KR20160029305A - Composition and method for treating or preventing multiple system atrophy targeting miRNA202 - Google Patents

Abstract

Disclosed in the present invention is a pharmaceutical composition for preventing or treating multiple system atrophy, through the control of microRNA 202. In addition, disclosed in the present invention are: a marker used for diagnosing the multiple system atrophy or measuring the prognosis; and uses thereof. The composition of the present invention can be efficiently used for treating the multiple system atrophy by increasing the expression of Oct1 and inhibiting the oxidative damage to the nerves.

Description

[0001] The present invention relates to pharmaceutical compositions and methods for treating or preventing multi-system atrophy,

The present invention relates to the treatment of multi-system atrophy targeting a particular miRNA.

As the lifespan of humans increases, the incidence of neurodegenerative diseases including Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, Huntington's disease, Alzheimer's disease, multiple system atrophy, multiple infarct dementia and disc macular degeneration is also increasing. The number of neurodegenerative disease patients is estimated to be 24 million worldwide. In addition, diseases caused by other types of neurodegenerative diseases such as strokes or other trauma or injuries are increasing year by year.

In Korea, as of the end of 2003, the number of elderly people aged 65 or older who are required to receive medical treatment or care for people with brain diseases such as dementia or stroke is estimated to reach 620,000, which is equivalent to 3.4 trillion won , And the proportion of elderly population arithmetically will reach 870,000 in 2015 and 1.64 million in 2030. The management costs for these will exceed 4.8 trillion won in 2015 and reach 9 trillion by 2030 .

Among them, Mutiple System Atrophy (MSA) is a rare progressive neurodegenerative disorder characterized by the combination of various symptoms. People with this disorder have Cerebellar ataxia and symptoms similar to Parkinson's, such as heart rhythm, blood pressure, sweating, autonomic failure such as bowel and bladder control. However, the exact cause of multi-system atrophy has not yet been elucidated. Currently, no drug has been developed as a remedy, but it is aimed at symptom control and drugs such as levodopa / carbidopa combination known as Sinemet used for the treatment of Parkinson's disease are prescribed. U.S. Published Patent Application No. 2010-0168239 discloses the use of Rasagiline for the treatment of MSA.

However, it is necessary to develop a therapeutic agent for more fundamental treatment out of the treatment. Recent attempts have been made to develop therapeutic agents using microRNA inhibitors. Korean Laid-Open Patent Publication No. 2012-0088009 discloses a therapeutic agent for neurodegenerative diseases and a diagnostic method targeting miR-206. WO2013-036936 discloses miRNA diagnostic markers for Parkinson's disease, which are similar to those of multi-system atrophy, but different diseases. MiRs associated with the pathogenesis and treatment of multi-system atrophy have not been disclosed and development of miRNA targets for therapeutic or diagnostic purposes is required.

The present invention provides a method of treating or diagnosing a multi-systematic atrophic disease-related disease through miR-202 modulation.

In one aspect, the present invention provides a pharmaceutical composition for treating or preventing multi-system atrophy, comprising a substance capable of inhibiting the activity of microRNA (miR) -202 and a pharmaceutically acceptable carrier.

In one embodiment according to the present invention, the substance capable of inhibiting activity contained in the composition is a substance capable of inhibiting its expression, for example, a nucleic acid molecule capable of binding to all or a part of the nucleotide sequence of the molecule, For example, RNA, DNA, antigens, antisense molecules, siRNA, shRNA, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, phosphorothioate-backbone ribonucleotides, decoy oligonucleotides, PNA but are not limited to, peptide nucleic acid oligonucleotides or LNA (oligonucleotide) oligonucleotides.

The miR-202 to which the substance of the pharmaceutical composition according to the present invention binds may be represented by any one of SEQ ID NOS: 1 to 3, but is not limited thereto.

In one embodiment, the nucleic acid molecule capable of inhibiting the activity of miR-202 contained in the composition of the present invention is selected from the group consisting of the first to seventh nucleotides of SEQ ID NO: 1, 11th to 18th nucleotides of SEQ ID NO: 2, (5'-UUCCCAUGCCCUAUACCUCU-3) or a sequence comprising a ribonucleic acid and a nucleic acid, wherein the antisense oligonucleotide comprises a sequence complementary to all or part of the 64th to 71st nucleotide sequences of SEQ ID NO: No. 5 (5'-TTCCCATGCCCTATACCTCT-3 '), but is not limited thereto.

An antisense oligonucleotide according to the present invention comprises at least one nucleotide constituting LNA, or 2'-O-methylated sugar of one or more nucleotides constituting it, or at least one phosphothioate in its backbone, or a combination thereof But is not limited thereto.

The pharmaceutical composition according to the present invention is effective in the symptom of multi-system atrophy in one embodiment, for example, cerebellar ataxia dysfunction or autonomic dysfunction.

The pharmaceutical composition according to the present invention is effective for multi-system atrophy, and such a composition does not exhibit the effect through the mechanism through the inhibition of the protein expression of the Oct 1 gene, but is not limited thereto.

The composition according to the present invention may be delivered to a desired site, for example, a brain, through a formulation for intranasal administration, intravenous administration, subcutaneous injection, intracerebral intramuscular injection, inhalation administration, or oral administration.

In another aspect, the disclosure also provides a method of treating a mammal, comprising contacting a miR-202 molecule with a test substance; And determining the activity of the molecule contacted with the test substance, wherein when the contacted molecular activity is reduced compared to the activity of the miR-202 molecule of the control not contacted with the test substance, it is selected as a candidate substance Wherein the method comprises the steps of:

In the method according to the present invention, the activity of the miR-202 molecule can be determined, but not limited thereto, by measuring the binding of its Oct 1 gene to the 3'UTR region.

In another embodiment, the present invention is also directed to a kit for the diagnosis of a multi-system atrophy, comprising a substance for detecting a sequence comprising a nucleotide sequence of miR-202, a complementary sequence thereof, or a fragment thereof.

In yet another aspect, the present invention provides a method of determining miR-202 expression level in a biological sample, And a method of detecting miR-202 to provide information necessary for the diagnosis or prognosis of multi-system atrophy, comprising the step of associating the detected miR-202 concentration with a diagnosis or prognosis of a multi-system atrophy of a subject to be examined. Provide a method of providing.

