2 min, centrifuged at the highest speed for 1 min, Lt; / RTI &gt;

Example  2: primer  Design and manufacturing

Forward and reverse primers capable of acting as universal primers (UP), wild-type primers capable of specifically amplifying wild-type primers based on coding sequences including mutation sites of multiple genes, A wild-type primer (WSP) and a mutant specific primer (MSP) capable of specifically amplifying the mutation were modified to a sequence capable of sufficiently exhibiting PCR specificity by modifying the conventional primer design method And designed.

Among these primers, the mutant primers have a structure of the general formula I so as to hybridize with the target sequence with very high specificity. In these primers having the structure of the general formula I, the two specificity regions are physically and functionally divided by the segmentation region, and the hybridization specificity of the entire primer structure is double controlled by the mutation adjacent specificity region and the mutation specificity region. In addition, the base corresponding to the nucleotide mutation or hybridized to the mutation is located at the central portion of the mutation specificity region, so that the difference in Tm value due to mismatch can be increased, and DNA synthesis by Taq polymerase can not be achieved during mismatch. These primer sequences are shown in the following table, respectively.

Primer information for 15 genes gene 5`-primer 3`-primer APC GAGGT III CCACACAGAACTAACCTC AGTTT III TTATGAGAAAAGCAAACT GGTTT III TTATGAGAAAAGCAAACC GST CAGCA III CTCTGAGCACCTGCTG ATCTC III GGTGTAGATGAGGGAGAT GTCTC III GGTGTAGATGAGGGAGAC GCTTT III GAACTCCCTGAAAAGCTAAAGC CCACC III GTTGGGCTCAAATATACGGTGG GAGAT III TTCCTTACTGGTCCTCACATCTC TGCTG III TCACCGGATCATGGCCAGCA CDH1 GCTCA III GCTTGGGTGAAAGAGTGAGC GGTCC III GGTGGGTTATGGGACC TCTCA III GCTTGGGTGAAAGAGTGAGA MLH CGTTA III CGGACAGCGATCTCTAACG ATAGG III CGTGCTCACGTTCTTCCTAT GTAGG III CGTGCTCACGTTCTTCCTAC BRAF CAATG III GAATATCTGGGCCTACATTG TGAAA III CACTCCATCGAGATTTCA AGAAA III CACTCCATCGAGATTTCT DMNT3 CACTG III GAAAACTCGGTTTCAGTG GTGTT III CAGGTAAATCAGCTAACAC AACTG III GAAAACTCGGTTTCAGTT ESR TGTGG III GGGTTTTCCCTGCCACA CTCCT III CCGGAGTGTATGCAGGAG CGTGG III GGTTTTCCCTGCCACG XRCC1 AGCTG III GGGCTCTCTTCTTCAGTT GAGGG III CAGACCTCTCAACCCTC GGCTG III GGGCTCTCTTCTTCAGTC EGFR CAGGT III CATTCATGCGTCTTCACCTG CGCAG III CGTTGGGCATGAGCTGTG TGCAG III CGTTGGGCATGAGCTGTA RB CATCT III GGTCTCATAAGACTTCCTGAGATG AAGTT III CAGGCTGGTCTCAAACAT GAGTT III CAGGCTGGTCTCAAACAC BCL2 TGGGA III GCTCCTTCATCGTCCCA GGACT III GTCCGGTATTCGCAGAAGTC TGGGA III GCTCCTTCATCGTCCCA MTHFR GTGCTGTGCTGTTGGAAGGTGCAAGAT GCTTATCAAGTGGTTCTGATGACAGCCAC GATCC III GAAGGTGTCTGCGGGATC TCGAT III GCGTGATGATGAAATCGA JAK2 AATAT III GGTTTTAAATTAGGAGTATATT TGAAA III TAGTCCACAGTGTTTTCAGTTTCA CTTTC III GTCATGCTGAAAGTAGGAGAAAG COX2 CAGGA III GCAAAGATGAAATTCCTG CATCA III CATTTCTCTCCCTGATG TAGGA III AGCAAAGATGAAATTCCTA CAGGA III GGAGAATTTACCTTTCCTG CTGCA III GTATATCTGCTCTATATGCAG GAGGA III GGAGAATTTACCTTTCCTC FLT3 GCTGG III GCAATTTAGGTATGAAAGCCAGC GGTTG III CTTTCAGCATTTTGACGGCAACC

I in the above sequence represents dioxyinosine.

