KR20150139231A - Compositions of markers for diagnosing hydrocephalus comprising Anks1a protein - Google Patents

Abstract

The present invention relates to a biomarker composition comprising Anks1a protein for diagnosing hydrocephalus. According to the present invention, it is found that the expression of ependymal cells is reduced when a person is lack of an Anks1a protein, so normal cerebral ventricles cannot be formed. Therefore, easier and simpler diagnosis of hydrocephalus is possible compared with an existing test, by detecting the Anks1a protein from a sample of a suspected hydrocephalus case.

Description

Technical Field [0001] The present invention relates to a biomarker composition for diagnosing hydrocephalus including Anks1a protein,

The present invention relates to a biomarker composition for diagnosing hydrocephalus including an Anks1a protein, and more particularly, to a composition for diagnosing hydrocephalus including an antibody specifically binding to Anks1a protein, and a kit containing the same. The present invention also relates to a method for detecting Anks1a protein from a patient to provide information for the diagnosis of hydrocephalus.

The cerebrospinal fluid (CSF) in the brain is filled with clear fluid inside and outside the brain. On the inside of the brain there are small empty spaces called the ventricles, where cerebrospinal fluid is made. Cerebrospinal fluid acts as a cushion that cushions the brain from impact, disperses pressure evenly within the cranial cavity, and is known to carry nutrients and waste products.

If the cerebrospinal fluid in the ventricle is blocked by some cause, CSF fluid accumulates abnormally in the cranial or vertebral column. Cerebrospinal fluid accumulation in most cases leads to elevated intracranial pressure, resulting in symptoms and disruption of brain development.

Hydrocephalus is often associated with congenital anomalies of the brain and spinal cord and is common in children. However, the association with acquired diseases such as cerebral hemorrhage, brain tumors and central nervous system infections is seen not only in children but also in adults. In the elderly, there is a unique type of hydrocephalus in which cerebrospinal fluid accumulates without increasing intracranial pressure due to a fine cerebrospinal fluid circulation disorder.

Dandy-Walker syndrome, which is associated with cysts in the fourth ventricle and cerebellar development due to cysts such as subarachnoid cysts in the ventricle due to congenital anomalies, is also an important cause of hydrocephalus in infants. On the other hand, if there is myelomeningocele or Chiari I malformation, the cause is somewhat unclear, but hydrocephalus is common due to abnormality in cerebrospinal fluid circulation.

The diagnosis of hydrocephalus requires the pressure of the abdomen and the examination of the eye movements. In the larger children, the symptoms of headache, vomiting and head circumference, the presence of papilledema in the fundus examination, need. Adults are assessed for subjective symptoms such as headache or vomiting, fundus examination, gait disturbance, and urinary incontinence.

The conventional hydrocephalus test confirms the enlargement of the ventricle by cranial ultrasound or computed tomography (CT) through an open abdomen. Magnetic resonance imaging (MRI) is widely used as a more detailed examination of the causes of hydrocephalus, and video magnetic resonance imaging (cine-MRI) for evaluating the flow of cerebrospinal fluid is also used. The brain pressure monitor is placed in the cranial cavity, Pressure is also measured.

However, all of these inspection methods were inconvenient in terms of cost and time. Accordingly, the inventors of the present invention have confirmed through repeated experiments that when the Anks1a protein is deficient, it can not form a normal ventricle and thus manifests symptoms of hydrocephalus. Thus, the present invention has been completed.

Accordingly, it is an object of the present invention to provide a biomarker composition for the diagnosis of hydrocephalus including Anks1a protein.

Another object of the present invention is to provide a composition for diagnosing hydrocephalus comprising an antibody that specifically binds to Anks1a protein, or a hydrocephalus diagnostic kit comprising such a composition.

In order to accomplish the above object, the present invention provides a biomarker composition for the diagnosis of hydrocephalus including Anks1a protein.

The present invention also provides a composition for diagnosing hydrocephalus comprising an antibody that specifically binds to Anks1a protein.

In one embodiment of the present invention, the antibody may be at least one selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a fragment of an antibody, and a recombinant antibody.

In one embodiment of the invention, the fragment of the antibody may be a Fab, Fab ', scFv, (scFv) ₂ , Fv or a combination thereof.

The present invention also provides a kit for the diagnosis of hydrocephalus comprising the composition.

The present invention also provides a method for detecting Anks1a protein from a patient to provide information for diagnosis of hydrocephalus comprising the composition.

According to the present invention, it was confirmed that when the Anks1a protein is deficient, the expression of the ventricular membrane cells is decreased and the normal ventricle is not formed. Therefore, by detecting the level of Anks1a protein in samples of patients suspected of hydrocephalus, it is possible to diagnose hydrocephalus faster and more easily than conventional methods.