The composition capable of regulating microarray expression according to the present invention shows an inhibitory effect on nerve damage due to oxidation through inhibition of Oct 1, and thus can be usefully used for the treatment, diagnosis or therapeutic agent development of multi-system atrophic diseases.

Figure 1 shows the up-regulation of miR-202 in human MSA cerebellar samples,
FIG. 1A shows microarray analysis showing miRNAs differentially expressed in the control group and the MSA cerebellum. The color shows a Z-score, the red shows a high expression (a high Z-score), the green shows a low expression, Were listed from top to bottom according to the number of miRNAs.
Figure 1B shows a heat map of miRNAs showing significant group-to-group variation.
Figure 1c shows the up-regulation of miR-202 expression in human MSA cerebellum by real-time PCR as compared to the control cerebellum, and sno202 RNA was used as an internal control. N = 4 for each group, ** P < 0.01, and Bar is ± sem.
Fig. 2 shows the result of examination of the target gene of miR-202,
Figure 2a shows the results of the detection of human Oct1 # 1 and # 2 (gene name = Pou2f1), Foxp2, Acvr2a (two sites, Acvr2a # 1 and # 2), and of human Oct1 using TargetScan, PicTar, The 3'UTR of Gad1 was selected as a possible target of human (hsa) -mIR-202, and the underlined sequence indicates the seed sequence.
Figure 2b shows the results (n = 6 per group) of reduced luciferase activity of vectors containing 3 'UTR of Oct1, Acvr2a, and Gadl as a result of miR-202 transfer into Hela cells, -202. &Lt; / RTI &gt;
Figures 2c and 2d show that transfer of miR-202 to Neuro-2a mouse neuroblastoma cells decreased Oct1 expression but not Foxp2, Acvr2a, and GAD1 expression (n = 4 per group ), Indicating that only Oct1 is the target of miR-202. Scr represents a scrambled sequence, and Bar is ± sem.
FIG. 3 shows the results of analyzing the expression of target proteins as possible in human cerebellum samples,
Figure 3a shows the result of observing the expression of possible target proteins with Western blot in control human cerebellum and MSA cerebellum.
FIG. 3B shows that only Oct1 expression was decreased in the MSA cerebellum compared to the control group.
FIG. 3c shows the correlation between the expression of Oct1 protein and the expression of miR-202 in human cerebellum (Pearson's correlation coefficient = -0.839, P = 0.009).
FIG. 3D shows that expression of Oct1 protein was decreased in a concentration-dependent manner when three different concentrations of miR-202 (0, 25, and 100 nM) were transferred to Neuro-2a cells. The results are consistent with the results.
FIG. 4 shows the effect of miR-202 on oxidative stress-induced apoptosis. As a result, Neuro2a cells were transferred to miR-202 (50 nM), AM202 (antagomir for miR-202, 50 nM) After 48 hours, the cell viability was analyzed by WST-1 after 4 hours from the addition of H ₂ O ₂ ,
Figure 4a shows increased H ₂ O ₂ induced apoptosis due to miR-202 and decreased adverse effects of miR-202 due to treatment of AM202 in the presence of H ₂ O ₂ (n = 6 per group).
Figure 4b shows that miR-202 increased Neuro-2a cell death and AM202 prevented the toxicity of miR-202 when the results were re-expressed as cell loss (% relative to untreated control). ** P &lt; 0.01.

The present invention is based on the discovery that treatment or prevention of multi-system atrophy is possible through modulation of microRNA-202 expression.

Thus, in one aspect, the invention provides a method of treating or preventing multiple system atrophy, comprising a substance capable of inhibiting the activity of one or more molecules selected from the group consisting of miR-202 and miR-199a-5p, and a pharmaceutically acceptable carrier. &Lt; / RTI &gt;

The term "miR" or "microRNA" or &quot; microRNA &quot;, as used herein, is intended to encompass 21 to 23 beats that modulate gene expression after transcription by promoting degradation of target RNA, Coded RNA. The maturation sequences of the miRNAs used herein can be obtained from the miRNA database (http://www.mirbase.org). As of August 2012, 25,141 mature miRNAs from 193 breeds are registered according to the miRNA database (19th edition, miRBase). In general, microRNAs are transcribed into precursors of about 70-80 nt (nucleotide) long with a hairpin structure called pre-miRNA and then matured by cleavage by the RNAse III enzyme Dicer. MicroRNAs form a ribonucleotide complex called miRNP, which cleaves the target gene by complementary binding to the target site, or inhibits translation. Over 30% of human miRNAs are present in clusters, which are transcribed into a single precursor and then cleaved to form the final mature miRNA.

MiR-202 herein, although not limited to this theory, binds to the 3 'untranslated region of mRNA encoding Oct 1 and regulates its expression. The sequence of miR-202 herein is of human origin and the matured sequence is 5 ' UUCCUAU GCAUAUACUUCUUUG-3' (SEQ ID NO: 1, miR-202-5p) and 5'- AGAGGUAU AGGGCAUGGGAA- CGCCUCAGAGCCCCGCCCGCCGUUCCUUUUUCCUAUGCAUAUACUUCUUUGAGGAUCUGGCCUAA AGAGGUAU AGGGCAUGGGAAAACGGGGCGGUCGGGUCCUCCCCAGCG-3 '(SEQ ID NO: 3) as well as the precursor sequence 5'- In the above sequence, the underlined part of the boldface indicates the seed sequence, and the seed sequence in SEQ ID NO: 2 is the AGAGGUAU or GAGGUAU.

miR-202 has been shown to be involved in the development of endometrial tumors (Hoffman AE et al (2013) Cancer Epidemiol Biomarkers Prev 22: 327-336) And their expression was regulated to be associated with neurodegeneration.

 Inhibition of the activity of miR-202 contained in the composition of the present invention means that it inhibits or interferes with the intracellular action or function of the miR-202. Typically, the microarray encodes its target, for example, Or directly inhibit the function of these microenome using a small molecule inhibitor, an antibody or a fragment of an antibody, or use an inhibitor or small interfering RNA molecule And indirectly controlling it. Furthermore, inhibition or inhibition of miR-202 activity includes inhibiting the activity of a precursor or mature sequence, either directly or indirectly. Inhibition of miR-202 activity also includes inhibiting their transcription (expression) and lowering their intracellular concentration.

