KR20160028870A - Bacteria producing monophosphoryl lipid A, and method for the production of monophosphoryl lipid A using the same - Google Patents

Abstract

Provided are: bacteria for producing monophosphoryl lipid A (MLA) comprising LpxE polypeptide; and a production method of MLA by using the same. Accordingly, the MLA can be simply produced without acidic hydrolysis and/or basic hydrolysis.

Description

[0001] The present invention relates to a bacterium producing monophosphoryl lipid A and a method for producing monophosphoryl lipid A using the same, and a method for producing monophosphoryl lipid A,

A monophosphoryl lipid A (MLA), and a method for producing MLA using the same.

Lipopolysaccharide (LPS) is one of the components of the outer membrane that surrounds the peptidoglycan of gram-negative bacteria. LPS is a combination of lipid A and several types of covalently bonded sugars. Lipid A is known to be an endotoxin that is responsible for the toxicity of Gram-negative bacteria.

Lipid A activates cells (e. G., Monocytes or macrophages) in the amount of picograms to milliliters and is therefore used as a very potent stimulant to activate the immune system. Lipid A, its derivatives, or variants thereof, are used, for example, as a component of the vaccine (adjuvant). In particular, monophosphoryl lipid A (MLA) has been used for adjuvant, allergic immunotherapy, cancer immunotherapy, or for the prevention and treatment of dementia. Lipid A of a membrane of Gram-negative bacteria such as E. coli is a sugar-bound substance such as Kdo (2-keto-3-deoxy-D-manno-octulosonate). After extracting LPS from the bacterial membrane, LPS is heated And hydrolysis in the presence of sodium carbonate to remove Kdo and 1-phosphate groups, or chemically synthesizing MLA. However, these methods are complicated and have a low yield.

Therefore, there is a need to develop a method for producing MLA that is simpler than conventional methods and without acid hydrolysis.

Provides bacteria that produce MLA.

Provides a production method of MLA.

One aspect provides a bacterium that produces a monophosphoryl lipid A (MLA) comprising an LpxE polypeptide.

The lipid A consists of acyl chains attached to two glucosamines (carbohydrates or sugars) and generally contains one phosphoric acid group in each glucosamine. Tetra, penta, hexa, or hepta-acylated lipid A, depending on the number of acyl chains. Lipid A, which activates the immune system well, is known as lipid A, which comprises six acyl chains, four acyl chains directly attached to glucosamine are betahydroxyacyl chains of 10 to 16 carbons in length, and two additional The acyl chain is attached mainly to the beta hydroxy group.

The MLA refers to a monophosphoryl lipid in which one phosphate group is bonded to only one of two glucosamines. For example, the MLA may be 1-dephosphoryl-lipid A or 4-dephosphoryl-lipid A.

The MLA may not contain 2-keto-3-deoxy-D-manno-octulosonate (Kdo). Kdo is a constituent of LPS, a conserved residue found in almost all LPS. The minimal LPS structure required for the growth of E. coli is known as tetraacyl lipid A (lipid IV _A ).

The MLA may be a tree, tetra, penta, hexa, or hepta-acylated MLA. For example, the MLA may be monophosphoryl lipid _A IV.

The MLA may be present in a membrane of a bacterium, for example, an outer membrane.

The LpxE polypeptide belongs to a lipophosphate phosphatase comprising a tripartite active site of three amino acids and six transmembrane helices. Lipophosphate phosphatase is a hydrolytic enzyme that specifically binds to a phosphoric acid monoester bond and can remove a phosphate group from a lipid containing a phosphate group. The LpxE polypeptide may be selected from the group consisting of a bacterium belonging to the genus Aquifex, a bacterium belonging to the genus Francisella, a bacterium belonging to the genus Helicobacter, a genus belonging to the genus Bordetella, a bacterium belonging to the genus Brucella, a genus belonging to the genus Rhizobium, May be an LpxE polypeptide of a bacterium selected from the group consisting of bacteria, Mesorhizobium bacteria, and Porphyromonas bacteria. The bacterium belonging to the genus Aquifex includes Aquifex aeolicus or Aquifex pyrophilus. The genus Acquepex is a thermophilic bacterium and can grow well at a temperature of about 85 ° C to 95 ° C. The bacterium belonging to the genus Acquipex may be Aquifex aeolicus. For example, the LpxE polypeptide can be an LpxE polypeptide (AaLpxE) derived from an Aquiplex aeolite. The LpxE polypeptide comprises an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence of about 90% identity, about 80% identity, about 70% identity, about 60% identity, about 50% identity, about 40% identity, 30% identity, about 20% identity, or about 10% identity to the amino acid sequence of SEQ ID NO: 1. The LpxE polypeptide comprises a nucleic acid sequence of SEQ ID NO: 2, 90% identity, 80% identity, 70% identity, 60% identity, 50% identity, 40% identity, 30% identity, 20% identity, 0.0 > 10% < / RTI > identity.