Example  3: DLP-based gene mutation analysis

3-1) Mutation analysis of APC gene

In order to analyze the 465899C / T polymorphism of the APC gene, primary confirmation was made using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The 465899C / T polymorphism detection was performed according to the following conditions using the primer system of the present invention with respect to the sample DNA in which the genotype was confirmed. The DLP-based primers were designed on the basis of the APC GenBank sequence (entry number 611731).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the denaturation of the reaction solution at 95 ° C for 10 minutes, the reaction was repeated 32 times at 94 ° C for 30 seconds, 58 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally amplified at 72 ° C for 5 minutes .

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild type was amplified only in the MP system only in the WP system, and the 250 bp band was amplified in all the heterozygotes (see FIG. 3 ).

FIG. 3 shows a schematic diagram of the electrophoresis results obtained from the APC gene mutation analysis results (AA, AG and GG) of Example 3 above. In FIG. 3, sample 1 is a heterozygote with an AG genotype, sample 2 is a wild-type homozygote with an AA genotype, sample 3 is a wild-type homozygote with an AA genotype, sample 4 is a heterozygote with an AG genotype, , Sample 6 was a homozygous homozygous mutant with GG genotype, sample 7 was homozygous wild type with AA genotype, and sample 8 was heterozygous with AG genotype.

3-2) GST gene mutation analysis

In order to analyze GST polymorphism, we confirmed by using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) Using the primer system of the present invention as a sample DNA, polymorphism detection was performed according to the following conditions. The DLP-based primers were designed based on the GST GenBank sequence (listing number L34079).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, repeating the reaction at 94 ° C. for 30 seconds, 62 ° C. for 60 seconds and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

When 5 μL of each PCR product was electrophoresed on 1.5% agarose gel, the GSTP gene was amplified only in the wild-type WP system and the mutant type was amplified only in the MP system and the 250 bp band was amplified in all the heterozygotes In the case of the GSTT gene, the mutant type was not amplified at 500 bp in the wild type, and the band was confirmed at the 230 bp in the wild type but not in the GSTM gene (see FIG. 4).

The results of the electrophoresis obtained in the GSTP1 gene mutation analysis of Example 3 are shown in Fig. 4 (a). In FIG. 4 (a), sample 1 is a homozygote of the wild type having an AA genotype, sample 2 is a heterozygote having an AG genotype, sample 3 is a homozygous mutant having a GG genotype, sample 4 is a wild type homozygote having an AA genotype, Specimen 5 was identified as a wild type homozygote with AA genotype, specimen 6 was heterozygous with AG genotype, specimen 7 was identified as wild type homozygote with AA genotype, and specimen 8 was heterozygous with AG genotype.

FIG. 4 (b) is a schematic diagram of the electrophoresis result obtained from the GST gene mutation analysis result of Example 3 above. In FIG. 4 (b), specimens 1 to 5, 9, 14 and 16 were identified as GSTT type, specimens 6 to 8, 10 and 13 as GSTT, GSTM type, specimens 11 and 15 as GSTM type, and specimen 12 as normal.

3-3) DNMT3B gene mutation analysis

In order to analyze DNMT3B -579G> T polymorphism, we confirmed by using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) method. The polymorphism detection was carried out according to the following conditions using the primer system of the present invention with respect to the specimen DNA in which the genotype was confirmed. The PCR primers were designed based on the DNMT3B GenBank sequence (Accession No. NT_028392).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 32 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally, amplified at 72 ° C for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the mutant type was amplified only in the MP system only in the WP system and the 200 bp band was amplified in all the heterozygous bodies (see FIG. 5 ).