As used herein, the term &quot; substance capable of inhibiting activity &quot; of microalaine includes any substance capable of inhibiting its expression and / or activity. Such materials include, for example, antigens, antisense molecules, small hairpin RNA molecules (shRNA), Firefly RNA molecules (siRNA), seeded LNA (Locked Nucleic Acid) oligonucleotides, decoy oligonucleotides, aptamers, ribozymes, Or an antibody that recognizes a DNA: RNA hybrid.

As used herein, the term "antisense oligonucleotide" is intended to encompass nucleic acid-based molecules capable of forming duplexes with miRNAs having a sequence complementary to all or part of the target miRNA, will be. Thus, the term "antisense oligonucleotide" as used herein may be referred to as "complementary nucleic acid-based inhibitor ".

The antisense oligonucleotides include various molecules such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), antagomir, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, Thioate-backbone ribonucleotide, a PNA (peptide nucleic acid) oligonucleotide or a LNA (locked nucleic acid) oligonucleotide.

Preferably a ribonucleic acid. The ribonucleic acid includes double interfering RNA (siRNA), short hairpin RNA (shRNA), and ribozyme.

LNA is a modified ribonucleotide with an additional bridge between the 2 'to 4' carbons of the ribose sugar site to have a locked form, whereby the oligonucleotide with the LNA has improved thermal stability.

PNA (peptide nucleic acids) include peptide-based backbones instead of sugar-phosphate backbones in polynucleotides. The 2'-O-modified oligonucleotides are preferably 2'-O-alkyl oligonucleotides, more preferably 2'-OC _1-3 alkyl oligonucleotides, and most preferably 2'-O-methyl oligonucleotides to be.

The antisense oligonucleotides include antisense oligonucleotides, antigomes and inhibitory RNA molecules in the narrow sense.

As used herein, the term " antagomir "is a single-stranded chemically modified oligonucleotide that is used for the silencing of endogenous microRNAs. Antagomir contains sequences that are not complementary to the Arganoute 2 (Ago 2) cleavage site, or that the base is modified to, for example, a 2 'methoxy group, a 3' cholesterol group or a phosphorosioate to inhibit Ago2 cleavage And has a complementary sequence to the target sequence. An antagonist according to the present invention has a sequence which is at least partially or completely complementary to the microalgae according to the present invention. In one embodiment, the antigomere comprises one or more modifications (e. G., 2'-O-methyl-sugar modifications, or 3'cholesterol modifications). In other embodiments, the antigomere comprises at least one phosphorocytoate linkage and at least partially has a phosphorothioate backbone. Suitable antagomir lengths for inhibiting the activity of microalgae according to the present invention are 7-50 nucleotides, especially 10-40 nucleotides, more particularly 15-30 nucleotides, even more particularly 15-25 nucleotides, especially 16-19 nt , But is not limited thereto. For example, 5'-AUACCUCU-3 ', which is a complementary sequence to the seed sequence 5'-AGAGGUAU-3' of miR-202.

As used herein, the term "complementary" means that the antisense oligonucleotide is sufficiently complementary to the target of microenergy according to the present invention under certain hybridization or annealing conditions, preferably physiological conditions, Is meant to encompass both partially partially substantially complementary and perfectly complementary, and preferably means completely complementary. Substantially complementary, although not entirely complementary, is intended to mean a complementarity sufficient to bind to the target sequence and to produce an effect according to the present invention, i. E. Sufficient to interfere with the activity of the microarray.

As used herein, the term "nucleic acid" includes polynucleotides, oligonucleotides, DNA, RNA, and analogs and derivatives thereof such as peptide nucleic acids (PNA) or mixtures thereof. The nucleic acid can also be single or double stranded and can encode molecules including polypeptides, mRNA, microRNA or siRNA, and the like.

In one embodiment according to the present disclosure, a substance capable of inhibiting the activity of a microarray can be complementarily bound to all or a part of the microarray pre- and / or mature sequence, in particular the seed sequence, Is an antisense oligonucleotide capable of inhibiting its activity. The inhibition of the activity is to inhibit the transcription of microalgae according to the present invention and / or its binding to the target mRNA. An antisense oligonucleotide according to the present invention may or may not include one or more of the following modifications of the backbone (skeleton) connecting the nucleotides or nucleotides constituting the antisense oligonucleotide. That is, the antisense oligonucleotide may comprise 2'-O-methylation of one or more nucleotides constituting the LNA or a sugar of one or more nucleotides constituting the antisense oligonucleotide, or one or more phosphotioates in its backbone.

In one embodiment according to the present application, the antisense oligonucleotide or nucleic acid molecule of the present invention comprises a sequence complementary to all or part of the seed sequence of a microarray according to the present invention. Seed sequences are conserved sequences that are conserved in a variety of species that are critical for the recognition of target molecules of miRNAs (Krenz, M. et al., J. Am. Coll Cardiol. 44: 2390-2397 (2004); H. Kiriazis, et al., Rev. Physiol. 62: 321 (2000)). Since miRNA binds to the target through the seed sequence, it can effectively suppress the translation of the target mRNA when the interaction of the seed sequence with the target is inhibited. Herein, the seed sequence of miR-202 is the nucleotide sequence of the first or seventh nucleotide sequence of SEQ ID NO: 1, the first or second to eighth nucleotide sequence of SEQ ID NO: 2, or the 64th to 71st nucleotides of SEQ ID NO: Lt; / RTI &gt;

Thus, in one embodiment according to the present invention, the nucleic acid molecule capable of inhibiting the activity of miR-202 is the first or the seventh nucleotide sequence of SEQ ID NO: 1, or the first or the second to eighth nucleotide sequence of SEQ ID NO: Or an antisense oligonucleotide comprising a sequence complementary to all or a part of the nucleotide sequence from the 64th to the 71st nucleotides of SEQ ID NO: 3, for example, the antisense oligonucleotide of the present invention may be a 5'-UUCCCAUGCCCUAUACCUCU-3 ' (SEQ ID NO: 4) or 5'-TTCCCATGCCCTATACCTCT-3 '(SEQ ID NO: 5).

Wherein one or more nucleotides constituting the oligonucleotide are 2'-O-methylated, or each of the one or more nucleotides is LNA, or at least one of the chemical bonds constituting the backbone may be a phosphothioate, . &Lt; / RTI &gt;

Here we have identified that miR-202 binds to the 3 'untranslated region of mRNA encoding Oct 1 and regulates its expression. miR-202 has been shown to be involved in the 3 &apos; -position of mRNA encoding Oct 1 for the first time in the present invention (Hoffman AE et al (2013) Cancer Epidemiol Biomarkers Prev 22: 327-336) And it is associated with neurodegeneration, especially cerebellar atrophy of multiple system atrophy.

