KR20160000516A - Fibroin Heavy chain Core Promoter of Bombyx mori and the Vector Thereof - Google Patents

Abstract

The present invention relates to a high expression promoter of a fibroin heavy chain gene of a silkworm, to a recombinant vector comprising the same, and to a production method of silk thread-specific foreign protein by using the same. According to the present invention, a core promotor derived from a fibroin heavy chain gene and a high expression vector comprising the same are industrially useful by convenience of a refining process and improvement of heterologous protein productivity in the silkworm, capable of inducing high expression in a silk thread or a living body of the silkworm more than the conventional BmA3 promoter, and having high transformation efficiency with the small size.

Description

Fibroin Heavy chain Core Promoter of Bombyx mori and the Vector Thereof "

The present invention relates to a high-expression promoter which is a core-promoter derived from a fibroin heavy chain of silkworm, and a method for producing an exogenous protein in a silkworm using the promoter.

Production of useful foreign proteins using recombinant DNA technology has been utilized in various industries as host cells such as Escherichia coli, yeast, animal cells, plant cells, and insect cells. However, when E. coli and yeast are used, it is easy to manipulate and can be mass-produced. However, since there is no endoplasmic reticulum, there is no post-translational modification, so sugar chain modification is impossible and yeast and plant have an endoplasmic reticulum Since the sugar chain modification is different from that of mammals, purification of the final product requires much effort and cost. In addition, although it is the best production environment for animal cells, it is difficult to produce a useful protein in each expression system by using these as a host, as there is a problem in economy due to high production cost.

Silkworm ( Bombyx mori ) is a larva of a silkworm moth, belonging to the order Lepidoptera, and is highly domesticated and can be mass-fed throughout the year. It has a silk-producing posterior silk gland (PSG) and a middle silk gland (MSG) Therefore, it is advantageous to mass-produce protein at a low cost by expressing a silkworm-specific protein. Above all, since silkworm has an endoplasmic reticulum, it is advantageous in that glycoprotein production is facilitated by glycosylation through a post-translational modification process very similar to that of mammals. Thus, The problem can be solved.

In addition to protein drugs, transgenic silkworms can produce new fiber materials, especially with many useful materials.

The first silkworm transgenic studies were attempted by Nawa et al. (1971) in Japan prior to Drosophila, and continued to fail silkworm transplantation. However, in 2000, piggyBac transposon from T. ni cells ) Were used to construct a donor vector and a piggyBac transposon. The donor vector and piggyBac transposon were mixed with each other at a ratio of 1: 1, and microinjection was carried out within 4 hours after scattering before fission. It has been successful.

The silkworm transgenic technology is generalized and not only capable of producing a satisfactory level of transgenic plants, but also features that the introduced gene is retained without being removed even when descending to a generation. Nevertheless, it is necessary to study precisely the location of microinjection in the silkworm eggs, the concentration of the introduced DNA, the mixing ratio of the PiggyBac vector and Helper vector, and the DNA transport method, and development of a promoter is indispensable in vector development.

Promoters for silkworm transformation include the cytoplasmic Actin 3 promoter (BmA3) of the silkworm, the eyelashes of Drosophila, and the 3xP3 promoter specifically expressed in the nervous system. The technique of introducing the foreign gene into the silkworm chromosome has a low production amount of the desired foreign protein and it is difficult to purify the target protein from the silkworm body fluid.

Accordingly, the present inventors have made intensive efforts to develop a protein expression technique that is easy to purify because it is possible to improve the production amount of the target protein having physiological activity and to recover the target protein from the silk thread or silk thread. As a result, The present inventors have confirmed that the highly expressed genes are selected and the promoters involved in their expression are isolated and their expression-inducing ability is superior to that of the BmA3 promoter used for transgenic silkworm transformation.

It is an object of the present invention to provide a promoter for regulating the expression of a fibroin heavy chain gene of silkworm, a recombinant vector containing the promoter, and a method for producing silk-specific foreign protein using the same.

In order to achieve the above object, the present invention provides a high expression promoter having the nucleotide sequence shown in SEQ ID NO: 1.

The present invention also provides a recombinant vector comprising said high expression promoter.

The present invention also provides a transformant transformed by said recombinant vector.

(A) introducing a foreign gene downstream of the promoter of SEQ ID NO: 1 to produce a recombinant vector; (b) pre-treating the silkworm eggs with hydrochloric acid at 25 DEG C for 1 hour; (c) transforming the recombinant vector of step (a) by microinjection into the pretreated silkworm eggs; And (d) growing the transformed silkworm.

The present invention also provides a method for producing an exogenous protein, which is produced by the above method, wherein a silkworm transformant having a high fungicidal activity of an exogenous protein is grown on a silk thread or a silk thread to allow the exogenous protein to be contained in the silkworm dog or silkworm of the transformant .

The high expression promoter composed of the core promoter regulating the expression of the fibroin heavy chain gene according to the present invention and the recombinant vector containing the promoter have a high transformation efficiency due to their small size and are superior to the conventional BmA3 promoter in silkworms or silkworms And thus it is very useful industrially by improving the productivity of the variant protein in the silkworm and by the convenience of the purification process.

