KR20150139189A - Method for increasing plant disease resistance using OsWRKY67-inducible resistance gene1 from Oryza sativa and the plant thereof - Google Patents

Abstract

The present invention relates to a method for increasing resistance to plant disease using rice-derived OsWRKY67-inducible resistance gene 1 (OsWIR1), and to a plant thereby. According to the present invention, by inserting the gene derived from mutant rice into an expression vector for plant transformation and overexpressing the gene, it is possible to promote growth by increasing resistance to rice blast disease of the plant, resulting in an increase in yield. Therefore, the method can be effectively applied in promoting a new variety.

Description

TECHNICAL FIELD [0001] The present invention relates to a method for increasing resistance to a plant disease using OsWIR1 (OsWRKY67-inducible resistance gene 1), a rice-derived NB-LRR immunosensor resistance gene, and a plant plant thereof}

The present invention is derived from rice plant NB-LRR resistance gene, immune sensor OsWIR1 (OsWRKY67-inducible resistance gene1) by using a method and a plant according thereto for increasing the disease resistance of the plant, and more particularly, rice (Oryza sativa A method of increasing plant disease resistance compared to a non-transformant comprising a step of overexpressing OsWIR1 gene by transforming a plant cell with a recombinant vector containing a gene encoding OsWIR1 protein, A method for producing a transgenic plant having enhanced disease resistance compared to a non-transformant comprising transforming a recombinant vector containing the gene into a plant cell, a method for producing a transgenic plant produced by the method, A composition for increasing disease resistance of a plant comprising a gene coding for OsWIR1 protein derived from rice and an expression of a gene encoding OsWIR1 protein derived from rice as an active ingredient, and a mutant plant having enhanced disease resistance.

Plants have immune mechanisms characterized by pathogen recognition and defense responses to protect themselves against the invasion of numerous pathogens. Plants recognize pathogen- or microbial-related molecular patterns (PAMP / MAMP), that is, parts of molecules that are highly conserved among microorganisms belonging to the same family, by means of pattern recognition receptors (PRRs) activates PAMP-triggered immunity (PTI), which involves the accumulation of reactive oxygen species (ROSs) and the deposition of phenolic compounds. ROSs not only have direct antimicrobial activity, they also function as signaling molecules in the defense response. PTI is often referred to as the underlying defense against pathogen infiltration and growth (Jones and Dangl, 2006, Nature, 444: 323-329).

As another plant immune system, recognition of pathogen effector molecules through host immunosensors encoded by disease resistance ( R ) genes leads to effector-triggered immunity (ETI). If the fungal reactors are recognized by similar rice-derived R proteins, ETI is induced and terminated with an irritable reaction, which stops fungal growth within 48 hours. ETI is a potent immune response that effectively protects plants from pathogens specific strains or races. Localized hypersensitivity reactions cause a long-lasting systemic response called systemic acquired resistance (SAR), which allows plants to be prepared to resist a wide range of pathogens.

If the fungal reactors are not recognized, a limited PTI reaction occurs under the recognition of fungal PAMP like chitin (Kaku et al., 2006, Proc Natl Acad Sci USA, 103: 11086-11091). And fungal hyphae spread through plant tissues, causing disease (Chen and Ronald, 2011, Trends plant Sci, 16: 451-459). Therefore, early defense response after invasion of pathogens is important for the end result of host resistance.

The transcriptional reprogramming associated with plant defense responses requires the activity of various transcription factors as well as plant hormones. Transcription factors such as WRKY, ERF, TGA, bZIP, and Myb are associated with downstream signaling of plant innate immune mechanisms (Eulgem, 2005, Trends Plant Sci, 10: 71-78). In particular, WRKY transcription factors are very important in transcription reprogramming linked to the plant's immune response. The WRKY gene family has been widely developed among terrestrial plants (Eulgem and Somssich, 2007, Curr. Opin. Plant. Biol., 10: 366-371). For example, there are more than 80 WRKY genes in Arabidopsis and over 130 WRKY genes in rice (Zhan et al., 2011, Nucl Acids Res, 39: D1114-D1117).

The R gene, which identifies resistance to pathogens, is classified into five taxa depending on the configuration of the domains conserved in its protein (Van Ooijen et al., 2007, Annu. Rev. Phytopatho 45: 43-72). Among them, the NB-LRR proteins including the nucleotide-binding (NB) and leucine-rich repeat (LRR) domains have been reported to be about 150 in the Arabidopsis, 500 in the rice (Ellis et al., 2000, Current Opinion in Plant Biology 3: 278-284). This suggests that a common mechanism for recognition and transmission of pathogen signals is present in various plant species.