Oct 1 protein is a transcription factor that contains a POU region containing 150 amino acid residues and regulates a number of target genes related to cellular stress, carcinogenesis and stemness, etc. (Kang J et al. (2009) STRENDS Biochem Sci 34: 491-499). Cells lacking Oct 1 are known to be very vulnerable to gamma rays and hydrogen peroxide, thereby increasing the concentration of reactive oxygen (Tantin D, et al. (2005) Cancer Res 65: 10750-10758).

Therefore, miR-202 overexpressed in the cerebellum of the MSA may decrease the expression of Oct 1, causing neuronal cells to be vulnerable to oxidative stress, resulting in damage of neuronal cells, and inhibiting the expression of miR-202 using the composition of the present invention Related diseases can be treated or prevented.

Accordingly, a composition comprising a substance capable of inhibiting the activity of miR-202 according to the present invention can be usefully used for the treatment, prevention or diagnosis of diseases of multi-system atrophy.

Multilateral atrophy is a rare progressive neurodegenerative disorder characterized by complex manifestations of cerebellar ataxia and autonomic changes such as heart rate, blood pressure, sweating, defecation and bladder control. It is accompanied by symptoms such as autonomic failure of the nervous system. It is associated with symptoms similar to Parkinson's disease but different from Parkinson's disease and includes Shy-Drager syndrome, Striatonigral degeneration, sporadic olivopontocerebellar atrophy. Multilateral atrophy is caused by the progressive loss of neurons in the brain. Striatonigral degeneration is known to be caused by destruction of the communication between the neurons in the two structures of the brain, known as the striatum However, the exact cause has not been revealed to date. It is difficult to distinguish it from other similar diseases including Parkinson's disease, so it is difficult to diagnose it accurately, and it is urgent to develop therapeutic agents and markers.

The composition according to the present invention is provided for the treatment or prevention of the aforementioned diseases and is administered to a subject ultimately requiring prevention or treatment of the disease in an effective amount in a prophylactically or therapeutically effective manner to prevent or treat the disease .

As used herein, the term " treatment ", "palliative" or "improvement" refers to any act that improves or alleviates the symptoms of a related disease upon administration of the composition. Those skilled in the art will be able to ascertain the precise criteria of the disease by referring to the data provided by the Korean Medical Association, and to judge the degree of improvement, improvement, and treatment of the disease.

As used herein, the term "prophylactic" means any act that inhibits or delays the onset of a related disorder. It will be apparent to those skilled in the art that the compositions herein may prevent early onset symptoms, or related disorders when administered prior to appearance.

The composition of the present invention may further comprise one or more active ingredients exhibiting the same or similar functions in association with the treatment of a disease other than the substance capable of inhibiting the activity of microalbumin according to the present invention or maintaining / increasing the solubility and / &Lt; / RTI &gt; Also optionally, it may further comprise a chemotherapeutic agent, an anti-inflammatory agent, an antiviral agent and / or an immunomodulator.

The composition of the present invention may further comprise one or more pharmaceutically acceptable diluents, carriers and / or adjuvants in addition to the above-mentioned active ingredients. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and one or more of these components. , A buffer solution, a bacteriostatic agent, and the like may be added. In addition, it can be formulated into injection formulations, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like by additionally adding diluents, dispersants, surfactants, binders and lubricants, Specific antibody or other ligand can be used in combination with the carrier. Can further be suitably formulated according to the respective disease or ingredient according to the appropriate method in the art or using the methods disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA have. For example, as solutions, emulsions and liposomes, and the like. For example, the active ingredient may be formulated into tablets, capsules, gels, syrups or suppositories by mixing with pharmaceutically acceptable liquid and / or solid carriers or excipients of fine powder. The composition according to the invention may also be prepared as a suspension in an aqueous, non-aqueous or mixed medium. The aqueous suspension may further comprise a material that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran.

The method of administering the composition according to the present invention is not particularly limited, and a known method of administering the inhibitor can be applied. Depending on the intended method, parenteral administration (for example, intranasal, intravenous, subcutaneous, ) Or oral administration. In order to obtain a rapid therapeutic effect, administration by intra-nasal injection is preferable. The compositions herein may also be delivered in a variety of routes including, for example, infusion or bolus injection, epidermal or mucosal (oral mucosa, anal mucosa, intestinal mucosa, etc.). The compositions herein may also be administered systemically or topically.

Further, the composition of the present invention is preferably introduced into the central nervous or peripheral nerves through appropriate routes. Suitable routes include intraventricular or intrathecal administration. Such administration can be accomplished using a catheter connected to the reservoir. Administration via the lung via an inhaler or sprayer may also be used, formulated as an aerosol. It is not intended to exclude formulations for intravenous administration, subcutaneous injection, intracerebral intramuscular injection, inhalation administration, or oral administration, so long as the effects according to the present invention arise.

In one embodiment according to the present application. Upon nasal administration, the effect of the composition can be enhanced as it is delivered to the brain along the olfactory nerve pathway. The nasal cavity refers to the space in the nose separated by the septa, and the intranasal administration refers to the delivery of the composition of the present invention to any tissue of the nasal epithelium. Nasal administration for the intranasal administration of the composition of the present application, which carrier comprises one or more suitable solid or filler diluents suitable for administration to any part of the mammalian, preferably human, nasal epithelium, Or an encapsulating material. Typically, the carrier can be a liquid, solution, suspension, gel, ointment, lotion, or a combination thereof. Preferably, the carrier is a pharmaceutically acceptable aqueous carrier. The compositions of the present invention may be prepared in various unit dosage forms. Such forms include, but are not limited to, nasal drops, nasal sprays, nasal gels, nasal ointments, and powders for nasal passages.