FIG. 1 shows the result of PCR analysis using 8 kinds of primer sets for 5'UTR of silkworm fibroin heavy chain gene.
FIG. 2 is a structural analysis result in which the positions of the respective primers and the active region of the promoter are predicted based on the PCR analysis result.
FIG. 3 is a genome map showing the position of a silkworm fibroin heavy chain gene promoter segment and an electrophoresis image for confirming the state of insertion of a segment vector into 8 kinds of segments.
Figure 4 shows the luciferase activity induced by the fibroin H-chain gene promoter (F1 / R1) measured over time after microinjection into silkworms (NC: pGL3 injection group: only solution: ).
FIG. 5 shows the results of analysis of luciferase activity induced by each segment of the eight silk fibroin heavy chain gene promoters.
FIG. 6 is an electrophoresis image for confirming the vector insertion state of four segments derived from the F5 / R1 promoter, which is a segment of silk fibroin heavy chain gene promoter.
FIG. 7 shows the results of analysis of luciferase activity induced by four F5 / R1 promoter-derived fragments.

Hereinafter, the present invention will be described in detail.

The present invention was to discover a core promoter having the highest expression inducing ability in the fibroin heavy chain gene promoter of silkworm, and to develop a technique for utilizing the promoter selected therefrom.

In one aspect, the present invention relates to a high-expression promoter having the nucleotide sequence shown in SEQ ID NO: 1.

In the present invention, the high-expression promoter is a core promoter derived from a fibroin heavy chain gene of silkworm, and is characterized by including a region having the highest expression-inducing ability.

In the present invention, the 'core promoter' is a vector in which a vector containing a primary promoter segment derived from the fibroin heavy chain of silkworm is microinjected into silkworm, and the promoter segment having the highest expression after 36 hours is further divided into sub- And the ability to induce expression in the fibroin heavy chain gene promoter obtained by confirming each expression ability is the best.

The high-expression promoter of the present invention is characterized by having a protein-expressing ability specifically for silkworm silk.

In another aspect, the present invention relates to a recombinant vector comprising said high expression promoter

In another aspect, the present invention relates to a transformant transformed with the recombinant vector.

In the present invention, the transformant may be an insect cell line, silkworm or microorganism.

The recombination vector of the present invention may be used to link a signal sequence or the like derived from an arbitrary gene to a promoter or to link any gene sequence to a poly A gene. It is also possible to link artificially designed and synthesized gene sequences. If necessary, sequences for replication in a bacterial host, an antibiotic resistance gene, a fluorescent protein gene, a LacZ gene, and the like may be ligated. For example, the green fluorescent protein GFP bound downstream of the promoter can introduce the gene into the appropriate site between a pair of transposon-derived DNA sequences. Whereby the screening of the transformant can be carried out conveniently.

The term 'vector' in the present invention has a circular DNA structure or a linear DNA structure and is characterized by its ability to deliver foreign genes to host cells. In particular, the vector can be replicated in E. coli, and the vector may further include a marker gene such as an antibiotic resistance gene or a fluorescent green protein gene derived from a jellyfish for the purpose of facilitating screening of the transformant.

The backbone of the recombinant vector of the present invention is a baculovirus, a viral vector, or a transposon DNA, but is not limited thereto.

In the transformant of the present invention, transformation techniques include a calcium phosphate method, an electroporation method, a DEAE-dextran method, a liposome method, a microinjection method, and a bombardment method. Can be easily selected by a person skilled in the art. Particularly, in the silkworm transformation method, it is possible to produce a silkworm transformant by microinjecting a recombinant vector into silkworm eggs.

The host target to be used in the above transformation technique is not particularly limited to insect cells but preferably is a human insect insect, more preferably a cell derived from Bombyx mori , more preferably a silkworm cell or silkworm ( Bombyx mori) ) Eggs, but are not limited thereto.

In the introduction into the silkworm silkworm cell, it is possible to easily introduce the gene into the rear silkworm tissue taken out from the body of the fifth silkworm larva by using the gene gun. The gene introduction into the posterior silk gland by the gene gun can be carried out, for example, by using gold particles coated with the high expression vector of the present invention on an agar plate or the like using a particle gun (Model: PDS-1000 / He) Lt; / RTI > pellet with a He gas pressure of 1,100 to 1,800 psi.

(A) introducing a foreign gene downstream of the promoter of SEQ ID NO: 1 to produce a recombinant vector; (b) pre-treating the silkworm eggs with hydrochloric acid at 25 DEG C for 1 hour; (c) transforming the recombinant vector of step (a) by microinjection into the pretreated silkworm eggs; And (d) growing the transformed silkworm.

In the silkworm transformant preparation method of the present invention, a promoter contained in a conventional vector is removed and replaced with a promoter of the present invention, and then a foreign gene is inserted downstream of the promoter to prepare a recombinant vector. A signal sequence derived from an arbitrary gene or the like may be ligated between the polynucleotide and an arbitrary gene sequence may be linked to the poly A. It is also possible to link artificially designed and synthesized gene sequences. If necessary, sequences for replication in a bacterial host, an antibiotic resistance gene, a fluorescent protein gene, a LacZ gene, and the like may be ligated. For example, the green fluorescent protein GFP bound downstream of the appropriate promoter can introduce the gene into the appropriate site between a pair of transposon-derived DNA sequences. This makes it easy to screen the gene recombinant silkworms.

More specifically, the method for producing a silkworm transgenic plant of the present invention is a method for producing a silkworm transformant which is suitable for transformation by allowing the eggs scattered after mating of silkworms of the silkworm cultivar variety to be in a dormant state at a low temperature (25 ° C) Then, the above-mentioned hydrochloric acid-treated silkworm eggs are attached to a slide glass, and a hole is drilled in eggshell eggs of silkworm eggs primarily using a fine tungsten capability. Then, a glass capillary is inserted and the silkworm transfection vector and the helper plasmid mixture are injected into silkworm eggs for transformation.