The term " bacteria "refers to prokaryotic bacteria. The bacterium may be a Gram-negative bacterium or a Gram-positive bacterium. Gram-negative bacteria refer to bacteria of the kind that are not stained with crystal violet used in Gram staining, and Gram-positive bacteria are those that are stained with crystal violet. The membrane of Gram-negative bacteria consists of an outer membrane and an inner membrane, each of which consists of a bilayer membrane, and a thin peptidoglycan layer is present. Gram-positive bacteria surround the cell membrane with a thick peptidoglycan layer. The bacterium is preferably selected from the group consisting of Escherichia genus, Shigella genus, Salmonella genus, Campylobacter genus, Neisseria genus, Haemophilus genus, Aeromonas Aeromonas, Francisella, Yersinia, Klebsiella, Bordetella, Legionella, Corynebacteria, and the like. , Citrobacter spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., Burkholderia spp., Porphytomonas spp., Vibrio spp. (Vibrio), or a combination thereof. The bacterium may be, for example, E. coli.

The bacterium may be a mutated polynucleotide encoding a KdtA polypeptide, a polynucleotide encoding a YjhD polypeptide, or a combination thereof.

The KdtA polypeptide may be an enzyme that attaches Kdo to lipid IVA. The YhjD polypeptide may be a lipid transport protein. Mutations refer to mutations in genetic material, including point mutations, frame shift mutations, insertions, deletions, inversions, translocations, and the like.

One aspect includes culturing a bacterium producing an MLA comprising an LpxE polypeptide; Obtaining a bacterium from the culture; And obtaining an MLA from the obtained bacterium.

The method comprises culturing a bacterium producing an MLA comprising an LpxE polypeptide.

The LpxE polypeptide, MLA, and bacteria are as described above.

The culture method may be a known one. The kind of the culture, the culture temperature, the culture conditions and the like may be well known. The incubation temperature may be, for example, from about 30 째 C to about 37 째 C. It can be cultured while shaking.

The method comprises obtaining a bacterium from a culture.

Methods for obtaining bacteria from cultures may be those known in the art. Bacteria can be obtained from the culture, for example, by centrifugation. The obtained bacteria can be washed with a buffer solution.

The method comprises obtaining MLA from the obtained bacteria.

MLA can be separated from lipids. Methods for obtaining lipids may be those known in the art. MLA can be obtained by physical or chemical methods. The physical method can perform, for example, ultrasonic wave or cold-shock repetition. The chemical method may be an extraction using an organic solvent. The organic solvent may be, for example, chloroform, dichloromethane, methanol, hexane, isopropyl alcohol, ethyl acetate, ethanol, or a combination thereof. The method of extracting lipids can be, for example, the Bligh and Dyer extraction method (Bligh, EG and Dyer, WJ, Can. J. Biochem. Physiol., 1959, vol.37, p.911-917) have. The method may further comprise purifying the MLA in the lipid.

According to one aspect of the present invention, a bacterium producing an MLA containing an LpxE polypeptide, and a method for producing MLA using the bacterium, can produce MLA without a simple acid hydrolysis and / or base hydrolysis.