FIG. 5 is a schematic diagram of the result of electrophoresis obtained from the mutation analysis of DNMT3B of Example 3 above. 5, the specimen 1 is a mutagenic homozygote, the specimen 2 is a homozygote of wild type, the specimen 3 is a homozygous homozygous mutant, the specimen 4 is a homozygous homozygous mutant, the specimen 5 is a heterozygote, the specimen 6 is a heterozygous specimen, And the specimen 8 was identified as a mutant homozygote.

3-4) BRAF gene mutation analysis

In order to analyze the BRAF T1799A polymorphism, the polymorphism (PCR) and Restriction Fragment Length Polymorphism (RFLP) method were used to confirm the genotype. Using the primer system of the present invention as a sample DNA, polymorphism detection was performed according to the following conditions. The PCR primers were designed based on the BRAF GenBank sequence (accession number NM_004333).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 33 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 65 seconds, and finally, amplified at 72 ° C for 5 minutes.

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild-type was amplified only in the MP system only in the WP system, and the 400 bp band was amplified in all the heterozygotes (see FIG. 6 ).

FIG. 6 shows a schematic diagram of an electrophoresis result obtained from the BRAF gene mutation analysis result of Example 3 above. In FIG. 6, sample 1 is a homozygote of wild type, sample 2 is homozygous wild type homozygote, sample 3 is homozygous homozygote of wild type, specimen 4 is homozygous homozygous mutant type, specimen 5 is homozygous wild type homozygote, specimen 6 is homozygous wild type homozygote, Homozygous, and specimen 8 were identified as mutant homozygotes.

3-5) XRCC1 gene mutation analysis

In order to analyze the Arg194Trp A / T polymorphism of the XRCC1 gene, primary confirmation was made using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The polymorphism detection was performed according to the following conditions using the primer system of the present invention. The PCR primers were designed based on the XRCC1 GenBank sequence (Accession No. AI056688).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C for 10 minutes, then repeating the reaction at 94 ° C for 30 seconds, 62 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally at 72 ° C for 5 minutes.

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild-type was amplified only in the MP system only in the WP system and the 400 bp band was amplified in all the heterozygotes (see FIG. 7 ).

FIG. 7 shows a schematic diagram of the electrophoresis result obtained from the XRCC1 gene mutation analysis result of Example 3 above. In FIG. 7, sample 1 is a heterozygote, sample 2 is a homozygous wild type, sample 3 is a homozygous homozygous mutant, sample 4 is a homozygous wild type sample, sample 5 is a homozygous homozygote, sample 6 is a homozygous homozygote mutant, Homozygous mutant, specimen 8 was identified as homozygous homozygous mutant, and specimen 9 was heterozygous.

3-6) CDH1 gene mutation analysis

The 347 G> GA polymorphism of the CDH1 gene was first identified using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The polymorphism detection was performed according to the following conditions using the primer system of the present invention. The PCR primers were designed based on the CDH1 GenBank sequence (accession number NM_004360).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, repeating the reaction at 94 ° C. for 30 seconds, 62 ° C. for 60 seconds and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the wild type was amplified only in the MP system only in the WP system, and the 200 bp band was amplified in all the heterozygotes (see FIG. 8 ).

A schematic diagram of the electrophoresis result obtained from the CDH1 gene mutation analysis result of Example 3 is shown in FIG. 8, a specimen 1 is a homozygote of a wild type, a specimen 2 is a homozygote of a wild type, a specimen 3 is a heterozygote, a specimen 4 is a homozygous homozygous mutant, a specimen 5 is a homozygous homozygote, a specimen 6 is a heterozygote, , And sample 8 was identified as a wild type homozygote.

3-7) MLH1 gene mutation analysis

To analyze the 93 G> A polymorphism in the exon 14 of the MLH1 gene, we used the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The polymorphism was detected using the primer system of the present invention in the following manner. The PCR primers were designed based on the MLH1 GenBank sequence (Accession No. NG_007109).

After mixing 0.1 μg / μL BSA, 2.5 mM MgCl 2, and 1 unit of Taq polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, repeating the reaction at 94 ° C. for 30 seconds, 62 ° C. for 60 seconds and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, repeating the reaction at 94 ° C. for 30 seconds, 62 ° C. for 60 seconds and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the mutant type was amplified only in the MP system only in the wild type WP system, and the 200 bp band was amplified in all the heterozygous type (FIG. 9 ).