In the present invention, the silkworm may be Antheraea pernyi , Antheraea yamamai , Bombyx mori L. or caliqula japonica , preferably characterized by a silkworm (Bombyx mori L.) have.

In the present invention, foreign genes are introduced into germ cells in recombinant silkworms grown by hatching from microinjected silkworm eggs, and progeny of transgenic silkworms can stably maintain the desired gene on the chromosome thereof.

The silkworm transformants produced by the method of the present invention can be maintained in the same manner as conventional silkworms. Eggs can be kept in the usual conditions and the hatched egg silkworms can be kept in the same conditions as ordinary silkworms by artificial feed or the like to breed 5th silkworms.

In the present invention, the silkworm transgenic can produce a cocoon by making a pupae in the same manner as a normal silkworm. At the stage of pupae, the male is distinguished and germinated after mating, and the male is mated and the next day is packed. Eggs can be stored in the same manner as ordinary silkworm eggs. The gene recombinant silkworm of the present invention can be transplanted by repeating such breeding, and can be increased in a large amount.

The silkworm transformant of the present invention can be cultivated in the same manner as ordinary silkworms and can be cultured under usual conditions to produce the desired protein. Depending on the target protein, the silkworm transformant can be cultured under the usual conditions such as the culture temperature, humidity, It is also possible to improve the production amount of the exogenous protein by optimizing the conditions and the like.

In another aspect, the present invention relates to a method for producing an exogenous protein, wherein the silkworm transformant is cultivated, and the exogenous protein is incorporated into the silkworm dog or silkworm of the transformant.

The silkworm transformant transformed with the recombinant vector containing the high expression promoter and the foreign gene of the present invention is characterized by expressing a large amount of foreign protein in the silk thread or silk thread. Therefore, it is possible to produce a large amount of foreign protein in the cocoon, so that the foreign protein can be easily purified and recovered from the obtained cocoon. Depending on the function of the produced foreign protein, It can be used for various industrial applications in processed form.

The exogenous protein produced from the silkworm transformant according to the present invention can be obtained by a suitable extraction procedure from silk thread or helix, and the solvent used for the extraction may be a water-soluble solvent, but is not limited thereto.

The water-soluble solvent used for the extraction is selected from inorganic acids such as phosphoric acid, organic acids such as acetic acid, citric acid and malic acid, salts such as sodium chloride, urea, hydrochloric acid, guanidine and calcium chloride for ethanol, methanol, acetonitrile , Acetone, and the like may be included as additional components, but the present invention is not limited thereto.

As a method for isolating and purifying the extracted protein, a conventional protein purification method can be used. For example, purification is carried out by combining chromatography using a silica gel carrier, an ion exchange carrier, a gel filtration carrier, a chelating carrier, a dye carrier, etc., or desalting and concentration using ultrafiltration, gel filtration, It can be isolated.

The term 'foreign gene' in the present invention refers to a gene which is heterogeneous to a host cell to be transformed and encodes a protein that is not originally produced by the host cell and is a protein produced by humans or mammals, Growth hormone, cytokine, proliferation factors, and genes expressing cytoskeletal proteins. Also, it may include, but is not limited to, enzymes produced by microorganisms, plants or insects, and various proteins, for example, human-derived interferon and antibodies.

The present invention will be described in more detail with reference to the following examples. However, the following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited by these examples in any sense.

In this case, unless otherwise defined, technical terms and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the following description and the accompanying drawings, A description of known functions and configurations that may unnecessarily obscure the description of the present invention will be omitted.

Example  One: Sequence and structure analysis of 5'-UTR of silkworm (Heavy chain) gene

1. Isolation of 5'-UTR of the silkworm heavy chain gene

Silkworm ( Bombyx mori ) The silkworms used to isolate the 5'-UTR of the fibroin heavy chain gene were Suk 125, a member of the National Institute of Agricultural Science and Technology, ℃, relative humidity, 70% ~ 90%).

A primer set was constructed to clone a silkworm H-chain gene 5'-UTR of about 8.2 kb on the basis of the domestic silkworm fibroin heavy chain genome sequence information (GenBank accession No. AF226688.1) (Table 1).

Primer Sequence (5 '-> 3') SEQ ID NO: Remarks (link) F1 GGGCCCTCGAGCGCCATCTTAATTTATTCCGTTACGCGCCA SEQ ID NO: 2 5'-ApaI-XhoI F2 GGGCCCTCGAG CTTCATCCGGCACGAAAGACTGGCCTTC SEQ ID NO: 3 F3 GGGCCCTCGAGATCGGTCGAGCCGTTTCGGAGGAGTTC SEQ ID NO: 4 F4 GGGCCCTCGAGATGAGCAGCTATTACTTAATC SEQ ID NO: 5 F5 GGGCCCTCGAGCGTGCTAATTACTGGACACATT SEQ ID NO: 6 R1 AGATCTCGCGACTTGAGAGTTGGAACCGAACT SEQ ID NO: 7 3'-BglII-NruI R2 AGCGCTCGCGAGACCAGTTAACGTAGCGTGATTGTTAGTAAA SEQ ID NO: 8 3'-AflI-NruI
R3 AGCGCTCGCGAATGTCAATATCGGCAGCTGCCTTAATCAAG SEQ ID NO: 9

