KR20160079269A - Anti-inflammatory pharmaceutical composition and health functional food containing artemisia fermentation extract - Google Patents

Abstract

The present invention relates to an anti-inflammatory pharmaceutical composition comprising a fermented extract of Artemisia argyi, and to a health functional food for alleviating the inflammation. According to the present invention, the fermented extract of Artemisia argyi contained as an active ingredient inhibits the expression or the synthesis of a substance for inducing or mediating an inflammatory reaction. The fermented extract of Artemisia argyi is extracted from a natural plant, thereby being used as a functional ingredient of a pharmaceutical product and a food in a safe manner without a problem of toxicity even if the fermented extract of Artemisia argyi is injected in the human body.

Description

FIELD OF THE INVENTION [0001] The present invention relates to an anti-inflammatory pharmaceutical composition containing a leaf fermentation extract and a health functional food,

The present invention relates to a pharmaceutical composition using natural materials and a health functional food, and more particularly, to an anti-inflammatory pharmaceutical composition containing a fermented leaf extract as an active ingredient and a health functional food for improving inflammation.

Inflammation is one of defense mechanisms of biological tissue against external stimuli such as trauma or bacterial invasion, and is a complicated lesion involving tissue degeneration, circulatory disorder, and tissue proliferation. When an inflammatory reaction occurs, a variety of inflammatory mediators are produced, leading to clinical symptoms such as redness, swelling, and pain.

Recently, due to environmental pollution and excessive stress caused by rapid industrialization, the health of modern people has been greatly threatened. In particular, the rate of occurrence of various inflammatory diseases has been steadily increasing every year. For example, in osteoarthritis, a typical inflammatory disease, approximately 80% of people over 55 years of age and 75 years of age or older in Korea have a degree of osteoarthritis. However, almost all people are known to have osteoarthritis It is noted above.

Since inflammation is accompanied by massive release of substances such as nitric oxide (NO) and prostaglandin E ₂ (PGE ₂ ) during the course of the process, inducible nitric oxide (iNOS), known as the enzyme producing these substances, and cyclooxygenase The development of therapeutic agents has been under way focusing on the inhibition of the expression of Cyclooxygenase 2 (COX-2).

Currently, non-steroidal or steroidal compounds are mainly used for the treatment of inflammatory diseases, but steroidal compounds can disrupt the immune system by disrupting the cytokine network associated with lymphocyte function, , There was a risk of inducing skin atrophy by reducing collagen synthesis, and therefore, it was difficult to take it for a long time. In addition, safety issues such as gastrointestinal and cardiovascular side effects are constantly being raised. Therefore, it is urgent to develop a therapeutic agent for inflammatory diseases more safely, and relatively safe natural materials are pointed out as an alternative to chemicals causing various side effects.

The leaves of Artemisia argyi , A. princeps var. Orientalis (Pampan) A. asiatica , A. montana , A. mongolica , and young stems belonging to the family Asteraceae It refers to dried herbal medicine. Young leaves were used as mugwacke for edible purposes, and they were used as medicines for gynecological bleeding, uterine bleeding and hemorrhage during pregnancy, gynecological diseases and diarrhea. In the Korean Pharmacopoeia and Herbal Medicine Specification Collection, the leaves and young stems of the mugwort are also referred to as ael ( Artemisia argyi Herb).

Regarding the physiological effect of lye, Korean Patent No. 10-0727887 discloses that hot-water extract or alcohol extract of lye is effective for the treatment or prevention of osteoporosis. In Korean Patent No. 10-1239516, Based on the fact that it protects the surface damage of hair by hydrogen peroxide, it proposes a hair protecting cosmetic containing a lady extract.

In addition, eupatilin, one of the components of the leaf extract, was found to be effective in reducing diabetes by promoting insulin secretion by lowering blood glucose (Kang YJ et al., 2008. Diabetes Res. Clin. Pract. 82: 25-32) (Park JY et al., 2008. J. Med. Food 11: 237-245) and have been shown to be effective against atherosclerosis (Han JM et al., 2009. J. Agric. Food. Chem. 57: 1267-1274). However, more research is still needed on the new physiological function of LEE.

The present invention has been proposed in order to solve the problems of the prior art described above, and an object of the present invention is to provide an antiinflammatory pharmaceutical composition containing, as an active ingredient, a natural material excellent in the pharmacological effect without adverse side effects .

Another object of the present invention is to provide a health functional food for improving inflammation which contains a natural material having no side effects or toxicity as an effective ingredient.

According to an aspect of the present invention, the present invention provides a method for producing artemisia argyi ( A. princeps Pampan , A. asiatica , Artemisia montana , A. mongolica ) fermented by a strain of Bacillus sp. The present invention provides an anti-inflammatory pharmaceutical composition comprising a fermented extract as an active ingredient.

For example, the leaf cultured fermentation extract may be contained in the pharmaceutical composition at a concentration of 1 to 1000 μg / ml.