Figure 1 is a schematic representation of the structure of the Anks1a gene and the Anks1a knock-out gene.
2 (B) and 2 (C) show the results of PCR of the normal, heterozygous and knockout mice (B) and Western blotting result (C).
Figure 3 is a cross-sectional view of the brain of Anks1a heterozygous mouse with LacZ staining to analyze the expression timing of Anks1a.
FIG. 4 is a graph (left) of immuno-staining with S100? And GFAP on the brain slice and a graph quantifying the result (right).
FIG. 5 shows the result of immunostaining with S100? And GFAP only in the ventricle.
FIG. 6 is a graph (left) of immuno-staining with S100β and Glast in the brain slice and a graph quantifying the results (right).
FIG. 7 shows the result of immunostaining using only S100beta and Glast in the ventricle portion.
8 is a graph (left) of immuno-staining with S100? And Edu in the brain slice and a graph obtained by quantifying these results (right).
FIG. 9 (left) shows the results of brain tissue staining of Anks1a knockout mouse and wild type mouse by cresyl violet staining and DAPI staining. FIG. 9 (right) shows the results of anklea knockout mice and wild type mice It is a graph showing the incidence rate.
FIG. 10 shows the schematic diagram of the control vector and the Anks1a vector, and the electroporation process. FIG. 10 (bottom) shows the result of immunostaining of S100β and anti-Anks1a mice electroporated.
Fig. 11 shows the process of differentiation according to the expression of Anks1a protein of radial glial cells.

The present invention relates to a biomarker composition for hydrocephalus diagnosis comprising Anks1a protein.

As used herein, the term " Anks1a protein "is an ankyrin repeat and Sterile Alpha Motif domain-containing protein 1A comprising the SAM domain and includes seven ankyrin repeat sites and a SAM domain- . Diseases associated with abnormalities in the Anks1a gene coding for the Anks1a protein include adjustment disorders and hyperactivity.

The Anks1a protein may be derived from a mammal. For example, the Anks1a protein may be derived from human, monkey, rodent, and the like. As an example, the Anks1a protein may have the amino acid sequence of SEQ ID NO: 1 (NCBI accession No. Q92625.4) derived from human.

The above-mentioned "hydrocephalus" of the present invention is a disease in which cerebrospinal fluid accumulates in the ventricles or in the two intestines, which is also referred to as hydrocephalus. The hydrocephalus occurs naturally when the passage through which the cerebrospinal fluid circulates is obstructed. When the cerebrospinal fluid becomes bulky, the head gets bigger and the pressure in the cranial cavity rises rapidly, and symptoms such as headache, vomiting, and visual impairment appear. In addition, tumors can develop and block the flow of cerebrospinal fluid, or may occur as acquired cases such as encephalitis and meningitis. When the hydrocephalus is acquired over 2 years old, the head size does not become much larger than that of congenital hydrocephalus because the skull is already hardened. However, as with congenital hydrocephalus, symptoms such as headache, vomiting, and visual impairment appear. Also, if you have an ankle in your legs, walking becomes difficult.

It can be diagnosed by CT and MRI, and can be used as a bypass to bypass the cerebrospinal fluid from the brain to other tissues of the body. However, you should keep an eye on whether you maintain proper intracranial pressure after surgery.

The "biomarker" of the present invention refers to an index capable of detecting changes in the body using proteins, DNA, RNA, metabolites, etc., and the protein marker detects the change according to the expression level of the protein A gene encoding the same may also be included in the biomarker of the present invention. By utilizing the biomarker, it is possible to objectively measure the normal or pathological state of living organism, the degree of response to the drug, and the like. It is attracting attention as an effective way to diagnose various intractable diseases such as cancer, stroke, and dementia. It can be reflected in the development process of new drugs, thus securing safety and cost savings.

The present invention also relates to a biomarker composition for the diagnosis of hydrocephalus comprising an antibody specifically binding to Anks1a protein.

The "specific binding" of the present invention means that the antibody forms an antigen-antibody complex with the hydrocephalic biomarker of the present invention, which is the target protein thereof, and does not form such a complex with other proteins.

In one embodiment of the present invention, the antibody may be at least one selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a fragment of an antibody, and a recombinant antibody.

The "antibody" of the present invention means an immunoglobulin specific for an antigenic site and can be in its complete form with two full-length light chains and two full-length heavy chains. The antibody in the present invention refers to an antibody that specifically binds to Anks1a protein, and the antibody can be prepared from the protein according to a conventional method in the art.

The antibody also includes a special antibody such as a humanized antibody. These antibodies can be used to detect an enzyme linked immunosorbent assay (ELISA), a fluoroimmunoassay (FIA), a luminous immunoassay, a radioimmunoassay (RIA), a sandwich assay a method such as sandwich assay, Western blotting on polyacryl gel, or immunoblotting can be used to confirm that the protein is expressed in a biological sample.

The enzymatic immunoassay may include enzymes such as peroxidase (POD), alkaline phosphatase,? -Galactosidase, urease, catalase, glucose oxidase, lactate dehydrogenase, amylase or biotin-avidin complex, In the case of the measurement method, it is possible to use fluorene isothiocyanate, tetramethylrhodamine isothiocyanate, substituted rhodamine isothiocyanate, dichlorotriazine isothiocyanate, Alexa or AlexaFluoro et al. Fluorescent substances or fluorophore may be used. In the luminescence immunoassay, a luciferase method, a luminol peroxidase POD method, etc. may be used together with a luminescent substance such as a dioxetane compound.

