KR20160050569A - Expression system for psicose epimerase and production for psicose using the same - Google Patents

Abstract

The present invention relates to a gene expression system which is capable of producing psicose epimerase with high stability and expression level, and a transgenic generally recognized as safe (GRAS) microorganism using the same, and a method for producing psicose using the transgenic GRAS microorganism or an enzyme obtained from the transgenic GRAS microorganism.

Description

Expression system for psicose epimerase and production of psicose using this system and expression system of psicose epimerase for psicose using the same

The present invention relates to an expression system capable of producing a perimerizing enzyme in a high expression rate and stability in a microorganism, and a method for producing a microorganism and an enzyme using the expression system, will be.

A variety of biosynthetic products are produced in cells by natural processes and are used in a number of industries, including food, feed, cosmetics, food, food and pharmaceutical industries. These are most conveniently produced on a large scale by the growth of bacterial strains or other microorganisms that have been developed to produce and secrete large amounts of the specific substances required in each case. Corynebacterium glutamicum, which efficiently produces glutamic acid in the mid-1950s, has been found and industrialization has been made, and Corynebacterium glutamicum The amino acid is produced industrially through the fermentation process using the mutant strain of the nutrient requirement.

To engineer cells, it is necessary to control the degree of expression of various related genes, and this regulation of gene expression requires various efficient expression systems. Various components of the regulatory sequences of the cells are known to those skilled in the art. These include the binding site for the operator, the binding site for the RNA polymerase enzyme referred to as the -35 and -10 region, and the ribosomal binding site or ribosomal 16S RNA referred to as the Shine-Dalgarno sequence It is classified as a joining site.

The selection of the promoter is most important for the development of the expression system because the promoter is involved in the degree of expression and regulation of the gene. Several promoters available in Corynebacterium glutamicum have been reported, mainly promoters derived from Corynebacterium or E. coli (J. Biotechnol., 104: 311-323, 2003).

However, the promoter derived from Escherichia coli exhibits relatively low activity in Corynebacterium because of low permeability of expression inducing factors and absence of gene expression inhibiting substance. Also, even with the same promoter, the expression efficiency varies depending on the gene encoding the target protein, and since the selectivity of the promoters usable in Corynebacterium is also small, it is not easy to produce an expression system suitable for the purpose. In particular, when the expression of various genes such as the establishment of a metabolic pathway is regulated together, it is a reality that Corynebacterium can not make various choices as in Escherichia coli.

Although Saikos is popular as a diet sweetener, it belongs to a rare sugar which rarely exists in the natural world. Therefore, it is necessary to develop a technique for mass-producing Saikos efficiently in the food industry. Conventionally, most of the methods for producing the Sicos are produced through a chemical synthesis process. As a technique related to the method of producing the Saikos by an enzymatic method, Korean Patent No. 10-0744479, a method of mass production of a Saikoshi epimerase derived from Agrobacterium tumefaciens using the transformed Escherichia coli, Discloses a method for producing the < RTI ID = 0.0 > cyucose < / RTI > Studies have been conducted on a method for producing a cyucus by using a strain that can produce a high efficiency of a low cost of manufacture by omitting the process of enzyme purification. For example, in Korean Patent No. 10-1106253, The present invention relates to a method for producing transformed Escherichia coli expressing Tumegacies cis-3-epimerase and inactivating a specific gene, and inoculating the strain into a fructose-containing medium to convert the fructose in the medium into a cyucose .

Since the technology described in Korean Patent No. 10-1106253 is not a strain that is recognized as a substance (GRAS, Generally Recognized As Safe) that is difficult to cultivate when it is used industrially by using Escherichia coli as a strain, And thus it is not suitable for use as a strain to produce. It is disadvantageous in that the activity of the enzyme is low and the thermal stability is poor by using a psicose epimerase derived from Agrobacterium tumefaciens.

Therefore, it is an object of the present invention to provide an expression system capable of producing a highly active scythic epimerase having a high activity in a GRAS strain at a high yield with high stability, a method for producing the scythic epimerase using the same, It is still necessary to produce a sauces using a strain.

An example of the present invention is to provide a transcriptional promoter capable of producing a high-yield sucrose epimerase with high stability in a GRAS strain.

Another example of the present invention is to provide a gene expression cassette comprising the coding sequence of the Corynebacterium sp. Strain and the transcriptional promoter for expression of the Corynebacterium sp. Strain.

Another example of the present invention is to provide a vector comprising the expression cassette for Corynebacterium sp. Strain comprising the coding sequence of the transcriptional promoter for expression of the genus of genus Corynebacterium and the cyclic epimerase.

Another example of the present invention provides a Corynebacterium genus host cell that expresses a cytokine epimerase that is transformed with the expression cassette or comprises the expression cassette.

Another example of the present invention is a method for producing a coryneform bacterium belonging to the genus Corynebacterium isolated from the group consisting of the above-mentioned Escherichia bacterium strain-derived Escherichia coli, the strain of the strain, the culture of the strain, the disruption of the strain, And at least one selected from the group consisting of at least one selected from the group consisting of:

Another example is a microorganism selected from the group consisting of a cytokine epimerase obtained by using the Corynebacterium sp. Strain, a microorganism of the microorganism, a culture of the microorganism, a disruption of the microorganism, and an extract of the microorganism or the culture The present invention provides a method for producing cicosone from a fructose-containing raw material.

The present invention relates to an expression system capable of producing a perming enzyme at high stability and expression rate in psicose, a generically recognized as safe microorganism using the same, a method for producing an enzyme using the transformed GRAS (Generally recognized as safe microorganism) And a method for producing a microcosm and an enzyme using the expression system.

Escherichia coli-derived promoters exhibit relatively low activity in Corynebacterium sp. Strains due to low permeability of expression inducing factors and absence of gene expression inhibiting substances. In addition, Provide an expression system suitable for expression of the enzyme.

The present invention provides a promoter capable of stably expressing a psicose epimerase at a high expression rate in a strain of the genus Corynebacterium and a gene expression cassette containing the promoter, It is possible to stably and mass-produce the malting enzyme at a high expression rate. The present inventors have also found that in order to mass-produce the psicose applicable to food, in order to express a large amount of a psicose epimerase having stable and high enzyme production activity in a GRAS (Generally recognized as safe) strain, And a nucleotide sequence encoding the same.

As used herein, the terms "promoter "," nucleic acid molecule having promoter activity ", or "promoter sequence" means a nucleic acid that is operably linked to a target nucleic acid sequence to be transcribed and regulates transcription of the desired nucleic acid sequence.

The nucleic acid sequence to be transcribed does not necessarily need to be directly linked to the promoter in the chemical sense, but may include additional gene control sequences and / or linker nucleic acid sequences. An arrangement in which the target nucleic acid sequence to be transcribed is located at the lower part of the promoter sequence (that is, at the 3 'end of the promoter sequence) is preferable. The distance between the promoter sequence and the nucleic acid sequence to be transcribed is preferably less than 200 bases, particularly preferably less than 100 bases.

The sequence of a "ribosomal binding site" (RBS) (also referred to as a Shine-Dalgano sequence) according to the present invention refers to an A / G-rich polynucleotide sequence.

As used herein, the term "regulatory sequence" refers to a nucleic acid that contains a promoter and is operatively linked to a nucleic acid sequence or gene to be expressed, and then has the expression activity of regulating expression of the nucleic acid or gene, i.e., transcription and translation. Thus, in this regard, the nucleic acid sequence is also referred to as a "regulatory nucleic acid sequence ".

"Expression cassette" means a regulatory sequence operatively linked to the coding nucleic acid sequence of the subject nucleic acid sequence, for example, the coding nucleic acid sequence of the psicose epimerase. Thus, unlike an expression unit, an expression cassette includes a nucleic acid sequence that is transcribed and expressed as a protein as a result of transcription and translation, as well as nucleic acid sequences that control transcription and translation.

All nucleic acid molecules according to the present invention are preferably nucleic acid molecules that are non-naturally occurring, in the form of isolated nucleic acid molecules or by synthetic or recombinant methods. An "isolated" nucleic acid molecule is removed from other nucleic acid molecules present in the natural source of the nucleic acid, and further, when produced by recombinant techniques, essentially no other cellular material or culture medium is present or chemically synthesized There may be no chemical precursors or other chemicals present.

An example of the present invention relates to a nucleic acid molecule of a transcriptional promoter for expression of a genus of Corynebacterium sp., Which enables to produce a high-stability and activity cyclic epimerase with high stability in a GRAS strain at a high yield .

Another embodiment of the present invention is a nucleic acid sequence encoding a cytoskeletal epimerase and a regulatory sequence operably linked upstream thereof and regulating the expression of the cytoskeletal epithelium in a strain of the genus Corynebacterium, A gene expression cassette expressing a cyclic epimerizing agent in a strain of the genus Corynebacterium.

The regulatory sequence according to the present invention comprises a transcriptional promoter which expresses a nucleic acid sequence encoding a cyclosporidase in a GRAS strain, for example a Corynebacterium sp. Strain. In one embodiment, the transcriptional promoter may be a nucleic acid molecule that expresses a nucleic acid sequence encoding a cyclic epimerase in a Corynebacterium sp. Strain, but may be a tac1, tac2, trc, or sod promoter. The sod promoter is derived from Corynebacterium glutaricum, and preferably comprises the nucleotide sequence of SEQ ID NO: 1 as a core region. The trc promoter is an Escherichia coli -derived promoter produced by a combination of the trp promoter and the lac UV5 promoter. The Tac1 promoter is an Escherichia coli-derived promoter, which is produced by a combination of the trp promoter and the lac UV5 promoter. The Tac2 promoter is an Escherichia coli-derived promoter, which is prepared by a combination of the trp promoter and the lac UV5 promoter, and is optimized by modifying the sequence of the Tac1 promoter.

Examples of the transcription promoter according to the present invention include a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: And a nucleic acid molecule including a nucleic acid sequence.

The regulatory sequence may further comprise at least one nucleic acid molecule selected from the group consisting of a ribosome binding region and a spacer. In addition to the transcriptional promoter in the regulatory sequence according to the present invention, the expression of the cyclosporin-converting enzyme may be improved by additionally including at least one member selected from the group consisting of RBS, spacer sequence and linker sequence. For example, the regulatory sequences according to the present invention may be composed of the following combinations, but are not limited thereto.