FIG. 9 shows a schematic diagram of the electrophoresis result obtained from the MLH1 gene mutation analysis result of Example 3 above. In FIG. 9, sample 1 is a heterozygote, sample 2 is a homozygote of wild type, sample 3 is a homozygote of wild type, sample 4 is a homozygote, specimen 5 is a homozygous homozygote, specimen 6 is a homozygous homozygous mutant, , And sample 8 was identified as a heterozygote.

3-8) BCL2 gene mutation analysis

To analyze the -938 C / A polymorphism of the BCL2 gene, we first checked by using Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) Using the primer system of the present invention, the polymorphism detection was performed according to the following conditions. The PCR primers were designed based on the BCL2 GenBank sequence (Accession No. NG_009361).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, then repeating the reaction at 94 ° C. for 30 seconds, 62 ° C. for 60 seconds and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the mutant type was amplified only in the MP system only in the WP system and the 150 bp band was amplified in all the heterozygous bodies (see FIG. 10 ).

FIG. 10 shows a schematic diagram of the electrophoresis result obtained from the BCL2 gene mutation analysis result of Example 3 above. In FIG. 10, sample 1 is a homozygote of wild type, sample 2 is homozygous homozygous mutant, sample 3 is heterozygous, sample 4 is homozygous wild type, sample 5 is homozygous mutant type, sample 6 is homozygous homozygous mutant type, Heterozygote, and sample 8 were heterozygous.

3-9) ESR gene mutation analysis

In order to analyze the 2014 G> A polymorphism of the ESR gene, primary confirmation was made using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The polymorphism detection was performed according to the following conditions using the primer system of the present invention. The PCR primers were designed based on the ESR2 GenBank sequence (accession number MIM 601633).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 32 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally, amplified at 72 ° C for 5 minutes.

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild type was amplified only in the MP system only in the WP system, and the 150 bp band was amplified in all the heterozygotes (see FIG. 11 ).

FIG. 11 shows a schematic diagram of an electrophoresis result obtained from the ESR gene mutation analysis result of Example 3 above. 11, specimen 1 is a homozygote of wild type, specimen 2 is homozygous homozygous mutant, specimen 3 is heterozygous, specimen 4 is homozygous wild type, specimen 5 is homozygous homozygous mutant, specimen 6 is heterozygous homozygous specimen, Heterozygote, and sample 8 were heterozygous.

3-10) MTHFR gene mutation analysis

In order to analyze the C677T polymorphism of the MTHFR gene, a primer was first identified using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The identified sample DNA was subjected to polymorphism detection using the primer system of the present invention according to the following conditions. The PCR primers were designed based on the MTHFR GenBank sequence (Accession No. NM_005957).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 32 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally, amplified at 72 ° C for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the mutant type was amplified only in the MP system only in the WP system, and the 250 bp band was amplified in all the heterozygotes (see FIG. 12).

FIG. 12 is a schematic diagram of the electrophoresis result obtained from the MTHFR gene mutation analysis result of Example 3 above. 12, sample 1 is a wild type homozygote, sample 2 is a homozygous wild type homozygote, sample 3 is a homozygous wild type sample, sample 4 is a homozygous homozygote, sample 5 is a homozygous homozygous mutant type, sample 6 is a homozygous homozygote, And the specimen 8 was identified as a heterozygote.

3-11) RB gene mutation analysis

In order to analyze the polymorphism of RB gene located in intron 17, we first confirmed by using Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) , And the polymorphism detection was carried out according to the following conditions using the primer system of the present invention with respect to the sample DNA in which the genotype was confirmed by this method. The PCR primers were designed based on the RB GenBank sequence (accession number MIM 601633).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 32 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally, amplified at 72 ° C for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, the wild-type was amplified only in the MP system only in the WP system, and the 200 bp band was amplified in all the heterozygotes (see FIG. 13 ).