In most cases, the NB-LRR protein is involved in gene-for gene resistance. For example, Isaac blast (Panicle blast ) 1 ( Pb1 ) gene is a gene encoding CC-NB-LRR (coiled-coil-nucleotide-binding site-leucine-rich repeat) protein that interacts with OsWRKY45 in intracellular nuclei (Inoue et al., 2013, Proc. Natl. Acad. Sci. USA 113 (23): 9577-9582).

Rice blast caused by Magnaporthe oryzae is the most devastating rice disease causing annual losses of 10-30% of rice production worldwide (Skamnioti and Gurr, 2009, Trends Biotechnol, 27: 141-150) . After initiating infection of the rice leaves by appressoria differentiation and conidia germination at the top of the germination tube, the narrow penetrating peg is the result of intrusion of the intracellular buildup during the biotrophic phase Differentiate into mycelium. Blast lesions are generally visible within 7 days of the infection, but they do not kill the plant cells early, and they kill plants by continuous growth of the mycelia infected in the later stages of infection. Bacterial leaf blight caused by Xanthomonas oryzae pv. Oryzae (Xoo ) is one of the rice diseases that severely loses rice yields in most rice growing countries worldwide (Lino- Liu et al., 2006, Mol. Plant Pathol, 7: 303-324). Blisters of white blossom infiltrate into plants through wounds and hydathodes, propagate in coat tissues and penetrate into water tubes. Therefore, research for preventing rice disease caused by pathogenic bacteria is very important because of its importance as a crop to be occupied by rice.

Thus, the present invention reports the potential role of the OsWIR1 gene in promoting its functional role in plant defense response and enhancing disease resistance. In the present invention, a mutant line overexpressing the rice-derived OsWIR1 gene was resistant to the blast fungus. These data support that the OsWIR1 gene is essential for basic defense and resistance to pathogens.

Korean Patent No. 1352035 discloses 'rice blast resistance resistant OsABP67', Korean Patent Registration No. 0990370 discloses 'a gene promoting tolerance to rice blast fungus and its use', but the rice origin of the present invention There is no disclosure of a method for increasing the disease resistance of a plant using OsWIR1 (OsWRKY67-inducible resistance gene 1), which is an NB-LRR immunosensor resistance gene, and the resulting plant.

Check the present invention is derived by the request as described above, the present invention OsWIR1 gene mutant plants confirmed that the downstream genes regulated by OsWRKY67, said OsWIR1 gene overexpression represents a strong resistance to oryzae Thereby completing the present invention.

In order to solve the above problems, the present invention is rice (Oryza transforming a plant cell with a recombinant vector comprising a gene encoding OsWIR1 protein derived from S. sativa The present invention provides a method for increasing plant disease resistance compared to a non-transformant comprising the step of overexpressing the OsWIR1 gene.

The present invention also provides a method for producing a transgenic plant having enhanced disease resistance as compared to a non-transformant comprising transforming plant cells with a recombinant vector comprising a gene encoding OsWIR1 protein derived from rice .

In addition, the present invention provides a transgenic plant having enhanced disease resistance and seeds thereof compared to the non-transformant produced by the above method.

In addition, the present invention provides a composition for increasing disease resistance of a plant comprising a gene coding for OsWIR1 protein derived from rice as an active ingredient.

In addition, the present invention provides a mutant plant and a seed thereof, wherein the expression of a gene encoding OsWIR1 protein derived from rice is increased.

The present invention relates to a method for increasing disease resistance of a plant using a gene encoding OsWIR1 protein derived from rice. According to the present invention, by inserting the gene into an expression vector for plant transformation and overexpressing it, it is possible to effectively increase the resistance of the plant to blast disease, and consequently, it is expected that it will contribute to economic efficiency such as increase of crop yield.