FIG. 1A is a schematic diagram showing a biosynthetic pathway of Kdo ₂ -Lipid A in bacteria, and FIG. 1B is a schematic diagram showing a 1-dephosphorylation pathway of lipid A in bacteria.
FIG. 2A is a schematic diagram of a method for producing a PCR product containing a cat-sacB cassette, FIG. 2B is a schematic diagram of a method for producing a PCR product containing a yhjD gene mutated with a target gene, yhjD gene (*: mutation) , And FIG. 2C is a schematic diagram for introducing a chromosome mutation using a homologous recombination method (*: mutation).
Fig. 3 is a photograph showing the TLC result of lipid (lane 1: Escherichia coli JZ2, lane 2: Escherichia coli JZ2 containing pWSK29-AaLpxE, lane 3: Escherichia coli JZ2 containing pWSK29-FnLpxF).
FIG. 4A is a graph of LC / MS analysis of lipid of E. coli JZ2, and FIG. 4B is a graph of LC / MS of lipid of E. coli JZ2 containing pWSK29-AaLpxE.
5 is the respective by AaLpxE FnLpxF polypeptides and polypeptide in vivo depot 1 sports-a schematic diagram showing the process of generating a lipid IV _{A-IV A,} and 4-lipid depot spokes.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these embodiments are for illustrative purposes only, and the scope of the present invention is not limited to these embodiments.

Example  One. Aciphex Aeelokus LpxE  or Francesela  I will LpxF Preparation of a plasmid containing a polynucleotide encoding

1.1. pET21 - AaLpxE Preparation of

Aquifex Aeolite LpxE ( Aquifex aeolicus LpxE; AaLpxE polypeptide (GenBank Accession No. NP_214169.1 (ATCC)) using the following primer pairs from the Aquaplex aEerokus VF5 genome (GenBank Accession No. NC_000918.1) (ATCC) to obtain polynucleotides encoding the AaLpxE polypeptide , SEQ ID NO: 1) (GenBank Accession No. NC_000918.1: 1199317..1199841, SEQ ID NO: 2) was amplified.

Forward primer: 5'-GCATGCCATATGATGGTAATAGAAGACTTTGCTCTAAAC-3 '(SEQ ID NO: 3)

Reverse primer: 5'-ATTAGCCTCGAGATTTCTCTCATACACACCTCCCTT-3 '(SEQ ID NO: 4)

For polymerase chain reaction (PCR), KOD hot start DNA polymerase (Novagen) was used and performed in a T3000 thermocycler (Biometra).

The amplified product was purified using a QIAquick PCR purification kit (Qiagen), and the purified product was introduced into a pET21a plasmid (Novagen). Cloned plasmids were transformed into E. coli DH5a by electroporation and screened on LB-ampicillin plates. The cloned plasmid was named pET21-AaLpxE.

1.2. pWSK29 - AaLpxE Preparation of

A polynucleotide encoding AaLpxE was amplified using pET21-AaLpxE prepared in Example 1.1 as a template and using the following primer pairs.

Forward primer: 5'-TAATACGACTCACTATAGGG-3 '(SEQ ID NO: 5)

Reverse primer: 5'-ATTAGCCTCGAGCTAATTTCTCTCATACACACCTCCC-3 '(SEQ ID NO: 6)

For PCR, KOD hot start DNA polymerase (Novagen) was used and performed in a T3000 thermocycler (Biometra).

The amplified product was purified using QIAquick PCR purification kit (Qiagen) and the purified product was introduced into a pWSK29 plasmid (Wang, RF, and Kushner, SR, Gene (1991), vol.100, p.195-199) Respectively. The cloned plasmids were transformed into E. coli XL1-Blue by electroporation and screened on LB-ampicillin plates. The cloned plasmid was named pWSK29-AaLpxE.

1.3. pWSK29 - FnLpxF Preparation of

To obtain a polynucleotide encoding a Francisella novicida LpxF (FnLpxF) polypeptide, pXYW4 (Wang, X., McGrath, SC, Cotter, RJ, and Raetz, CR, The Journal of Biological Chemistry, (GenBank Accession No. DQ364143, GenBank Accession No. ABC96319.1, SEQ ID NO: 7) using the following primer pairs as primers: .1, SEQ ID NO: 8).

Forward primer: 5'-GCGCGCCATGGCAAGATTTCATATCATATTAGGTT-3 '(SEQ ID NO: 9)

Reverse primer: 5'-GCGCGCCTCGAGTCAATATTCTTTTTTACGATACATTAGTG-3 '(SEQ ID NO: 10)

For PCR, KOD hot start DNA polymerase (Novagen) was used and performed in a T3000 thermocycler (Biometra).