Radioimmunoassay is tritium, iodine ^{(131 I, 125 I, 123} I, 121 I), phosphorus ⁽³² P), sulfur ⁽³⁵ S), metals (e.g., ⁶⁸ Ga, ⁶⁷ Ga, ⁶⁸ Ge, ⁵⁴ Mn, ⁹⁹ Mo, ⁹⁹ Tc, ¹³³ Xe, etc.) may be used, and the antibody may be bound to a labeling substance as needed when the avidin-biotin method, the streptavidin-biotin method or the like is used .

In the enzyme immunoassay, a method such as glutaraldehyde method, maleimide method, pyridyl disulfide method, periodic acid method and the like can be used for the binding of the labeling substance and the antibody. In the radioimmunoassay, the chloramine T method, Method can be used.

The polyclonal antibody may be prepared by injecting an immunogen-causing biomarker protein or an immunogenic fragment thereof into an external host according to a conventional method known to those skilled in the art. The external host may use mammals such as mice, rats, sheep, rabbits. The immunogens may be administered with an adjuvant to increase antigenicity when injected intramuscularly, intraperitoneally or subcutaneously. Then, blood can be periodically taken from the external host to collect the serum exhibiting improved activity and specificity for the antigen, or isolate and purify the antibody therefrom.

The monoclonal antibodies can be prepared by cell line generation techniques known to those skilled in the art. A method for producing a monoclonal antibody is briefly described. The protein is purified and immunized with an appropriate amount (about 10 μg) of Balb / C mouse, or a polypeptide fragment of the protein is synthesized and bound to bovine serum albumin, Immunized, then immunized with antigen-producing lymphocytes isolated from mice to produce immortalized hybridomas by fusion with human or mouse myeloma, and only hybridoma cells producing the desired monoclonal antibody using the ELISA method were selected And then the monoclonal antibody can be isolated and purified from the culture.

In the present invention, the fragment of the antibody may be Fab, Fab ', scFv, (scFv) ₂ , Fv or an antibody obtained by recombination thereof, but is not limited thereto.

Fab 'differs from Fab in that it has a hinge region that contains at least one cysteine residue at the C-terminus of the heavy chain CH1 domain. The F (ab ') ₂ antibody is produced when the cysteine residue of the hinge region of the Fab' forms a disulfide bond.

Recombinant techniques for generating Fv fragments with minimal antibody fragments having only a heavy chain variable region and a light chain variable region are well known in the art. The double-chain Fv is a non-covalent bond, and the variable region of the heavy chain and the light chain variable region are connected to each other. The single-chain Fv generally shares the variable region of the heavy chain and the variable region of the short chain through the peptide linker Or directly connected at the C-terminus to form a dimer-like structure like the double-stranded Fv.

The antigen-binding fragment can be obtained using a protein hydrolyzing enzyme. For example, if the whole antibody is restricted to pepsin, a Fab can be obtained. If the antibody is cleaved with papain, an F (ab ') ₂ fragment can be obtained.

In addition, the present invention relates to a hydrocephalus diagnostic kit comprising the composition for diagnosing hydrocephalus.

The hydrocephalus diagnostic kit includes an antibody that specifically binds to a biomarker for hydrocephalus diagnosis according to the present invention.

The antibody that specifically binds to the hydrocephalus biomarker may be in the form of a single substance or a mixture, a form bound to a solid phase carrier such as a protein chip, or a free form.

The kit can be used for immunoassay of a hydrocephalus biomarker labeled with a secondary antibody, for example, a fluorescent dye capable of detecting the expression level of a hydrocephalus biomarker, which can be used for an immunological method for quantitatively confirming the expression amount of an obesity biomarker An antibody and carrier, a washing buffer, a sample diluent, an enzyme substrate, a reaction stopping solution, and the like.

That is, if the expression level of the hydrocephalus biomarker is lower than the cut-off value, it will be judged to be hydrocephalus or vulnerable to hydrocephalus. Here, the reference value can be determined from the expression level of the hydrocephalus biomarker measured in plasma samples of several individuals.

As an example, the diagnostic kits of the present invention are prepared by conventional manufacturing methods known to those skilled in the art and typically include lyophilized forms of antibodies and buffers, stabilizers, inert proteins, and the like. The antibody may be labeled with radionuclides, fluorescors, enzymes, and the like.

The monoclonal antibody of the present invention can be used not only in immunoassay kit (ELISA, antibody coated tube test, lateral-flow test, potable biosensor), but also in the hydrocephalus detection spectrum through development of antibodies showing higher specificity and sensitivity Can be used for the development of protein chips.

The present invention also provides a method for detecting Anks1a protein from a patient to provide information for diagnosis of hydrocephalus.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

Example 1: Preparation of Anks1a knockout mouse

The embryonic stem cell line CF0537 with Gene trap vector inserted was purchased from UC Davis. As a result of DNA sequence analysis by extracting genomic DNA from the cell line, it was confirmed that the gene trap vector was inserted between the 14th and 15th exons of Odin gene (see A in FIG. 2). The CF0537 ES cell line was microinjected into blastocysts and transplanted into the uterus to produce chimeric mice. Subsequently, a heterozygote mouse was prepared by crossing the chimeric mouse and the normal 129 mouse, and again, the heterozygous mice were crossed to prepare an Anks1a knockout (- / -) mouse.