Genomic DNA was purified using a Wizard Genomic DNA Purification Kit (Promega) using a 10 mg sample of the pollen after the pollen of the silkworm (strain 125) larvae was ground in a container containing liquid nitrogen. Then, the genomic DNA (5 / / 50 ㎕) purified by pure separation was used as a template and the combination of the PCR primer set (Table 1) prepared in this study and TaKaRa LA Taq (TaKaRa) And denatured. The amplified DNA was reacted at 98 ° C for 10 seconds + 68 ° C for 15 minutes (30 times), and the amplified DNA was stabilized by reacting at 72 ° C for 10 minutes. The amplified PCR product of each primer combination was electrophoresed on a 1% agarose gel at 5 each, and its size was confirmed (Fig. 1), and each of the PCR products was cloned into a pGEM-T vector to analyze the base sequence. Nucleotide sequence analysis was performed using an automatic sequencing system (Perkin Elmer, ABI377) as recommended by the manufacturer. As a result of the whole base sequence analysis, a 5'-UTR sequence of a heavy chain gene of silkworm (sleep 125) of 8,206 bp in the base upstream of the transcription initiation site (ATG) of a heavy chain gene was obtained (SEQ ID NO: 14).

Using the promoter prediction program (http://www.fruitfly.org/seq_tools/promoter.html) for the 5'-UTR structure analysis of the cloned fibroin heavy chain gene 5'-UTR structure, Based on the presence of the RNA polymerase II base sequence and the nucleotide sequence homology (> 98%), the fibroin H-chain gene promoter region was predicted, resulting in all six promoter active regions (FIG. 2).

Example 2: Fibroin H-chain gene promoter Maximum active region selection

1. Fabrication of silkworm (hind 125) fibroin H-chain gene promoter segment vector

In order to test the promoter activity of the selected silkworm silkworm-expressing gene, a fibroin heavy chain (H-chain) gene promoter segment was introduced into a promoter-free pGL-luc vector (promega, USA) The following experiment was carried out in order to test the expression ability of the promoter by activity.

The PCR products obtained by using the primer set prepared so as to include the promoter active region in the 5'-UTR of the fibroin H-chain gene were treated with restriction enzymes Xho I and Nru I from each of the cloned pGEM-T vectors, . Each of the isolated fragments was cloned into a vector pGL3 Basic vector (Promerga, USA) treated with the same restriction enzyme, and the fragment vector for the analysis of the fibroin heavy chain gene promoter activity by Luciferase activity was transcribed into the heavy chain of fibroin (PGL-F1 / R1 (-8,206 ~ -1) with promoter segments of up to 8,206 bp in size upstream from the start point (ATG, +1) and pGL-F5 / R1 558 ~ -1) (Table 3).

As a control for Luciferase activity, Bm Actin 3 gene promoter and silk fibroin L-chain gene promoter were introduced into pGL3 basic vector, respectively.

2. Determination of optimal timing of Fibroin H-chain gene promoter activity

A preliminary experiment to determine the optimal timing of the expression of pGL3-F1 / R1 (8.2 kb) vector containing the largest size segment of the fibroin heavy chain gene promoter fragment in the silkworm eggs within 4 hours after spawning Respectively.

When pGL3-F1 / R1 was transfected, pRL-Hsp70 (20 ng / egg), a Renilla expression vector introduced with silkworm Heatshock protein 70 (Bmhsp70) gene promoter, was mixed with pGL3-F1 / R1 for transfection efficiency and variation correction The optimal time for promoter activity was determined by comparing the activity of luciferase expressed by the promoter with respect to pGL-BmA3 into which physiological saline solution treatment, pGL3 vector and silkworm Actin3 gene (BmA3) promoter were introduced as a control. Respectively. Luciferase activity was measured in a Victor II luminometer microplate reader according to the manufacturer's method of Luciferase Assay System (Promega).

Transfection was performed by injecting 200 ng of DNA per animal and control group into silkworm eggs within 4 hours after fertilization from a commercial variety of silkworm, a commercial variety, by using a microinjector. After vector injection, 30 scrambled silkworm eggs from each of pGL3-F1 / R1 and control were collected at intervals of 12 hours for 72 hours, and then sacrificed. The expression level of luciferase was measured according to the manual of the dual-luciferase assay kit (Promega) And analyzed quantitatively. The luciferase activity of each period was calibrated to the Renilla activity value of pRL-Hsp70.

Luciferase expression pattern showed similar luciferase expression pattern after lapse of time after injection of pGL3-F1 / R1 and pGL-BmA3, and the highest luciferase expression level was observed at 36 hours. In addition, the luciferase expression levels of pGL3-F1 / R1 and pGL-BmA3 were significantly elevated in the range of 24 hours to 36 hours, and the expression level of pGL3-F1 / R1 was more than 5 times higher (Fig. 4). Therefore, the optimal irradiation time for analysis of the maximum active region of the silkworm fibroin heavy chain gene promoter segment was determined to be 36 hours after the microinjection (Fig. 4).

3. Determine the maximum active region of fibroin H-chain gene promoter

For the relative quantitative analysis of luciferase expression level of the 8-promoter segment vector, a segmental vector (200 ng / egg) and pRL-Hsp70 (20 ng / egg) Respectively. Expression level analysis pGL-BmA3 as a control was microinjected under the same conditions. Then, after 36 hours, each of the 30 eggs in which the respective promoter vectors were introduced was pollinated to examine the expression level of luciferase. Irradiation was repeated three times, and the luciferase activity of each sample was corrected to the Renilla activity value.

