KR20160057659A - RNAi recombinant vector including BrGI gene and transgenic plant with enhanced salt stress tolerance using the same - Google Patents

Abstract

The present invention relates to a RNA interference (RNAi) recombinant vector including a Brassica rapa GIGANTEA (BrGI) gene or a fragment thereof. The present invention further relates to a transgenic plant which has increase salinity stress resistance and is prepared by transforming the plant using the vector, and to a method for producing the transgenic plant with increased salinity stress resistance. The use of the RNAi recombinant vector of the present invention allows the plant to have salinity resistance by regulating the expression of genes associated with biorhythms. The plant becomes adaptable to various environmental changes due to the climate change, enabling the cultivation of the plants. Thus, it is possible to develop crops capable of sustaining productivity.

Description

[0001] The present invention relates to an RNAi recombinant vector containing a BrGI gene and a plant having enhanced salt stress resistance transformed using the same,

The present invention relates to an RNAi (RNA interference) recombinant vector comprising a Brgi (Brassica rapa GIGANTEA) gene or a fragment thereof, a transformed plant having enhanced salt stress resistance produced by transforming the vector into a plant, To a method for producing a transgenic plant.

RNA interference (RNAi) is a phenomenon in which the expression of genes at specific sites is inhibited by short double-stranded RNA (ds RNA), which occurs in plants, animals, and humans. The short double-stranded RNA is referred to as interfering RNA or siRNA, and this short double-stranded RNA breaks messenger RNA (mRNA) that carries the genetic information to prevent specific genes from being expressed. The genetic information contained in the DNA is transferred to the organelle, which is copied to the mRNA and made into a protein. In this process, the double-stranded RNA disrupts the mRNA with the same nucleotide sequence as its own to prevent the gene from being expressed.

In Korean Patent Registration No. 1258079, Chinese cabbage discloses a method for increasing the abiotic stress tolerance of a plant using BrcIPK3 (Brassica rapa CBL-calcium interacting protein kinase 3) protein derived from rapa -related abiotic stress tolerance. Transgenic plants with increased resistance to salt, aluminum, low temperature or oxidative stress were produced by transforming plants with a vector overexpressing the BrCIPK3 gene.

Therefore, the inventors of the present invention discovered that a plant derived from Chinese cabbage, in which salt stress resistance of a plant is enhanced by inhibiting its expression, can be produced by using an RNAi vector containing the gene, Thereby completing the invention.

Korean Patent Registration No. 1258079

An object of the present invention is to provide an RNAi (RNA interference) recombinant vector comprising BrGI (Brassica rapa GIGANTEA) gene or a fragment thereof.

It is another object of the present invention to provide a transgenic plant with enhanced salt stress resistance.

Another object of the present invention is to provide a seed of a transgenic plant having enhanced salt stress resistance.

It is another object of the present invention to provide a method for producing transgenic plants with enhanced salt stress resistance.

The present invention provides an RNAi (RNA interference) recombinant vector comprising BrGI (Brassica rapa GIGANTEA) gene or a fragment thereof comprising the nucleotide sequence of SEQ ID NO: 1.

The fragment may be a fragment consisting of the 1711 to 2289th sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: In one embodiment of the present invention, a fragment consisting of the 1711 to 2289th sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: 1 is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 4 and SEQ ID NO: 5 can do. In one embodiment of the present invention, the RNAi recombinant vector comprising a fragment consisting of the 1711 to 2289th sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: 1 means the GK4 vector named in the present invention.

The fragment may be a fragment consisting of the 3081 to 3461 sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: In one embodiment of the present invention, the fragment consisting of the 3081 to 3461th sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: 1 is amplified using a primer set consisting of the nucleotide sequence of SEQ ID NO: 2 and SEQ ID NO: can do. In one embodiment of the present invention, the RNAi recombinant vector comprising the fragment consisting of the 3081 to 3461th sequence of the BrGI gene consisting of the nucleotide sequence of SEQ ID NO: 1 means the GK1 vector named in the present invention.

The BrGI gene may be a biorhythm gene.

As used herein, the term "biorhythm gene" refers to a gene whose expression level varies according to a certain period. In the case of a periodic biorhythm gene, the expression of the gene changes with a period of 24 hours.