FIG. 13 shows a schematic diagram of the electrophoresis result obtained from the RB gene mutation analysis result of Example 3 above. 13, the specimen 1 is a mutagenic homozygote, the specimen 2 is a heterozygote, the specimen 3 is a heterozygote, the specimen 4 is a heterozygote, the specimen 5 is a heterozygote, the specimen 6 is a heterozygote, the specimen 7 is a wild type homozygote, Was identified as a mutagenic homozygote.

3-12) EGFR gene mutation analysis

In order to analyze the T790M polymorphism of the EGFR gene, the primers were firstly identified using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The identified sample DNA was subjected to polymorphism detection using the primer system of the present invention according to the following conditions. The PCR primers were designed based on the EGFR GenBank sequence (Accession No. NM_005228).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. After the reaction solution was denatured at 95 ° C for 10 minutes, the PCR reaction was repeated 32 times at 94 ° C for 30 seconds, 60 ° C for 60 seconds, and 72 ° C for 60 seconds, and finally, amplified at 72 ° C for 5 minutes.

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild-type was amplified only in the MP system only in the WP system and the 200 bp band was amplified in all the heterozygotes (see FIG. 14 ).

Fig. 14 shows a schematic diagram of the electrophoresis result obtained from the EGFR gene mutation analysis result of Example 3 above. In FIG. 14, sample 1 was found to be a homozygote of wild type, sample 2 was heterozygous, sample 3 was homozygous wild type, sample 4 was heterozygous, and sample 5 and 8 were wild type homozygotes.

3-13) COX-2 gene mutation analysis

In order to analyze the polymorphism of -765 C / G promoter of COX-2 (cyclo-oxygenase 2) gene, the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism , RFLP) method, and the polymorphism was detected according to the following conditions using the primer system of the present invention in the sample DNA in which the genotype was confirmed. The PCR primers were designed based on the COX-2 GenBank sequence (accession number NM_005228).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C for 10 minutes, repeating the reaction at 94 ° C for 30 seconds, 52 ° C and 58 ° C for 60 seconds and 72 ° C for 60 seconds, and finally at 72 ° C for 5 minutes .

5 μL of each PCR product was electrophoresed on a 1.5% agarose gel. As a result, it was confirmed that the wild type was amplified only in the MP system only in the WP system, and the 200 bp band was amplified in all the heterozygotes (see FIG. 15 ).

FIG. 15 (a) is a schematic diagram of the electrophoresis result obtained from the mutation analysis of COX-2 -765G> C gene of Example 3 above. In Fig. 15 (a), all of the samples 1 to 8 were identified as wild-type homozygotes.

FIG. 15 (b) is a schematic diagram of the result of electrophoresis obtained from the mutation analysis of COX-2 1195 AA gene of Example 3 above. In FIG. 15 (b), sample 1 is a homozygote of wild type, sample 2 is a heterozygote, samples 3 and 4 are mutant heterozygotes, samples 5 and 6 are heterozygotes, sample 7 is a homozygous homozygous mutant, Respectively.

3-14) JAK2 gene mutation analysis

In order to analyze the V617F polymorphism of the JAK2 gene, the polymetal chain reaction (PCR) and the restriction fragment length polymorphism (RFLP) The identified sample DNA was subjected to polymorphism detection using the primer system of the present invention according to the following conditions. The PCR primers were designed based on the JAK2 GenBank sequence (accession number MIM_147796).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, then repeating the reaction at 94 ° C. for 30 seconds, 58 ° C. for 60 seconds, and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, 350 bp of the wild type and 350 bp of the single band and 200 bp of the 2 bands of the mutant type were detected (see FIG. 16).

FIG. 16 is a schematic diagram of the electrophoresis result obtained from the JAK2 V617F mutation analysis result of Example 3 above. 16, sample 1 was normal, sample 2 was positive, samples 3 to 6 were negative, sample 7 was positive, sample 8 was normal, sample 15 was positive, and sample 16 was normal.

3-15) FLT3 gene mutation analysis

In order to analyze the IDT polymorphism of the FLT3 gene, primers were firstly identified using the conventional method Polymer Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) The identified sample DNA was subjected to polymorphism detection using the primer system of the present invention according to the following conditions. The PCR primers were designed based on the FLT3 GenBank sequence (accession number MIM_601626).