In the exemplary embodiment, the Bacillus strain is Bacillus subtilis (Bacillus subtilis), Bacillus piece you formate miss (Bacillus licheniformis), Bacillus pumi Ruth (Bacillus pumilus), and Bacillus Sono alkylene cis selected from the group consisting of (Bacillus sonorensis) One or more strains.

According to another aspect of the present invention, there is provided a fermented extract of Artemisia argyi , A. princeps Pampan , A. asiatica , Artemisia montana , and A. mongolica fermented by a strain of Bacillus sp. To provide a health functional food for improving inflammation.

According to the present invention, the fermentation extract of the leaf fermented by the strain of Bacillus subtilis inhibits the expression of the factors mediating or inducing the inflammatory reaction, and thus the anti-inflammatory effect is very excellent. In addition, since the fermented extract of lobster does not have cytotoxicity, it does not cause side effects or toxicity even when administered to a human body, thus securing safety.

Therefore, the fermented extract of the leaf of the present invention can be utilized as an effective ingredient of a health functional food, which is a food engineering composition for improving inflammation, as well as an active ingredient of a pharmaceutical composition which is a pharmaceutical composition for anti-inflammation. For example, the leaf cultured fermented extract of the present invention can be used as a pharmaceutical composition for treating and / or preventing osteoarthritis, which is a typical inflammatory disease, or as an active ingredient of a health functional food for improving osteoarthritis.

FIG. 1 is a graph showing cell survival rate after administration of a leaf cultured fermented extract to Raw264.7 cells, which is a mouse macrophage cell line, according to an exemplary embodiment of the present invention.
FIG. 2 is a graph showing cell survival rate after administration of a non-fermented lobule extract to Raw264.7 mouse macrophage cell line according to a comparative example.
FIG. 3 is a graph showing the degree of production of nitrogen monoxide (NO) after administration of a leaf cultured fermented extract to Raw264.7 mouse macrophage cell line according to an exemplary embodiment of the present invention.
FIG. 4 is a graph showing the degree of production of nitrogen monoxide (NO) after administration of non-fermented lobule extract to Raw264.7 mouse macrophage cell line according to a comparative example.
FIG. 5 is a graph showing the relationship between the gene level (A) and the protein level (B) of iNOS in the mouse macrophage cell line Raw264.7 cells after RT- Of the present invention.
FIG. 6 is a graph showing the gene expression level of COX-2 by RT-PCR after administration of a fermented leaf extract to Raw264.7 cells, which is a mouse macrophage cell line, according to an exemplary embodiment of the present invention.
FIG. 7 is a graph showing the expression of TNF-α and IL-1β, which are inflammatory cytokines, by RT-PCR after administration of a fermented leaf extract to Raw264.7 cells of the mouse macrophage cell line according to an exemplary embodiment of the present invention It is the photograph which measured the degree.

Hereinafter, the present invention will be described in more detail with reference to the accompanying drawings where necessary.

The present invention includes an anti-inflammatory pharmaceutical composition relating to the treatment and / or prevention of an inflammatory disease such as osteoarthritis, or a leaf cultured fermentation extract as an active ingredient of a health functional food for improving inflammatory diseases or inflammation . That is, the present invention relates to an anti-inflammatory pharmaceutical composition containing a leaf cultured fermented extract as an active ingredient and a food engineering composition such as a health functional food for improving inflammation.

Artemisia argyi , A. princeps var. Orientalis (Pampan) A. asiatica , Artemisia montana and Artemisia mongolica leaves and / or young stems belonging to the family Asteraceae Means dried natural materials.

According to the present invention, in order to obtain a fermented extract of a leaf, fermenting the leaf with, for example, a strain of Bacillus sp., Fermenting the leaf, and extracting the fermented leaf .

Fermentation refers to a kind of bioconversion process for producing substances useful in human life by decomposing organic matter using enzymes possessed by microorganisms. In the fermentation step, microbial strains belonging to the genus Bacillus sp. Can be used to ferment the leaves. Bacillus strains can be used to ferment aeyeop, for example, Bacillus called Bacillus subtilis subtilis (Bacillus subtilis), Bacillus piece you formate miss (Bacillus licheniformis), Bacillus pumi Ruth (Bacillus pumilus), and Bacillus Sono alkylene cis ( Bacillus sonorensis ). ≪ / RTI > These Bacillus spp. Strains can be easily purchased, for example, from the Microbial Resource Center.

In an exemplary embodiment, the Bacillus subtilis strain, which is a fermentation strain for fermenting leaves, may be inoculated at a concentration of 3 to 10% (v / v) in distilled water used for fermentation. If the inoculation amount of the strain is less than this, the fermentation time may become too long, and even if the inoculation amount of the strain is less than this, the fermentation time may not be shortened, resulting in waste of the fermentation strain. In an exemplary embodiment, the fermentation process may be performed at a temperature of about 25-35 DEG C for 24-96 hours, although the invention is not so limited.