In one embodiment of the present invention, the BrGI gene is homologous to the Arabidopsis GI (GIGANTEA) gene homologous to Brassica rapa ) and named it BrGI (Brassica rapa GIGANTEA). Therefore, the BrGI gene is expressed in Brassica rapa , but is not limited thereto. In addition, in one embodiment of the present invention, the Brgi gene was confirmed to be a biorhythm gene by confirming the daily cycle expression of the BrGI gene.

As used herein, the term "RNAi" is an abbreviation for RNA interference, and when an agent that induces RNAi such as double helical RNA (also referred to as dsRNA) And the synthesis of the gene product is inhibited. The RNAi used here has the same meaning as the agonist inducing RNAi. The RNAi is a process in which a short double-stranded RNA selectively degrades a target mRNA corresponding to its own base sequence to stop transcription and protein synthesis of a target gene, and siRNA (small interfering RNA) can be prepared by directly synthesizing siRNA in vitro and then introducing the siRNA into a cell through transfection, and using a shRNA (short hairpin RNA) expression vector designed to express siRNA in the cell . Expression of an shRNA expression vector in a cell by transformation using a method of utilizing an expression vector allows the sense and antisense sequence of the target sequence from the promoter to be inserted between the gus linker , And thus, a small hairpin shRNA is synthesized. The thus synthesized shRNA is degraded by an RNase III enzyme called Dicer existing in the cell, converted into an siRNA of about 21 to 23 nucleotides having an accurate structure, and is bound to a protein complex called RISC (RNA-induced Silencing Complex) (Plant Cell Physiol. "Simple RNAi Vectors for Stable and Transient Suppression of Gene Function in Rice" 45 (4): 490-95 (2004)).

As used herein, the term "vector" means a DNA construct that retains a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in the appropriate host. The vector may be a plasmid, phage particle, or simply a potential genome insert. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. In particular, "vector for plant transformation" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked to a particular plant host organism. Promoters, enhancers, termination signals and polyadenylation signals available in plant cells are known to those of ordinary skill in the art. The vector of the present invention is most preferably a plant transformation vector, but is not limited thereto.

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed by using prokaryotic cells or eukaryotic cells as hosts. For example, when the recombinant vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter (for example, pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , Ribosome binding sites for initiation of detoxification, and transcription / translation termination sequences.

The vectors that can be used in the present invention include plasmids such as pSC101, ColE1, pBR322, pUC8 / 9, pHC79, pGEX series, pET series and pUC19 which are frequently used in the art, phages such as λgt4 · λB ,? -charon,?? z1, and M13), or a virus (e.g., SV40, etc.).

Methods of delivering the vector of the present invention into a host cell include, but are not limited to, microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, Agrobacterium-mediated transfection, DEAE-dextran, The vector can be injected into host cells by bedding or the like.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.

In the vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In one embodiment of the invention, the RNAi recombinant vector was constructed using the Gateway RNAi vector system. Specifically, a tt sites were inserted in both the gene specific region sequences to be inhibited in expression, and the desired gene was inserted into the entry clone vector using the BP Clonase II Enzyme Mix. Then, the target gene was inserted into Gateway RNAi vector system using LR Clonase II Enzyme Mix. In this manner, an RNAi vector that suppresses the expression of the target gene was prepared. site-specific recombination (SSR) through a unique sequence called att .

The RNAi recombinant vector can inhibit the expression of the BrGI gene.

The RNAi recombinant vector is preferably GK1 or GK4, most preferably GK4, but is not limited thereto.

The present invention also provides a transgenic plant produced by transforming the RNAi recombinant vector into a plant.

The transgenic plants may be those in which the expression of BrGI gene is inhibited and the salt stress resistance is enhanced. Accordingly, the present invention provides a transgenic plant having enhanced salt stress resistance, which is produced by transforming the RNAi recombinant vector into a plant.

The plants are either Arabidopsis or Chinese cabbage rapa ), but is not limited thereto.