≪ Example 2 > Anks1a knockout confirmation experiment

To analyze the genotype of the Anks1a knockout mouse prepared in Example 1, a tail DNA was used. Three kinds of primers were mixed and PCR was carried out as follows.

The tail tissue of the 10-day-old mouse was slightly cut and mixed with DNA lysis buffer and incubated at 55 ° C overnight to allow the DNA to dissolve in the buffer. Using a centrifuge, separate only the DNA-solubilized layer, which is the supernatant, from the mixture of dissolved DNA and DNA lysis buffer. Only the DNA is extracted from the supernatant by the ethanol precipitation method. Then, PCR was performed at an annealing temperature of 56 ° C using mouse tail DNA as a template. Three primers were purchased from bioneer and used as a primer: WT F: TGAAGGCACATGAGGCTGAG, WT R: ACAGCGTTTGCATCTTGCTG, and KOF: ATGTCATAGCTGTTTCCTGT.

As a result, it was possible to distinguish +/- (+/-) mice from + / + mice with gene trap vectors (see FIG. 2B).

In addition, embryonic fibroblasts (MEF) of 14.5 days old embryo (E14.5) were isolated and cultured in pregnant mice, and Western blotting was performed using cell lysate and anti-Anx1a antibody as follows.

The 14.5-day-old embryos obtained by crossing Anks1a +/- mice were genotyped and then hybridized with wild-type mice to select heterozygous embryos.

The separated MEF (Mouse Embryonic Fibroblast) cells were placed in a PLC (Phospholipase C) buffer, homogenized with a pipette, and further vortexed to completely dissolve the tissue. Thereafter, the cells were incubated on ice for 10 minutes, and only the supernatant in which the proteins were dissolved was separated and mixed with the sample buffer using a centrifuge. The supernatant and sample buffer mixture was water-soaked at 100 and the upper layer mixture was cooled on ice.

The sample was then loaded onto the next protein gel overnight and the PVDF membrane bound to the gel to convert to a protein membrane. The Anks1a marker marking Anks1a was used as the primary antibody and the immunohistochemistry was performed using the HRP-labeled secondary antibody.

As a result, it was confirmed that the expression of Anks1a protein disappeared in Anks1a - / - embryonic fibroblast cells (see Fig. 2C).

<Example 3> Expression timing and expression pattern analysis of Anks1a protein

To analyze the expression timing and expression pattern of Anks1a protein, brain of Anks1a +/- mouse of E12.5, E16.5, P0, P5, P7, P20 was extracted and LacZ staining was performed as follows.

The mouse brain was perfused with 4% PFA and post-fixed with 4% PFA. Fixed brain was embedded in 30% sucrose to harden brain tissue and cyro-embedding to prepare a 40-μm-thick section. Each slice of brain tissue was attached to slides and stained with LacZ.

The tissue was cultured in a solution (B) containing 0.2% GDA, fixed for about 10 minutes, and cultured in a solution (C) containing NP-40, Na-deoxycholate detergent. Thereafter, the solution (D) containing peracyanide, ferrocyanide, and X-gal (5-bromo-4-chloro-3-indolyl-D-galactopyranoside) Lt; / RTI &gt; and staining was performed.

Results LacZ expression was not found in the lateral ventricle (LV) before birth but in Chrold plexus (ChPl), whereas LacZ expression in the lateral ventricle after birth was also observed in P20 adult mouse brain 3).

Therefore, it was confirmed that the expression of Anks1a protein in the lateral ventricle occurs after birth.

<Example 4> Analysis of the effect of Anks1a deficiency on ventricular formation

4-1. Brain sample production of mouse

The brain of Anks1a mice was extracted with 4% PFA and post-fixed with 4% PFA for 1 hour at room temperature. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissues. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 40 μm.

In addition, brains of wild-type mice and Anks1a knockout mice (P13) 13 days after birth are perfused with 0.9% physiological saline and brain is extracted. The extracted brain is subdissected again to expose only the ventricular wall and sub-dissect other tissues except the wall of the ventricle.

4-2. S100beta + / GFAP + cell analysis

Immunostaining was carried out on the samples prepared in the above 4-1 with the GFAP antibody, which is a differentiated mature ventricular cell marker S100β and a neural stem cell marker, as follows.

The mouse brain was perfused with 1X PBS and 4% PFA and extracted with 4% PFA for 1 hour at room temperature. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissues. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 25 μm. Brain tissue sections were attached to each slide on 6-7 consecutive lines. After drying for 3 hours at room temperature, the tissue was washed with 1X PBS and incubated at 0.3% for 20 minutes at room temperature. Then, the cells were incubated in 10% horse serum and 0.3% Triton X-100 / PBS at room temperature for 1 hour. Anti-mouse S100β, an endothelial cell marker, and anti-rabbit GFAP, an NSC marker, were used as primary antibodies and tissues were incubated overnight in primary antibody solution. The next day, tissues were washed again with 1X PBS and then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at room temperature. Anti-mouse FITC and anti-rabbit TRITC were used as secondary markers and tissues were incubated in secondary antibody solution for 2 hours at room temperature. The tissue was then washed with 1X PBS and mounted with a mounting solution containing DAPI.