As a result of the test, it was found that the gene expression by pGL3-F5 / R1 was the highest, and especially the expression level was about 6 times higher than that of pGL-BmA3. Thus, the transcription initiation codon of the fibroin H- (+1) to F5 / R1 (-561 bases upstream of the gene) (Fig. 5).

In particular, the region was found to have a homology of 98% or more with the RNA polymerase II base sequence that binds to the transcription initiation site of operon.

Example 3: Selection of the largest active region of the F5 / R1 site promoter

1. F5 / R1 region promoter segmentation vector production

In order to select the core promoter region that plays a key role in the F5 / R1 (-558 to -1) promoter activity, four kinds of primers were prepared to obtain the promoter segments of the F5 / R1 region, and PCR primers pGL-5'-1 (-469 to -1), pGL-5'-2 (-361 to -1), pGL-5'-3 (-331 -1) and pGL-5'-1 (-244 to -1) (Table 2 and FIG. 6).

Primer Sequence (5 '-> 3') SEQ ID NO: PCR region Remarks (link) F5'-1 gggcccggcgcgccggctttgtatttttgattta SEQ ID NO: 10 -468 to -1 5'-ApaI-Asc I F5'-2 gggcccggcgcgcccgattggcaaacaaaaacta SEQ ID NO: 11 -361 ~ -1 F5'-3 gggcccggcgcgccgttcctctagtgggagaaag SEQ ID NO: 12 -331 ~ -1 F5'-4 gggcccggcgcgccaagtaagaacaataagatca SEQ ID NO: 13 -244 to -1

2. Determination of the maximum active region in the F5 / R1 region promoter

Luciferase activity was analyzed on four F5 / R1 promoter segment vectors as described in Example 2-2, and the maximum active region was confirmed. As a result, pGL-5'-1 containing a promoter region of 468 bp size Showed the highest luciferase activity value, and the expression level was about 6.6 times higher than that of pGL-BmA3 (FIG. 7).