The transgenic plants according to the present invention can be obtained through the ovine reproduction method or the non-reproductive propagation method which is a conventional method in this technical field. More specifically, the plant of the present invention can be obtained through reproductive process, which is a process of producing seeds through the moisture process of flowers and propagating from the seeds. Also, the plant can be transformed with the recombinant expression vector according to the present invention, and then obtained by a conventional method, such as induction, rooting and soil purification of the callus. That is, a fragment of a plant transformed with the recombinant expression vector of the present invention is pelleted in a suitable medium known in the art, and cultured under appropriate conditions to induce callus formation. When shoots are formed, the plant is transferred to a hormone-free medium Lt; / RTI > After about two weeks, the shoots are transferred to rooting medium to induce roots. The transformed plants according to the invention can be obtained by roots being induced and then transplanted into the soil for purification. Transgenic plants in the present invention may include whole plants as well as tissues, cells or seeds obtainable therefrom.

In one embodiment of the present invention, it has been confirmed that the Arabidopsis transformants transformed with the above RNAi recombinant vectors, particularly the GK4, GK5, and GK7 vectors, have obtained salt resistance, and a Chinese cabbage transformant transformed with the GK1 or GK4 vector It was confirmed that the salt resistance was obtained. Especially, when the GK4 vector was introduced, it was confirmed that salt resistance was obtained in Arabidopsis and Chinese cabbage crops.

The present invention also provides a seed of the transgenic plant.

In one embodiment of the present invention, the T3 seeds of Arabidopsis and Chinese cabbage transformed with the RNAi recombinant vector of the present invention were inoculated on the soil and subjected to a salt resistance assay. As a result, it was confirmed that each transformant obtained salt resistance there was.

In addition,

1) preparing the RNAi recombinant vector; And

2) transforming the recombinant vector into a plant to inhibit the expression of BrGI gene, thereby producing a transformed plant having enhanced salt stress resistance.

Using the RNAi recombinant vector containing the Brgi gene of the present invention as a biorhythm gene, it is possible to regulate the expression of the biorhythm gene, thereby imparting salt resistance to the plant. Thus, it can be cultivated in accordance with various environmental changes due to climate change It is possible to develop crops that can sustain productivity. Therefore, it is possible to apply vectors directly to various crops as well as Arabidopsis and Chinese cabbage, or to develop environmentally customized crops and improve productivity by utilizing various genes that affect the environmental resistance mechanism.

Figure 1 shows the mRNA sequence of the BrGI gene (3552 bp) and the primer positions of the GK1 and GK4 vectors:
Primer position of the red, GK4 vector; And
Blue, the primer position of the GK1 vector.
FIG. 2 is a diagram showing the structure of Arabidopsis GIGANTEA (AtGI) gene and BrGI (Brassica rapa GIGANTEA) gene of the present invention.
Figure 3 is a diagram showing daily cycle expression of the BrGI gene:
LD, 16 hours day / 8 hours night;
LD_LL, continuous light condition after 1 week LD condition;
SD, 8 hours day / 16 hours night; And
SD_LL, continuous light condition after one week SD condition.
Fig. 4 is a diagram showing a pBrGI-RNAi vector into which a BrGI gene fragment is inserted.
FIG. 5 is a graph showing the expression level of GI (GIGANTEA) gene in the transformant by transforming the RNAi vector of the present invention into Arabidopsis.
FIG. 6 is a graph showing the results of assaying salt resistance by treating 250 mM NaCl solution for 2 weeks with Arabidopsis transfected with the RNAi vector of the present invention.
FIG. 7 is a graph showing the results of assaying salt resistance by treating NaCl in different concentrations of a Chinese cabbage transformant into which an RNAi vector of the present invention has been introduced.
FIG. 8 is a graph showing the results of assaying salt resistance by draining a Chinese cabbage transformant into which the RNAi vector of the present invention has been introduced, draining three trunks, and watering with 250 mM NaCl for 2 weeks.

Hereinafter, the present invention will be described in more detail in the following Examples. It should be noted, however, that the following examples are illustrative only and do not limit or limit the scope of the present invention. It will be understood by those of ordinary skill in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims.

< Example  1> Biological Rhythm Genes in Chinese Cabbage GIGANTEA Homologous gene of BrGI  Sympathy

The homologous gene of the Arabidopsis GI (GIGANTEA) gene was isolated from the Chinese cabbage ( Brassica rapa ).