(1) those containing a promoter nucleic acid sequence,

(2) comprises a first linker sequence connected to the 3 'end of the promoter nucleic acid sequence (for example, a promoter-first linker)

(3) a promoter-first linker-ribosome binding region or a promoter-ribosome binding region, which comprises at least one ribosome binding region directly or through a first linker sequence to the 3 ' ,

(4) a promoter comprising a ribosome binding region and a second linker sequence directly linked to the 3 'end of the promoter nucleic acid sequence or through a first linker sequence (e.g., promoter-first linker-ribosome binding region-second linker, or Promoter-ribosome binding region-second linker),

(5) a promoter comprising a ribosome binding region and a spacer sequence (for example, a promoter-first linker-ribosome binding region-spacer, or a promoter-ribosome binding region-spacer) directly or through a linker to the 3 'end of the promoter nucleic acid sequence ), And

(6) a promoter comprising a ribosome binding region and a spacer sequence which are connected to the 3 'end of the nucleic acid sequence directly or through a linker, the spacer sequence being repeated twice or more (for example, promoter-first linker-ribosome binding region- spacer- (E.g., a promoter-first region-spacer, or a promoter-ribosome binding region-spacer-ribosome binding region-spacer), or further comprising a third linker between the ribosome binding region and the spacer sequence repeated two or more times Linker sequence-ribosome binding region-spacer, or promoter-ribosome binding region-spacer sequence-third linker sequence-ribosome binding region-spacer sequence).

The ribosome binding region and the spacer may be chemically linked directly or indirectly via a linker nucleic acid sequence in between. In an embodiment of the present invention, the ribosome binding region and the spacer sequence may include one oligonucleotide sequentially linked from the 5'-end to the 3'-end.

The ribosome binding region, the spacer sequence and the linker sequence may be selected from the group consisting of the same or different sequences in the regulatory sequence one or more times. For example, one selected from the group consisting of a ribosome binding region, a spacer sequence and a linker sequence may contain the same or different sequences repeatedly in the regulatory sequence one or more times, and the additional nucleic acid sequence may be chemically linked directly Lt; / RTI > can be indirectly linked via a linker nucleic acid sequence.

The first linker sequence, the second linker sequence, and the third linker sequence included in the regulatory sequence may be a nucleic acid sequence having 1 to 100 bases, for example, 5 to 80 bases, A nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 17. The first linker sequence is connected to the 3 'end of the transcriptional promoter of the regulatory sequence and is linked to the 5'-end of the ribo-dot binding region, and has 1 to 100 bases, for example, 5 to 80 bases And as a specific example, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 10 to SEQ ID NO: 11, and a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 14 to SEQ ID NO: 15 .

In one embodiment of the present invention, the spacer sequence included in the regulatory sequence is a nucleic acid molecule located between the ribosome binding region and the gene coding sequence, usually having 3 to 15 bases, and may be prepared in various types of bases and lengths, By including the spacer sequence in the regulatory sequence, the expression efficiency of the gene located underneath can be increased. In addition, various types of nucleic acid compositions and sizes may be used in consideration of the coding sequence of the protein to be expressed and the kind of the host cell. An example of a spacer sequence according to the present invention is preferably but not limited to TTACAAA (SEQ ID NO: 19).

In the present invention, the promoter sequence comprises a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: And a nucleic acid molecule including a nucleic acid sequence. The term " transcription promoter "

In the present invention, there is provided an isolated nucleic acid molecule comprising a polynucleotide capable of effecting expression polynucleotide transcription. The isolated nucleic acid molecule comprises a nucleic acid molecule comprising the nucleic acid sequences of SEQ ID NOS: 1, 8, 12, and 16 and a polynucleotide selected from functional variants. In another example of the present invention, the functional variant has at least 90% identity with the sequence of the nucleic acid sequence of SEQ ID NO: 1, 8, 12, and 16, ie, 99%, 98%, 97% 95%, 94%, 93%, 92%, 91%, 90% or more.

The regulatory sequence comprising the promoter and the ribosome-binding region located under the promoter includes a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 2 to SEQ ID NO: 7, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: A nucleic acid molecule comprising SEQ ID NO: 13 to SEQ ID NO: 15.

The ribosome binding region according to one embodiment of the present invention may be a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 18 and the spacer sequence may be the nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: The regulatory sequence may include an oligonucleotide consisting of a ribosomal binding region having a nucleic acid sequence of SEQ ID NO: 8 and a spacer sequence having a nucleic acid sequence of SEQ ID NO: 9 sequentially linked from the 5'-end to the 3'-terminal side . Specifically, the regulatory sequence may be selected from the group consisting of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 6 to SEQ ID NO: 7, a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 11 and a nucleic acid molecule comprising SEQ ID NO: have.

Specific transcription promoters according to the present invention are exemplified in Table 1 below. A polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 19, and may be a transcriptional promoter that expresses a cyclic epimerizing agent in a strain of the genus Corynebacterium.

order
number The sequence (5 'to 3' direction) denomination One aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac Sod promoter (1) 2 aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga Sod promoter
(2) 3 aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc Sod promoter
(3) 4 aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac Sod promoter
(4) 5 aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga Sod promoter
(5) 6 aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga ttacaaa Sod promoter
(6) 7 tcagaattggttaattggttgtaacactggcagtgaattctcaagtctccacaccaccatcgaaacttacaagtgtgaactctggcggatcaactagtgaaaagcgtaactacatggtccttcttgagtatctactacgcgtactgggaacaatcactagtgaattcgcggccgcgc
aagcgcc tcatcagcgg taaccatca cgggttcgggt gcgaaaaacc atgccataac aggaatgttc ctttcgaaaa ttgaggaagc cttatgccct tcaaccctac ttagctgcca attattccgg gcttgtgacc cgctacccgataaataggtc ggctgaaaaa tttcgttgca atatcaacaa aaaggcctat cattgggaggtgtcgcacca agtacttttg cgaagcgcca tctgacggat tttcaaaaga tgtatatgct cggtgcggaa acctac
gaaagga ttttttaccc atggctg tatacgaact cccagaactc gactacgcat acgac
gaaagga ttacaaa Sod promoter
(7) 8 tgacaattaatcatcggctcgtatattgt tac1 promoter (1) 9 Tgacaattaatcatcggctcgtatattgt
gaaagga tac1 promoter
(2) 10 tgacaattaatcatcggctcgtatattgt gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga tac1 promoter
(3) 11 tgacaattaatcatcggctcgtatattgt gtggaattgtgagcggataacaatttcacacaggaaacagaattcccggg gaaagga ttacaaa tac1 promoter
(4) 12 tgacaattaatcatccggctcgtataatgt Tac2 promoter
(One) 13 Tgacaattaatcatccggctcgtataatgt
gaaagga Tac2 promoter
(2) 14 Tgacaattaatcatccggctcgtataatgt
taacaatttgtggaattgtgagcggacacacaggaaa cagaccatgg aattcgagct cggtacccggg gaaagga Tac2 promoter
(3) 15 Tgacaattaatcatccggctcgtataatgt taacaatttgtggaattgtgagcggacacacaggaaacagaccatggaattcgagctcggtacccggg gaaagga ttacaaa Tac2 promoter
(4) 16 tgacaattaatcatcggcctcgtataatgt trc promoter
(One) 17 tgacaattaatcatcggcctcgtataatgt gtggaattgtgagcggataacaatttcacacaggaaacagacccatgg trc promoter
(2) 18 gaaagga Ribosome binding region 19 ttacaaa Spacer sequence

In the above Table 1, the shaded portions indicate the ribosome binding region, the spacer sequence, the linker sequence, and the like among the regulatory sequences.

The promoter for expression of a strain of genus Corynebacterium according to the present invention is to regulate the expression of Saikosupemirase linked to the lower part thereof in a strain of the genus Corynebacterium. Escherichia coli-derived promoters exhibit relatively low activity in Corynebacterium because of low permeability of expression inducing factors and absence of gene expression inhibiting substances. Also, even with the same promoter, the expression efficiency differs depending on the gene encoding the target protein, and the selectivity of the promoters usable in Corynebacterium is also small, making it difficult to produce an expression system suitable for the purpose. Also, the transcriptional regulatory activity may be different depending on the specific target protein, even if it is a transcriptional promoter for Corynebacterium sp. Expression. Thus, the transcriptional promoter, regulatory sequence or gene expression cassette according to the present invention may be a Corynebacterium sp. Strain Lt; / RTI > is suitable to express the < RTI ID = 0.0 >

The target protein may be directly connected to the 3 'end of the nucleic acid molecule for Corynebacterium spp. Expression, or may be linked through a linker.

It is preferable that the cyclic epimerase according to the present invention is excellent in enzyme activity and thermal stability. Accordingly, in the embodiment of the present invention, the combination of the transcriptional promoter or the regulatory sequence with the gene encoding the cyclic epimerase is important , The tac1, tac2, trc, and sod promoters used in the present invention can provide more than adequate titers of protein expression, and when the sod promoter is used, folding of the protein is robust, It is more preferable to obtain a result which is high.

In one embodiment of the present invention, the Saicos' epimerase is Clostridium scidens , Treponema primitia , Ensifer adhaerens ) or Ruminococcus ( Ruminococcus may be one derived from the torques), preferably the amino acid of the peptide, or SEQ ID NO: 29 comprises the amino acid sequence of the peptide, SEQ ID NO: 26 comprises the amino acid sequence of the peptide, SEQ ID NO: 23 comprises the amino acid sequence of SEQ ID NO: 20 Lt; RTI ID = 0.0 > a < / RTI > peptide comprising a sequence.

The amino acid sequence of SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 26, or SEQ ID NO: 29 may be substituted, inserted and / or deleted so long as the activity of converting the cyclic epimerization fructose into the cyclosporin is maintained . For example, the protein may have an amino acid sequence having a homology of at least 70%, at least 80%, at least 90%, at least 95%, or at least 99% with the amino acid sequence of SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: . ≪ / RTI >

The nucleic acid sequence encoding the Saikosupemirase is Clostridium scidens , Treponema primitia , Ensifer adhaerens ) or Ruminococcus ( Ruminococcus or encoding nucleic acid sequence of the psicose epimerase obtained in torques), it may be a modified nucleic acid sequence to optimize the expression in E. coli or Corynebacterium sp.

For example, the nucleic acid sequence encoding the above-mentioned cyclic epimerase includes a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 20, a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 23, A nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 26, or a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 29. Specifically, the nucleic acid sequence coding for the above-mentioned cyclic epimerase is selected from the group consisting of SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30 and SEQ ID NO: 31 Lt; RTI ID = 0.0 > of: < / RTI > Or a sequence having substantial identity to the base sequence. The substantial identity is determined by aligning the nucleotide sequence of SEQ ID NO: 2 with any other sequence to the greatest extent possible and analyzing the sequence to find that the other sequence is at least 70%, at least 90% Or 98% or more sequence homology.