Figure 1 shows the isolation and characterization of OsWRKY67 activated mutants ( OsWRKY67-D1 and OsWRKY67-D2 mutants). (A) Schematic diagram of OsWRKY67 genome structure and T-DNA insertion site in OsWRKY67-D1 and OsWRKY67-D2 mutants. The boxes and solid lines represent exons and introns, respectively, and the positions of T-DNA are represented by triangles. 4X35S means 35S enhancer. (B) RT-PCR analysis of OsWRKY67 gene expression in OsWRKY67-D1, OsWRKY67-D2 mutant and wild type rice.
Figure 2 shows the intracellular location of the OsWRKY67-GFP fusion protein in transfected corn leafy protoplasts. Chlorophyll autofluorescence and OsABF1-RFP were used as markers for chloroplasts and nuclei, respectively. To distinguish from GFP (green) and RFP (red) fluorescence, false color (blue) was used for chlorophyll fluorescence.
3 shows a resistance reaction result after inoculating rice blast fungus (M. oryzae) PO6-6 the leaf OsWRKY67 active mutants and wild-type Dongjin (Dongjin). (A) Disease response of wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activated mutant plants inoculated with rice blast fungus PO6-6. The disease is shown 10 days after inoculation. Immunity control RIL260 was used. (B) Length of leaf lesions of wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activated mutant plants inoculated with rice blast fungus PO6-6. OsWRKY67-D1 and OsWRKY67-D2 show increased resistance compared to the wild - type strain .
4 is OsWRKY67 active mutants and wild-type Dongjin (Dongjin) rice blast fungus on the leaves (M. oryzae) The results of the resistance reaction after inoculation with KI-215 are shown. (A) Disease response of wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activated mutant plants inoculated with rice blast fungus KI-215. The disease is shown 10 days after inoculation. (B) Length of leaf lesion of wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activated mutant plants inoculated with rice blast fungus KI-215. OsWRKY67-D1 and OsWRKY67-D2 show increased resistance compared to the wild - type strain .
Figure 5 shows the results of a reaction resistance inoculated OsWRKY67 active mutants and wild-type Dongjin Rice blight fungus huinip PX099 on (Dongjin) leaves. (A) Disease response of wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activated mutant plants inoculated with rice blast fungus PXO99. The plants are inoculated at 5 weeks of age and the disease is shown at 10 days after inoculation. (B) Length of lesions of wild-type and OsWRKY67 activating mutants. It was measured at 0, 5, 10, and 14 days after inoculation and expressed as the mean value of three leaves. The bar represents the SD value. (C) Growth curve of blight of blight of white blossom. The degree of growth was expressed as log CFU / leaf colony forming units, and was measured on three leaves of similar growth stages in wild type strain , OsWRKY67-D1 and OsWRKY67-D2 . The bar represents the SD value.
6 illustrates via a RT-PCR analysis The expression pattern of the rice blast fungus after inoculation of defense-related genes in OsWRKY67 active mutants and wild-type Dongjin (Dongjin) (OsWRKY67, PR1a, PR1b, PR4, PR10a and PR10b). Expression of the genes was analyzed in wild type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activating mutants in mutant and wild-type plants at 0, 12 and 24 hours after treatment with rice blast fungus PO6-6. OsUbq5 was used as an internal control.
7 is RT- the expression pattern of the rice blast fungus after inoculation of defense-related genes in OsWRKY67 active mutants and wild-type Dongjin (Dongjin) (EDS1, PAD4, ICS1, CHS1, PAL2, PAL3, PAL5, PAL6, PAL8 and PAL9) PCR analysis results.
8 is OsWRKY67 in active mutants and wild-type Dongjin (Dongjin) The results of the ROS reaction induced after treatment with chitin (A) or flg22 (B) are shown. The error bars represent the standard error (n = 3).
Figure 9 shows the result of gene ontology (GO) analysis in the OsWRKY67 activating mutant.
Figure 10 shows Mapman analysis in biological stress. Red indicates upregulation in the OsWRKY67 activating mutant.
Figure 11 shows via a RT-PCR analysis The expression pattern of the R gene from the rice blast fungus after inoculation OsWRKY67 active mutants and wild-type Dongjin (Dongjin). Expression of the six R genes was analyzed in wild - type Dongjin, OsWRKY67-D1 and OsWRKY67-D2 activating mutations in mutant and wild-type plants at 0, 12 and 24 hours after treatment with rice blast fungus PO6-6. OsUbq5 was used as an internal control.
Figure 12 shows the isolation and characterization of OsWIR1 activating mutants. (A) A schematic diagram of the OsWIR1 genome structure and the T-DNA insertion site in the mutant OsWIR1- D . The boxes and solid lines represent exons and introns, respectively, and the positions of T-DNA are represented by triangles. 4X35S means 35S enhancer. (B) of OsWIR1 -D active mutant (T / T) and wild-type (W / W) OsWIR1 Gene Expression in Rice Plants RT-PCR analysis results.
Figure 13 shows the OsWIR1 active mutants and wild-type Dongjin (Dongjin) rice blast fungus (M. oryzae) PO6-6 or resistant reaction after the KI-215 inoculated on the leaf. (A) Disease response of wild-type Dongjin, OsWIR1- D activated mutant plants inoculated with rice blast fungus PO6-6. The disease is shown on the eighth day after inoculation. (B) Length of leaf lesion of wild-type Dongjin, OsWIR1- D activated mutant plants inoculated with rice blast fungus PO6-6. OsWIR1- D activating mutations show increased resistance compared to wild-type dengue . (C) Disease response of wild-type Dongjin, OsWIR1- D activated mutant plants inoculated with rice blast fungus KI-215. The disease is shown 6 days after inoculation. (D) Length of leaf lesion of wild-type Dongjin, OsWIR1- D activated mutant plant inoculated with rice blast fungus KI-215. OsWIR1- D activated mutant plants show increased resistance compared to wild-type dengue .