Specifically, the GI gene is a gene located at Arabidopsis chromosome 1, 8061844 to 8067716 (AT1G22770), and the corresponding sequence was searched using the Chinese cabbage genome sequence database (http://brassicadb.org/brad/).

(5'-ATCTGAGAGGTGGACCGATG-3 ', forward primer; SEQ ID NO: 6) and BrGI_pcr_R (5'-GTTATGCCGCTTTGGTTCAT-3', reverse primer; SEQ ID NO: 7) primer set (BrGI 3552 bp) was prepared. And Chinese cabbage rapa , L. ssp. (Brgi_pcr_L and BrGI_pcr_R) were isolated and confirmed that the gene was amplified in Chinese cabbage genome.

The exon region was predicted using a program for predicting the structure of the gene (FGENESH), and the gene was compared with the Arabidopsis thaliana to confirm that it is a homologous gene of the Arabidopsis GI gene (Fig. 2). The thus-identified Chinese cabbage gene was named BrGI (Brassica rapa GIGANTEA) (SEQ ID NO: 1).

In addition, the expression of the BrGI gene in the daily cycle was confirmed. In FIG. 3, the LD is 16 hours / 8 hours at night, the LD_LL is 1 day light condition, the SD is 8 hours / 16 hours night condition, the SD_LL is 1 day SD condition, , And the daily cycle expression pattern of BrGI gene according to each condition is shown. From the results shown in Fig. 3, it was confirmed that BrGI is a biorhythm gene having an expression pattern with a cycle of 24 hours (Fig. 3).

< Example  2> BrGI  For modulation of expression RNAi  Vector production

In order to confirm the relationship between inhibition of BrGI gene expression and salt resistance of plants, RNAi (RNA interference) vector, in particular Gateway RNAi vector system, was used as a system for suppressing BrGI gene expression in the present invention.

A primer was prepared to construct an RNAi vector capable of inhibiting the expression of the BrGI gene. A primer was designed to produce an RNAi disc of approximately 500 bp in the region of the 3552 bp total mRNA of the BrGI gene and the 3'-UTR (bp) region.

The PCR products amplified using the primers are sequentially sequenced from the 3'-UTR region into block 0, block 1, block 2, block 3, block 4, block 5, block 6, block 7, block 8, block 9 Respectively. The positions in the BrGI gene of blocks 0 to 9 are shown in FIG.

Next, 10 kinds of RNAi vectors into which the blocks 0 to 9, which are specific regions of the Brgi gene having a large gene size, were inserted, respectively (FIG. 4).

More specifically, by inserting the att sites on the sequence on both sides of the block 0 to block 9 inserted using BP Clonase II Enzyme Mix (Invitrogen cat . No. 11789-020) in DONR221 vector (Invitrogen, cat. No. 12536-017) Respectively. Then, each block was inserted into the Gateway RNAi vector system pB7GWIWG2 (II) using the LR Clonase II Enzyme Mix (Invitrogen, cat. No.11791-100). site-specific recombination (SSR) through a unique sequence called att . The vector into which the block 1 was inserted was pBrGI1-RNAi, and the vector into which the block 2 was inserted was pBrGI2-RNAi, and the vector was sequentially prepared (FIG. 4). Then, the vector from pBrGI0-RNAi to pBRGI9-RNAi was sequentially named GK (GI-knockout) 0 to GK9 vector. The RNAi vector thus constructed is expressed from the promoter, with the sense and anti-sense sequences of the target base sequence located between the linkers, thereby degrading the target mRNA.

Table 1 shows the primer information used to construct the GK1 and GK4 vectors.

vector SEQ ID NO: primer  designation primer  direction primer  The sequence (5 '- &gt; 3') PCR  Product size ( bp ) GK1
2 GK1_F Forward tggaatgcttgttgatggag 554
3 GK1_R Reverse cgcttcccagttcaaacact GK4
4 GK4_F Forward atggctgagcttcgtgctat 579
5 GK4_R Reverse agacaaggcatgcgtcaag

< Example  3> Production of Arabidopsis transformants Salt resistance  black

First, each vector prepared in Example 2 was transformed into Arabidopsis thaliana, a model plant.