The PCR reaction solution contained 200 ng of genomic DNA, 25 pM of each primer, 0.2 mM dNTPs, 75 mM Tris-HCl (pH 9.0), 15 mM ammonium sulfate, 0.1 μg / μL BSA, 2.5 mM MgCl2, After mixing the polymerase (Neurotics), the final volume was adjusted to 20 μL with distilled water. The PCR reaction was carried out by denaturing the reaction solution at 95 ° C. for 10 minutes, then repeating the reaction at 94 ° C. for 30 seconds, 58 ° C. for 60 seconds, and 72 ° C. for 60 seconds, and finally at 72 ° C. for 5 minutes.

As a result of electrophoresis on 5% agarose gel of 5 μL of each PCR product obtained, 320 bp of the wild type and 320 bp of the single band only and 320 bp of the two bands were observed at 320 bp (see FIG.

FIG. 17 shows a schematic diagram of the electrophoresis result obtained from the FLT3 IDT gene mutation analysis result of Example 3 above. 17, samples 1 and 2 were normal, sample 3 was positive, samples 4 to 9 were normal, sample 10 was positive, and samples 11 to 16 were normal.

Taken together with these experimental results, it can be seen that the single nucleotide polymorphism of the human gene can be accurately distinguished without false positives and false negatives even under the conditions of the multiplex PCR when the method of the present invention is used .

Those skilled in the art will be able to contemplate further benefits and modifications. Accordingly, the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein. Accordingly, various modifications may be made without departing from the spirit and scope of the general inventive concept as defined by the appended claims and their equivalents.

<110> DIOGENE. Co., Ltd <120> Dumbbell-shaped oligonucleotides and method for detecting gene          mutation using the same <130> P14-1156 <160> 52 <170> Kopatentin 2.0 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for APC <220> <221> modified_base <222> (6) <223> n is dexoyinosine <400> 1 gaggtnnncc acacagaact aacctc 26 <210> 2 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for APC <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 2 agtttnnntt atgagaaaag caaact 26 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for APC <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 3 ggtttnnntt atgagaaaag caaacc 26 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 4 cagcannnct ctgagcacct gctg 24 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 5 gctttnnnga actccctgaa aagctaaagc 30 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 6 gagatnnntt ccttactggt cctcacatct c 31 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 7 atctcnnngg tgtagatgag ggagat 26 <210> 8 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 8 gtctcnnngg tgtagatgag ggagac 26 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 9 ccaccnnngt tgggctcaaa tatacggtgg 30 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GST <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 10 tgctgnnntc accggatcat ggccagca 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CDH1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 11 gctcannngc ttgggtgaaa gagtgagc 28 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for CDH1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 12 tctcannngc ttgggtgaaa gagtgaga 28 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for CDH1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 13 ggtccnnngg tgggttatgg gacc 24 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for MLH <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 14 cgttannncg gacagcgatc tctaacg 27 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for MLH <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 15 ataggnnncg tgctcacgtt cttcctat 28 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for MLH <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 16 gtaggnnncg tgctcacgtt cttcctac 28 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for BRAF <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 17 caatgnnnga atatctgggc ctacattg 28 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for BRAF <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 18 tgaaannnca ctccatcgag atttca 26 <210> 19 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for BRAF <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 19 agaaannnca ctccatcgag atttct 26 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for DMNT3 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 20 cactgnnnga aaactcggtt tcagtg 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for DMNT3 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 