An engineer skilled in the art can substitute, add or delete one or more bases of the nucleotide sequence of the polynucleotide using gene recombination techniques or the like known in the art, It will be easily understood that a polynucleotide encoding an enzyme protein having an activity can be produced. This comparison of homology can be performed by calculating the percentage homology between two or more sequences using a commercially available computer program.

In one example of the present invention, a protein (CDPE) derived from Clostridium scidens and having an activity of producing cicosane from fructose is provided. For example, the protein may have the amino acid sequence of SEQ ID NO: 20 and have activity to produce psicose from fructose. The nucleic acid sequence encoding the Saikosupemirase may include a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 20, a nucleic acid sequence of SEQ ID NO: 21, and a nucleic acid sequence of SEQ ID NO:

The protein may have a molecular weight of 30 to 37 kDa, for example 30 to 35 kDa, as measured by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The optimum temperature of the protein is 40 to 65 ?, specifically 50 to 65? Lt; / RTI > The optimum temperature may be, for example, a result of a reaction for 5 minutes in the presence of pH 7.0, 1 mM Co ^{2 +} , but is not limited thereto. The optimal pH of the protein may be pH 6 to 9, pH 7 to 9, pH 7 to 8.5, or pH 7 to 8. The optimum pH may be, for example, but not limited to, a result of the reaction progress for 5 minutes in the presence of 1 mM Co ^{2 +} at 60 ° C.

In one example of the present invention, a protein (TDPE) having an activity of producing a psicose from fructose is provided, which is derived from Treponema primitia . For example, the protein may have the amino acid sequence of SEQ ID NO: 23 and have activity to produce psicose from fructose.

The nucleic acid sequence encoding the Saikosupemirase may include a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 23, a nucleic acid sequence of SEQ ID NO: 24, and a nucleic acid sequence of SEQ ID NO: 25.

In one example of the present invention, a protein (EDPE) having an activity of producing cicosane from fructose is provided, which originates from Ensifer adhaerens . For example, the protein may have the amino acid sequence of SEQ ID NO: 26 and have activity to produce psicose from fructose.

The nucleic acid sequence encoding the Saikosupemirase may comprise a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 26, a nucleic acid sequence of SEQ ID NO: 27, and a nucleic acid sequence of SEQ ID NO: 28.

In one example of the present invention, Ruminococcus that resulting from the torques), a protein (RDPE) which is active to produce fructose from between courses is provided. For example, the protein may have the amino acid sequence of SEQ ID NO: 29 and have activity to produce psicose from fructose.

The nucleic acid sequence encoding the Saikosupemirase may include a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 29, a nucleic acid sequence of SEQ ID NO: 30, and a nucleic acid sequence of SEQ ID NO: 31.

The expression cassette according to the present invention may further comprise at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site.

A further example of the present invention is a coryneform bacterium comprising a promoter for expression of a genus of Corynebacterium sp. According to the present invention, a regulatory sequence comprising it, or a polynucleotide encoding said regulatory sequence and a < RTI ID = Thereby providing a gene expression cassette for the Bacterium sp. Strain.

The nucleic acid molecule for expressing the Corynebacterium sp. Strain, and the regulatory sequence and the cytoskeletal epimerase are as described above.

In one embodiment of the present invention, the expression cassette further comprises at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site as a polynucleotide sequence for expression can do. The invention also relates to an expression vector comprising said expression cassette of the invention.

The invention particularly preferably relates to a genetically modified microorganism, in particular a genus of the genus Corbicuterium, comprising a vector carrying at least one expression cassette of the invention, in particular a shuttle vector or a plasmid vector.

The recombinant vector can be constructed as a vector for cloning or as a vector for expression via methods well known in the art (Francois Baneyx, current Opinion Biotechnology 1999, 10: 411-421). The recombinant vector may be any vector that has been used for gene recombination. For example, the recombinant vector may be a plasmid expression vector, a virus expression vector (for example, replication defective retrovirus, adenovirus, and adeno-associated virus) A viral vector, and the like, but the present invention is not limited thereto.

For example, the recombinant vector may be one selected from the group consisting of pET, pKK223-3, pTrc99a, pKD, pXMJ19, pCES208 vector, and preferably E. coli-corynebacterium shuttle vector (pCES208, J. Microbiol Biotechnol., 18: 639-647, 2008).

The polynucleotide may be used as such, or in the form of a recombinant vector comprising the polynucleotide. The recombinant vector means a recombinant nucleic acid molecule capable of delivering a target polynucleotide operably linked thereto, and the polynucleotide of interest may be operably linked to one or more transcriptional regulatory elements such as a promoter and a transcription termination factor .

The transcription termination factor may be a terminator such as rrnB, rrnB_T1, rrnB_T2, T7, and preferably a PCR T7 transcription termination factor from the pET21a vector.

An example of the present invention may be a recombinant Corynebacterium genus host cell transformed with a vector containing the gene expression cassette or containing the expression cassette.

Methods for transforming the host cell with the recombinant vector can be selected and used without particular restriction on all transformation methods known in the art. For example, fusion of bacterial protoplasts, electroporation, projectile bombardment, Infection with a vector, or the like.

The transformed strain of the genus Corynebacterium according to the present invention has high stability and overexpresses the introduced scorpion epimerase, and thus can provide a stable high-scoring ability for a long period of time. Therefore, the transformed strain of the genus Corynebacterium can be usefully applied to the production of the scikos, and the yield of the scikos production can be further improved.

Preferred strains of the genus Corbacterium are the genus Corynebacterium, especially Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, Corynebacterium, Thermoaminogenes, Corynebacterium melassecola, and Corynebacterium efficiens are bacterial species.

The transformed recombinant Corynebacterium host cell according to the present invention may be a recombinant Corynebacterium glutamicum, for example, the Korean Culture Center of Microorganisms , KCCM) is a recombinant Corynebacterium glutamicum strain deposited on Oct. 29, 2014 and deposited under accession number KCCM11593P.

The cultivation of the Corynebacterium sp. Strain can be carried out in a suitable culture medium by various culture methods known in the art. Examples of the culture method include batch, continuous, and fed-batch cultivation. The fed-batch cultivation includes, but is not limited to, an implantation and a repeated implantation culture.

The media which can be used according to the present invention generally comprise at least one carbon source, a nitrogen source, inorganic salts, vitamins and / or trace elements. Preferred carbon sources are sugars such as monosaccharides, disaccharides or polysaccharides. The nitrogen source is generally an organic or inorganic nitrogen compound, or a material comprising these compounds. Examples of nitrogen sources include ammonia gas or ammonium salts such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids, or complex nitrogen sources such as corn steep liquor, Yeast extract, and meat extract. The nitrogen source may be used alone or as a mixture. Inorganic salt compounds which may be present in the medium include chloride, phosphate or sulfate of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. As the phosphorus source, phosphoric acid, potassium dihydrogenphosphate or dipotassium hydrogenphosphate, or the corresponding sodium-containing salts may be used. A chelating agent may be added to the medium to maintain metal ions in solution. All components of the medium are sterilized by heating (1.5 bar and 121? For 20 min) or by sterile filtration. These ingredients can be sterilized together, or individually as needed. All components of the medium may be present at the start of the culture, or may optionally be added continuously or batchwise.

Another example of the present invention relates to a method for producing a microorganism which comprises culturing a microorganism of the genus Escherichia of the genus Corynebacterium, And at least one selected from the group consisting of

In addition, the present invention relates to a method for producing a recombinant Corynebacterium cell culture, which comprises culturing a recombinant Corynebacterium sp. Host cell, which comprises culturing the cell, Wherein the composition for producing a sciatica comprising at least one selected is contacted with a fructose-containing raw material to produce a scicos.

The culture includes an enzyme produced from the strain of genus Corynebacterium, and may include the strain of the strain or may be a cell-free form that does not include a strain. The lysate refers to a lysate obtained by disrupting the strain of the genus Corynebacterium or a supernatant obtained by centrifuging the lysate, and comprises the enzyme produced from the strain of genus Corynebacterium. In the present specification, unless otherwise stated, the Corynebacterium sp. Strain used in the production of the scorch may contain at least one selected from the group consisting of the cells of the strain, the culture of the strain and the disruption of the strain It is used to mean.

The method for producing a sacca comprises reacting the Corynebacterium sp. Strain with a fructose-containing raw material. In one embodiment, the step of reacting the strain of genus Corynebacterium with fructose may be carried out by culturing the host strain of the genus Corynebacterium in a culture medium containing fructose. In another embodiment, the step of reacting the strain of genus Corynebacterium with fructose comprises contacting the strain (fungus, culture of the strain, and / or strain of the strain) with fructose, for example, Or by contacting the carrier with fructose in the carrier on which the strain is immobilized. Thus, by reacting the strain of genus Corynebacterium with fructose, it is possible to convert fructose into cyclosporin and produce cyclosaccharide from fructose.

In the above-mentioned method of producing a scicos, the concentration of fructose used as a substrate may be 40 to 75% (w / v), for example, 50 to 75% (w / v) have. When the concentration of fructose is lower than the above range, economical efficiency is lowered. When the concentration of fructose is higher than the above range, fructose is not dissolved well, so that the concentration of fructose is preferably within the above range. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

In the above-mentioned method for producing a scicos, the reaction may be carried out under the conditions of a pH of 6 to 9.5, for example, a pH of 7 to 9, a pH of 7 to 8 or a pH of 8 to 9. Further, the reaction can be carried out at a temperature of 30 DEG C or more, for example, 40 DEG C or more. The reaction may be carried out at a temperature of 40 to 80 ° C, for example, 50 to 75 ° C, 60 to 75 ° C, or 68 to 75 ° C, since the browning of fructose, which is a substrate, may occur when the temperature exceeds 80 ° C . Further, the longer the reaction time, the higher the conversion rate of psicose. For example, the reaction time is preferably at least 1 hour, such as at least 2 hours, at least 3 hours, at least 4 hours, at least 5 hours, or at least 6 hours. When the reaction time exceeds 48 hours, the rate of increase of the conversion rate of the psicose is small or rather decreases, so that the reaction time should not exceed 48 hours. Therefore, the reaction time may be 1 to 48 hours, 2 to 48 hours, 3 to 48 hours, 4 to 48 hours, 5 to 48 hours, or 6 to 48 hours. In view of industrial and economical aspects, 48 hours, 2 to 36 hours, 3 to 24 hours, 3 to 12 hours, or 3 to 6 hours, but the present invention is not limited thereto. The above conditions are selected as conditions under which the conversion efficiency from fructose to psicose is maximized.