The amplified product was purified using QIAquick PCR purification kit (Qiagen) and the purified product was introduced into the pWSK29 plasmid of Example 1.2. The cloned plasmids were transformed into E. coli XL1-Blue by electroporation and screened on LB-ampicillin plates. The cloned plasmid was named pWSK29-FnLpxF.

Example  2. Escherichia coli JZ2  ( kdtA :: blood , yhjD - R134C , W3110 ) Preparation of Strain

2.1. Mutated yhjD  Preparation of Escherichia coli into which the gene is introduced into the genome

500 bp (base pair) upstream and 500 bp downstream of the yhjD gene in the E. coli genome were amplified from Escherichia coli genomic DNA using the following primer pairs (Fig. 2a).

For the following PCR, KOD hot start DNA polymerase (Novagen) was used and performed in a T3000 thermocycler (Biometra).

Primer P1: 5'-TCTTCATGATGGTTTTGATTGCGTG-3 '(SEQ ID NO: 11)

Primer P2: 5'-TCTTTTGTCCTTCTGTCGTGGTCATTCTTAAA-3 '(SEQ ID NO: 12)

The primer P3: 5'-GTGGCGTAAATGTAAAAGTCGAAGA-3 '(SEQ ID NO: 13)

Primer P4: 5'-CGGCGTAAACGCCTTATCCGGCA-3 '(SEQ ID NO: 14)

cat - to make a PCR product containing the sacB cassette, pYA4373 (Sun, W., Wang , S., and Curtiss, R., 3rd Applied and environmental microbiology, 2008, vol.74, p.4241-4245.) Was used as a template and the cat- sacB cassette was amplified using the following primer pairs.

Primer P5: 5'-GACCGACTATACTTTTTAAGAATGACCACGACAGAAGGACAAAAGAGCGGTACC

TGTGACGGAAGATCACTTCGCAGAAT-3 '(SEQ ID NO: 15)

Primer P6: 5'-CGAATAAAATCGTATGCCGGATAAGGCGTTTACGCCGCATCCGGCCTATTTTAT

TTGTTAACTGTTAATTGTCCTTG-3 '(SEQ ID NO: 16)

The amplification reaction was carried out using primers P1 and P4 using the product of the above 3 PCR as a template.

The amplified linear PCR products contained a cat - sacB cassette between 500 bp upstream and 500 bp upstream of the yhjD gene and the linear PCR product was cloned into the pKD46 plasmid (Datsenko, KA, and Wanner, BL, Proceedings of the National Academy of Sciences E. < / RTI > of America, 2000, vol. 97, p.6640-6645) by electroporation. Were selected on LB / agar plates containing 30 / / ml of chloramphenicol and 50 ㎍ / ml of ampicillin. Due to the 500 bp upstream and 500 bp upstream of the yhjD gene in the amplified PCR product, the cat - sacB cassette was introduced via homologous recombination into the E. coli genome (Figure 2c).

On the other hand, mutant yhjD polynucleotide fragments were amplified using Escherichia coli genomic DNA as a template and primers P1 and P4 and the following primer pairs (Fig. 2B).

Primer P7: 5'-GCCGTTCAGCAG TGT ACGACTGTAGGG-3 '(SEQ ID NO: 17)

Primer P8: 5'-CCCTACAGTCGT ACA CTGCTGAACGGC-3 '(SEQ ID NO: 18)

is a nucleic acid sequence in which primers P7 and P8 are designed so that arginine (R), which is the 134th amino acid in the yhjD polypeptide, is substituted (C13) from cysteine (C13), and the underlined portion is substituted.

The mutated yhjD polynucleotide fragment amplified in the Escherichia coli into which the cat - sacB cassette was introduced into the genome was transformed by electroporation, and LB / L mutants containing 5% (w / v) sucrose and 50 쨉 g / Agar plates. The mutated yhjD polynucleotide fragment was introduced via homologous recombination into the E. coli genome (Figure 2c). As a result, Escherichia coli transformed with pKD46 was introduced into the genome of the mutated yhjD gene.

2.2. Escherichia coli JZ2  ( kdtA :: blood , yhjD - R134C , W3110 ) Preparation of Strain

The amplification reaction was performed using CMR100 (Reynolds, C. M., and Raetz, C. R., Biochemistry, 2009, vol.48, p.9627-9640) as a template and the following primer pairs.