For reference, Actin 3 gene (BmA3) is the main component for synthesizing filamentous proteins of cells and muscles. It can be identified in most eukaryotes, and its expression level is known to be high regardless of the stage of development. However, it was confirmed that the fibroin H-chain gene core promoter of pGL-5'-1 showed excellent expression of the core promoter (SEQ ID NO: 1) at position -469 to -1.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Fibroin Heavy chain Core Promoter of Bombyx mori and the Vector          Thereof <130> p2014-0066 <160> 14 <170> Kopatentin 2.0 <210> 1 <211> 467 <212> DNA <213> Bombyx mori <400> 1 ggctttgtat ttttgattta caaatgtttt tttggtgatt tacccatcca ggcattctcc 60 aggatggttg tggcatcacg ccgattggca aacaaaaact aaaatgaaac taaaaagaaa 120 cagtttccgc tgtcccgttc ctctagtggg agaaagcatg aagtaagttc tttaaatatt 180 acaaaaaaat tgaacgatat tataaaattc tttaaaatat taaaagtaag aacaataaga 240 tcaattaaat cataattaat cacattgttc atgatcacaa tttaatttac ttcatacgtt 300 gtattgttac gttaaataaa aagattaatt tctatgtaat tgtatctgta caatacaatg 360 tgtagatgtt tattctatcg aaagtaaata cgtcaaaact cgaaaatttt cagtataaaa 420 aggttcaact ttttcaaatc agcatcagtt cggttccaac tctcaag 467 <210> 2 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> F1 <400> 2 gggccctcga gcgccatctt aatttattcc gttacgcgcc a 41 <210> 3 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> F2 <400> 3 gggccctcga gcttcatccg gcacgaaaga ctggccttc 39 <210> 4 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> F3 <400> 4 gggccctcga gatcggtcga gccgtttcgg aggagttc 38 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> F4 <400> 5 gggccctcga gatgagcagc tattacttaa tc 32 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> F5 <400> 6 gggccctcga gcgtgctaat tactggacac att 33 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R1 <400> 7 agatctcgcg acttgagagt tggaaccgaa ct 32 <210> 8 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> R2 <400> 8 agcgctcgcg agaccagtta acgtagcgtg attgttagta aa 42 <210> 9 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> R3 <400> 9 agcgctcgcg aatgtcaata tcggcagctg ccttaatcaa g 41 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> F5'-1 <400> 10 gggcccggcg cgccggcttt gtatttttga ttta 34 <210> 11 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> F5'-2 <400> 11 gggcccggcg cgcccgattg gcaaacaaaa acta 34 <210> 12 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> F5'-3 <400> 12 gggcccggcg cgccgttcct ctagtgggag aaag 34 <210> 13 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> F5'-4 <400> 13 gggcccggcg cgccaagtaa gaacaataag atca 34 <210> 14 <211> 8206 <212> DNA <213> Bombyx mori <400> 14 gcgccatctt aatttattcc gttacgcgcc atgtttattt tatttctatt tagtttgtta 60 tcaacagatg tcgctgcacg taaattcaac aattcctgaa tcgcggtgac gagatgttac 120 acagttgata gactttctcg tatttctctt gctatatcat acttaactgg cctaggtata 180 ccgtgatcat gcaggctgtc ccccagggtg aggctgctcc attgcactac gaagtggctg 240 acccttgcga ttatttttat attttatgtt ataagtttta cttcaccctt ttgtgacaca 300 tatatttttt tattagtgaa ttgtcatcgg tcctcaataa gtataccaag tttcgagtta 360 atccgaagtt ttgaagggag tcaaaatcat gttcaaagat tccaatacat acttactaac 420 atacatacgt ctgaagctaa taaaagcgta ttaaaaatca gtatacactg agccatcggc 480 cgcatctacc gccttaaatt ccagaatcaa gggtaatcgc ctatgaagga gtaataaagt 540 taatctcatt acgaagtcct caatagatag aaactatgta agtatgctga tgcacaccaa 600 catttaatag tccccaataa tagcgatctg ctccgtcaat tcaacaataa tataattcct 660 gtttgcaacg aaaacaattt gccatgatag gacgcgtttc gctttgaatt gtatagagct 720 taacacaaac agtttgcttg ctcaagtcgg caataaatcg gggggtgtta cacgccaaac 780 atgtcgagaa cgttttaatt ttaacaagat aacacggcgc atacaagatg ctcgtcgacc 840 tgaatgatca agtgctatta ttaccttctg atatcgcaac gagacataat taaaagtaat 900 ttgaagtgcg accatcctac gtggatacga aatctataaa gtatacgcaa tgctcattaa 960 aaataattag tttttgaaac catatgtgta ctttgaatca ttgaaatttt tttttattgc 1020 ctttatttgt ggacgagctc acagcccacc tggtgttaag tggttactgg aacccataga 1080 catctacaac gtaaatgcgt cacacacctt gagatataag ttctaagatc tcagtatagt 1140 tacaacggtt gccccaccct tcaaaccgaa acgcattact gattcacggc agaaataggc 1200 ggggcggtgg taccttcccg tgcggtctca caaaaggtcc taccaccagt aattacgcaa 1260 attaaaatgt ttgcgggttt gatttttatt acacgactag cgacccgccc tcgcttcgct 1320 tcggaaacat taaaagacac atgaaaccaa aaaataaaaa ataaaaaaat aaataaaaaa 1380 aagtagccta tgttcatcag ggacaatgtc ggcttctaat ggaaaaagaa tttttcaaat 1440 cggtccagta gtttcggagc ctattcgaaa caaacaaaca aacaaatctt tcctctttat 1500 aatattagta tagattagta tagatgttat tccttcaccg tggaagtcaa tcgtgaacaa 1560 ttgttaagta cgtatttcat tagaaaaatt ggtacccgcc tgcgggattc gaacaccgtt 1620 gcatcgctat atacgaatgc atcggacgtc ttatccttaa agccacgacg actccgaatt 1680 aaagcaatca tgaattaaat aaagcaattt agctatttta atgtaccaaa tcactggccc 1740 actggatatt tactcgttac ccgagtctgt agacatcatg acgtgtgttt ctcgcaccac 1800 ctttagatat gacaagtatt tctgtccggc tgtttcagct tgaagagctc aatccgggac 1860 gcgcgttgta tcacggcaga aattggtggg atggattcac gtgatgtacc tacgtgctca 1920 cagtacacag aagcagtacc ctaattacgc aaattaaaaa tatacaaata taatttttag 1980 ttcacgatgt tactacacct ttattatgaa gtccgcgagc acgcattaaa atgtttgctt 2040 agaaaataaa atggtatctg cttcagggat ttgaatctcg gcgtggcgtt gtcggaattc 2100 gattgaaacc gatgcgtgtt tttggcacaa tactgaaata gactacacta aatataacta 2160 gtcaagtcat aagtattgtc acaaagtaaa aacttttctt ttagaatgct ggccacaaaa 2220 aagtttattg aattcgaatt tcgaattgtt catgaaaata aaaatgtata cttttagaat 2280 tttactcatt tttaaatatg gagtggacgc ttaaagaaga ccgtgttgca gttattgcgt 2340 tgcatcgttg cggttacgcg ccaattcaaa tttttattat actgaataat ttgaatataa 2400 ccaaaagatt cgtttatcgt accatcaaac gatacaatga agactctagt gtagatgaca 2460 ggtcaagaag tggtcgccct cggtctgtta ggactccagc agtgataaaa gctgtgaagg 2520 cgcgaattca aagaaatccc aaacgtaagc agaaactgtt ggcccttcag atggggttaa 2580 gcagaaccac ggtgaaaagg gtgttaaatg aagacttagg gcttcgggga tatcgaagaa 2640 aaacaggaca cgtttgaatg ctcgtctaat ggacctgaga ctgaagagat gccgcgcttt 2700 gttgaagcgg tacgcgggaa aaaaatatcg ggaaattctt ttttcggatg aaaaaatttt 2760 taccgtagaa gagagctaca acaaacaaaa tgataacgtg tacgcacaca gtagtgaaga 2820 agcgagcaac cgtattccgc gtgtccaatg aggtcatttt ccatcctcgc tcatggtatg 2880 gttggagtt tcttattggg gcttaacaga ggtacatttt tgtgagaaag gtgtaaaaac 2940 gaatgcagtt gtgtatcaaa atacagtcct gacgaacctt gtgcaaccag tttctcatac 