According to an aspect of the invention, the invention is rice (Oryza transforming a plant cell with a recombinant vector comprising a gene encoding OsWIR1 protein derived from S. sativa The present invention provides a method for increasing plant disease resistance compared to a non-transformant comprising the step of overexpressing the OsWIR1 gene.

The OsWRKY67-inducible resistance gene1 (OsWIR1) protein of the present invention includes a protein having the amino acid sequence of SEQ ID NO: 2 and a functional equivalent of the protein. As used herein means at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, more preferably 95% or more, Or more homologous to the amino acid sequence of SEQ ID NO: 2 and having substantially the same physiological activity as the protein having the amino acid sequence of SEQ ID NO: 2. "Substantially homogenous bioactivity" means an activity that increases disease resistance in a plant.

In addition, the gene encoding OsWIR1 protein includes both genomic DNA and cDNA. Preferably, the OsWIRl gene cDNA sequence of the present invention may include the nucleotide sequence shown in SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene includes a nucleotide sequence having at least 70% homology, more preferably at least 80% homology, even more preferably at least 90% homology, and most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 1 can do. "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ". The term "expression vector" means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The recombinant vector is preferably a recombinant plant expression vector.

A preferred example of a plant expression vector is a Ti-plasmid vector which is capable of transferring a so-called T-region into a plant cell when present in a suitable host such as Agrobacterium tumefaciens . Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as Kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant genes, but are not limited thereto.

In the plant expression vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter " refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) Terminator of the Octopine gene, and the rrnB1 / B2 terminator of E. coli, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

Any host cell known in the art may be used as the host cell capable of continuously cloning and expressing the vector of the present invention in a stable and prokaryotic cell, for example, E. coli JM109, E. coli BL21, E. coli RR1 , E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus tulifene, and Salmonella typhimurium, Serratia marcesensus and various Pseudomonas species And enterobacteria and strains such as the species.

When the vector of the present invention is transformed into eukaryotic cells, yeast ( Saccharomyce cerevisiae), and the like insect cells, human cells (e.g., CHO (Chinese hamster ovary), W138, BHK, COS-7, 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cell may be used. The host cell is preferably a plant cell.

The method of delivering the vector of the present invention into a host cell can be carried out by the CaCl ₂ method, Hanahan, D., 1983, J. Mol. Biol., 166: 557-580, An electric drilling method or the like. When the host cell is a eukaryotic cell, the vector is injected into the host cell by microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, gene bombardment or the like .

In the method according to an embodiment of the present invention, the disease resistance may be resistance to rice blast disease, preferably resistance to rice blast fungus by the blast fungus PO6-6 or KI-215, It does not.

The present invention also provides a method for producing a recombinant vector comprising the steps of: transforming a plant cell with a recombinant vector comprising a gene encoding OsWIR1 protein derived from rice; And regenerating the plant from the transformed plant cell. The present invention also provides a method for producing a transgenic plant having enhanced disease resistance compared to a non-transformant comprising the step of regenerating a plant from the transformed plant cell.

In the method according to one embodiment of the present invention, the gene encoding the OsWIR1 protein is as described above.

The method of the present invention comprises transforming a plant cell with a recombinant vector according to the invention, said transformation being mediated, for example, by Agrobacterium tumefaciens.

In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

Transformed plant cells must be regenerated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989, Momillan, N. Y.).

In addition, the present invention provides a transgenic plant having enhanced disease resistance and seeds thereof compared to the non-transformant produced by the above method. The plant may be selected from the group consisting of monocot plants such as rice, barley, wheat, rye, corn, sorghum, oats and onions or potatoes, potatoes, eggplant, tobacco, pepper, tomato, burdock, cilia, lettuce, spinach, And may be a twin leaf plant such as celery, carrot, parsley, parsley, cabbage, cabbage, gab, watermelon, melon, cucumber, amber, pak, strawberry, soybean, mung bean, kidney bean and pea. It is preferably rice.