In addition, in the above-mentioned method of producing a saccate, the cell concentration of the used strain is 5 mg (dcw: dry cell weight) / ml or more, for example, 5 to 100 mg (dcw) / ml, 10 to 90 mg ) / ml, 20 to 80 mg (dcw) / ml, 30 to 70 mg (dcw) / ml, 40 to 60 mg (dcw) / ml or 45 to 55 mg (dcw) / ml. When the cell concentration is less than the above range, the activity of converting the cytokine is low or almost not. When the celloca concentration exceeds the above range, the cell becomes too large and the overall efficiency of the cytokine conversion reaction is lowered.

Since activation of the enzyme (e. G., Epimerase) that converts the fructose into a cyucose can be regulated by the metal ion, the addition of a metal ion in the production of the cyucose results in the conversion efficiency from fructose to cyclosu The yield of psycosis can be increased.

Therefore, the composition for producing the sci-cose comprising the Corynebacterium sp. Strain may further comprise a metal ion. In addition, the method for producing Corynebacterium using the Corynebacterium sp. Strain may further include adding a metal ion. In one embodiment, the metal ion may be added to the culture medium of the culturing step, or the culturing step may be performed in a culture medium to which the metal ion is added. In another embodiment, the metal ion may be added to fructose or to a mixture of the Corynebacterium sp. Strain and fructose. In another embodiment, the Corynebacterium sp. Strain is added to the immobilized carrier (before the fructose addition), or the Corynebacterium sp. Strain is added to the mixture of immobilized carrier and fructose (after fructose addition) , Or in the form of a mixture of fructose and fructose upon addition of fructose, respectively.

The metal ion may be at least one selected from the group consisting of copper ion, manganese ion, calcium ion, magnesium ion, zinc ion, nickel ion, cobalt ion, iron ion and aluminum ion. For example, the metal ion may be at least one selected from the group consisting of manganese ion, magnesium ion, nickel ion, and cobalt ion. In one embodiment, the metal ion may be manganese ion, cobalt ion, or a mixture thereof. When the addition amount of the metal ion is less than 0.5 mM, the effect of increasing the yield of the production of the psicose is insignificant, so that the addition amount of the metal ion may be 0.5 mM or more. On the other hand, if the addition amount of the metal ion exceeds 5 mM, the effect is insignificant compared to the excess amount, and therefore the addition amount of the metal ion can be 5 mM or less. For example, the addition amount of the metal ion may be in the range of 0.5 mM to 5 mM, for example, 0.5 mM to 2 mM.

The carrier may be an immobilized strain, or an environment in which the activity of the enzyme produced from the strain can be maintained for a long time, and may be any known carrier that can be used for enzyme immobilization. For example, sodium alginate (soduim alginate) may be used as the carrier. Sodium alginate is a natural colloidal polysaccharide abundantly present on the cell wall of algae. It is composed of mannuronic acid (β-D-mannuronic acid) and α-L-gluronic acid. Beta-1,4 bond so that the strain or enzyme can be stably fixed, which is advantageous to exhibit excellent scorch yield.

In one embodiment, a sodium alginate solution (e.g., sodium alginate solution) at a concentration of 1.5 to 4.0% (w / v), such as sodium alginate at a concentration of about 2.5% (w / v) The solution can be used to immobilize the strain. For example, the microorganism is cultured in a culture medium containing a microorganism, an enzyme produced by the microorganism, or an aqueous solution of sodium alginate in an amount of 1 to 2 times the volume of the microorganism, or a culture containing the enzyme produced by the microorganism, Or a lysate of the strain is added and mixed, and then the obtained mixed solution is dropped into a 0.2M calcium ion solution by using a syringe pump and a vacuum pump to produce beads. The bacteria of the strain are added to the sodium alginate carrier, A culture containing the produced enzyme, or a lysate of the strain may be immobilized. The enzyme may be purified from the strain, the strain culture or the disruption of the strain by a conventional method such as dialysis, precipitation, adsorption, electrophoresis, affinity chromatography, ion exchange chromatography and the like.

In one embodiment, the step of reacting the enzyme protein or the like with fructose may be performed by contacting the enzyme protein with fructose. In one embodiment, the step of contacting the enzyme protein or the like with fructose may be carried out, for example, by mixing the enzyme protein or the like with fructose, or contacting the fructose with a carrier to which the enzyme protein or the like is immobilized have. In still another embodiment, the step of reacting the enzyme protein with fructose may be carried out by reacting the cells of the recombinant strain with a fructose-containing starting material and reacting at an appropriate temperature. Thus, by reacting the enzyme protein or the like with fructose, it is possible to convert fructose into cyclosaccharide and produce cyclosaccharide from fructose.

In order to efficiently produce the above-mentioned cyclosporin, the amount of enzyme protein used is preferably 0.001 mg / ml to 1.0 mg / ml, 0.005 mg / ml to 1.0 mg / ml, 0.01 mg / ml to 1.0 mg / / ml to 0.1 mg / ml, or 0.05 mg / ml to 0.1 mg / ml. When the amount of the enzyme used is lower than the above-mentioned concentration, the conversion efficiency of the psicose can be lowered. If the concentration is higher than the above-mentioned concentration, the economical efficiency in the industry is lowered.

For efficient cicos production, the concentration of fructose used as a substrate may be 40 to 75% (w / v), such as 50 to 75% (w / v), based on the total reactants. When the concentration of fructose is lower than the above range, economical efficiency is lowered. When the concentration of fructose is higher than the above range, fructose is not dissolved well, so that the concentration of fructose is preferably within the above range. The fructose may be used in the form of a solution dissolved in a buffer solution or water (e.g., distilled water).

Taking into account the optimum conditions of the enzyme protein, the reaction pH, the reaction temperature and the concentration of the enzyme can be appropriately selected and performed. For example, the pH of the reaction may be 6 to 9, and the reaction temperature may exceed 10O 0 C, for example, 40 0 C or higher, since the browning of the substrate fructose may occur when the reaction temperature exceeds 80 ° C. In addition, although it depends on the enzyme concentration, the longer the reaction time is, the higher the conversion rate of psicose. For example, considering the thermal stability of the enzyme (for example, thermal stability at 50 캜), the reaction time is preferably 1 hour or more. When the reaction time exceeds 8 hours, the rate of increase of the cyclosuction conversion rate is small or rather decreases, so that the reaction time should not exceed 8 hours.

In the case of using the recombinant strain in the above-mentioned method of producing a saccate, the cell concentration of the strain used may be 0.1 mg (dcw: dry cell weight) / ml or more based on the total reactant.

The enzyme protein having the above-mentioned cyclosporin-converting enzyme activity may have a metalloenzyme characteristic that activation is controlled by a metal ion. The reaction by the enzyme protein can be carried out in the presence of metal ions to enhance the yield of the production of the psicose. The metal ion that can contribute to the yield of the psicose production may be one or more selected from the group consisting of copper ion, manganese ion, calcium ion, magnesium ion, zinc ion, nickel ion, cobalt ion, iron ion, , Manganese ion, iron ion, and cobalt ion. When the addition amount of the metal ion is less than 0.1 mM, the effect of increasing the yield of the production of the psicose is insignificant, so that the addition amount of the metal ion can be 0.1 mM or more. On the other hand, if the addition amount of the metal ion exceeds 5 mM, the effect is insignificant compared to the excess amount, and therefore the addition amount of the metal ion can be 5 mM or less. For example, the addition amount of the metal ion may be in the range of 0.1 mM to 5 mM, for example, 0.1 to 2 mM, or 0.5 mM to 1.5 mM.

Therefore, the composition for the preparation of the above-mentioned composition may further contain the above-mentioned metal ion, and the kind and content of the metal ion are as described above. In addition, the method for producing a cosmetic composition may further comprise adding a metal ion, and the kind and content of the metal ion are as described above.

In another embodiment, the method for producing Saikosu may comprise reacting a recombinant strain expressing a cyclic epimerase or an enzyme protein separated from the recombinant strain with fructose. The method for producing the above-mentioned cyclosaccharide may further comprise the step of culturing and recovering a recombinant strain expressing a cyclosporin-like enzyme before the reaction step.

Saikos obtained from fructose by the method of the present invention can be purified by conventional methods, and such crystals belong to a technique common to those skilled in the art. For example, by one or more methods selected from the group consisting of centrifugation, filtration, crystallization, ion exchange chromatography, and combinations thereof.

The present invention relates to a gene expression system for expressing a cyclic epimerase in a strain of the genus Corynebacterium, which is a GRAS strain, so that it can be mass produced from fructose and used as a food material, a recombinant vector containing the same and a Corynebacterium genus And a fungus-containing raw material can be used to produce a cyclosporin using the gene of the gene expression system.

Figures 1a-1d illustrate the preparation of the D-psicose 3-epimerase protein according to one embodiment of the present invention in combination with corynebacterium (pCES_tac1CDPE), Fig. 1C shows a recombinant vector (pCES_tac2CDPE), and Fig. 1D shows a recombinant vector (pCES_trcCDPE), respectively, in order to show the cleavage map of the recombinant vector for expression in glutamicum . will be.
FIG. 2 is a photograph showing the amount of protein expressed by SDS-PAGE after lysing cells cultured using a bead beater according to an embodiment of the present invention.
FIG. 3 is a graph illustrating a comparison of cell initial reaction kinetics in a section where the cyclosconversion rate is a straight line according to an embodiment of the present invention.
FIG. 4 is a graph comparing the thermal stability of CDPE-expressing cells at 50.degree. C. in the course of cell reaction according to an embodiment of the present invention. FIG.

Hereinafter, the present invention will be described in more detail by way of specific examples. However, the present invention is not limited to the following examples.

Example  1. Preparation of plasmid

Example  1-1: sod  Vector Production Using Promoter

The DPE gene (Gene bank: EDS06411.1) derived from Clostridium scindens ATCC 35704 was synthesized as modified polynucleotides by optimizing E. coli for the Escherichia coli CDPE. The polynucleotide optimized for E. coli (SEQ ID NO: 21), the corynebacterium gDNA (SEQ ID NO: 22) and the sod promoter (SEQ ID NO: 4) obtained from the pET21a vector and the T7 terminator were obtained through PC The polynucleotide was sequenced by cloning into a pGEM T-easy vector through T-vector cloning using a single template by overlap PCR (PCR). Specifically, the polynucleotide was a sod promoter of SEQ ID NO: 6, And the CDPE sequence and the T7 terminator, which are the optimized sequences in E. coli No. 21.

The entire confirmed polynucleotide was inserted into the same restriction enzyme site of the expression vector pCES208 (J. Microbiol. Biotechnol., 18: 639-647, 2008) using restriction enzymes NotI and XbaI (NEB) to obtain a recombinant vector pCES208 / (PCES_sodCDPE) was prepared. A cleavage map of the prepared recombinant vector (pCES_sodCDPE) is shown in Fig.