3000 catgttcaat accaggcact gggtattcca acaagattgg gcgccagctc atagagcgaa 3060 gagcacacaa gactgcctgg cgcgcgtgaa atcgacttca tccggcacga aagactggcc 3120 ttcctccagt ccagttgaat ccgttagatt acaagatatg gcaacacttg gaggaaaaga 3180 cgtgctcaaa gcctcatccc aatttggagt cactcaagac atccttgatt aaggcagctg 3240 ccgatattga catggacctc gttcgtgctg cgatagacga ctggccgcgc agattgaagg 3300 cctgtattca aaatcacgga ggtcattttg aataaacttt agtgtcataa gaatctatgt 3360 tttgttaagt tcattttggt atatgaatgg ttacataatg aataaacttg tttcaattat 3420 tttacattaa acatgtgaca gaatttatga cctgactagg taggtacaaa cagccttttt 3480 gatattagaa aactaagtaa aatagcctac ggtcacatct ctttccgtgg gtgtcgttaa 3540 agggcgactt agagaaccac caagaacgta gcagaatcct cagagtgtca taccagcata 3600 cagccatcgc taactgctat ttactggtaa tagggcacat tgtaatctca cttaaccata 3660 ctgtcgggcc accatctagc ctatttctgc cacgaatcaa tcgtgagtga tggacataga 3720 gaaactatta gttgagaaga aaacaagagc actaaaggtt tgatattgac aaaaatctac 3780 ttcgccgtca ctccataggt ttattgtctc tcattagtcc agaacagcag ttacagacgt 3840 aagcttttac gcacaaacta cagggttgct ctttattgta tcgaaaatat gggacctgaa 3900 taagggcgat tttgacgcgt cctgcccgcc cattcccgat cctacggaca gaatggcaag 3960 cagtcgacgt cgccccaaac acgtcatttc ggatcctcac gatccactaa cggtgcttta 4020 ggtacctcaa gcaccggtca tcgttctcgt cggacccgtc gcttgcgacg aagggctcga 4080 cgagcaaatt aaccctcaga cacagcccac tgagtttctc gccggatctt ctcagcgggt 4140 cgcgtttccg atccggtggt agattctgcg aagcacggct cttgctagga ttcgtgttag 4200 caacgtcgtc aggtttgagc cccgtgagct cacttactag ttaaggttac gctgaaatag 4260 cctctcaagg ctctcagcta ggtaggaaac aaaaaaaaaa gtcctgccct taacaccgtt 4320 gcgatggctt gtcttctgca gcgtactgtc gtggcagggc ggtaccgcac catctttttc 4380 gacgccacct tgtgatctga aggcgaagat actcgacctt aatgattgag gcaagagcgt 4440 aatacctcgc gctccctaga cgagtagatc tcgtggaaga ttcggcacac ggcacacaaa 4500 aatagctttt gagatagcct tcaatgtaat tatgttttta tatatattta ctagctgacc 4560 cggcaaacgt tgtgttgcct taaataagat ttctagggaa attctagtgt agaaaaataa 4620 cctcattcaa ccacataata cctcattata accaaaaaaa aataatatcc aaaaaataaa 4680 aattaaaat aaatgtttgg ggtggacaac ccttatcaca taggggtatg aaaattagat 4740 agtagccgat tctcagacct actgaacata ctattgatac acaaataaaa ccaaaaaaac 4800 atggctgaaa aatgtatagt aggtattgta ttattaagtg tataatctat gatgtatatg 4860 agtaagtaag acaggagacc ggcttcgtcc tcatccgtca taaaaaccgt cataaaaatc 4920 aaacccgcaa aattataatt tgcgtaatta ctggtggctg gtggtaggac cttcttgtga 4980 gtccgcgcgg gtaggtacca ccatctgact attctgccgt gaagcagtaa tgggtttcgg 5040 tttgaagggc gggacagccg ttgtaactat acttgagacc ttagaactta tatctcaatg 5100 tgggtggcgc atttttttac ggtaggcagc ggcttggctc tgcccctggc attgctgaag 5160 tccataggcg acggttacca ctcaccatca ggtgggccgt atggccgtct gcctacaaaa 5220 tcaataaaaa aaaaataaaa aatttacgtt gtagatgtct atgggctcca gtaaccactt 5280 aacaccaggc gggctgtgag ctcgtccacc catctaagca ataaaaataa ataaatagat 5340 agttgatcag tagtggaccg gcgagggcgg gagatcaaat tgaatttaaa ataaaacata 5400 attaaaggaa tttgaaacta taaactctga ataataattt atcgtactac aattataata 5460 tttgattgcc atcttgcaac cttattgcgg atctgtgaat agaaaaaaaa aaaaatcggg 5520 atggaaaaat aggggttgat cgtataagag tgaaaattga gagtaatatg gaattttttt 5580 attttaagtc atgacaaaat aaaaataaga tcttgccaaa aaaatttaag tttattatta 5640 aattaagttt aacaaataaa aaattggggt tgatcgcaga ggggtgaaaa tttagggttt 5700 tatgtatttt tgtatgctgt atcataaaaa aataaaaaca aaaaataaaa atagggggat 5760 gaaaaataaa tgttgttcga ttctcaaccc tggccgatat gcacgctaag attcacaaaa 5820 atcggtcgag ccgtttcgga ggagttcaat cacgcacccc gtcacacgag aattttattt 5880 attagattta gaagagctga aagataaatc gatatttaat tttgtaagtt gtcttgatga 5940 tacatttttt cgtttgtcat tctttcctgc agttagaaca taatataaaa tgcaaatgaa 6000 aaatagaaat ataataaata ataataaata aataataaat atttactaac aatcacgcta 6060 cgttaactgg tcccgtgata agttcgtaaa gaacttgtgt tacaggtacc agataacgga 6120 tataaatgta agatttttat tatacacata catatatttc atatacattc ataaccctgg 6180 aaaatacatt tatatttatc atacaaatat cttcccttgg cgggattcga acccgcgacc 6240 cccttgtgta gtgacaatgt cacttaccac tacaccctct ggcattgctg ggcgacggta 6300 accacccacc attaggtggg ccatatgctc gtctgcctac aagggaaata aaaaaaatat 6360 cctaatataa attgcattaa tttttttaaa ccgactttca atcacaatga agacagattc 6420 tcgtcgaagt ttgtttttga aactatatca ataacttttc attatccgtt cttcgtcttt 6480 tgtctttttt tcgcaaacaa aacgaacaaa acgttctaat tcgaaagatg ttttgtacgg 6540 aaagtttgaa taagtgctta attgcaagta acgtaacaat gttttagggt tcggtcctca 6600 ataaattcga ccaataaacc atacaaattc tttaacattt ttttaatctt atactagctg 6660 acccggcaga cttcgtggtg cctcaatcga taaataaaat acctatgctt ctgtataaaa 6720 taaacataaa acaaacaaaa ggaatccgtc cgacgggaga cacatcaaag gaaaaacatc 6780 ttttttattt ttttaccttt taaaccttct ctggacttcc acaaataatt taagaccaaa 6840 attagccaaa tcggtctagc attttcgagt tttagcgaga ctaacgaaca gcaattcatt 6900 tttatataca cagatttatg ttaccggggt ctagtgacct aaacgacttc agctctaaca 6960 ctaggctaac tcaggcttag tagcctggtc ctagtgttag atttgaagtc gtctaatgca 7020 aagattattg gatctgatgg atccgtaagg acgtgtctag agcgtcgacg gtgactagct 7080 cctgcgtgat caggaaaaat gtggaaagct taacgatttt gtcacatttt acttatcaca 7140 acttgttttt ataataattc gcttaaatga gcagctatta cttaatctcg tagtggtttt 7200 tgacaaaatc agcttcttta gaactaaaat atcatttttt tcgtaatttt tttaatgaaa 7260 aatgctctag tgttatacct ttccaaaatc accattaatt aggtagtgtt taagcttgtt 7320 gtacaaaact gccacacgca tttttttctc cactgtaggt tgtagttacg cgaaaacaaa 7380 atcgttctgt gaaaattcaa acaaaaatat tttttcgtaa aaacacttat caatgagtaa 7440 agtaacaatt catgaataat ttcatgtaaa aaaaaaatac tagaaaagga atttttcatt 7500 acgagatgct taaaaatctg tttcaaggta gagatttttc gatatttcgg aaaattttgt 7560 aaaactgtaa atccgtaaaa ttttgctaaa catatattgt gttgttttgg taagtattga 7620 cccaagctat cacctcctgc agtatgtcgt gctaattact ggacacattg tataacagtt 7680 ccactgtatt gacaataata aaacctcttc attgacttga gaatgtctgg acagatttgg 7740 ctttgtattt ttgatttaca aatgtttttt tggtgattta cccatccaag gcattctcca 7800 ggatggttgt ggcatcacgc cgattggcaa acaaaaacta aaatgaaact aaaaagaaac 7860 agtttccgct gtcccgttcc tctagtggga gaaagcatga agtaagttct ttaaatatta 7920 caaaaaaatt gaacgatatt ataaaattct ttaaaatatt aaaagtaaga acaataagat 7980 caattaaatc ataattaatc acattgttca tgatcacaat ttaatttact tcatacgttg 8040 tattgttacg ttaaataaaa agattaattt ctatgtaatt gtatctgtac aatacaatgt 8100 gtagatgttt attctatcga aagtaaatac gtcaaaactc gaaaattttc agtataaaaa 8160 ggttcaactt tttcaaatca gcatcagttc ggttccaact ctcaag 8206