According to an exemplary embodiment, the fermentation broth containing the lobes fermented by the strain of Bacillus subtilis is extracted using an appropriate solvent. The extraction solvent that can be used is an organic solvent such as 50% to 100% of a polar solvent such as methanol, 1 to 4 carbon atoms such as ethanol and ethyl acetate, and a nonpolar solvent of hexane, chloroform or dichloromethane, or a mixed solvent thereof . Alternatively, a hydrothermal extraction method may be used.

For example, it is preferable that the leaf which has been fermented and dried by the strain of Bacillus subtilis is pulverized into an appropriate size, put into an extraction container, and added with an appropriate amount of solvent, for example, about 5 to 20 times as much as the fermentation broth, Or refluxed to obtain a leaf culture fermented extract. This process can be repeated several times or more in order to increase the extraction efficiency of the leaves. If necessary, the extract may be filtered and concentrated under reduced pressure to produce a leaf culture fermented extract.

For example, the salt and impurities of fermented leaves are removed and dried to prepare a dry sample. Then, a crude extract can be obtained by adding ethanol and / or methanol to the dried sample, followed by reflux extraction, or by heating at room temperature to obtain a crude extract. The crude extract can be concentrated under reduced pressure to prepare a leaf extract. The removal of salt and impurities of the fermented leaves can be carried out by washing with running water. The dried sample can be prepared by drying the fermented leaf after removing the salt and impurities, followed by pulverization. If necessary, the obtained leaf culture fermented extract can be stored in a deep freezer until used.

Alternatively, the leaf cultured fermented extract may be one obtained by completely removing the water through concentration and lyophilization of the obtained extract, and using the leaf cultured fermented extract in which the water is completely removed, or dissolving the powder in distilled water or a usual solvent Can be used.

If necessary, the leaf cultured fermentation extract extracted with the solvent may be further fractionated with a solvent selected from the group consisting of hexane, methylene chloride, acetone, ethyl acetate, ethyl ether, chloroform, water and mixtures thereof. This fractionation process can be performed at 4 캜 to 120 캜, but is not limited thereto. One or more solvents may be used in the fractionation.

The thus-prepared extract or the fraction obtained by performing the fractionation process may be filtered, concentrated or dried to remove the solvent, and may be subjected to both filtration, concentration and drying. Specifically, the filtration can be performed using a filter paper or a vacuum filter, and the concentration can be reduced by using a vacuum concentrator, for example, a rotary evaporator. The drying can be performed by, for example, freeze drying. Alternatively, the leaf extract fermented extract fraction may be obtained by completely removing moisture through concentration and lyophilization of the obtained fraction solution.

According to the present invention, the leaf cultured fermented extract has an anti-inflammatory effect and an inflammation-improving effect. Inflammation is one of the defense mechanisms of biological tissue against injury of a living body caused by a certain stimulus, and morphologically appears as degenerative lesion, circulatory disorder, and tissue proliferation. In the present invention, the degree of expression of inflammatory mediators or inducers was examined in order to examine the safety and anti-inflammatory effect of the fermented extracts of the fungus.

Specifically, in the present invention, macrophages were used to investigate the anti-inflammatory effect, which is a physiological activity effect on the leaf cultured fermentation extract obtained through the above-described method. Macrophages are one of the predominant cells in the immune system and are widely distributed in each tissue and play an important role in the immune system. Macrophages migrate within the blood vessels in the form of monocytes from bone marrow precursor cells derived from precursor cells called hematopoietic stem cells in the bone marrow, and then differentiate into macrophages in the tissues. In particular, RAW264.7 cells, a cell line of murine macrophages, are well known. Differentiated macrophages are surface receptors capable of recognizing and binding to common bacterial surfaces, and they are activated by antigenic stimulation (IL-6), interleukins such as IL-1β, IL-6 and IL-12, and cytokines such as tumor necrosis factor-α and TNF-α to mediate local inflammatory responses It acts on vascular endothelial cells to regulate the immune response by increasing the expression of surface molecules that mediate leukocyte adhesion.

First, in the example of the present invention, when the rabbit fermentation extract was administered to the mouse macrophage cell line Raw264.7 cell line, the survival rate was good and it was confirmed that the leaf fermentation extract was not toxic to the living body (see FIG. 1 ). In particular, according to the present invention, the leaf culture fermented extract fermented by the strain of Bacillus sp. Was not cytotoxic compared with the extract of the leaf extract (see FIG. 2) without performing the fermentation process, .

In order to examine the anti-inflammatory effect of the present invention, Raw264.7 cells of mice were examined to determine whether the factors mediating or inducing an inflammatory reaction were inhibited by the leaf culture fermented extract of the present invention. Specifically, in accordance with an exemplary embodiment of the present invention, tumor necrosis factor-alpha (TNF-a) and interleukin-1 beta (IL), which are iNOS, COX-2 and inflammatory cytokines, as mediators and / -1β), the expression of these factors in vivo was inhibited by administration of the leaf cultured fermented extract.