The carrier may also include a delivery enhancer, which may include, but is not limited to, an aggregation inhibitor, a dosage modifier, a pH control agent, a degradative enzyme inhibitor, a mucolytic dissolution or dextrin, a ciliostatic reagent, a membrane permeation enhancer For example, one or more of a surfactant, a bile salt, a phospholipid or a fatty acid additive, a micelle, a liposome, or a carrier, an alcohol, an enamine, a nitric oxide donor mixture, a long-chain amphipathic molecule, Hydrophobic penetration enhancers, sodium or salicylic acid derivatives, glycerol esters of acetoacetic acid, cyclodextrin or beta-cyclodextrin derivatives, medium chain fatty acids, chelating reagents, amino acids or salts thereof, N-acetylamino acids or salts thereof, Enzymes, fatty acid synthesis inhibitors, cholesterol synthesis inhibitors or nitric oxide stimulating substances, chitosan, The present compositions can be effectively combined, combined, stored, encapsulated, or stabilized to stabilize active pharmaceutical agents, such as modulating agents, vasodilators, selective delivery enhancers and intranasal mucosal delivery of epithelial junctional physiology, Stable carriers, carriers, support materials or complex-forming species, and the like.

The composition according to the present application is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically or therapeutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level will depend on the type, severity, The activity of the drug, the sensitivity to the drug, the time of administration, the route of administration and the rate of release, the duration of the treatment, factors including co-administered drugs, and other factors well known in the medical arts. The composition of the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

The dosage ranges vary widely depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate and severity of the disease, and a proper dosage is, for example, And / or the degree of specific activity of the polynucleotide used. May be calculated on the basis of the EC50 generally measured as effective in the in vivo animal model and in vitro, for example from 0.01 [mu] g to 1 g per kg of body weight and may be divided into daily, weekly, monthly, May be administered once or several times per unit period, or may be continuously administered for a long period using an infusion pump. The number of repeated administrations is determined in consideration of the duration of the drug in the body, the drug concentration in the body, and the like. The composition may be administered for recurrence, even after treatment according to the course of the disease treatment.

The active ingredients according to the present invention, for example antisense oligonucleotides, may be used in the composition as such or in the form of pharmaceutically acceptable salts. A pharmaceutically acceptable salt means that the undesirable toxicity is minimized while maintaining the biological activity of the polynucleotide according to the present invention. Such salts include salts formed with metal cation such as, for example, zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, sodium, But are not limited to, salts formed with cations derived from N-dibenzylethylene-diamine, D-glucosamine, tetraethylammonium, or ethylenediamine. no.

In one embodiment according to the present application, the active ingredients of the present invention, such as antisense oligonucleotides, are negatively charged due to the nature of the nucleotides thereof. Due to the lipophilic nature of the cell membrane, the uptake of antisense oligonucleotides into the cell membrane can be reduced. Absorption inhibition due to this polarity can be overcome through the prodrug approach described below (Crooke, RM (1998) in Crooke, ST Antisense research and Application, Springer-Verlag, Berlin, Germany, vol. 103-140).

In another aspect, the present disclosure relates to a diagnostic kit for a seizure disorder comprising a nucleotide sequence of miR-202, a complementary sequence thereof, or a fragment thereof. The nucleotide sequence is as described above and can also be found at miRBase (http://www.mirbase.org).

 The miR-202 molecules herein are differentially expressed miRNAs in MSA samples, as shown in Fig.

Therefore, the diagnostic kit of the present invention can be used for diagnosis of multi-system atrophy as described above.

The kit of the present invention may further include other components in addition to the above components. For example, when the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally comprise reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus Thermostable DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactors and dNTPs. The kit of the present invention may be made from a number of separate packaging or compartments containing the above reagent components.

According to a preferred embodiment of the present invention, the kit of the present invention may be a microarray. According to a preferred embodiment of the present invention, the kit of the present invention is a gene amplification kit.

When the kit of the present invention is a microarray, the probe is immobilized on the solid-phase surface of the microarray. When the kit of the present invention is a gene amplification kit, it includes a primer. The probe or primer specifically recognizes one or more of miR-466 and miR-let7 according to the present invention and has a sequence complementary to the above sequence. The term "complementary " as used herein means having complementarity to selectively hybridize to the nucleotide sequence under certain hybridization or annealing conditions, as defined above, and the probe or primer of the present invention May have one or more mismatch nucleotide sequences so long as they are capable of selectively hybridizing to the nucleotide sequence in addition to being fully complementary.

The nucleotide sequence of the miRNA of the present invention to be referred to in the preparation of the primer or probe can be confirmed by miRBase, and the primer or the probe can be designed by referring to this sequence.

In yet another aspect, the present invention provides a method of determining miR-202 expression level in a biological sample, And correlating the detected miR-202 concentration with a subject's diagnosis or prognosis of a multi-system atrophy, the method comprising: contacting the miR-202 with a marker for multi-system atrophy To a method for detecting it for use as a computer.

In the method according to the present invention, the associating step compares the expression level of miR-202 with the miR-202 detection result determined in the control group, wherein the expression level of miR-202 is increased compared to the control.

Further, the method according to the present invention can further use the non-marker clinical information of the test subject at the time of diagnosis or prognosis determination of the multi-system atrophy of the test subject. The non-marker clinical information of the subject includes, but is not limited to, the age, sex, weight, diet, body mass, baseline disease, blood test, brain MRI, brain CT, or cerebrospinal fluid examination.

The degree of expression of the miRNA analyzed by the kit or method of the present invention, such as RT (reverse transcriptase) -PCR or real-time-PCR (see Sambrook, J. et al., Molecular Cloning. The expression level measured by the method described in the Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) is 1.5 times or more, preferably 2 times or more as compared with the normal control, It is judged to be suffering from systemic atrophy or having a high risk of onset.

In another aspect, the present invention provides a method of treating a subject comprising contacting a microallogen according to the subject with a test substance; And determining the activity of the microen- ene in contact with the test substance, wherein the activity of the contacted microen- ene is determined by comparing the activity of the microen- ene of the control not contacted with the test substance And a method for screening a substance for treating or preventing a disease of multi-system atrophy.

In one embodiment according to the present application, the microenvironment according to the present invention may be provided in the form of cells expressing Invitro but is not limited thereto. The activity is analyzed by the expression of these microalgae. For example, a cell expressing microalgae according to the present invention may be contacted with a test substance, and then the change in the amount thereof may be compared with a control cell before or after the contact, Candidate materials are selected. The amount of expression of microalgae used in the method according to the present invention can be performed using known methods such as Northern blotting, RT-PCR, hybridization using a microarray, and the like.