21 aactgnnnga aaactcggtt tcagtt 26 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for DMNT3 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 22 gtgttnnnca ggtaaatcag ctaacac 27 <210> 23 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for ESR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 23 tgtggnnngg gttttccctg ccaca 25 <210> 24 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for ESR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 24 cgtggnnngg ttttccctgc cacg 24 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for ESR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 25 ctcctnnncc ggagtgtatg caggag 26 <210> 26 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for XRCC1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 26 agctgnnngg gctctcttct tcagtt 26 <210> 27 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for XRCC1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 27 ggctgnnngg gctctcttct tcagtc 26 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for XRCC1 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 28 gagggnnnca gacctctcaa ccctc 25 <210> 29 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for EFGR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 29 caggtnnnca ttcatgcgtc ttcacctg 28 <210> 30 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for EFGR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 30 cgcagnnncg ttgggcatga gctgtg 26 <210> 31 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for EFGR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 31 tgcagnnncg ttgggcatga gctgta 26 <210> 32 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for RB <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 32 catctnnngg tctcataaga cttcctgaga tg 32 <210> 33 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RB <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 33 aagttnnnca ggctggtctc aaacat 26 <210> 34 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for RB <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 34 gagttnnnca ggctggtctc aaacac 26 <210> 35 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for BCL2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 35 tgggannngc tccttcatcg tccca 25 <210> 36 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for BCL2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 36 tgggannngc tccttcatcg tccca 25 <210> 37 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for BCL2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 37 ggactnnngt ccggtattcg cagaagtc 28 <210> 38 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for MTHFR <400> 38 gtgctgtgct gttggaaggt gcaagat 27 <210> 39 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for MTHFR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 39 gatccnnnga aggtgtctgc gggatc 26 <210> 40 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for MTHFR <400> 40 gcttatcaag tggttctgat gacagccac 29 <210> 41 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for MTHFR <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 41 tcgatnnngc gtgatgatga aatcga 26 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for JAK2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 42 aatatnnngg ttttaaatta ggagtatatt 30 <210> 43 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for JAK2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 43 ctttcnnngt catgctgaaa gtaggagaaa g 31 <210> 44 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for JAK2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 44 tgaaannnta gtccacagtg ttttcagttt ca 32 <210> 45 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 45 caggannngc aaagatgaaa ttcctg 26 <210> 46 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 46 taggannnag caaagatgaa attccta 27 <210> 47 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 47 caggannngg agaatttacc tttcctg 27 <210> 48 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 48 gaggannngg agaatttacc tttcctc 27 <210> 49 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 49 catcannnca tttctctccc tgatg 25 <210> 50 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for COX2 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 50 ctgcannngt atatctgctc tatatgcag 29 <210> 51 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for FLT3 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 51 gctggnnngc aatttaggta tgaaagccag c 31 <210> 52 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for FLT3 <220> <221> modified_base <222> (6) <223> n is deoxyinosine <400> 52 tctcannngc ttgggtgaaa gagtgaga 28