The macrophages responsible for congenital immunity have been shown to produce a variety of substances such as nitric oxide (NO), prostaglandins (PGs) and inflammatory cytokines as a result of external stimuli such as lipopolysaccharide (LPS) Are known to induce various pathological responses that regulate the inflammatory response.

In vivo, nitric oxide (NO) acts as a cytotoxic substance such as inhibiting the metabolism of pathogens or destroying DNA, and is involved in inflammatory reactions such as pathogen removal. That is, nitrogen monoxide is a mediator of inflammation in vivo, and macrophages involved in innate immunity produce NO when an inflammatory reaction occurs by external stimulation.

NO plays a physiologically important function such as homeostasis of blood vessels, induction of apoptosis and neurotransmitters in normal state, but excess NO acts as a cause of acute or chronic inflammatory disease by killing normal cells and inducing inflammation. Thus, effective regulation of NO production is of great importance in the treatment of acute or chronic inflammatory diseases.

Accordingly, in another embodiment of the present invention, the production or expression level of inflammation-associated substances was measured when the leaf cultured fermented extract was administered. According to the present invention, it was confirmed that the administration of the fermented extract of the leaves to the macrophage cell line inhibits the production of nitrogen monoxide (NO) (see FIG. 3). In particular, according to the present invention, the leaf cultivar fermented by fermentation with a strain of Bacillus sp. Has a maximum inhibitory effect on the production of nitrogen monoxide compared to the leaf extract (see FIG. 4) Nearly improved. Compared with the simple leaf extract which has not undergone fermentation process, the fermented Leaf leaf extract after fermentation process is not toxic, thus further securing the safety. Especially, the anti-inflammatory activity is greatly increased, which is an unexpected effect.

On the other hand, nitrogen monoxide is an endothelium-derived relaxing factor (EDRF), which is biosynthesized from arginine and oxygen atoms by various nitric oxide synthases (NOS) As well as by macrophage-like phagocytes as part of the immune response of the immune system. In other words, nitrogen monoxide is an important inflammatory mediator in vivo.

Nitric oxide synthase (NOS), which synthesizes nitrogen monoxide in vivo, synthesizes nitrogen monoxide in nerve tissue to produce neuronal nitric oxide synthase (nNOS), which is involved in cell communication, The endothelial nitric oxide synthase (eNOS), which produces nitric oxide and is involved in vascular function, and inducible nitric oxide synthase (eNOS), which is greatly activated when mediated by the immune response, synthase, iNOS).

nNOS and eNOS are constantly expressed in vivo to perform physiological functions such as neurotransmission and vasodilation, whereas iNOS plays a role in the regulation of LPS, interferon-gamma (IFN-γ), tumor necrosis factor (TNF) It is known that exposure to the same inflammatory cytokine or rapid activation of immune cells that have encountered a bacterial toxin produces excessive amounts of nitrogen monoxide, thereby causing an inflammatory reaction by nitrogen monoxide. Nitric Oxide, which is overproduced by iNOS, causes autoimmune diseases, inflammatory diseases and sepsis.

In one embodiment of the present invention, the expression of iNOS inducing an inflammatory response is induced by administering a leaf culture fermented extract obtained according to the present invention using a reverse transcriptase polymerase chain reaction (RT-PCR) , It was confirmed that the leaf cultured fermented extract of the present invention suppresses the expression of these enzymes at the protein level as well as at the gene level, that is, the mRNA level (see FIG. 5).

On the other hand, prostaglandins (PGs), which are biosynthesized from essential fatty acids (EFAs), regulate hormone responses as well as mediate inflammatory responses. Prostaglandins are produced from arachidonic acid, a type of essential fatty acid, by constitute cyclooxygenase (COX-1) and inducible cyclooxygenase (COX-2) . COX-1 is constantly expressed in most tissues and regulates the physiological function of maintaining the homeostasis of the body. On the other hand, COX-2 is overexpressed only in macrophages and monocytes by stimulation of IL-1, TNF-α, and LPS.

In other words, the prostaglandin in the immune response that occurs in immune cells such as macrophages is is generated by the most COX-2, COX-2 is prostaglandin _{E 2 (prostaglandin E 2; PGE} 2) inflammatory factor involved in pain and fever that . PGE ₂ produced by COX-2 is known to be a causative agent of inflammatory responses by inducing the activity of immune-related cells such as dendritic cells, NK cells and macrophages.

For this reason, many of the substances developed to induce an immune-enhancing effect have been shown to inhibit the nuclear factor kappa-kappaB (NF-κB), a transcriptional regulator that is activated by iNOS or COX-2 activation or by signal transduction mechanisms (COX-2), which inhibits the signaling of light-chain-enhancer of activated B cells.