(Plant Physiology, May 2007, Vol. 144, pp. 495502), which has been distributed from Gyeongsang National University and Gy-T-DNA allele, The vector was introduced into the Arabidopsis thaliana using the agrobacterium transformation method to construct Arabidopsis transformants.

The transgenic Arabidopsis transformants transformed with each vector were constructed to confirm the expression of Arabidopsis GI (GIGANTEA) gene. Total RNA was isolated (Qiagen, RNeasy Plant Mini Kit, Cat. No. 74904) by selecting four Arabidopsis thaliana colonies and four transformants (Clontech, RNA to cDNA EcoDry, Cat No. 639541). Next, two specific primers capable of amplifying a part of the Arabidopsis GI gene were prepared. The NCBI Accession number of the Arabidopsis GI gene is NM_102124.2. Primer (amplification 3066 to 3519 in Arabidopsis GI) or AtGI_exp2_L (5-TGGCTAGTTCATCTTCATCTGAG-3, forward primer; SEQ ID NO: 8) and AtGI_exp1_R (5-TTGGGACAAGGATATAGTACAGC-3, reverse primer; SEQ ID NO: (Forward primer: SEQ ID NO: 10) and AtGI_exp2_R (5-GCGGAAAAGTTCTACTGAGTATTG-3, reverse primer: SEQ ID NO: 11) primers (amplified from 2 to 1614 in Arabidopsis GI).

In the results shown in Fig. 5, actin is a stable gene constantly expressed in Arabidopsis thaliana, meaning that the amount of cDNA used as a template is constant in the experiment of analyzing the gene expression amount, and there is no problem in the plant. Also, it was confirmed that the amount of GI gene expression of the transformant was lower than that of the control from the results of electrophoresis of the products amplified by the primers (AtGI_exp1_L and AtGI_exp1_R primers, or AtGI_exp2_L and AtGI_exp2_R primers). From this, it was found that the Arabidopsis thaliana was successfully transformed.

Experiments were carried out to test the salt resistance of the Arabidopsis thaliana transformants prepared above. Specifically, the Arabidopsis thaliana transformant T3 seed was inoculated on the soil, germinated, and then watered with 250 mM NaCl. After 2 weeks of growth, the growth was observed, and the results showed that the transformed Arabidopsis thaliana transformed with the GK4, GK5 and GK7 vectors It was confirmed that the body did not browse but grew well (Fig. 6).

Therefore, it was confirmed that the Arabidopsis transformants transformed with the GK4, GK5, and GK7 vectors were able to survive at high salt tolerance.

< Example  4> Production of Chinese cabbage transformants Salt resistance  black

Each vector prepared in Example 2 was transformed into Chinese cabbage.

Specifically, a vector is inoculated into the hypocotyl of the Chinese cabbage ( Brassica rapa , ssp. Pekinensis DH03 (2007 Plant Cell Rep. 26: 327-336)) using Agrobacterium, Tissue culture was used to transform each of the above-produced GK0 to GK9 vectors and to develop T3 generation. Then, seeds were sown on MS medium supplemented with 0 mM, 75 mM, 125 mM, and 250 mM NaCl.

As a result, it was confirmed that the roots of the Chinese cabbage transformed with the GK1 and GK4 vectors were well grown in the 125 mM medium while the roots of the untransformed plants did not grow well (FIG. 7).

When the Chinese cabbage transgenic plants were sown on the soil and three main leaves were developed and 250 mM NaCl was applied for 2 weeks, the leaves of the Chinese cabbage transformants transformed with the GK1 and GK4 vectors were well spread, whereas the leaves of the control It was confirmed that the young leaves were severely curled (Fig. 8).

Therefore, it was confirmed that the salt resistance of the Chinese cabbage transformed with the GK1 and GK4 vectors was enhanced, and in particular, the GK4 vector attained the salt resistance in the Arabidopsis and Chinese cabbage crops.