Claims (16)

An oligonucleotide of the dumbbel structure represented by the following formula 1:
<Formula 1>
5'-ABC-3 '
In this formula,
A is a low T m specificity region comprising 3 to 15 nucleotides having a base sequence complementary to the 3'-terminal consecutive nucleotide sequence of the oligonucleotide;
B is a segmented region comprising 3 to 5 nucleotides with a universal base;
C is a high Tm specific region comprising 3 to 20 nucleotides with a base sequence complementary to the target nucleotide sequence of the template nucleic acid.
The method according to claim 1,
Wherein the Tm of the low Tm specificity region is lower than the Tm of the high Tm specificity region.
The method according to claim 1,
Wherein the Tm of the segment is lower than the Tm of the low Tm specificity region and the Tm of the high Tm specificity region.
The method according to claim 1,
Wherein the Tm of the low Tm specificity region is between 10 and &lt; RTI ID = 0.0 &gt; 35 C. &lt; / RTI &gt;
The method according to claim 1,
Wherein the Tm of the segmented region is between 3 and &lt; RTI ID = 0.0 &gt; 10 C. &lt; / RTI &gt;
The method according to claim 1,
Wherein the high Tm specificity region has a Tm of from 50 to 65 DEG C. 2. The oligonucleotide according to claim 1,
The method according to claim 1,
Wherein the universal base is selected from the group consisting of dioxyinosine, inosine, 7-diaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMe inosine, &Lt; / RTI &gt; oligonucleotides of the dumbbell structure.
The oligonucleotide of claim 1, wherein the oligonucleotide of the dumbbell structure is used as a primer in a polymerase chain reaction (PCR).
2. The oligonucleotide of claim 1, wherein the oligonucleotide of the dumbbell structure is used to detect a polymorphism of a gene selected from the group consisting of:
(1) 465899C / T polymorphism of the APC gene;
(2) IIe105Val, GSTT and GSTM polymorphisms of the GST gene;
(3) 579 G> T polymorphism of DNMT3B gene;
(4) T1799A polymorphism of the BRAF gene;
(5) the Arg194Trp polymorphism of the XRCC1 gene;
(6) 347 G> GA polymorphism of the CDH1 gene;
(7) -93 G > A polymorphism of MLH1 gene;
(8) the 938 C> A polymorphism of the BCL2 gene;
(9) 2014 G> A polymorphism of the ESR gene;
(10) C677T polymorphism of the MTHFR gene;
(11) Intron 17 of RB gene A> G polymorphism
(12) T790M polymorphism of the EGFR gene
(13) 7654 G> C, 1195 AA polymorphism of the COX2 gene;
(14) V617F polymorphism of the JAK2 gene; And
(15) IDT polymorphism of the FLT3 gene.
The method according to claim 1,
Wherein the dumbbell structure oligonucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 52.
A method for amplifying a nucleic acid comprising the step of performing a polymerase chain reaction using an oligonucleotide of the dumbbell structure of claim 1 as a primer.
There is provided a method for detecting a gene mutation, which comprises detecting a gene mutation by a polymerase chain reaction using an oligonucleotide of the dumbbell structure of claim 1 as a primer.
(i) obtaining DNA from a sample of an individual;
(ii) performing a polymerase chain reaction from the DNA using the oligonucleotide of the dumbbell structure of claim 9 as a primer; And
(iii) analyzing the polymorphism of a gene selected from the group consisting of
A method for predicting the risk of developing cancer in an individual, comprising:
(1) 465899C / T polymorphism of the APC gene;
(2) IIe105Val, GSTT and GSTM polymorphisms of the GST gene;
(3) 579 G> T polymorphism of DNMT3B gene;
(4) T1799A polymorphism of the BRAF gene;
(5) the Arg194Trp polymorphism of the XRCC1 gene;
(6) 347 G> GA polymorphism of the CDH1 gene;
(7) -93 G > A polymorphism of MLH1 gene;
(8) the 938 C> A polymorphism of the BCL2 gene;
(9) 2014 G> A polymorphism of the ESR gene;
(10) C677T polymorphism of the MTHFR gene;
(11) Intron 17 of RB gene A> G polymorphism
(12) T790M polymorphism of the EGFR gene
(13) 7654 G> C, 1195 AA polymorphism of the COX2 gene;
(14) V617F polymorphism of the JAK2 gene; And
(15) IDT polymorphism of the FLT3 gene.
14. The method of claim 13,
Wherein the risk of cancer is high when the genotype of any one of the genes selected from the group below is present in step (iii).
(1) the 465899C / T CC genotype of the APC gene;
(2) IIe105Val GG genotype, GSTT null and GSTM null polymorphism of the GST gene;
(3) 579 G> T TT genotype of the DNMT3B gene;
(4) T1799A AA genotype of the BRAF gene;
(5) Arg194Trp CC genotype of XRCC1 gene
(6) CDH1 gene 347 G> GA AA genotype
(7) -93 G> A GG genotype of MLH1 gene
(8) 938 C> A CC genotype of the BCL2 gene
(9) 2014 G> A GG genotype of the ESR gene;
(10) C677T TT genotype of the MTHFR gene;
(11) Intron 17 of RB gene A> G AA genotype;
(12) T790M AA genotype of the EGFR gene;
(13) 7654 G> C GG genotype and 1195 AA genotype of COX2 gene
(14) the V617F genotype of the JAK2 gene; And
(15) IDT genotype of FLT3 gene.
14. The method of claim 13,
Wherein said cancer is selected from gastric cancer, prostate cancer, colon cancer, thyroid cancer, ovarian cancer, breast cancer, uterine cancer, pancreatic cancer, lung cancer, liver cancer, thyroid cancer, esophageal cancer, renal cancer and retinoblastoma.
A kit for predicting the risk of developing cancer in an individual, the oligonucleotide of the dumbbell structure of claim 9.

Images