As a result, it was confirmed that the ventricular cell differentiated through the staining of S100β and the GFAP staining was normally expressed in the ventricular wall of the wild type mouse, but the expression of neural stem cells was hardly performed. On the other hand, in the ventricular wall of the Anks1a knockout mouse, the expression of the differentiated ventricular cell was significantly reduced compared to the wild type, but the cells expressing the differentiated ventricular cell and the neural stem cell together increased (see the left side of FIG. 4) . When these results were quantified, it was confirmed that the number of S100β + / GFAP + cells in the Anks1a knockout mouse was increased by about 20% as compared with the wild type (see the right figure of FIG. 4).

In addition, since the differentiation of the cells expressing in the ventricle of the mouse is mostly performed after about 2 weeks after birth and the differentiation into the specific tissue has already been completed, the differentiated ventricular cells are closely distributed in the lateral ventricle wall of the wild type mouse, Expression was scarcely found. On the other hand, in the ventricular wall of the lateral ventricle of Anks1a knockout mouse, the expression of differentiated ventricular cells was significantly decreased compared to the wild type, but the number of S100beta + / GFAP + cells was increased (see FIG.

4-3. S100β + / Glast + cell analysis

Immunostaining was performed with the Glast antibody, which is a marker of S100beta and a radial glia marker, which are differentiated into mature ventricular cell markers differentiated in the samples prepared in the above 4-1.

The mouse brain was perfused with 1X PBS and 4% PFA and extracted with 4% PFA for 1 hour at room temperature. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissues. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 25 μm. Each of the cut brain tissues was attached to each slide on a continuous basis of 6-7. After drying at room temperature for about 3 hours, the tissues were washed with 1X PBS and cultured in 0.3% Triton X-100 / PBS for 20 minutes at RT. The cells were then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at RT. Anti-mouse S100β, an endothelial cell marker, and anti-guinea pig Glast, an NSC marker, were used as primary antibodies and tissues were incubated overnight in primary antibody solution. The next day, tissues were washed again with 1X PBS and then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at room temperature. Anti-mouse FITC and anti-guinea pig TRITC were used as secondary markers and tissues were incubated in secondary antibody solution at room temperature for 2 hours. The tissue was then washed with 1XPBS and mounted with a mounting solution containing DAPI.

As a result, in the ventricular wall of wild type mouse, differentiated ventricular cell cells were normally expressed through the staining and Glast staining of S100β, but it was confirmed that the expression of the glial cells was almost not achieved. On the other hand, in the ventricular wall of the Anks1a knockout mouse, the expression of the differentiated ventricular cell was significantly reduced compared with the wild type, but the cells expressing the differentiated ventricular cell and glial cell together were increased (see the left side of FIG. 6) . When these results were quantified, it was confirmed that the number of S100β + / Glast + cells in the Anks1a knockout mouse was increased by about 20% as compared with the wild type (see the right side of FIG. 6).

In addition, since the differentiation of the cells expressing in the ventricle of the mouse is mostly performed after about 2 weeks after birth and the differentiation into the specific tissue has already been completed, the differentiated ventricular cells are closely distributed in the lateral ventricle wall of the wild type mouse, Expression was scarcely found. On the other hand, in the lateral ventricle wall of the Anks1a knockout mouse, the expression of differentiated ventricular cells was significantly reduced compared with the wild type, but the number of S100beta + / Glast + cells was increased (see FIG. 7).

4-4. Fission pattern analysis of S100β + / GFAP + cells or S100β + / Glast + cells

Edu cell proliferation assays were performed to analyze the cleavage pattern of S100β + / GFAP + cells or S100β + / Glast + cells. Edu is injected into the wild type of P12 and Anks1a knockout mouse by abdominal injection. In the same way, inject 5 times total of Edu every 12 hours. The brains of P15 wild-type and Anks1a mice, which were 24 hours after the 5th injection of Edu, were extracted and frozen sections were prepared in the same manner as described in 4-1 above. S100beta and disrupted cells were labeled on each section as follows Edu immunostaining was performed.

The mouse brain was perfused with 1X PBS and 4% PFA and extracted with 4% PFA for post-fixing at room temperature for 1 hour. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissue. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 25 μm. Brain tissue sections were attached to each slide on 6-7 consecutive slides. After drying at room temperature for about 3 hours, tissues were washed with 1X PBS and cultured in 0.3% Triton X-100 / PBS at room temperature for 20 minutes. Then, the cells were incubated in 10% horse serum and 0.3% Triton X-100 / PBS at room temperature for 1 hour. Anti-mouse S100, which is a ventricular cell marker, was used as the primary antibody and tissues were incubated overnight in primary antibody solution. The next day, tissues were washed again with 1X PBS and then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at room temperature. Anti-mouse FITC was used as a secondary marker and tissues were incubated in secondary antibody solution for 2 hours at room temperature. The cells were then incubated in EdU solution for 30 min at room temperature using the Click-iT EdU alexa 594 imaging kit (Cat No. C10339). Tissues were washed with 1X PBS and mounted with mounting solution containing DAPI.

As a result, although there were few Edu-positive cells in the lateral ventricle of the wild-type mouse, many of Edu-positive cells were found in the lateral ventricle of Anks1a knockout mouse, especially in the ventral side (see the left side of FIG. When these results were quantified, it was confirmed that the number of S100beta + / Edu + cells in Anks1a knockout mice was increased by about 1.7 compared to the wild type (see the right figure of FIG. 8).