Claims (10)

1. A high expression promoter having the nucleotide sequence shown in SEQ ID NO: 1.
2. The high-expression promoter according to claim 1, wherein the promoter is a core-promoter derived from a fibroin heavy chain gene of silkworm.
A recombinant vector comprising the high-expression promoter of claim 1.
4. The recombinant vector according to claim 3, wherein the vector is a vector selected from the group consisting of a baculovirus vector, a viral vector and a transposon DNA as a backbone.
A transformant transformed with the vector of claim 3 or 4.
6. The transformant according to claim 5, wherein the transformant is selected from the group consisting of insect cell lines, silkworms and microorganisms.
A method for producing a silkworm transformant comprising the steps of:
(a) preparing a recombinant vector by introducing a foreign gene downstream of the promoter of SEQ ID NO: 1;
(b) pre-treating the silkworm eggs with hydrochloric acid at 25 DEG C for 1 hour;
(c) transforming the recombinant vector of step (a) by microinjection into the pretreated silkworm eggs; And
(d) growing the transformed silkworm.
8. The method of producing a silkworm transformant according to claim 7, wherein the recombinant vector is a vector selected from the group consisting of a baculovirus vector, a viral vector, and a transposon DNA.
The method of claim 7, wherein the silkworm is jakjam (Antheraea pernyi), cheonjam (Antheraea yamamai), silkworm (Bombyx mori L.) and yulchung silkworm transformant, characterized in that one selected from the group consisting of (caliqula japonica) Gt;
A silkworm transformant which is produced by the method according to any one of claims 7 to 9 and has high fungicidal activity on the silkworm or silkworm, is cultivated to produce an exogenous protein such that the exogenous protein is contained in the silkworm dog or silkworm of the transformant Way.

Images