In one embodiment of the present invention, the anti-fungal extract of the present invention is administered to a cell using the Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) method to induce the inflammatory response of COX-2 The degree of induction was confirmed, and it was confirmed that the leaf cultured fermented extract of the present invention inhibited the expression of these enzymes at the gene level, that is, the mRNA level (see FIG. 6).

On the other hand, IL-1β, a cytokine that is deeply involved in the initial inflammatory reaction, exerts an exothermic effect upon inflammatory reaction and is involved in tumorigenesis together with TNF-α. On the other hand, TNF-a is involved in acute-phase reaction in systemic inflammation and immune response.

In the present invention, it was confirmed that the secretion of IL-1β and TNF-α, which are major cytokines involved in the inflammatory reaction, was significantly inhibited by administration of the leaf cultured fermentation extract to the macrophage line of mice (see FIG. 7).

Therefore, according to one aspect of the present invention, the present invention relates to an antiinflammatory pharmaceutical composition comprising a leaf cultured fermented extract as an active ingredient. The leaf cultured fermentation extract as an active ingredient in the pharmaceutical composition of the present invention may be used alone, and may further contain additional components, that is, a pharmaceutically acceptable carrier, excipient, diluent or subcomponent depending on the formulation, . In an exemplary embodiment, the leaf cultured fermentation extract may be contained in the pharmaceutical composition at a concentration of 1 to 1000 μg / ml, but the present invention is not limited thereto.

The antiinflammatory pharmaceutical composition containing the leaf cultured fermented extract according to the present invention may be administered orally or parenterally in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups or aerosols, external preparations, May be formulated in the form of injection solutions. For example, the compound of the present invention can be administered orally or parenterally in various formulations during clinical administration. In the case of formulation, the fillers, extenders, binders, humectants, surfactants, anticoagulants, lubricants , A wetting agent, a flavoring agent, an emulsifying agent or an antiseptic, and the like, and either orally or parenterally may be used.

Examples of the carrier, excipient and diluent which can be contained in the pharmaceutical composition including the leaf cultured fermented extract include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin , Calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil, dextrin, calcium carbonate, Propylene glycol, liquid paraffin, and physiological saline. However, it is not limited to these, and any conventional carrier, excipient or diluent may be used. The above components may be added to the leaf cultured fermentation extract, which is an effective ingredient of the pharmaceutical composition of the present invention, independently or in combination.

Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like. These solid preparations can be prepared by mixing at least one excipient such as starch, calcium carbonate, Sucrose, lactose, gelatin and the like. In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions and syrups. Various excipients such as wetting agents, sweeteners, fragrances and preservatives may be included in addition to water and liquid paraffin, which are commonly used simple diluents. have.

Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like. As a suppository base, witepsol, macrogol, tween 61, cacao paper, laurin, glycerol, gelatin and glycerogelatin can be used. The pharmaceutical composition of the present invention can be administered parenterally, subcutaneously, intravenously or intramuscularly.

Examples of the form for parenteral administration include toothpastes, mouthwashes, topical administration agents (creams, ointments, dressing solutions, sprays, and other coating agents). An example of the formulations of the topical administration agent may be one in which the active ingredient, Leaf Leaf Extract, is impregnated with a carrier such as gauze made of natural fibers or synthetic fibers. In the case of the cream or ointment, it may be suitable for direct application to the site of inflammation. In the case of the above-mentioned spray agent, the spray agent may be manufactured by a conventional spray agent manufacturing method except that it contains a fermented extract as an active ingredient, and it is filled and packed in a compression vessel or other spray vessel to spray the oral disease part frequently. Prevention or treatment. In the case of the dressing solution, the dressing solution may be prepared by a conventional method for producing a dressing solution, except that it contains a fermented leaf extract as an active ingredient.

Further, the antiinflammatory pharmaceutical composition of the present invention may be administered using any suitable method known in the art or by methods described in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA Can be preferably formulated.

In addition, the antiinflammatory pharmaceutical composition may further contain, in addition to the active ingredient, a nutrient, a vitamin, an electrolyte, a flavoring agent, a coloring agent, a thickening agent, a pectic acid and a salt thereof, alginic acid and its salt, an organic acid, a protective colloid thickener, Stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated drinks, and the like.

According to another aspect of the present invention, the present invention relates to a food engineering composition and / or a health functional food for improving inflammation comprising an effective ingredient of a leaf cultured fermented extract. Foods to which the leaf cultured fermented extract of the present invention can be added include, for example, various foods, beverages, gums, candies, tea, vitamin complexes, and functional foods.

For example, examples of foods that can be supplemented with the leaf cultured fermented extract include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, Drinks, tea, drinks, alcoholic beverages, and vitamin complexes, all of which include health functional foods in a conventional sense.