Therefore, in Anks1a knockout mice, the expression of differentiated ventricular cells in the ventricular wall of the lateral ventricle was markedly decreased compared to that of wild-type mice. However, cells expressing differentiated ventricular cells, neural stem cells or differentiated ventricular cells and glial cells together . In addition, in the Anks1a knockout mouse, many cells in the lateral ventricle were found to have the properties of neural stem cells that undergo cell division.

<Example 5> Mechanism of hydrodynamic induction of undifferentiated Anks1a protein

5-1. Brain tissue analysis of Anks1a knockout mouse

The brain tissues of E18.5 and P13 Anks1a knockout mice and wild type mice were compared by performing cresyl violet staining and DAPI staining.

The brain of 18.5-day-old mouse embryos was perfused with 4% PFA and extracted and post-fixed overnight at 4 with 4% PFA. Tissues were washed with 1X PBS and embryos were dehydrated with 25%, 50%, 75%, 100% ethanol. The solution was replaced with 25%, 50%, 75%, 100% histoclear to prevent discoloration. The embryos were then embedded in 60% 25%, 50%, 75%, and 100% paraffin. The embryos embedded in the microtome were cut in the sagittal direction to make paraffin sections 10 μm thick. Each of the cut brain tissues was attached to each slide on a continuous basis of 6-7, and brain tissue was stained using a crystal violet solution

In addition, the brains of 13-day old mice were perfused with 1 × PBS and 4% PFA, and then post-fixed with 4% PFA for 1 hour at RT. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissues. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 25 μm. Brain tissue sections were attached to each slide on 6-7 consecutive lines. After drying at room temperature for about 3 hours, the tissue was washed with 1X PBS and mounted with a mounting solution containing DAPI.

As a result of the comparison, the brain of the mouse knockout of Anks1a was able to observe a hydrocephalus relatively large in the ventricles including the lateral ventricle (see the left side of FIG. 9). When these results were quantified, hydrocephalus occurred in about 60% of the P13 Anks1a knockout mice (see the right side of FIG. 9).

5-2. Anx1a protein overexpression experiment

Taken together with Examples 4 and 5-1 above, the correlation between the decrease in the number of ventricular cell counts and the incidence of hydrocephalus in Anks1a knockout mice can be deduced. The role of Anks1a protein can be thought to induce neural stem cells to differentiate into normal ventricular cell. To confirm this hypothesis, the following experiment was conducted.

Control GFP and Anks1a GFP DNA for overexpression of Anks1a were injected into the ventricle of the mouse and electroporation was performed as follows.

The head of the mouse, which is 0-5 days old, is illuminated by a light beam. The DNA to be injected at a concentration of 1-2 μg / μl is inserted into a glass pipette having a thickness of μm and DNA is injected into the brain ventricle of the mouse. Immediately after the injection, the brain of the mouse is electroporated using an electroporation machine and pulsed in the direction of DNA injection.

Approximately 10 days after the electroporation method, the brains of each mouse were extracted and immunostained with anti-Anks1a antibody which is a marker of S100? And Anks1a protein.

The mouse brain was perfused with 1X PBS and 4% PFA and extracted with 4% PFA for post-fixing at room temperature for 1 hour. Fixed brains were embedded in 30% sucrose for 2 days, 30% sucrose: OCT compound = 50:50 for 1 day, and brain tissue was replaced with sucrose to harden the tissues. After that, frozen embedding was carried out in OCT compound at -20 ° C to prepare a frozen section with a thickness of 25 μm. Brain tissue sections were attached to each slide on 6-7 consecutive lines. After the sections were dried at room temperature for about 3 hours, tissues were washed with 1X PBS and cultured in 0.3% Triton X-100 / PBS for 20 minutes at RT. The cells were then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at RT. Anti-mouse S100beta, which is a ventricular cell marker, was used as a primary antibody and secondary antibody, and tissues were incubated overnight in primary antibody solution. The next day, tissues were washed again with 1X PBS and then incubated in 10% horse serum, 0.3% Triton X-100 / PBS for 1 hour at room temperature. The tissues were then incubated in secondary antibody solution for 2 hours at room temperature, washed with 1X PBS and mounted with mounting solution containing DAPI.

As a result, mice injected with control GFP DNA were found to express GFP-expressing cells as monolayer in the lateral ventricle similarly to the result of staining with S100β, whereas mice injected with Anks1a GFP DNA showed that GFP- It was confirmed that it was expressed in multiple layers.

That is, in the mice overexpressing Anks1a protein, it was confirmed that more ventricular cell cells were expressed compared to the control mice. Thus, the Anks1a protein induces normal differentiation of radial glial cells (RGC) to differentiate neural stem cells into normal ventricular cells, resulting in smooth flow of cerebrospinal fluid (see FIG. 11).