Forward primer: 5'-AGCAGCATATCGATTTTGCATCAG-3 '(SEQ ID NO: 19)

Reverse primer: 5'-AAAGTGATGGTAAACCGGGCTATTT-3 '(SEQ ID NO: 20)

For PCR, KOD hot start DNA polymerase (Novagen) was used and performed in a T3000 thermocycler (Biometra).

The amplified linear kdtA :: kan PCR fragment was transformed by electroporation into E. coli containing the mutated yhjD gene prepared in Example 2.1 and pKD46 and screened on LB agar plates containing 25 μg / ml kanamycin. The selected E. coli was named JZ2. Coli JZ2 kdtA is because the gene is removed, Kdo ₂ from lipid IV _A - can not be converted to lipid IV _A, IV _A are accumulated lipids in the outer membrane of E. coli.

Example  3. AaLpxE  or FnLpxF Identification of the introduced lipid of Escherichia coli

3.1. pWSK29 - AaLpxE  or pWSK29 - FnLpxF Lt; / RTI > JZ2 Extraction of lipids from

When E. coli JZ2 prepared in Example 2.2 was transformed into pWSK29-AaLpxE or pWSK29-FnLpxF, lipid of E. coli membranes was confirmed. Escherichia coli JZ2 without the introduction of pWSK29-AaLpxE and pWSK29-FnLpxF as negative control groups was used.

Specifically, pWSK29-AaLpxE and pWSK29-FnLpxF prepared in Examples 1.2 and 1.3, respectively, were transformed by electroporation into JZ2 strain prepared in Example 2.2, and 0.2% (w / v) glucose and 50 μg / Lt; RTI ID = 0.0 > LB < / RTI > agar plates containing ampicillin. The selected colonies were inoculated into LB liquid medium containing 0.2% (w / v) glucose and 50 μg / ml ampicillin and incubated overnight at 30 ° C. 200 ml of LB liquid medium containing 50 / / ml ampicillin was diluted to an OD (OD ₆₀₀ ) of 0.06-0.1 at 600 nm and cultured at 30 캜 until an OD ₆₀₀ of 0.2 was reached. Then 0.5 mM IPTG (isopropyl-1-thio-? - D-galactopyranoside). When the OD ₆₀₀ reached 0.5 to 0.6, the culture was centrifuged at 4000 x g for 20 minutes to obtain E. coli, and the obtained E. coli was washed with 30 ml of PBS and resuspended in 8 ml of PBS. 10 ml of chloroform and 20 ml of methanol were added to resuspended Escherichia coli, incubated at room temperature for 1 hour with occasional shaking, and centrifuged at 2500 x g for 30 minutes to obtain supernatant. 10 ml of chloroform and 10 ml of water were added to the supernatant, mixed thoroughly and then centrifuged at 2500 x g for 20 minutes. The organic solvent layer was separated and the organic solvent layer was extracted twice by adding a pre-equilibrated organic solvent layer to the upper aqueous layer. The organic solvent layer was pooled and dried on a rotary evaporator. Lipid was dissolved in 5 ml of 4: 1 (v / v) chloroform: methanol and sonicated irradiation was performed in the water bath. The lipids were transferred to a new test tube, dried at room temperature under nitrogen gas, and stored at -80 ° C.

3.2. Lipid TLC  analysis

To carry out thin layer chromatography (TLC), 1/3 of the total lipids obtained from 200 ml of Escherichia coli culture were dissolved in 200 [mu] l of 4: 1 (v / v) chloroform: methanol. 5-15 μl was then spotted on a 10 x 10 cm HPTLC plate (EMD Chemicals) and eluted with a gradient of 25: 10: 5: 4: 3 (v / v) chloroform: methanol: pyridine: acetic acid: Lt; / RTI > The developed plates were dried, visualized by spraying with 10% (v / v) sulfuric acid (in ethanol) and smeared on a hot plate at 300 ° C. TLC results of the lipids are shown in Fig. 3 (lane 1: E. coli JZ2, lane 2: E. coli JZ2 containing pWSK29-AaLpxE, lane 3: E. coli JZ2 containing pWSK29-FnLpxF).