The health functional food may include a food-aid-acceptable food-aid additive in addition to the effective ingredient for improving inflammation, such as a leaf cultured fermented extract, and further includes suitable carriers, excipients and diluents commonly used in the production of health functional foods . The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Illustratively, the amount of the leaf cultured fermented extract in the health functional food or drink may be from 0.01 to 15% by weight of the total food, and the health beverage composition may comprise from 0.02 to 5 g, preferably from 0.3 to 1 g, . However, in the case of long-term consumption intended for health or hygiene purposes or for health control purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range.

The health functional food of the present invention includes forms such as tablets, capsules, pills, and liquids. The health functional food of the present invention is not particularly limited to other components except for containing the leaf cultured fermented extract as an active ingredient and may be added with various additives such as various flavorings or natural carbohydrates, ≪ / RTI >

Examples of natural carbohydrates are monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose and the like; And sugar alcohols such as xylitol, sorbitol and erythritol as well as conventional sugars such as polysaccharides such as dextrin and cyclodextrin. Natural flavors / sweeteners such as tautatin, stevia extract (e.g., rebaudioside A, glycyrrhizin) as flavorings or sweeteners other than those mentioned above; Synthetic flavorings / sweeteners such as saccharin and aspartame may be used.

In addition, the health functional food containing the leaf cultured fermented extract of the present invention can be used as a nutritional supplement, a vitamin, a mineral (electrolyte), a flavor such as a synthetic flavor and a natural flavor, a coloring agent and an aging agent (cheese, Acid and its salts, alginic acid and its salts, organic acids, protective colloid thickening agents, pH adjusting agents, stabilizers, preservatives, glycerin, carbonating agents used in alcoholic carbonated beverages and the like. In addition, the health functional food according to the present invention may contain natural fruit juice, fruit juice beverage and flesh for the production of vegetable beverage. These components may be used independently or in combination. Although the ratio of such additives is not so important, it is generally selected in the range of 0 to about 20 parts by weight, preferably 0.01 to 1.0 part by weight, per 100 parts by weight of the leaf cultured fermented extract of the present invention.

Hereinafter, the present invention will be described in detail with reference to exemplary embodiments. However, the present invention is not limited to the technical idea described in the following embodiments.

Example 1: Preparation of a fermented leaf extract of a fungus fermented by a Bacillus subtilis strain

The leaf cultured fermented extract was prepared by the following method. Bacillus subtilis (KCTC 3617), a microorganism strain used in the fermentation of the present invention, was distributed at the microbial resource center in Daejeon, Republic of Korea. To 100 g of dried leaves ( Artemisia princeps Pampan), 100 ml of distilled water was added and sterilized at 121 캜 for 15 minutes. The sterilized leaflets were sufficiently cooled and then inoculated with 5% (v / v) of Bacillus subtilis cultured in YM medium (BD Bioscience, USA) for 24 hours and cultured at 30 ° C for 3 days. Then, 1,000 ml of 70% (v / v) ethanol was added to the leaves which had been fermented by Bacillus subtilis, and the mixture was refluxed for 3 hours. The extract was filtered through a filter paper and concentrated under reduced pressure at 60 ° C using a conventional concentrator. Thereafter, the concentrate was lyophilized to give 24.3 g of a leaf culture fermented extract as a dry weight, which was used as the following experimental sample.

Comparative Example: Preparation of lobule extract

1,000 g of 70% (v / v) ethanol was added to 100 g of the dried leaf, followed by reflux extraction for 3 hours. The extract was filtered through a filter paper and concentrated under reduced pressure at 60 DEG C using a conventional concentrator. Thereafter, the concentrate was lyophilized to obtain 23.7 g of a leaf culture fermented extract at a dry weight, which was used as the following experimental sample.

Example 2: Evaluation of cytotoxicity of leaf extract

The cell viability was measured by administering the leaf cultures of Example 1 and the leaf extracts prepared in Comparative Example to mouse macrophages, and cytotoxicity of the leaf cultures was evaluated. The mouse macrophage cell line Raw264.7 cells used in this example was purchased from Korean Cell Line Bank (KCLB, Seoul, Korea) and used in Dulbecco's Modified (Gibco BRL, Grand Island, NY, USA) supplemented with 10% FBS And cultured in Eagle's Medium (DMEM; Gibco BRL) at 37 ° C and 5% CO ₂ .

Soluble tetrazolium salt (WST) assay was performed using a cell counting kit (Dojindo, Japan) to evaluate the cytotoxicity of the leaf cultured fermented extract before evaluating the anti-inflammatory effect of the fermented extract. Raw264.7 cells were inoculated at a density of 1 × 10 ⁵ cells / well in a 96-well plate and cultured for 12 hours. Then, the leaf cultured fermented extracts were treated at different concentrations (0, 5, 10, 25, 50 and 100 μg / mL) And cultured for 24 hours. 10 μl of WST-8 solution per well was added and reacted at 37 ° C and 5% CO ₂ for 2 hours. Then, 450 μl of 450 μl of the WST-8 solution was added using an ELISA reader (BIO-TEK Instruments Inc. Power wave X340, Winooski, nm absorbance was measured. The experimental values were expressed as a percentage of the control group in which the leaf cultured fermented extract was not treated.