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Hwang Mok Park <120> Compositions of markers for diagnosing hydrocephalus comprising          Anxa1 protein <130> NP14 = 1135 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 1134 <212> PRT <213> Homo sapiens <400> 1 Met Gly Lys Glu Glu Glu Leu Leu Glu Ala Ala Arg Thr Gly His Leu   1 5 10 15 Pro Ala Val Glu Lys Leu Leu Ser Gly Lys Arg Leu Ser Ser Gly Phe              20 25 30 Gly Gly Gly Gly Gly Gly Gly Ser Gly Gly Gly Gly Gly Gly Gly Gly Ser Gly          35 40 45 Gly Gly Gly Gly Gly Leu Gly Ser Ser Ser His Pro Leu Ser Ser Leu      50 55 60 Leu Ser Met Trp Arg Gly Pro Asn Val Asn Cys Val Asp Ser Thr Gly  65 70 75 80 Tyr Thr Pro Leu His His Ala Ala Leu Asn Gly His Lys Asp Val Val                  85 90 95 Glu Val Leu Leu Arg Asn Asp Ala Leu Thr Asn Val Ala Asp Ser Lys             100 105 110 Gly Cys Tyr Pro Leu His Leu Ala Ala Trp Lys Gly Asp Ala Gln Ile         115 120 125 Val Arg Leu Leu Ile His Gln Gly Pro Ser His Thr Arg Val Asn Glu     130 135 140 Gln Asn Asn Asp Asn Glu Thr Ala Leu His Cys Ala Ala Gln Tyr Gly 145 150 155 160 His Thr Glu Val Val Lys Val Leu Leu Glu Glu Leu Thr Asp Pro Thr                 165 170 175 Met Arg Asn Asn Lys Phe Glu Thr Pro Leu Asp Leu Ala Ala Leu Tyr             180 185 190 Gly Arg Leu Glu Val Val Lys Met Leu Leu Asn Ala His Pro Asn Leu         195 200 205 Leu Ser Cys Asn Thr Lys Lys His Thr Pro Leu His Leu Ala Ala Arg     210 215 220 Asn Gly His Lys Ala Val Val Gln Val Leu Leu Asp Ala Gly Met Asp 225 230 235 240 Ser Asn Tyr Gln Thr Glu Met Gly Ser Ala Leu His Glu Ala Ala Leu                 245 250 255 Phe Gly Lys Thr Asp Val Val Gln Ile Leu Leu Ala Ala Gly Thr Asp             260 265 270 Val Asn Ile Lys Asp Asn His Gly Leu Thr Ala Leu Asp Thr Val Arg         275 280 285 Glu Leu Pro Ser Gln Lys Ser Gln Gln Ile Ala Ala Leu Ile Glu Asp     290 295 300 His Met Thr Gly Lys Arg Ser Thr Lys Glu Val Asp Lys Thr Pro Pro 305 310 315 320 Pro Gln Pro Pro Leu Ile Ser Ser Met Asp Ser Ser Ser Gln Lys Ser                 325 330 335 Gln Gly Asp Val Glu Lys Ala Val Thr Glu Leu Ile Ile Asp Phe Asp             340 345 350 Ala Asn Ala Glu Glu Glu Gly Pro Tyr Glu Ala Leu Tyr Asn Ala Ile         355 360 365 Ser Cys His Ser Leu Asp Ser Met Ala Ser Gly Arg Ser Ser Asp Gln     370 375 380 Asp Ser Thr Asn Lys Glu Ala Glu Ala Ala Gly Val Lys Pro Ala Gly 385 390 395 400 Val Arg Pro Arg Glu Arg Pro Pro Pro Pro Ala Lys Pro Pro Pro Asp                 405 410 415 Glu Glu Glu Glu Asp His Ile Asp Lys Lys Tyr Phe Pro Leu Thr Ala             420 425 430 Ser Glu Val Leu Ser Met Arg Pro Arg Ile His Gly Ser Ala Ala Arg         435 440 445 Glu Glu Asp Glu His Pro Tyr Glu Leu Leu Leu Thr Ala Glu Thr Lys     450 455 460 Lys Val Val Leu Val Asp Gly Lys Thr Lys Asp His Arg Arg Ser Ser 465 470 475 480 Ser Ser Arg Ser Gln Asp Ser Ala Glu Gly Gln Asp Gly Gln Val Pro                 485 490 495 Glu Gln Phe Ser Gly Leu Leu His Gly Ser Ser Pro Val Cys Glu Val             500 505 510 Gly Gln Asp Pro Phe Gln Leu Leu Cys Thr Ala Gly Gln Ser His Pro         515 520 525 Asp Gly Ser Pro Gln Gln Gly Ala Cys His Lys Ala Ser Met Gln Leu     530 535 540 Glu Glu Thr Gly Val His Ala Pro Gly Ala Ser Gln Pro Ser Ala Leu 545 550 555 560 Asp Gln Ser Lys Arg Val Gly Tyr Leu Thr Gly Leu Pro Thr Thr Asn                 565 570 575 Ser Arg Ser His Pro Glu Thr Leu Thr His Thr Ala Ser Pro His Pro             580 585 590 Gly Gly Ala Glu Glu Gly Asp Arg Ser Gly Ala Arg Ser Ser Ala Pro         595 600 605 Pro Thr Ser Lys Pro Lys Ala Glu Leu Lys Leu Ser Arg Ser Leu Ser     610 615 620 Lys Ser Asp Ser Asp Leu Leu Thr Cys Ser Pro Thr Glu Asp Ala Thr 625 630 635 640 Met Gly Ser Ser Arg Gly Ser Leu Ser Asn Cys Ser Ile Gly Lys Lys                 645 650 655 Arg Leu