As shown in Figure 3, was detected from E. coli lipid _A IV JZ2, from E. coli JZ2 containing pWSK29 AaLpxE-1- depot spokes - was detected in lipid _{IV A (1-dephospho-lipid} IV A), pWSK29-FnLpxF JZ2 from E. coli containing a 4-depot spokes - was detected in the lipid _{IV a (4-dephospho-lipid} IV a). Therefore, it was confirmed that when Escherichia coli JZ2 was transformed with pWSK29-AaLpxE or pWSK29-FnLpxF, it was possible to obtain live Escherichia coli containing 1-depospo-lipid IV _A or 4-depospo-lipid IV _A in the membrane.

3.3. Lipid IV _A  And 1- Defocus - Lipids IV _A Top of normal phase ) LC / MS  analysis

The lipid extracted from Example 3.1 was resuspended in 4: 1 (v / v) chloroform: methanol and LC / electrospray ionization-MS / MS analysis was performed with an equal volume of lipid sample.

Specifically, normal liquid chromatography was performed using an Ascentis silica HPLC column (5 μm, 25 cm × 2.1 mm) (Sigma-Aldrich) in an Agilent 1200 Quatenary LC system (mobile phase A: chloroform in volume ratio 800: : Methanol: water: aqueous ammonia in a volume ratio of methanol: water: aqueous ammonia, mobile phase B: volume ratio 600: 340: 50: 5, methanol: water: aqueous ammonia, and mobile phase C: volume ratio 450: 450: 95: 5). Elution (300 [mu] l / min) was performed on 100% mobile phase A for 2 min; 14 minutes in linear concentration gradient of 100% mobile phase B; 11 minutes holding on 100% mobile phase B; 3 minutes at a linear concentration gradient of 100% mobile phase C; And 100% mobile phase C for 3 minutes. The column was washed with mobile phase A between each sample for 5 minutes. 10% of the eluate was analyzed on a QSTAR XL quadropole time-of-flight tandem mass spectrometer using nitrogen as collision gas. Data were analyzed using Analyst QS software and the results are shown in Figures 4a and 4b.

Confirmed that lipid _{IV A (1-dephospho-lipid} IV A) are detected - as shown in Figures 4a and 4b, it was detected from E. coli lipid _A IV JZ2, from E. coli JZ2 containing pWSK29-1- AaLpxE depot Spokane Respectively. Thus, it was confirmed that Escherichia coli can express AaLpxE polypeptide to obtain live Escherichia coli containing 1-depospo-lipid IV _A (FIG. 5).