Example  1-2: tac1  Vector Production Using Promoter

The following plasmids were also prepared for cloning to compare expression and activity of non-target proteins other than pCES_sodCDPEII:

(SEQ ID NO: 21) was obtained from pET21a_CDPE by PCR and cloned into pKK223-3 vector with XmaI and HindIII to prepare pKK_CDPE. Using pKK_CDPE as a template, PCR was carried out from the tac promoter (SEQ ID NO: 11) to the rrn terminator The plasmid pCES208 was cloned into NotI and XbaI site to prepare a recombinant vector (pCES_tac1CDPE). A cleavage map of the prepared recombinant vector (pCES_tac1CDPE) is shown in Fig. 1B.

Example  1-3: tac2  Vector Production Using Promoter

PCR was carried out from pET21a_CDPE to obtain CDPE (SEQ ID NO: 21). The pKD vector was cloned into NcoI and SalI to prepare pKD_CDPE. The pKD_CDPE was used as a template and the insert was obtained by PCR from the tac2 promoter (SEQ ID NO: 15) to the rrnB terminator Followed by cloning into pCES208 plasmid with XbaI site to prepare pCES_tac2CDPE. The cleavage map of the prepared recombinant vector (pCES_tac2CDPE) is shown in Fig. 1C.

Example  1-4: trc  Vector Production Using Promoter

pTrc_CDPE was obtained from pET21a_CDPE by PCR and cloned into pTrc99a vector with XmaI and HindIII to prepare pTrc_CDPE. Inserts were obtained by PCR from trc promoter (SEQ ID NO: 17) to rrnB terminator using pTrc_CDPE as a template The plasmid pCES208 was cloned into XbaI site to prepare pCES_trcCDPE. A cleavage map of the prepared recombinant vector (pCES_trcCDPE) is shown in Fig. 1D.

Example  2. Transformation of host cells

Four types of plasmids prepared in Example 1 were transformed with Corynebacterium glutaricum using electroporation. Colonies were picked and inoculated into 4 ml of LB medium (10 g / L of tryptone, 10 g / L of NaCl, 5 g / L of yeast extract) supplemented with kanamycin at a final concentration of 15 ug / And 250 rpm for about 16 hours. Then, 1 ml of the culture solution was obtained and inoculated into 100 ml of LB medium containing 15 ug / ml of kanamycin, and the present cultivation was continued for 16 hours or more. Specifically, the recombinant vector (pCES_sodCDPE) The recombinant strain obtained by transforming four bacterium glutaricum was deposited at the Korea Culture Center of Microorganisms (KCCM) on October 29, 2014, addressed to 2 Gagi 25, Hongsei, Seodaemun-gu, Seoul, I received KCCM11593P.

Example  3. Target protein  Confirmation of expression

After lysis of cells cultured with Beadbeater, only supernatant is obtained, mixed with sample buffer 1: 1, and heated at 100 ° C for 5 minutes. The prepared sample was subjected to electrophoresis on a 12% SDS-PAGE gel (composition: running gel - 3.3 ml H ₂ O, 4.0 ml 30% acrylamide, 2.5 ml 1.5 M Tris buffer (pH 8.8), 100 μl 10% SDS, , 4 μl TEMED / stacking gel - 1.4 ml H ₂ O, 0.33 ml 30% acrylamide, 0.25 ml 1.0 M Tris buffer (pH 6.8), 20 μl 10% SDS, 20 μl 10% APS, 2 μl TEMED) The protein expression is confirmed by electrophoresis for about 50 minutes. The results are shown in Fig.

After the expression of CDPE was confirmed on SDS-PAGE gel, the His-tag purification was performed using Ni-NTA resin to determine the precise expression level. The expression (%) = (Purified protein (mg) / Total soluble protein )) * 100), and the expression ratios are shown in Table 2 below. In Table 2, the total protein in the strain is the entire protein contained in the Corynebacterium strain expressing the cyclic epimerase, and the cyclospermizing enzyme was obtained by purifying only the cyclic epimerase . Therefore, the expression rate is a value calculated as to how much the target protein is expressed in the total protein present in the Corynebacterium strain.

Promoter Origin Total protein in the strain (mg) Psychosomal epimerase (mg) Expression rate (%) Tac 21.43 6.28 29.3 tac2 15 2.36 15.73 trc 17.74 1.68 9.47 sod 16.62 1.74 10.47

Example  4. Through cell reaction Saikos  production

A raw material containing 50% by weight of fructose as a solid content based 1mM Mn ^{2 +} at a high concentration substrate conditions the addition, the CDPE-expressing cells obtained in Example 2 0.5 to a concentration pH 7.0 PIPES 50mM and 60 ℃ conditions of 2mg / ml After the reaction was completed, the reaction was stopped by boiling at 100 ° C for 5 minutes. Each cell was used to carry out the cell reaction under the above conditions, and after sampling by the reaction time, the yield of the cytosine and the initial cell reaction rate of each recombinant strain were calculated. (G / l) / hour (min) / the amount of cells used in the reaction (g)). The initial reaction rate per unit cell was calculated as follows: And is shown in the following Table 3 and FIG.

In order to confirm the obtained product, liquid chromatography (LC) analysis was performed to confirm the peaks of the substrate (fructose) and the product material (psicose) and to conduct quantitative analysis through the area of the peak. As a result, the initial reaction rate (Unit / g-DCW) for the production of the cytosine of the cells to various emulsifier solutions is shown in Table 3 below. The liquid chromatography analysis was carried out using an HPLC (Agilent, USA) Refractive Index Detector (Agilent 1260 RID) equipped with an Aminex HPX-87C column (BIO-RAD). The mobile phase solvent was water, and the temperature was 80 ° C and the flow rate was 0.6 ml / min.

The initial reaction rate is the initial reaction rate, which is the value obtained by dividing the amount of product produced at the reaction point of the linear velocity section by the amount of cells used in the reaction and the reaction time. That is, the larger the value of the initial reaction rate, the greater the amount of synuclein produced per cell and per hour.

Sample Saikosu (g / l) Cell initial reaction rate tacCDPE 59.12 3941 tac2CDPE 58.96 1965 trcCDPE 47.90 798 sodCDPE 65.28 1088

As shown in Table 3, tacCDPE having the highest expression rate showed the highest activity, followed by tac2, sod and trc. Therefore, it was confirmed that the initial cell reaction rate and CDPE expression amount were proportional.

Example  5: During cell reaction Thermal stability  compare

Although strains producing the psicose epimerase at a high expression rate are important, the strains producing the strains are industrially useful, and thus the present experiment was conducted to confirm the thermal stability of the strains producing the psicose epimerase.

In order to confirm the thermal stability at 50 ° C during the cell reaction, the recombinant strain cells expressing CDPE obtained in Example 2 were cultured at 50 ° C, heat was applied, and the cell reaction proceeded. The half-life (hour, min) of each cell was measured and shown in Table 4 and Fig.

Production enzyme Cell half-life (minutes) tacCDPE 1300 tac2CDPE 1260 trcCDPE 1500 sodCDPE 1800

As can be seen in Table 4, tac / CDPE showed the best cell activity, but the thermal stability at 50? Was the most stable with a half-life of 1800 min. The activity is also important when producing the cytosine through the cell reaction in the process, but if the activity of the right line is secured, then the thermal stability becomes more economical, so sod / CDPE is preferable.