In one embodiment according to the present application, the activity is determined by analyzing the interaction of the microallenes with the target thereof, for example with the 3'-UTR of Oct 1. For example, after contacting a cell expressing microalgae according to the present invention with a test substance, the degree of interaction of the target gene with the 3'-UTR of Oct 1 is compared with that of the control cell before or after the contact, Candidate substances are selected for variation, especially reduction, in the interaction. Methods for detecting RNA-RNA interactions used in the methods according to the present application are known in the art and are described for example in RNA Walk (Lusting et al., Nucleic Acids Res. 2010; 38 (1): e5 ) Or yeast two hybrid system (Piganeau et al., RNA 2006; 12: 177-184), and may be referred to RNA: A Laboratory Manual (Cold Spring Harbor Laboratory Press 2011).

The type of cells used and the amount and type of the test substance used in the present method will depend on the specific experimental method used and the kind of the test substance. Those skilled in the art will be able to select appropriate cell types, amounts and / or conditions. As a result of the experiment, a substance which causes a decrease in the activity of microalgae in the presence of the test substance as compared with the control group not in contact with the test substance is selected as a candidate substance. Less than about 99%, less than about 95%, about 90%, about 85%, about 80%, about 75%, about 70% less, less than about 65% , About 55% reduction, about 50% reduction, about 45% reduction, about 40% reduction, about 30% reduction, about 20% reduction,

As used herein, the term "test substance" means a substance that is expected to inhibit the activity of microalbumin according to the present invention as described above, and may be a low molecular weight compound, a high molecular weight compound, a mixture of compounds But are not limited to, proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzymes and DNAzymes) or sugars and lipids. The test substance may be a polypeptide having two or more amino acid residues, such as six, ten, twelve, twenty or fewer or more than twenty such as 50 amino acid residues. The test materials can be obtained from libraries of synthetic or natural compounds, and methods for obtaining libraries of such compounds are known in the art. Synthetic compound libraries are available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA) and Sigma-Aldrich Available from MycoSearch (USA). The test materials can be obtained by various combinatorial library methods known in the art and include, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the desired synthetic library method, &quot; 1-bead 1-compound &quot; library method, and by synthetic library methods using affinity chromatography screening. Methods for synthesis of molecular libraries are described in DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994, and the like.

In one embodiment according to the present application, for the purpose of screening a drug for treating multi-system atrophic disease, the compound may be used which has a therapeutic effect of low molecular weight. For example, compounds having a weight of about 1000 Da such as 400 Da, 600 Da or 800 Da can be used. Depending on the purpose, such compounds may constitute a part of a library of compounds, and the number of compounds constituting the library may vary from several tens to several millions. Such a library of compounds can be prepared by reacting peptides, peptoids and other cyclic or linear oligomeric compounds, and low molecular weight compounds based on a template, such as benzodiazepines, hydantoins, biaryls, carbocycles, and polycycle compounds such as naphthalene, Carbodihydrate and amino acid derivatives, dihydropyridines, benzhydryls and heterocycles (such as triazine, indole, thiazolidine, etc.), but this is merely exemplary It is not limited thereto.

For example, biologics can also be used for screening. Biologics refers to a cell or a biomolecule, which refers to a substance produced using biomolecules, proteins, nucleic acids, carbohydrates, lipids, or in vivo and in vitro cell systems. Biomolecules may be provided alone or in combination with other biomolecules or cells. Biomolecules include, for example, proteins or biological organic materials found in polynucleotides, peptides, antibodies, or other plasma.

Hereinafter, embodiments are provided to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited to the following examples.

Example

The experimental method used in this embodiment is as follows.

Human brain samples Frozen human cerebellum samples were obtained from the NICHD Brain and Tissue Bank for Developmental Disorders (Baltimore, MD, USA). MSA and control cerebellum (n = 4 per group) were matched for post-transitional period, age and sex. One gram of cortex derived from the cerebellar hemispheres (upper surface) was used, 0.5g was used for RNA extraction and the rest was used for protein analysis.

miRNA microarray analysis and target gene discovery

Total miRNAs were extracted from the samples using Trizol (Invitrogen, USA) according to the manufacturer's instructions. The concentration of each RNA sample was measured using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). miRNA expression profiles were analyzed using a microarray 8x15K kit (Agilent Technologies, Inc.) that detected 866 human miRNAs according to the manufacturer's instructions. Data were analyzed using Genowiz ^TM (OcimumBiosolutions, Hyderabad, India) according to the manufacturer's instructions. A total of 8 samples (4 normal controls and 4 MSA cerebellum) were analyzed on a single microarray chip. Up-expression was defined as> 2-fold increase in expression compared to control, and P-value vs. Lt; 0.05. Downward expression was defined as> 2-fold decrease in expression, and P-value vs. Lt; 0.05.

The maturation sequence of the elevated miRNA was obtained from miRBase (http://www.mirbase.org). Targets of elevated miRNAs are miRNA target prediction site TargetScan (www.targetcan.org) Lewis BP, et al, (2005) Cel 1 20: 15-20; Pictar (http://pictar.mdc-berlin.de/) Kreka, et al (2005) Nat Genet 37: 495-500, and microT (Kiriakidou M et al (2004) Genes Dev 18: 1165-1178) Were used to identify possible targets for elevated miRNAs. Expression of the target gene in the cerebellum was confirmed using GENSAT Atlas (http://www.gensat.org).

Real-time PCR of miRNA

MiRNAs selected by microarray analysis were verified by qRT-PCR (reverse transcription-polymerase chain reaction). Real-time PCR was performed using TaqMan® MicroRNA Assays (Life Technologies, USA), probes and primers contained therein, and amplified by PCR using ABI PRISM 7000 sequence detection system (Ambion-Applied Biosystems, USA) Respectively. The heat treatment was repeated for 40 cycles consisting of 95 캜 for 15 seconds and 60 캜 for 60 seconds after heat treatment at 50 캜 for 2 minutes and 95 캜 for 10 minutes. All reactions were carried out in triplicate. Relative expression levels were calculated using the comparative threshold cycle (Ct) 2-ΔCt equation and the miRNA concentration was normalized to the snoRNA202 concentration measured using an endogenous snoRNA detection kit (Ambion-Applied Biosystems).

Lucifer Lase Analysis

Luciferase assay was analyzed as previously described (Lee, ST et al (2012) Ann Neurol 72: 269-277). To summarize, a luciferase vector having the 3 'UTR (Untranslated Region) sequence of a human target gene was used (transfection-ready firefly-luciferase reporter construct: Product ID: S803410, S814351, S808010, S808906, SwitchGear Genomics , USA).