<110> Korea Institute of Science and Technology <120> Bacteria producing monophosphoryl lipid A, and method for the          production of monophosphoryl lipid A using the same <130> PN106464 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 174 <212> PRT <213> Artificial Sequence <220> <223> Aquifex aeolicus LpxE polypeptide <400> 1 Met Val Ile Glu Asp Phe Ala Leu Asn Leu Glu Leu Phe Arg Leu Ile   1 5 10 15 Asn Asn Ala Arg His Pro Leu Leu Asp Val Phe Phe Thr His Phe Ala              20 25 30 Tyr Leu Gly Ser Gly Tyr Val Leu Phe Pro Leu Leu Ile Phe Leu Phe          35 40 45 Ile Phe Arg Lys Glu Lys Val Lys Pro Leu Ile Leu      50 55 60 Glu Thr Val Leu Val Ile Ser Leu Lys Thr Phe Phe Asn Gln Pro Arg  65 70 75 80 Pro Ala Ile Leu Leu Glu Asp Val Asn Leu Leu Phe Pro Leu His Trp                  85 90 95 Arg Ser Phe Pro Ser Gly Asp Thr Ala Met Ala Phe Thr Ile Ala Thr             100 105 110 Val Leu Ser His Gly Glu Lys Leu His Ile Lys Ala Ile Leu Phe Leu         115 120 125 Tyr Ala Phe Leu Ile Gly Tyr Glu Arg Ile Tyr Ala Gly Val His Phe     130 135 140 Pro Leu Asp Val Phe Val Gly Ala Leu Ile Gly Ile Ile Cys Gly Ile 145 150 155 160 Ile Ser Leu Lys Tyr Ser Lys Gly Gly Val Tyr Glu Arg Asn                 165 170 <210> 2 <211> 525 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide encoding Aquifex aeolicus LpxE polypeptide <400> 2 atggtaatag aagactttgc tctaaacctt gaactttttc gtttgataaa caatgcgagg 60 catccacttc tggacgtttt ctttactcac tttgcttacc tcggttcggg ctatgtactg 120 tttcctttat taatctttct ttttattttc agaaaggaaa aagtaaagcc tttgatttta 180 gcgataattt tggaaacagt tttagtgatc tctctaaaaa catttttcaa ccagccgaga 240 cctgcaattt tactcgagga tgtaaactta ctttttcctt tacactggcg ttcctttccc 300 tcaggagaca ccgctatggc ttttacgata gcaactgtac tgtcacatgg tgaaaaactc 360 catataaagg caatactctt cttatacgct ttcctaatag ggtatgagag gatttacgcg 420 ggtgttcact ttcctctgga cgtttttgta ggagctctga ttggaattat ttgcggtatt 480 atttctttaa aatattccaa gggaggtgtg tatgagagaa attag 525 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 3 gcatgccata tgatggtaat agaagacttt gctctaaac 39 <210> 4 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 4 attagcctcg agatttctct catacacacc tccctt 36 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 5 taatacgact cactataggg 20 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 6 attagcctcg agctaatttc tctcatacac acctccc 37 <210> 7 <211> 222 <212> PRT <213> Artificial Sequence <220> <223> Francisella novicida LpxF polypeptide <400> 7 Met Ala Arg Phe His Ile Ile Leu Gly Leu Val Val Cys Phe Phe Ala   1 5 10 15 Trp Ile Phe Phe Leu Ile Phe Pro Asn Leu Asp Ile Gln Phe Ala Gly              20 25 30 His Phe Tyr Asn Ser Ser Ala His Gln Phe Ile Gly Gly Tyr Asp Gly          35 40 45 Phe Leu Gly Phe Leu His Trp Phe Ala Arg Phe Phe Pro Ile Phe Phe      50 55 60 Ser Ile Ile Val Ile Leu Phe Leu Leu Gly Ser Leu Phe Ile Asp Lys  65 70 75 80 Phe Lys Ile Lys Tyr Arg Lys Ala Ile Phe Phe Ile Ala Val Cys Leu                  85 90 95 Trp Ile Gly Pro Gly Leu Val Val Asn Tyr Val Phe Lys Asp His Trp             100 105 110 Gly Arg Pro Arg Val Met Val Glu Gln Phe Asn Gly Asp Lys Ile         115 120 125 Phe Gln Pro Pro Phe Val Ile Ser Ser Gln Cys Asp Lys Asn Cys Ser     130 135 140 Phe Val Cys Gly Asp Ala Ser Met Gly Phe Trp Leu Phe Ala Phe Met 145 150 155 160 Pro Leu Leu Ala Thr Arg Lys Lys Lys Leu Val Ala Phe Ile Ala Ala                 165 170 175 Val Val Ala Gly Gly Gly Leu Gly Leu Met Arg Met Ser Gln Gly Gly             180 185 190 His Phe Phe Ser Asp Val Val Phe Cys Gly Ile Phe Val Tyr Ile Ser         195 200 205 Thr Trp Val Val Tyr Ala Leu Met Tyr Arg Lys Lys Glu Tyr     210 215 220 <210> 8 <211> 669 <212> DNA <213> Artificial Sequence <220> <223> Polynucleotide coding Francisella novicida LpxF polypeptide <400> 8 ttggcaagat ttcatatcat attaggttta gttgtttgtt tttttgcatg gatattcttt 60 cttatattcc cgaatttgga tatacaattc gcgggacatt tttataattc atcggcacat 120 caatttattg gtgggtatga tggcttttta ggatttttgc attggtttgc tagatttttt 180 ccaatatttt tttcaataat agtgatttta tttctattag gatcgttatt tatcgataag 240 tttaagatta agtatagaaa agctatattc tttattgcgg tatgcttatg gataggtcca 300 ggtttggttg ttaactatgt gtttaaagat cattgggggc gtccaagacc agtgatggta 360 gagcaattta atggcgacaa aatttttcaa ccaccattcg ttatatcttc acaatgtgat 420 aaaaactgct cctttgtatg tggtgatgcc tcaatgggat tttggctttt tgcatttatg 480 ccattactag ctacaagaaa aaagaagctt gttgcgttta tcgcagcagt agttgctggt 540 ggaggtttgg gattgatgag aatgtcgcaa ggagggcatt tttttagtga tgttgttttc 600 tgtggcatat ttgtgtatat ctcaacctgg gtggtttatg cactaatgta tcgtaaaaaa 660 gaatattga 669 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 9 gcgcgccatg gcaagatttc atatcatatt aggtt 35 <210> 10 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 10 gcgcgcctcg agtcaatatt cttttttacg atacattagt g 41 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer P1 <400> 11 tcttcatgat ggttttgatt gcgtg 25 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Primer P2 <400> 12 tcttttgtcc ttctgtcgtg gtcattctta aa 32 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer P3 <400> 13 gtggcgtaaa tgtaaaagtc gaaga 25 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer P4 <400> 14 cggcgtaaac gccttatccg gca 23 <210> 15 <211> 80 <212> DNA <213> Artificial Sequence <220> <223> Primer P5 <400> 15 gaccgactat actttttaag aatgaccacg acagaaggac aaaagagcgg tacctgtgac 60 ggaagatcac ttcgcagaat 80 <210> 16 <211> 77 <212> DNA <213> Artificial Sequence <220> <223> Primer P6 <400> 16 cgaataaaat cgtatgccgg ataaggcgtt tacgccgcat ccggcctatt ttatttgtta 60 actgttaatt gtccttg 77 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer P7 <400> 17 gccgttcagc agtgtacgac tgtaggg 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Primer P8 <400> 18 ccctacagtc gtacactgct gaacggc 27 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 19 agcagcatat cgatttttgc atcag 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 20 aaagtgatgg taaaccgggc tattt 25