Korea Microorganism Conservation Center (overseas) KCCM11593P 20141029

<110> SAMYANG GENEX CORPORATION <120> Expression system for psicose epimerase and production for          psicose using the same <130> DPP20145029 <160> 31 <170> Kopatentin 1.71 <210> 1 <211> 283 <212> DNA <213> Artificial Sequence <220> The sod promoter (1) <400> 1 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tac 283 <210> 2 <211> 290 <212> DNA <213> Artificial Sequence <220> The sod promoter (2) <400> 2 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga 290 <210> 3 <211> 300 <212> DNA <213> Artificial Sequence <220> The sod promoter (3) <400> 3 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300                                                                          300 <210> 4 <211> 342 <212> DNA <213> Artificial Sequence <220> The sod promoter (4) <400> 4 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg ac 342 <210> 5 <211> 349 <212> DNA <213> Artificial Sequence <220> <223> sod promoter (5) <400> 5 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaagga 349 <210> 6 <211> 356 <212> DNA <213> Artificial Sequence <220> The sod promoter (6) <400> 6 aagcgcctca tcagcggtaa ccatcacggg ttcgggtgcg aaaaaccatg ccataacagg 60 aatgttcctt tcgaaaattg aggaagcctt atgcccttca accctactta gctgccaatt 120 attccgggct tgtgacccgc tacccgataa ataggtcggc tgaaaaattt cgttgcaata 180 tcaacaaaaa ggcctatcat tgggaggtgt cgcaccaagt acttttgcga agcgccatct 240 gacggatttt caaaagatgt atatgctcgg tgcggaaacc tacgaaagga ttttttaccc 300 atggctgtat acgaactccc agaactcgac tacgcatacg acgaaaggat tacaaa 356 <210> 7 <211> 534 <212> DNA <213> Artificial Sequence <220> The sod promoter (7) <400> 7 tcagaattgg ttaattggtt gtaacactgg cagtgaattc tcaagtctcc acaccaccat 60 tcgaaactta caagtgtgaa ctctggcgga tcaactagtg aaaagcgtaa ctacatggtc 120 cttcttgagt atctactacg cgtactggga acaatcacta gtgaattcgc ggccgcgcaa 180 gcgcctcatc agcggtaacc atcacgggtt cgggtgcgaa aaaccatgcc ataacaggaa 240 tgttcctttc gaaaattgag gaagccttat gcccttcaac cctacttagc tgccaattat 300 tccgggcttg tgacccgcta cccgataaat aggtcggctg aaaaatttcg ttgcaatatc 360 aacaaaaagg cctatcattg ggaggtgtcg caccaagtac ttttgcgaag cgccatctga 420 cggattttca aaagatgtat atgctcggtg cggaaaccta cgaaaggatt ttttacccat 480 ggctgtatac gaactcccag aactcgacta cgcatacgac gaaaggatta caaa 534 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> The Tac1 promoter (1) <400> 8 tgacaattaa tcatcggctc gtatattgt 29 <210> 9 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (2) <400> 9 tgacaattaa tcatcggctc gtatattgtg aaagga 36 <210> 10 <211> 86 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (3) <400> 10 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaagga 86 <210> 11 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> The Tac1 promoter (4) <400> 11 tgacaattaa tcatcggctc gtatattgtg tggaattgtg agcggataac aatttcacac 60 aggaaacaga attcccgggg aaaggattac aaa 93 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (1) <400> 12 tgacaattaa tcatccggct cgtataatgt 30 <210> 13 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (2) <400> 13 tgacaattaa tcatccggct cgtataatgt gaaagga 37 <210> 14 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (3) <400> 14 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aagga 105 <210> 15 <211> 112 <212> DNA <213> Artificial Sequence <220> <223> The Tac2 promoter (4) <400> 15 tgacaattaa tcatccggct cgtataatgt taacaatttg tggaattgtg agcggacaca 60 caggaaacag accatggaat tcgagctcgg tacccgggga aaggattaca aa 112 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> The Trc promoter (1) <400> 16 tgacaattaa tcatcggcct cgtataatgt 30 <210> 17 <211> 78 <212> DNA <213> Artificial Sequence <220> The Trc promoter (2) <400> 17 tgacaattaa tcatcggcct cgtataatgt gtggaattgt gagcggataa caatttcaca 60 caggaaacag acccatgg 78 <210> 18 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Ribosome binding region <400> 18 gaaagga 7 <210> 19 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> Spacer sequence <400> 19 ttacaaa 7 <210> 20 <211> 289 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of an enzyme protein originated from          Clostridium scindens <400> 20 Met Lys His Gly Ile Tyr Tyr Ala Tyr Trp Glu Gln Glu Trp Ala Ala   1 5 10 15 Asp Tyr Lys Arg Tyr Val Glu Lys Ala Ala Lys Leu Gly Phe Asp Ile              20 25 30 Leu Glu Val Gly Ala Ala Pro Leu Pro Asp Tyr Ser Ala Gln Glu Val          35 40 45 Lys Glu Leu Lys Lys Cys Ala Asp Asp Asn Gly Ile Gln Leu Thr Ala      50 55 60 Gly Tyr Gly Pro Ala Phe Asn His Asn Met Gly Ser Ser Asp Pro Lys  65 70 75 80 Ile Arg Glu Glu Ala Leu Gln Trp Tyr Lys Arg Leu Phe Glu Val Met                  85 90 95 Ala Gly Leu Asp Ile His Leu Ile Gly Gly Ala Leu Tyr Ser Tyr Trp             100 105 110 Pro Val Asp Phe Ala Thr Ala Asn Lys Glu Glu Asp Trp Lys His Ser         115 120 125 Val Glu Gly Met Gln Ile Leu Ala Pro Ile Ala Ser Gln Tyr Gly Ile     130 135 140 Asn Leu Gly Met Glu Val Leu Asn Arg Phe Glu Ser His Ile Leu Asn 145 150 155 160 Thr Ser Glu Glu Gly Val Lys Phe Val Thr Glu Val Gly Met Asp Asn                 165 170 175 Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu Glu Ser Ser             180 185 190 Ile Gly Asp Ala Ile Arg His Ala Gly Lys Leu Leu Gly His Phe His         195 200 205 Thr Gly Glu Cys Asn Arg Met Val Pro Gly Lys Gly Arg Thr Pro Trp     210 215 220 Arg Glu Ile Gly Asp Ala Leu Arg Glu Ile Glu Tyr Asp Gly Thr Val 225 230 235 240 Val Met Glu Pro Phe Val Arg Met Gly Gly Gln Val Gly Ser Asp Ile                 245 250 255 Lys Val Trp Arg Asp Ile Ser Lys Gly Ala Gly Glu Asp Arg Leu Asp             260 265 270 Glu Asp Ala Arg Arg Ala Val Glu Phe Gln Arg Tyr Met Leu Glu Trp         275 280 285 Lys     <210> 21 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of the enzyme protein of SEQ          ID NO: 20 <400> 21 atgaaacacg gtatctacta cgcgtactgg gaacaggaat gggcggcgga ctacaaacgt 60 tacgttgaaa aagcggcgaa actgggtttc gacatcctgg aagttggtgc ggcgccgctg 120 ccggactact ctgcgcagga agttaaagaa ctgaaaaaat gcgcggacga caacggtatc 180 cagctgaccg cgggttacgg tccggcgttc aaccacaaca tgggttcttc tgacccgaaa 240 atccgtgaag aagcgctgca gtggtacaaa cgtctgttcg aagttatggc gggtctggac 300 atccacctga tcggtggtgc gctgtactct tactggccgg ttgacttcgc gaccgcgaac 360 aaagaagaag actggaaaca ctctgttgaa ggtatgcaga tcctggcgcc gatcgcgtct 420 cagtacggta tcaacctggg tatggaagtt ctgaaccgtt tcgaatctca catcctgaac 480 acctctgaag aaggtgttaa attcgttacc gaagttggta tggacaacgt taaagttatg 540 ctggacacct tccacatgaa catcgaagaa tcttctatcg gtgacgcgat ccgtcacgcg 600 ggtaaactgc tgggtcactt ccacaccggt gaatgcaacc gtatggttcc gggtaaaggt 660 cgtaccccgt ggcgtgaaat cggtgacgcg ctgcgtgaaa tcgaatacga cggtaccgtt 720 gttatggaac cgttcgttcg tatgggtggt caggttggtt ctgacatcaa agtttggcgt 780 gacatctcta aaggtgcggg tgaagaccgt ctggacgaag acgcgcgtcg tgcggttgaa 840 ttccagcgtt acatgctgga atggaaataa 870 <210> 22 <211> 870 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (2) of the enzyme protein of SEQ ID          NO: 20 <400> 22 atgaagcacg gcatctacta cgcatactgg gagcaggagt gggcagcaga ctacaagcgc 60 tacgttgaga aggcagcaaa gctgggcttc gacatcctgg aggttggcgc agcaccactg 120 ccagactact ccgcacagga ggttaaggag ctgaagaagt gcgcagacga caacggcatc 180 cagctgaccg caggctacgg cccagcattc aaccacaaca tgggctcctc cgacccaaag 240 atccgcgagg aggcactgca gtggtacaag cgcctgttcg aggttatggc aggcctggac 300 atccacctga tcggcggcgc actgtactcc tactggccag ttgacttcgc aaccgcaaac 360 aaggaggagg actggaagca ctccgttgag ggcatgcaga tcctggcacc aatcgcatcc 420 cagtacggca tcaacctggg catggaggtt ctgaaccgct tcgagtccca catcctgaac 480 acctccgagg agggcgttaa gttcgttacc gaggttggca tggacaacgt taaggttatg 540 ctggacacct tccacatgaa catcgaggag tcctccatcg gcgacgcaat ccgccacgca 600 ggcaagctgc tgggccactt ccacaccggc gagtgcaacc gcatggttcc aggcaagggc 660 cgcaccccat ggcgcgagat cggcgacgca ctgcgcgaga tcgagtacga cggcaccgtt 720 gttatggagc cattcgttcg catgggcggc caggttggct ccgacatcaa ggtttggcgc 780 gacatctcca agggcgcagg cgaggaccgc ctggacgagg acgcacgccg cgcagttgag 840 ttccagcgct acatgctgga gtggaagtaa 870 <210> 23 <211> 295 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of psicose 3-epimerase from Treponema          primitia <400> 23 Met Gln Tyr Gly Ile Tyr Phe Ala Tyr Trp Thr Lys Glu Trp Gln Ala   1 5 10 15 Asp Tyr Lys Lys Tyr Ile Asp Lys Val Ser Lys Leu Gly Phe Asp Ile              20 25 30 Leu Glu Ile Ser Cys Ala Ala Leu Lys Asp Gln Tyr Val Ser Asp Ser          35 40 45 Gln Leu Phe Asp Leu Arg Asp Tyr Ala Lys Glu Lys Gly Val Thr Leu      50 55 60 Thr Ala Gly Tyr Gly Pro Ala Lys Gly Glu Asn Leu Ser Ser Ser Asp  65 70 75 80 Asn Val Val Lys Asn Ala Lys Ala Phe Tyr Lys Asp Val Leu Gly                  85 90 95 Lys Leu Asn Lys Leu Asp Ile Arg Leu Leu Gly Gly Gly Leu Tyr Ser             100 105 110 Tyr Trp Pro Val Asp Tyr Ser Leu Pro Ile Asp Lys Ala Gly Asp Trp         115 120 125 Lys Arg Ser Val Glu Asn Ile Arg Glu Ile Ala Ala Ile Ala Ala Asp     130 135 140 Arg Asn Val Val Leu Gly Met Glu Val Leu Asn Arg Phe Glu Gly Tyr 145 150 155 160 Leu Leu Asn Thr Cys Glu Glu Gly Ile Lys Phe Val Asp Glu Val Asn                 165 170 175 His Pro Asn Val Lys Val Met Leu Asp Thr Phe His Met Asn Ile Glu             180 185 190 Glu Asp Asn Met Ala Glu Ala Ile Arg Met Ala Gly Asp Lys Leu Gly         195 200 205 His Phe His Ile Gly Glu Gln Asn Arg Lys Val Pro Gly Lys Gly Cys     210 215 220 Ile Pro Trp Asn Ala Ile Gly His Ala Leu Arg Asp Ile Arg Tyr Asn 225 230 235 240 Gly Thr Val Met Glu Pro Phe Val Met Pro Gly Gly Thr Ile Gly                 245 250 255 Gln Asp Ile Lys Val Trp Arg Asn Leu Leu Pro Glu Thr Ser Glu Thr             260 265 270 Ile Leu Asp Arg Asp Ala Lys Gly Ala Leu Glu Phe Val Lys His Val         275 280 285 Phe Gly Ser Thr Ser Val Leu     290 295 <210> 24 <211> 888 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence of the epimerase enzyme SEQ ID NO:          23 <400> 24 atgcagtacg gtatctactt cgcgtactgg accaaagaat ggcaggcgga ctacaaaaaa 60 tacatcgaca aagtttctaa actgggtttc gacatcctgg aaatctcttg cgcggcgctg 120 