Glu Lys Ser Pro Ser Phe Ala Ser Glu Trp Asp Glu Ile Glu             660 665 670 Lys Ile Met Ser Ser Ile Gly Glu Gly Ile Asp Phe Ser Gln Glu Arg         675 680 685 Gln Lys Ile Ser Gly Leu Arg Thr Leu Glu Gln Ser Val Gly Glu Trp     690 695 700 Leu Glu Ser Ile Gly Leu Glu Gln Tyr Glu Ser Lys Leu Leu Leu Asn 705 710 715 720 Gly Phe Asp Asp Val His Phe Leu Gly Ser Asn Val Met Glu Glu Gln                 725 730 735 Asp Leu Arg Asp Ile Gly Ile Ser Asp Pro Gln His Arg Arg Lys Leu             740 745 750 Leu Gln Ala Ala Arg Ser Leu Pro Lys Val Lys Ala Leu Gly Tyr Asp         755 760 765 Gly Asn Ser Pro Pro Ser Val Pro Ser Trp Leu Asp Ser Leu Gly Leu     770 775 780 Gln Asp Tyr Val His Ser Phe Leu Ser Ser Gly Tyr Ser Ser Ile Asp 785 790 795 800 Thr Val Lys Asn Leu Trp Glu Leu Glu Leu Val Asn Val Leu Lys Val                 805 810 815 Gln Leu Leu Gly His Arg Lys Arg Ile Ale Ser Leu Ala Asp Arg             820 825 830 Pro Tyr Glu Glu Pro Pro Gln Lys Pro Pro Arg Phe Ser Gln Leu Arg         835 840 845 Cys Gln Asp Leu Leu Ser Gln Thr Ser Ser Pro Leu Ser Gln Asn Asp     850 855 860 Ser Cys Thr Gly Arg Ser Ala Asp Leu Leu Leu Pro Pro Gly Asp Thr 865 870 875 880 Gly Arg Arg Arg His His Ser Leu His Asp Pro Ala Ala Pro Ser Arg                 885 890 895 Ala Glu Arg Phe Arg Ile Gln Glu Glu His Arg Glu Ala Lys Leu Thr             900 905 910 Leu Arg Pro Pro Ser Leu Ala Ala Pro Tyr Ala Pro Val Gln Ser Trp         915 920 925 Gln His Gln Pro Glu Lys Leu Ile Phe Glu Ser Cys Gly Tyr Glu Ala     930 935 940 Asn Tyr Leu Gly Ser Met Leu Ile Lys Asp Leu Arg Gly Thr Glu Ser 945 950 955 960 Thr Gln Asp Ala Cys Ala Lys Met Arg Lys Ser Thr Glu His Met Lys                 965 970 975 Lys Ile Pro Thr Ile Ile Leu Ser Ile Thr Tyr Lys Gly Val Lys Phe             980 985 990 Ile Asp Ala Ser Asn Lys Asn Val Ile Ala Glu His Glu Ile Arg Asn         995 1000 1005 Ile Ser Cys Ala Gln Asp Pro Glu Asp Leu Cys Thr Phe Ala Tyr    1010 1015 1020 Ile Thr Lys Asp Leu Gln Thr Ser His His Tyr Cys His Val Phe Ser 1025 1030 1035 1040 Thr Val Asp Val Asn Leu Thr Tyr Glu Ile Ile Leu Thr Leu Gly Gln                1045 1050 1055 Ala Phe Glu Val Ala Tyr Gln Leu Ala Leu Gln Ala Gln Lys Ser Arg            1060 1065 1070 Ala Thr Gly Ala Ser Ala Glu Met Ile Glu Thr Lys Ser Ser Lys        1075 1080 1085 Pro Val Pro Lys Pro Arg Val Gly Val Arg Lys Ser Ala Leu Glu Pro    1090 1095 1100 Pro Asp Met Asp Gln Asp Ala Gln Ser His Ala Ser Val Ser Trp Val 1105 1110 1115 1120 Val Asp Pro Lys Pro Asp Ser Lys Arg Ser Leu Ser Thr Asn                1125 1130 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WT forward primer for PCR <400> 2 tgaaggcaca tgaggctgag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> WT reverse primer for PCR <400> 3 acagcgtttg catcttgctg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> KO forward primer for PCR <400> 4 atgtcatagc tgtttcctgt 20

Claims (6)

A biomarker composition for the diagnosis of hydrocephalus comprising the Anks1a protein consisting of the amino acid sequence of SEQ ID NO: 1. A composition for diagnosing hydrocephalus comprising an antibody that specifically binds to Anks1a protein having the amino acid sequence of SEQ ID NO: 1. The composition for diagnosing hydrocephalus according to claim 2, wherein the antibody is at least one selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a fragment of an antibody, and a recombinant antibody. 4. The composition of claim 3, wherein the fragment of the antibody is Fab, Fab 'scFv, (scFv) ₂ , Fv or a combination thereof. A kit for the diagnosis of hydrocephalus comprising the composition according to any one of claims 2 to 4. A method for detecting Anks1a protein from a patient to provide information for the diagnosis of hydrocephalus.

Images