FIG. 1 is a graph showing the cell survival rate of a mouse macrophage cell line administered with a leaf cultured fermented extract, FIG. 2 is a graph showing the cell survival rate of a mouse macrophage cell line administered with the leaf extract prepared in Comparative Example, It is a graph. As shown in FIG. 1, even when the leaf cultured fermented extract was administered, the survival rate was 100% or more. On the other hand, the cell survival rate of the mice administered with the leaf extract was found to be lower than that of the leaf cultures.

Example 3 Effect of Leaf Blight-Extract on Inhibition of NO Production

In order to investigate the anti - inflammatory effect of leaf extracts, Raw264.7 cells were treated with LPS to induce inflammation, and then Griess reagent reaction method Respectively. Raw 264.7 cells were inoculated at a density of 1 × 10 ⁵ cells / well in a 96-well plate and cultured for 12 hours. LPS (1 μg / mL) was then used alone or in various concentrations (0, 5, 10, mL) were cultured for 24 hours. The same amount of Griess reagent (1% sulfanilamide and 0.1% N- [1-naphthy] -ethylenediamine dihydrochloride in 5% phosphoric acid) was added to the culture solution and reacted at room temperature for 10 minutes. Then, absorbance at 540 nm Were measured. The NO concentration was calculated based on the quantitative curve prepared using NaNO ₂ standard solution. The results of the measurement according to the present embodiment are shown in Fig. 3, and the measurement results of the mice administered with the lysolecule extract are shown in Fig.

The amount of NO produced in the LPS - treated group was about 25 μM, which was about 6 times higher than that in the group not treated with LPS. However, it was confirmed that the NO production was decreased depending on the concentration of the leaf cultured fermented extract when various concentrations of the leaf cultured fermented extract were treated. In particular, it was confirmed that the fermented leaf cultured by the fermentation treatment inhibited the production of NO at up to 50%, compared with the case of administration of the leaf extract without fermentation.

Example 3: Inhibitory effect of iNOS gene and protein expression on leaf extract

In order to investigate the effect of the leaf cultured fermented extract on inhibition of protein expression of iNOS, an enzyme for synthesizing NO, which is an immunological mediator, Raw264.7 cells were plated at 6 × 10 ⁶ cells / well in a 6-well plate and cultured for 12 hours LPS was then incubated with LPS alone or with various concentrations (0, 10, 25 and 50 ug / mL) of the leaf cultured fermentation extract for 24 hours. The culture medium was discarded and washed twice with phosphate buffered saline (PBS; Gibco BRL). Intracellular proteins were obtained using RIPA buffer (Cell Signaling, Danvers, MA, USA). Protein concentration was measured using a BCA protein assay reagent kit (Pierce, Rockford, Ill., USA), and 20 μg of each protein was electrophoresed on a 10% SDS-PAGE gel. The nitrocellulose membrane (Whatman, Dassel , Germany). To prevent nonspecific binding of the antibody, 5% skim milk was added to the membrane for 1 hour and then replaced with 5% skim milk supplemented with iNOS (BD, USA) or β-actin (Sigma aldrich) And reacted for 12 hours. The cells were washed three times for 5 minutes with TBST (50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% Tween-20) and reacted with secondary antibodies for 1 hour at room temperature. Then, ECL solution (Amersham Pharmacia Biotech ., m NJ, USA).

In order to investigate the effect of the leaf culture on inhibition of iNOS mRNA expression, Raw264.7 cells were seeded at a density of 1 × 10 ⁶ cells / well in a 6-well plate and cultured for 12 hours. Then, LPS alone or in various concentrations (0, 10, 25, and 50 ㎍ / mL) and cultured for 12 hours. After the culture was discarded and washed twice with PBS, total RNA was isolated from the cells using total RNA extraction kit (iNtRON Biotechnology Inc., Korea). Total RNA was quantitated and each cDNA was synthesized from each total RNA of the same amount by 1 이용 using RT-PreMix (iNtRON Bioitechnology Inc.). RT-PCR was performed using a primer (forward primer: CCCTTCCGAAGTTTCTGGCAGCAGC; reverse primer: GGCTGTCAGAGCCTCGTGGCTTTGG) corresponding to iNOS gene at denaturation at 94 ° C for 1 min, annealing at 65 ° C for 40 sec, extension at 72 ° C for 1 min, RT-PCR was carried out in the same manner except that the primers corresponding to β-actin gene (forward: TGGAATCCTGTGGCATCCATGAAAC; reverse: TAAAACGCAGCTCAGTAACAGTCCG; purchased from Bioneer, Cat No. N-4021) were annealed at 56 ° C.