aaagaccagt acgtttctga ctctcagctg ttcgacctgc gtgactacgc gaaagaaaaa 180 ggtgttaccc tgaccgcggg ttacggtccg gcgaaaggtg aaaacctgtc ttcttctgac 240 aaccgtgttg ttaaaaacgc gaaagcgttc tacaaagacg ttctgggtaa actgaacaaa 300 ctggacatcc gtctgctggg tggtggtctg tactcttact ggccggttga ctactctctg 360 ccgatcgaca aagcgggtga ctggaaacgt tctgttgaaa acatccgtga aatcgcggcg 420 atcgcggcgg accgtaacgt tgttctgggt atggaagttc tgaaccgttt cgaaggttac 480 ctgctgaaca cctgcgaaga aggtatcaaa ttcgttgacg aagttaacca cccgaacgtt 540 aaagttatgc tggacacctt ccacatgaac atcgaagaag acaacatggc ggaagcgatc 600 cgtatggcgg gtgacaaact gggtcacttc cacatcggtg aacagaaccg taaagttccg 660 ggtaaaggtt gcatcccgtg gaacgaaatc ggtcacgcgc tgcgtgacat ccgttacaac 720 ggtaccgttg ttatggaacc gttcgttatg ccgggtggta ccatcggtca ggacatcaaa 780 gtttggcgtg acctgctgcc ggaaacctct gaaaccatcc tggaccgtga cgcgaaaggt 840 gcgctggaat tcgttaaaca cgttttcggt tctacctctg ttctgtaa 888 <210> 25 <211> 888 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequecne (2) of psicose epimerase SEQ ID          NO: 23 <400> 25 atgcagtacg gcatctactt cgcatactgg accaaggagt ggcaggcaga ctacaagaag 60 tacatcgaca aggtttccaa gctgggcttc gacatcctgg agatctcctg cgcagcactg 120 aaggaccagt acgtttccga ctcccagctg ttcgacctgc gcgactacgc aaaggagaag 180 ggcgttaccc tgaccgcagg ctacggccca gcaaagggcg agaacctgtc ctcctccgac 240 aaccgcgttg ttaagaacgc aaaggcattc tacaaggacg ttctgggcaa gctgaacaag 300 ctggacatcc gcctgctggg cggcggcctg tactcctact ggccagttga ctactccctg 360 ccaatcgaca aggcaggcga ctggaagcgc tccgttgaga acatccgcga gatcgcagca 420 atcgcagcag accgcaacgt tgttctgggc atggaggttc tgaaccgctt cgagggctac 480 ctgctgaaca cctgcgagga gggcatcaag ttcgttgacg aggttaacca cccaaacgtt 540 aaggttatgc tggacacctt ccacatgaac atcgaggagg acaacatggc agaggcaatc 600 cgcatggcag gcgacaagct gggccacttc cacatcggcg agcagaaccg caaggttcca 660 ggcaagggct gcatcccatg gaacgagatc ggccacgcac tgcgcgacat ccgctacaac 720 ggcaccgttg ttatggagcc attcgttatg ccaggcggca ccatcggcca ggacatcaag 780 gtttggcgcg acctgctgcc agagacctcc gagaccatcc tggaccgcga cgcaaagggc 840 gcactggagt tcgttaagca cgttttcggc tccacctccg ttctgtaa 888 <210> 26 <211> 282 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of D-psicose 3-epimerase originated from          Ensifer adhaerens <400> 26 Met Gln Gly Phe Gly Val His Thr Ser Met Trp Thr Met Asn Trp Asp   1 5 10 15 Arg Pro Gly Ala Glu Arg Ala Val Ala Ala Ala Val Lys Tyr Ala Val              20 25 30 Asp Phe Ile Glu Ile Pro Met Leu Asn Pro Pro Ala Val Asp Thr Ala          35 40 45 His Thr Arg Ala Leu Leu Glu Lys Asn Lys Leu Arg Ala Val Cys Ser      50 55 60 Leu Gly Leu Pro Glu Arg Ala Trp Ala Ser Val Arg Pro Asp Ala Ala  65 70 75 80 Ile Glu His Leu Lys Val Ala Ile Asp Lys Thr Ala Asp Leu Gly Gly                  85 90 95 Glu Ala Leu Ser Gly Val Ile Tyr Gly Gly Ile Gly Glu Arg Thr Gly             100 105 110 Val Pro Pro Thr Glu Ala Glu Tyr Asp Asn Ile Ala Arg Val Leu Gln         115 120 125 Ala Ala Ala Lys His Ala Lys Thr Arg Gly Ile Glu Leu Gly Val Glu     130 135 140 Ala Val Asn Arg Tyr Glu Asn His Leu Ile Asn Thr Gly Trp Gln Ala 145 150 155 160 Val Asp Met Ile Lys Arg Val Gly Ala Asp Asn Val Phe Val His Leu                 165 170 175 Asp Thr Tyr His Met Asn Ile Glu Glu Lys Gly Ile Gly Thr Gly Ile             180 185 190 Leu Asp Ala Arg Asp Phe Ile Lys Tyr Ile His Leu Ser Glu Ser Asp         195 200 205 Arg Gly Thr Pro Gly Tyr Gly Asn Cys Ala Trp Asp Glu Ile Phe Ala     210 215 220 Thr Leu Ala Ile Gly Phe Lys Gly Gly Leu Ala Met Glu Ser Phe 225 230 235 240 Ile Asn Met Pro Pro Glu Val Ala Tyr Gly Leu Ala Val Trp Arg Pro                 245 250 255 Val Ala Arg Asp Glu Glu Glu Val Met Gly Asn Gly Leu Pro Phe Leu             260 265 270 Arg Asn Lys Ala Arg Gln Tyr Gly Leu Ile         275 280 <210> 27 <211> 855 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence (1) of psicose epimerase SEQ ID          NO: 26 <400> 27 atgcagggtt tcggtgttca cacctctatg tggaccatga actgggaccg tccgggtgcg 60 gaacgtgcgg ttgcggcggc ggttaaatac gcggttgact tcatcgaaat cccgatgctg 120 aacccgccgg cggttgacac cgcgcacacc cgtgcgctgc tggaaaaaaa caaactgcgt 180 gcggtttgct ctctgggtct gccggaacgt gcgtgggcgt ctgttcgtcc ggacgcggcg 240 atcgaacacc tgaaagttgc gatcgacaaa accgcggacc tgggtggtga agcgctgtct 300 ggtgttatct acggtggtat cggtgaacgt accggtgttc cgccgaccga agcggaatac 360 gacaacatcg cgcgtgttct gcaggcggcg gcgaaacacg cgaaaacccg tggtatcgaa 420 ctgggtgttg aagcggttaa ccgttacgaa aaccacctga tcaacaccgg ttggcaggcg 480 gttgacatga tcaaacgtgt tggtgcggac aacgttttcg ttcacctgga cacctaccac 540 atgaacatcg aagaaaaagg tatcggtacc ggtatcctgg acgcgcgtga cttcatcaaa 600 tacatccacc tgtctgaatc tgaccgtggt accccgggtt acggtaactg cgcgtgggac 660 gaaatcttcg cgaccctggc ggcgatcggt ttcaaaggtg gtctggcgat ggaatctttc 720 atcaacatgc cgccggaagt tgcgtacggt ctggcggttt ggcgtccggt tgcgcgtgac 780 gaagaagaag ttatgggtaa ctctctgccg ttcctgcgta acaaagcgcg tcagtacggt 840 ctgatcctgg aataa 855 <210> 28 <211> 855 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence of psicose epimerase SEQ ID NO: 26 <400> 28 atgcagggct tcggcgttca cacctccatg tggaccatga actgggaccg cccaggcgca 60 gagcgcgcag ttgcagcagc agttaagtac gcagttgact tcatcgagat cccaatgctg 120 aacccaccag cagttgacac cgcacacacc cgcgcactgc tggagaagaa caagctgcgc 180 gcagtttgct ccctgggcct gccagagcgc gcatgggcat ccgttcgccc agacgcagca 240 atcgagcacc tgaaggttgc aatcgacaag accgcagacc tgggcggcga ggcactgtcc 300 ggcgttatct acggcggcat cggcgagcgc accggcgttc caccaaccga ggcagagtac 360 gacaacatcg cacgcgttct gcaggcagca gcaaagcacg caaagacccg cggcatcgag 420 ctgggcgttg aggcagttaa ccgctacgag aaccacctga tcaacaccgg ctggcaggca 480 gttgacatga tcaagcgcgt tggcgcagac aacgttttcg ttcacctgga cacctaccac 540 atgaacatcg aggagaaggg catcggcacc ggcatcctgg acgcacgcga cttcatcaag 600 tacatccacc tgtccgagtc cgaccgcggc accccaggct acggcaactg cgcatgggac 660 gagatcttcg caaccctggc agcaatcggc ttcaagggcg gcctggcaat ggagtccttc 720 atcaacatgc caccagaggt tgcatacggc ctggcagttt ggcgcccagt tgcacgcgac 780 gaggaggagg ttatgggcaa ctccctgcca ttcctgcgca acaaggcacg ccagtacggc 840 ctgatcctgg agtaa 855 <210> 29 <211> 290 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of D-psicose 3-epimerase originated from          Ruminococcus torques <400> 29 Met Lys Met Lys Phe Gly Thr Leu Tyr Ser Tyr Trp Gly Thr Lys Trp   1 5 10 15 Gln Cys Asp Tyr Leu Lys Thr Leu Lys Arg Val Ser Asp Ile Gly Phe              20 25 30 Asp Ile Leu Glu Met Gly Ala Pro His Leu Leu Glu Met Ser Asp Tyr          35 40 45 Glu Leu Ser Glu Leu Arg Arg Ala Ala Lys Asp Met Asp Met Val Leu      50 55 60 Thr Ala Asn Ile Gly Pro Ala Lys Asp Lys Asp Leu Ala Ser Pro Asp  65 70 75 80 Pro Asp Ile Arg Lys Ala Gly Val Asn Tyr Leu Ile Asp Ile Leu Lys                  85 90 95 Ala Met Glu Lys Val Gly Ser Lys Ser Leu Val Gly Ala Met Tyr Ser             100 105 110 Tyr Trp Pro Cys Gln Phe Glu Ile Thr Asp Lys Glu Ala Ala Trp Glu         115 120 125 Arg Ser Ile Glu Gly Met Lys Glu Val Ala Glu Ala Ala Glu Ser Leu     130 135 140 Gly Ile Glu Cys Cys Gln Glu Val Leu Asn Arg Tyr Glu Thr Tyr Ile 145 150 155 160 Ile Thr Asp Cys Arg Glu Gly Leu Glu Tyr Cys Arg Arg Val Gly Ser                 165 170 175 Glu Asn Val Asn Leu Leu Leu Asp Thr Phe His Met Asn Ile Glu Glu             180 185 190 Asp Asn Ile Pro Glu Ala Ile Arg Leu Ala Gly Arg Lys Leu Gly His         195 200 205 Leu His Val Gly Glu Ser Asn Arg Lys Leu Pro Gly Met Gly Ser Leu     210 215 220 Pro Trp Arg Asp Ile Gly Arg Ala Leu Arg Asp Ile Gly Tyr Glu Lys 225 230 235 240 Gly Val Val Met Glu Pro Phe Leu Leu Gln Gly Gly Glu Val Ala Arg                 245 250 255 Asp Cys Lys Val Trp Arg Asp Leu Ser Gly Asn Ala Asp Glu Lys Met             260 265 270 Leu Asp Arg Tyr Ile Lys Glu Ser Leu Thr Phe Leu Lys His Glu Phe         275 280 285 Thr Phe     290 <210> 30 <211> 873 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid sequnce of psicose epimperase SEQ ID NO: 29 <400> 30 atgaaaatga aattcggtac cctgtactct tactggggta ccaaatggca gtgcgactac 60 ctgaaaaccc tgaaacgtgt ttctgacatc ggtttcgaca tcctggaaat gggtgcgccg 120 cacctgctgg aaatgtctga ctacgaactg tctgaactgc gtcgtgcggc gaaagacatg 180 gacatggttc tgaccgcgaa catcggtccg gcgaaagaca aagacctggc gtctccggac 240 ccggacatcc gtaaagcggg tgttaactac ctgatcgaca tcctgaaagc gatggaaaaa 300 gttggttcta aatctctggt tggtgcgatg tactcttact ggccgtgcca gttcgaaatc 360 accgacaaag aagcggcgtg ggaacgttct atcgaaggta tgaaagaagt tgcggaagcg 420 gcggaatctc tgggtatcga atgctgccag gaagttctga accgttacga aacctacatc 480 atcaccgact gccgtgaagg tctggaatac tgccgtcgtg ttggttctga aaacgttaac 540 ctgctgctgg acaccttcca catgaacatc gaagaagaca acatcccgga agcgatccgt 600 ctggcgggtc gtaaactggg tcacctgcac gttggtgaat ctaaccgtaa actgccgggt 660 atgggttctc tgccgtggcg tgacatcggt cgtgcgctgc gtgacatcgg ttacgaaaaa 720 ggtgttgtta tggaaccgtt cctgctgcag ggtggtgaag ttgcgcgtga ctgcaaagtt 780 tggcgtgacc tgtctggtaa cgcggacgaa aaaatgctgg accgttacat caaagaatct 840 ctgaccttcc tgaaacacga attcaccttc tga 873 <210> 31 <211> 873 <212> DNA <213> Artificial Sequence <220> Modified nucleic acid sequence of psicose epimerase SEQ ID NO: 29 <400> 31 atgaagatga aatttggaac attatattct tattggggaa caaaatggca atgtgattat 60 gggtgctcct cacttgttgg aaatgtcaga ttatgaactt tcagaattga ggcgcgcggc gaaagatatg 180 gatatggtat tgacggcaaa tatcggaccg gcaaaagata aagatcttgc ttctcctgat 240 ccggatatac gaaaagcggg agtaaactat ttgatcgata tattaaaagc aatggaaaaa 300 gtaggatcta aatcacttgt tggagcaatg tattcttatt ggccgtgtca atttgaaata 360 acggataagg aagctgcctg ggagagaagc atcgagggga tgaaagaggt tgcagaagct 420 gcggaatcat tgggaatcga atgctgtcag gaagttttga atcgatatga aacttatatt 480 atcacagatt gcagggaagg attggaatac tgcaggagag tcggaagtga aaacgttaat 540 ctccttcttg atacatttca tatgaatatc gaagaagata atattccgga ggctatccgg 600 cttgcaggaa gaaaattggg ccatctgcat gtgggagaat caaacagaaa gcttccggga 660 atgggatccc ttccttggag agatatcgga cgggcgctaa gagatatcgg atatgagaaa 720 ggcgtcgtta tggaaccgtt tcttcttcaa ggaggagagg tcgctcggga ctgtaaagtg 780 tggagagatt taagtgggaa tgcagatgag aaaatgctgg atcgctatat aaaagaatct 840 ttaacatttt tgaaacatga atttacgttt tga 873