<110> Republic of korea <120> RNAi recombinant vector including BrGI gene and transgenic plant          with enhanced stress tolerance using the same <130> P14R12D1370 <160> 11 <170> Kopatentin 2.0 <210> 1 <211> 3552 <212> DNA <213> Brassica rapa <400> 1 atgacatcgc ctacttcatc tgagaggtgg accgatggtc ttcagttctc ttccttgtta 60 tggtctcccc cacgtgaccc tcaacaacat aaggatcaag tcgttgctta tgtcgaatac 120 tttggtcagt tcacatcaga gcaattccct gatgatattg ctgagttggt ccgtaatcag 180 tatccctcaa ctgagaagcg acttttggat gatgtgttgg ctatgtttgt actccatcat 240 cctgagcatg gtcatgctgt catccttccg attatctcat gtctcatcga tggcactcta 300 gtgtacagca aggaagctca tcccttcgcc tctttcattt ctttagtttc cccaaatagt 360 gagaatgact attcagagca atgggctttg gcgtgcggag aaatcctacg catcttgact 420 cattacaacc gtcccattta caagacggag cagcaaaatg gagaaacgga gagcaaagct 480 tctactagtg ggtctcctac gctttcagag gctaaggctg tatcaccagg acagcatgaa 540 aggaaaccgc taaggccttt gtctccatgg atcagtgata tactactcgc tgctcccctt 600 ggtattagaa gtgactactt tcgttggtgt agtggtgtta tgggtaaata tgctgctgga 660 gagctcaagc cacctaccat tggtgagtgt ccatcacctc tggctactac aatgggttct 720 actcgaggat ctggtaaaca tcctcaatat atgccttcga caccaagatg ggcggttgct 780 aatggagctg gtgtcatact gagtgtttgt gatgatgaag tcgctcggta tgagactgct 840 acgttaacag cggttgctgt ccctgcactt ctgcttcctc ccccaacgac atccttagat 900 gagcatttag ttgctggcct tccagctctt gagccttatg cacgtttgtt tcacagatat 960 tatgcgattg caactccaag tgctactcag agacttcttc ttggactctt ggaagcacca 1020 ccgtcgtggg ctccagatgc acttgatgct gccgtacagc ttgtggagct tctccgagct 1080 gctgaagatt atgcatctgg tgtaaggcta ccaaggaact ggatgcattt gcacttcttg 1140 cgtgcaatag gaatcgccat gtctatgagg gcaggcgttg ctgctgacgc tgcagctgct 1200 ttacttttcc gcatactgtc gcagccggca ctgctttttc ctccgctaag ccaagctgag 1260 ggagtagaaa tcaaacacgc tcctattggt ggctacggtt caaattacag aaagcagata 1320 gaagttcctg cagcagaagc aaccattgaa gccactgcac aaggaatagc ctcaatgctt 1380 tgtgctcacg gacctgaagt ggagtggagg atctgcacta tatgggaagc tgcctatgga 1440 ttgatccctt taaactcctc agccgttgat ctccctgaga tcattgtcgc caccccactg 1500 cagcctccca tcttgtcatg gaacctatac atcccactcc tcaaagtact cgagtatctt 1560 ccacgtggga gtccttccga agcatgcttg atgaagatat tcgtcgccac ggtggaaaca 1620 atcctcagca ggactttccc gccagagact tctatcagga aagctagagc gagtttagcc 1680 acgagatcat cagcgaccaa aaacctagct atggctgagc ttcgtgctat ggtccatgct 1740 ctcttcttgg aatcatgcgc tggcgtggag atagcgtcgc gcctgctttt cgttgtgttg 1800 actgtgtgtg ttagccatga agcgcagtct agtgggagag agagacggag aagcgaagaa 1860 gatgctactg cagaggagaa tcaagacaat caaactagta accgtaaaag taggaacgtc 1920 aagggacaag gacctgtggc ggcgtttgat tcgtacgttc tcgctgctgt ctgtgctctc 1980 gcctgtgagg ttcagctgta tcctatgatc tccggaggag ggaacttctc caactctgca 2040 gtggctgcaa ccattacaaa gtctgtgaag ataaacggtt catctaacga gtacggagct 2100 gggattgact ctgcaatcaa gcacacacgc cgcatcttag cgattctcga ggcgctcttt 2160 tcgttgaagc catcttctgt ggggactccg tggagttaca gctctagcga gatagttgct 2220 gcggccatgg tcgcagctca catctccgaa ctgttcagac gctcaaaggc cttgacgcat 2280 gccttgtctg gtttgatgag atgcaaatgg gacaaggaga ttcataagag agcgtcgtct 2340 ttgtataacc tcatcgatgt tcatagcaaa gttgtagcat ccatcgtcga caaagctgaa 2400 cccttagaag cgtaccttaa gaacgccccg gtccagaagg attcgctggc ttgtgttaac 2460 tggaaacaac agaacaacac atcatcagca gcagggtttg gtacagcggc ggtgacgtcc 