Claims (14)

A bacterium producing monophosphoryl lipid A (MLA) comprising an LpxE polypeptide. The bacterium of claim 1, wherein the MLA does not comprise 2-keto-3-deoxy-D-manno-octulosonate (Kdo). 2. The bacterium of claim 1, wherein the MLA is tri-, tetra-, penta-, hexa-, or hepta-acylated. The method according to claim 1, wherein the MLA is a monophosphoryl lipid will IV _A bacterium. The bacterium of claim 1, wherein the MLA is 1-dephosphoryl-lipid A or 4-dephosphoryl-lipid A. The LpxE polypeptide according to claim 1, wherein the LpxE polypeptide is selected from the group consisting of a bacterium belonging to the genus Aquifex, a bacterium belonging to the genus Francisella, a bacterium belonging to the genus Helicobacter, a genus belonging to the genus Bordetella, a genus belonging to the genus Brucella, Wherein the bacterium is an LpxE polypeptide of a bacterium selected from the group consisting of Rhizobium genus, Mesorhizobium genus, and Porphyromonas genus. The bacterium according to claim 6, wherein the bacterium belonging to the genus Acquapex is Aquifex aeolicus. The bacterium of claim 1, wherein the LpxE polypeptide is a polypeptide comprising the amino acid sequence of SEQ ID NO: 1. The bacterium of claim 1, wherein the LpxE polypeptide is encoded by a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 2. The bacterium according to claim 1, wherein the bacterium is a gram-negative bacterium. The method according to claim 1, wherein the bacterium is selected from the group consisting of Escherichia genus, Shigella genus, Salmonella genus, Campylobacter genus, Neisseria genus, Haemophilus genus, But are not limited to, Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Corynea spp. But are not limited to, bacteria such as Corynebacteria, Citrobacter, Chlamydia, Brucella, Pseudomonas, Helicobacter, Burkholderia, Porphytomonas, Vibrio, or a combination thereof. The bacterium of claim 1, wherein the bacterium is a polynucleotide encoding a KdtA polypeptide, a polynucleotide encoding a YhjD polypeptide, or a combination thereof. The bacterium according to claim 1, wherein the MLA is present in a membrane of a bacterium. Culturing the bacterium of claim 1;
Obtaining a bacterium from the culture; And
And obtaining MLA from the obtained bacteria.

Images