Claims (33)

A nucleic acid sequence encoding a cyclic epimerase and a regulatory sequence operably linked upstream thereof and regulating the expression of said cyclic epimerase in a genus of Corynebacterium sp.
Wherein the regulatory sequence comprises a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 1, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 8, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 12, A gene expression cassette expressing a cyclic epimerizing agent in a strain of the genus Corynebacterium, which comprises a transcription promoter selected from the group consisting of a nucleic acid molecule. The gene expression cassette of claim 1, wherein the regulatory sequence further comprises a ribosome binding region comprising the nucleic acid sequence of SEQ ID NO: 18. 3. The gene expression cassette of claim 2, wherein the regulatory sequence further comprises a spacer nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 4. The oligonucleotide according to claim 3, wherein the regulatory sequence comprises a ribosomal binding region having a nucleic acid sequence of SEQ ID NO: 18 sequentially linked from the 5 'end to a 3'-terminal direction and an oligonucleotide consisting of a spacer sequence having a nucleic acid sequence of SEQ ID NO: Wherein the gene expression cassette further comprises a gene expression cassette. 2. The gene expression cassette of claim 1, wherein the regulatory sequence further comprises a first linker polynucleotide of 1 to 100 base size linked to the 3'-end of the transcriptional promoter. The gene expression cassette according to claim 1, wherein the regulatory sequence is located sequentially from the 5 'end to the 3'-terminal direction, comprising a transcriptional promoter, a ribosome binding region, and a spacer sequence. 7. The gene expression cassette of claim 6, wherein the regulatory sequence further comprises a first linker sequence of between one and 100 base sizes located between the transcriptional promoter and the ribosome binding region. [Claim 3] The method according to claim 2, wherein the regulatory sequence comprises a transcriptional promoter and a ribosome binding region sequentially positioned from the 5 ' end to the 3 ' -end, A gene expression cassette further comprising a first linker polynucleotide of 100 bases in size. The method of claim 2, wherein the regulatory sequence comprises a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 2 to SEQ ID NO: 7, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 9 to SEQ ID NO: Wherein the nucleic acid molecule is selected from the group consisting of: &lt; RTI ID = 0.0 &gt; 7. The method of claim 4, wherein the regulatory sequence is selected from the group consisting of a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 6 to SEQ ID NO: 7, a nucleic acid molecule comprising a nucleic acid sequence of SEQ ID NO: 11 and a nucleic acid molecule comprising SEQ ID NO: A gene expression cassette that is selected. 6. The gene expression cassette of claim 5, wherein the regulatory sequence is a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 8. The method of claim 7, wherein the regulatory sequence is selected from the group consisting of a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 10 to SEQ ID NO: 11, and a nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: Expression cassette. 2. The method of claim 1, wherein the Saicospiriparase is selected from the group consisting of Clostridium scidens , Treponema primitia , Ensifer adhaerens ) or Ruminococcus ( Ruminococcus torques) to the gene expression cassette comes from. 14. The nucleic acid sequence according to claim 13, wherein the nucleic acid sequence encoding the cyclic epimerase comprises a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 20, a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: A nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 26, or a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 29. The method according to claim 14, wherein the nucleic acid sequence encoding the cyclic epimerase is SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 30, Wherein the nucleic acid molecule comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: The nucleic acid sequence according to claim 1, wherein the regulatory sequence is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 17, and the nucleotide sequence encoding the cyclic epimerase is SEQ ID NO: 20 A nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 23, a nucleic acid sequence encoding a peptide comprising the amino acid sequence of SEQ ID NO: 26, or a peptide comprising the amino acid sequence of SEQ ID NO: &Lt; / RTI &gt; wherein the nucleic acid sequence is a nucleic acid sequence encoding a peptide comprising SEQ ID NO. [Claim 17] The method according to claim 16, wherein the regulatory sequence is a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 7, and the nucleotide sequence encoding the cyclic epimerase is SEQ ID NO: A gene expression cassette that is a nucleic acid sequence encoding a peptide comprising an amino acid sequence. The method according to claim 1, wherein the Corynebacterium sp. Strain is selected from the group consisting of Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, A gene expression cassette comprising at least one member selected from the group consisting of thermoaminogenes, corynebacterium melassecola, and corynebacterium eficiens. The gene expression cassette according to claim 1, wherein the expression cassette further comprises at least one sequence selected from the group consisting of a replication origin, a leader, a selectable marker, a cloning site and a restriction enzyme recognition site. A transcription promoter comprising a polynucleotide selected from the group consisting of nucleic acid molecules comprising the nucleic acid sequences of SEQ ID NO: 1 to SEQ ID NO: 19, and expressing a cyclic epimerizing agent in a strain of the genus Corynebacterium. 19. A vector comprising a gene expression cassette according to any one of claims 1 to 19. 22. The vector of claim 21, wherein said vector is a plasmid. 22. The recombinant vector according to claim 21, wherein the vector has any one of the cleaved maps selected from the group consisting of a cleaved map in Figs. 1A to 1D. 19. Recombinant Corynebacterium host cells transformed with a vector comprising the gene expression cassette according to any one of claims 1 to 19 or comprising the expression cassette. 25. The method of claim 24, wherein the Corynebacterium sp. Strain is selected from the group consisting of Corynebacterium glutamicum, Corynebacterium acetoglutamicum, Corynebacterium acetoacidophilum, A Corynebacterium genus host cell comprising at least one member selected from the group consisting of thermoaminogenes, Corynebacterium melassecola, and Corynebacterium efficiens. 27. The host cell of claim 24, wherein said strain is a Corynebacterium glutamicum strain having accession number KCCM11593P. A method for producing a recombinant Corynebacterium sp. Strain comprising culturing a recombinant Corynebacterium sp. Host cell according to claim 24, comprising the step of culturing the cell, the cell culture, the cell lysate, and the lysate or the culture Wherein the composition comprises at least one selected from the group consisting of the following. 19. Recombinant Corynebacterium genus host cells transformed with a vector comprising the gene expression cassette according to any one of claims 1 to 19 or comprising the expression cassette,
At least one selected from the group consisting of a cytosine epimerase obtained from the culture, a cell of the cell, a culture of the cell, a cell lysate of the cell, and an extract of the lysate or the culture is reacted with the fructose- How to Produce Saikos. 29. The method according to claim 28, wherein the fecal-containing material is brought into contact with the carrier on which the cyclossephinase or the cells of the cell are immobilized, to produce the psicose. 29. The method according to claim 28, wherein at least one selected from the group consisting of the above-mentioned psicose epimerase, cells of said cells, cultures of said cells, lysates of said cells, and extracts of said lysates or cultures, &Lt; / RTI &gt; to produce the psicose. 29. The method of claim 28, further comprising the step of adding at least one metal ion selected from the group consisting of copper, manganese, calcium, magnesium, zinc, nickel, cobalt, iron and aluminum. 29. The method of claim 28, wherein the fructose-containing source comprises fructose at a concentration of from 40 to 75% (w / w). 29. The method of claim 28, wherein the method is performed under conditions of pH 6-9 and 40-80.

Images