Hela cells were seeded into each well of a 24 well plate at a concentration of 5 x 10 ⁴ cells in RPMI medium containing 10% FBS. After 24 hours, the cells were transfected with 50 nM miRNA-202 duplexes (or scrambled miRNA duplexes; Bioneer, South Korea), 83 ng / ml 3'-UTR firefly-luciferase expression vectors, and 83 ng / ml Renilla- luciferase expression empty vectors (SwitchGear Genomics) using Lipofectamine 2000 according to the manufacturer's instructions. The activity of Firefly and Renilla luciferase was measured after 48 hours using the Dual-Luciferase (R) Reporter 1000 Assay System (Promega, USA) according to the manufacturer's instructions. The ratio of Firefly luciferase activity to Renilla luciferase activity was used for the analysis.

(50 μM miR-202 duplex (Guide: 5'-AGAGGUAUAGGGCAUGGGAA-3 ', Passenger: 5'-UUCCUAUGCAUAUACUUCUUUU 3') was added to Neuro-2a cells (American Type Culture Collection, USA)

Or scrambled miRNA duplex; Bioneer), 50 nM antagomir-202 (AM202, 2'-O-methylated-5'-UUC CCA UGC CCU AUA CCU CU-3 ') or all using Lipofectamine 2000 (Life Technology, USA) . Different concentrations of miR-202 (0, 25, and 100 nM) were transferred to Neuro-2a cells to see the effect on dose. To observe the changes in expression level, cells were harvested 48 hours after transfection to produce homogeneous cargo and Western blotting. Antibodies against the following proteins were used in Western blot: Pou2f1 (Oct1; Santa Cruz Biotechnology, USA), Foxp2 (Abcam, UK), Acvr2a (Santa Cruz Biotechnology), and Gad1 (Santa Cruz Biotechnology). Proteins reacting with the antibody were visualized using a chemiluminescent reagent (Pierce, USA) according to the manufacturer's method and scanned with a GS-700 scanner (Bio-Rad, USA). The intensity of each band was measured relative to the beta actin band using Image-J software (National Institutes of Health, USA). Protein expression in human cerebellum samples was also measured by Western blotting using antibodies as described above.

Hydrogen peroxide treatment after miRNA transfer was performed as follows. Neuro-2a cells were transfected into 50 nM miR-202 duplex, 50 nM AM202, or both, and treated with H ₂ O ₂ (1 mM) or the same amount of sterilized water for 4 hours as a control. Cell viability was analyzed using the WST-1 assay kit (Roche, Switzerland) according to the manufacturer's instructions.

Statistical analysis

The heat map for miRNA expression was generated using the Z-score, which was calculated as follows: Z-score = [(raw value for expression of each miRNA - The mean value for each miRNA / standard deviation of all miRNAS expression. Group comparisons were performed using the Student-t test. Tertiary p-value <0.05 was considered statistically significant. Relationships were analyzed using Pearson correlation coefficient.

Example 1 Up-Expression of miR-202 in the Cerebellar Degenerative Tissue

MiRNA expression profiles were compared in four MSA and matched control samples in post-hysterectomy, sex, and age as described in the experimental method. The characteristics of the samples are shown in Table 1, and each group included the same number of male and female samples and the age (control, 59.3 ± 12.6 y; MSA, 60.3 ± 11.6) and the post- , 4.8 ± 1.3 days; MSA, 4.5 ± 1.7 days) were similar.

[Table 1]

miRNA analysis showed that a total of nine miRNAs (miR-129-3p, miR-129-5p, miR-337-3p, miR-380, miR-433, miR-132, miR- -5p) was significantly down-regulated (> 2-fold decrease, P <0.05) in the MSA samples compared to the control. Two miRNAs (miR-202, and miR-199a-5p) were significantly up-expressed in the MSA samples (> 2-fold increase, P <0.0.5, see Figs. 1a and 1b) as compared to the control. The expression level of miR-202 was highest in the expression level.

In order to exclude phagocytic results of microarray analysis, real-time RT-PCR on miR-202 in human cerebellum samples showed that compared to normal control samples, as shown in Fig. 1C, miR-202 (2.68-fold increase, P = 0.029, Mann-Whitney U test). Based on this, miR-202 was used for further analysis.

Example 2 Target Identification of miR-202

TargetScan, PicTar, and microT were used to identify the 3 'UTR target site of miR-202 as described in the experimental method. Expression of the target gene was confirmed using GENSAT Atlas. As a result, we identified six possible targets: Oct1 (Pou2f1; two positions), Foxp2, Acvr2a (two positions), and Gad1. The target site is depicted in Figure 2a.

In order to confirm the results of the in silico prediction, a vector containing 3 'UTR of each of the above-identified genes was transferred into Hela cells in the presence or absence of miR-202. As a result, miR-202 decreased the expression of Oct1, Acvr2a, and GAD1 3 'UTR as shown in Fig. 2b.

The effect of miR-202 on the expression of Oct1, Acvr2a, and GAD1 was examined by Western blotting after transferring the vector into Neuro-2a cells. As a result, as shown in FIGS. 2c and 2d, the transfer of miR-202 resulted in a decrease in the concentration of Oct 1 compared to the scrambled miRNA, indicating that the target of miR-202 is Oct 1. Normal Neuro-2a cells expressed a detectable amount of miR-202 (results not shown).

Example 3 Role of miR-202 and Oct 1 in cerebellar degeneration

The concentrations of Oct1, Foxp2, Acvr2a, and Gad1 proteins in MSA and control were analyzed by Western blotting (see FIG. 3a). Oct1 concentration was lower in the MSA cerebellum compared to the control group (Fig. 3B). In addition, the expression of Oct 1 protein was correlated with the concentration of miR-202 in human cerebellum samples (Pearson's correlation coefficient = -0.839, P = 0.009) (see FIG. These results indicate that Oct1 expression was decreased by increased expression of miR-202. The results were reaffirmed in an experiment with different concentrations (0, 25, and 100 nM) of miR-202 transferred to Neuro-2a. The higher the concentration of miR-202 (100>25> 0 nM), the more efficiently the expression of Oct 1 protein was reduced (see FIG. 3d).