INOS expression was not observed in both the mRNA and protein in the LPS-treated group, whereas the iNOS mRNA and protein expression in the LPS-treated group was strong. However, it was confirmed that the expression of mRNA and protein of iNOS by LPS was greatly inhibited in the treatment of the leaf cultured fermented extract (Fig. 5).

Example 4 Effect of Leaf Blight Fermentation Extract on Inhibition of COX-2 Gene Expression

In order to investigate the effects of the leaf cultured fermented extract on inhibition of COX-2 mRNA expression, Raw264.7 cells were seeded at a density of 1 × 10 ⁶ cells / well in a 6-well plate and cultured for 12 hours. (0, 10, 25, and 50 ㎍ / mL) and cultured for 12 hours. After the culture was discarded and washed twice with PBS, total RNA was isolated from the cells using a total RNA extraction kit (iNtRON Biotechnology Inc.). Total RNA was quantitated and each cDNA was synthesized from each total RNA of the same amount by 1 이용 using RT-PreMix (iNtRON Bioitechnology Inc.). RT-PCR was performed using a primer (forward: CACTACATCCTGACCCACTT; reverse: ATGCTCCTGCTTGAGTATGT) corresponding to COX-2 gene at denaturation at 94 ° C for 1 min, annealing at 52 ° C for 40 sec, extension at 72 ° C for 1 min,

As in Example 3, COX-2 mRNA expression was not observed in the LPS-treated group, whereas COX-2 mRNA expression was strongly observed in the LPS-treated group. However, it was confirmed that the expression of COX-2 mRNA by LPS was also inhibited depending on the treatment concentration of the leaf cultured fermented extract (Fig. 6).

Example 5 Inflammatory cytokine inhibitory effect of Leaf leaf extract

In order to investigate the effect of cultured leaf extract on inhibition of TNF-α and IL-1β mRNA expression, Raw264.7 cells were seeded at a density of 1 × 10 ⁶ cells / well in a 6-well plate and cultured for 12 hours. Alone or with various concentrations (0, 10, 25 and 50 ug / mL) of the leaf cultured fermentation extract and cultured for 12 hours. After the culture was discarded and washed twice with PBS, total RNA was isolated from the cells using a total RNA extraction kit (iNtRON Biotechnology Inc.). Total RNA was quantified and each cDNA was synthesized from each total RNA of the same amount by 1 ㎍ using RT-PreMix (iNtRON Biotechnology Inc.). Denaturation was carried out using primers (purchased from Bioneer, Cat No. N-4015) corresponding to the TNF-α gene and primers corresponding to the genes of IL-1β (purchased from Bioneer, Cat No. N-4009) RT-PCR was performed under the conditions of annealing 60 ° C (TNF-α) / 58 ° C (IL-1β) for 40 seconds, extension 72 ° C for 1 minute, and total 30 cycles.

The expression of TNF-α and IL-1β mRNA increased by LPS treatment was inhibited depending on the treatment concentration of the fermented leaf extract, and this inhibitory effect was confirmed to be more prominent in the IL-1β gene than TNF-α (Fig. 7).

From these results, it was shown that the leaf extract inhibited NO production and inhibited COX-2 gene expression by inhibiting iNOS expression in LPS-induced mouse macrophages. Furthermore, inhibition of the production of inflammatory cytokines such as TNF- [alpha] and IL-1 [beta] was found to be very effective for anti-inflammation. As a result, it is considered that the possibility that the leaf cultured fermented extract is utilized as a functional material for the prevention and treatment of inflammatory diseases is sufficient.

Although the present invention has been described based on the exemplary embodiments and examples of the present invention, the present invention is not limited to the technical ideas described in the above-described embodiments and examples. On the contrary, it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the present invention. It will be apparent, however, that such modifications and changes are all within the scope of the present invention.

Claims (4)

An antiinflammatory pharmaceutical composition comprising a fermented extract of Artemisia argyi , A. princeps Pampan , A. asiatica , Artemisia montana , and A. mongolica fermented by a strain of Bacillus sp. As an active ingredient.
The pharmaceutical composition according to claim 1, wherein the leaf cultured fermented extract is contained in the pharmaceutical composition at a concentration of 1 to 1000 μg / ml.
According to claim 1, wherein said Bacillus strain is from Bacillus subtilis (Bacillus subtilis), Bacillus piece you formate miss the group consisting of (Bacillus licheniformis), Bacillus pumi Ruth (Bacillus pumilus), and Bacillus Sono alkylene sheath (Bacillus sonorensis) And at least one strain selected.
A health functional food for improving inflammation containing the fermented extract of Artemisia argyi , A. princeps Pampan , A. asiatica , Artemisia montana , and A. mongolica fermented by a strain of Bacillus sp. .

Images