2520 acgtcacgta atgaaatggc tccgagagga ggtaaccata agtatgctag gcattcagat 2580 gaaggctcag ggagtagatc gtcatcagat aagggcatca aagatctgct gttggatgct 2640 tctgatctag cgaatttcct cacggctgat aggctagcag ggttttaccg tggtacgcaa 2700 gttcttttga ggtcgatact tgctgagaaa ccggagcttt ctttctccgt tgtttcgctg 2760 ttgtggcaca aactgatcgc ttctcctgag atccagccca cagccgaaag cacctctgct 2820 cagcaaggat ggagacaggt agttgatgca ctatgcaatg tggtatctgc aacgccagca 2880 aaagcagctg cagccgttgt tcttcaggct gagagagagt tgcagccttg gatagccaaa 2940 gatgatgaag aaggtcagaa aatgtggaaa ataaaccaaa ggatagtgaa agtgatggtg 3000 gaactcatga ggaatcatga caggcctgag tcactggtga ttctggcaag tgcatctgat 3060 ctccttctga gagcaactga tggaatgctt gttgatggag aagcttgtac attacctcaa 3120 cttgagctac ttgaagctac agcaagagca atacagccag tgttagcttg gggaccatct 3180 ggactagcag tagttgacgg cttatcaaat ctattgaagt gtcgtctgcc ggcaacaata 3240 cggtgcctct cacacccaag tgcacacgta cgtgccttga gcacatcagt actacgagac 3300 atcatgaacc aaagcggcat aaccaccacc aaggcaactc caaaaccgcc gccaacaata 3360 acaaccgaga agaacggaac ggacagcccg tcgtacaggt tcttcaacgc ggcggcaata 3420 gactggaaag cagacataca aaagtgtttg aactgggaag cgcacagctt gctgtcgacg 3480 acaatgccga cacagtttct tgacacggcg gctcgggaat taggatgtac catatcaatg 3540 tcgtcccaat aa 3552 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GK1_F <400> 2 tggaatgctt gttgatggag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GK1_R <400> 3 cgcttcccag ttcaaacact 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GK4_F <400> 4 atggctgagc ttcgtgctat 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> GK4_R <400> 5 agacaaggca tgcgtcaag 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGI_pcr_L <400> 6 atctgagagg tggaccgatg 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BrGI_pcr_R <400> 7 gttatgccgc tttggttcat 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> AtGI_exp1_L <400> 8 tggaatgctt gttgatggag 20 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtGI_exp1_R <400> 9 ttgggacaag gatatagtac agc 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> AtGI_exp2_L <400> 10 tggctagttc atcttcatct gag 23 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> AtGI_exp2_R <400> 11 gcggaaaagt tctactgagt attg 24

Claims (7)

An RNAi (RNA interference) recombinant vector comprising BrGI (Brassica rapa GIGANTEA) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or a fragment thereof.
The method according to claim 1,
Wherein the fragment is a fragment consisting of the 1711 to 2289th sequence or the 3081 to 3461th sequence of the BrGI gene comprising the nucleotide sequence of SEQ ID NO: 1.
The method according to claim 1,
Wherein the BrGI gene is a biorhythm gene.
A transformed plant having enhanced salt stress resistance, which is produced by transforming the RNAi recombinant vector of any one of claims 1 to 3 into a plant.
5. The method of claim 4,
The plants are either Arabidopsis or Chinese cabbage rapa ). &lt; / RTI &gt;
A seed of a transgenic plant according to claim 4.
1) preparing an RNAi recombinant vector according to any one of claims 1 to 3; And
2) transforming the recombinant vector into a plant to inhibit the expression of BrGI gene, thereby enhancing the salt stress resistance of the transgenic plant.

Images