Oct 1 is a protein expressed in Purkinje cells according to GENSAT Atlas, a transcription factor that plays an important role in the response of cells to oxidative stress (Kang J et al (2009) Genes Dev 23: 208-222 ). Oxidative stress has been linked to the pathogenesis of MSA (Stefanova N et al. (2009) Multiple systems atrophy: an update. Lancet Neurol 8: 1172-1178; Ahmed Z et al (2012) Neuropathol Appl Neurobiol 38: 4-24). Thus, based on this, overexpression of miR-202 in Neuro-2a cells resulted in an increase in nerve injury induced by hydrogen peroxide as shown in Figures 4a and 4b. On the other hand, treatment with Anthagomere (AM202) inhibited this effect in the presence of hydrogen peroxide. These results indicate that increased expression of miR-202 in the MSA cerebellum leads to cerebellar degeneration, indicating that miR-202 can also be the target of treatment and diagnosis of MSA.

In summary, we have shown that miR-202 is up-regulated in the brain of MSA patients, which decreases Oct 1 expression and causes oxidative damage of neurons. These results also indicate that miRNAs are involved as a pathogenesis of cerebellar degeneration and, therefore, can be targets for the treatment and diagnosis of miRNA MSAs.

While the present invention has been described in connection with what is presently considered to be the preferred embodiments, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, .

All technical terms used in the present invention are used in the sense that they are generally understood by those of ordinary skill in the relevant field of the present invention unless otherwise defined. The contents of all publications referred to herein are incorporated herein by reference.

<110> SNU R & DB Foundation <120> Composition and method for treating or preventing multiple system          atrophy targeting miRNA202 <130> DP201407007P <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 22 <212> RNA <213> Homo sapiens <400> 1 uuccuaugca uauacuucuu ug 22 <210> 2 <211> 20 <212> RNA <213> Homo sapiens <400> 2 agagguauag ggcaugggaa 20 <210> 3 <211> 110 <212> RNA <213> Homo sapiens <400> 3 cgccucagag ccgcccgccg uuccuuuuuc cuaugcauau acuucuuuga ggaucuggcc 60 uaaagaggua uagggcaugg gaaaacgggg cggucggguc cuccccagcg 110 <210> 4 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> antagomir for miR-202 <400> 4 uucccaugcc cuauaccucu 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> DNA corresponding to antagomir for miR-202 <400> 5 ttcccatgcc ctatacctct 20

Claims (19)

A pharmaceutical composition for the treatment or prophylaxis of multi-system atrophy, comprising a substance capable of inhibiting the activity of microarray (miR) -202 and a pharmaceutically acceptable carrier.
The pharmaceutical composition according to claim 1, wherein the substance capable of inhibiting the activity is a substance capable of inhibiting its expression.
The pharmaceutical composition according to claim 1, wherein the activity-inhibiting substance is a nucleic acid molecule capable of binding to all or a part of the nucleotide sequence of the molecule.
4. The method of claim 3, wherein the nucleic acid molecule is selected from the group consisting of RNA, DNA, antigens, antisense molecules, siRNA, shRNA, 2'-O-modified oligonucleotides, phosphorothioate-backbone deoxyribonucleotides, phosphorothioate- Wherein the nucleic acid is a nucleotide, a decoy oligonucleotide, a PNA (peptide nucleic acid) oligonucleotide or a LNA (oligonucleotide) oligonucleotide.
5. The method of claim 4,
MiR-202 is represented by any one of SEQ ID NOS: 1 to 3,
The nucleic acid molecule capable of inhibiting the activity of miR-202 may be selected from among the first to seventh nucleotides of SEQ ID NO: 1, the first nucleotide of SEQ ID NO: 2, the second to eighth nucleotide of SEQ ID NO: 2, Wherein the antisense oligonucleotide comprises a complementary sequence to all or a portion of the sequence of the polynucleotide sequence.
6. The antisense oligonucleotide according to claim 5, wherein the antisense oligonucleotide comprises at least one nucleotide, wherein the sugar of the LNA or at least one nucleotide constituting the antisense oligonucleotide is 2'-O-methylated, or at least one phosphothioate in its backbone, &Lt; / RTI &gt; or a combination thereof.
The method according to claim 5 or 6,
Wherein the antisense oligonucleotide capable of inhibiting miR-202 activity is represented by SEQ ID NO: 4 (5'-UUCCCAUGCCCUAUACCUCU-3 ') or SEQ ID NO: 5 (5'-TTCCCATGCCCTATACCTCT-3' Or prophylaxis.
The pharmaceutical composition according to claim 1, wherein the symptoms of multi-system atrophy are cerebellar ataxia dysfunction or autonomic dysfunction.
The pharmaceutical composition according to claim 1, wherein the composition inhibits protein expression of the Oct 1 gene.
9. The method according to any one of claims 1 to 8,
Wherein the composition is delivered to the brain.
11. The method of claim 10,
The pharmaceutical composition for treating or preventing multiple system atrophy, wherein the composition is formulated for intranasal administration, intravenous administration, subcutaneous injection, intracerebroventricular injection, inhalation administration, or oral administration.
contacting the miR-202 molecule with the test substance; And
Determining the activity of the molecule contacted with the test substance,
Wherein the contacted molecular activity is selected as a candidate if the activity of the contacted molecule is reduced compared to the activity of the miR-202 molecule of the control not contacted with the test substance.
13. The method of claim 12,
Wherein the activity of the miR-202 molecule is determined by measuring binding of the Oct 1 gene to the 3'UTR region thereof.
13. The method of claim 12,
Wherein the symptoms of multi-system atrophy include cerebellar ataxia dysfunction or autonomic dysfunction. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt;
A kit for diagnosing multi-system atrophy, comprising a substance for detecting a sequence comprising a nucleotide sequence of miR-202, a complementary sequence thereof, or a fragment thereof.
Determining the amount of expression of miR-202 in the biological sample; And
And correlating the detected miR-202 concentration with a subject's multi-system atrophic disease diagnosis or prognosis.
17. The method of claim 16,
Wherein the associating further uses non-marker clinical information of the multi-system atrophy test subject.
18. The method of claim 17,
Wherein the non-marker clinical information of the subject is at least one of the age, sex, weight, dietary habit, body mass index, baseline disease, blood test, brain MRI, brain CT, or cerebrospinal fluid examination.
17. The method of claim 16,
Wherein the associating step is to compare the expression level of miR-202 with the miR-202 detection result determined in the control group, wherein the expression of miR-202 is increased compared to the control.

Images