In addition, the present invention provides a composition for increasing disease resistance of a plant comprising, as an active ingredient, a gene encoding the OsWIR1 protein consisting of the amino acid sequence of SEQ ID NO: 2. The composition for increasing the disease resistance of a plant of the present invention comprises a gene encoding an OsWIR1 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient and can be used to increase the disease resistance of a plant by transforming the gene into a plant .

The present invention also provides a mutant plant having increased disease resistance due to an increased expression of a gene encoding the OsWIR1 protein comprising the amino acid sequence of SEQ ID NO: 2.

In a plant according to an embodiment of the present invention, the expression of the OsWIR1 protein-encoding gene may be increased by a T-DNA tagging method, but the present invention is not limited thereto.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Plant material and growth conditions

Rice T-DNA mutant group two activating mutations (OsWRKY67-D1-D2 and OsWRKY67) and their wild-type plant of Dong Jin (Dongjin) an increase in the expression of OsWRKY67 this was used in the study. The seedlings of japocanica rice cultivar, Dongjin, were mainly used as a susceptible control in rice blotting and inoculation experiments. Rice was grown in a greenhouse at a temperature of 20 ° C overnight, typically at a 14/10 hour light / dark cycle, during the day at 30 ° C.

Inoculation of pathogens and evaluation of diseases

The rice blast isolates PO6-6 and KI-215 were used for all phenotypic analyzes. The isolates of rice blast fungus are stable Philippine isolates that do not show pathology in RIL260. All inoculations and disease assessments were performed at Kyunghee University's greenhouse as described by Chen et al. (Chen et al., 1996, Plant Disease 80: 52-26). Five-week-old leaves were used for inoculation experiments. The rice blast fungi PO6-6 and KI-215 were cultured in oval medium for two weeks in a dark room at 22 ° C and induced conidia three days before collection. The inoculated plants were kept in a culture chamber for 24 hours in a dark room at 24 占 폚, and then kept at a humidity of 95% for 14 hours. Disease assessment was performed 9-10 days after inoculation. Pine blight isolate PXO99 was used for all phenotypic analysis. Five-week-old leaves were used for inoculation. PXO99 was grown on peptone sucrose agar medium for 3 days at 28 ° C and then suspended in distilled water to a concentration of 0.8 (OD ₆₀₀ ). As described in Park et al. (Park et al., 2010, PLoS One 5 : e9262) Inoculation experiments were carried out together. Disease assessment was performed 14 days after inoculation.

Intracellular location of OsWRKY67-GFP fusion protein

The OsWRKY67 gene was amplified using primer pair: forward primer (5'-CACCATGAGGTACGAGAGCGAGGAGAA-3 '(SEQ ID NO: 3)) and reverse primer (5'-GAAGAGCAGCGAGCCGCCTGCCGAATA-3' (SEQ ID NO: 4)) for C- And amplified by PCR. The PCR products were then subcloned into pENTR ^TM / D-TOPO vector (Invitrogen, Gaithersburg, Md.). The validated inserts were then subcloned into p2GWF7 for C-terminal GFP fusion, the target vector, using LR clonase (Invitrogen) according to the manufacturer's instructions. The resulting fusion construct (OsWRKY67-GFP) induced by the CaMV35S promoter was carried into the corn lobe protoplast using the polyethylene glycol (PEG) -calcium-mediated method, followed by incubation for 12-24 hours allowing transient expression . Chlorophyll autofluorescence and OsABF1-RFP were used as chloroplasts and nuclear markers, respectively. The expression of the fusion constructs was monitored using a confocal microscope (LSM510 META, Carl Zeiss, Jena, Germany).

RNA isolation and RT-PCR analysis

Total RNA was isolated from rice plants and blast-treated seedlings under normal growth conditions using Trizol reagent (Invitrogen, Gaithersburg, Md.). First strand cDNA was synthesized using 1 쨉 g of purified total RNA, oligo (dT) primer and First Strand cDNA synthesis kit (Roche). The rice ubiquitin 5 ( OsUBQ5 ) gene was amplified as an internal control to quantify the relative amount of cDNA. The primer sequences used in Table 1 are shown.

The primer sequences used in the present invention primer Forward order
number Reverse order
number OsWRKY67-D1 CTCATAGCATTTGACCTTCACTTCCTCTA 5 TCTTTTTGTGTTTCTTGCTCTAGTCCTTG 6 OsWRKY67-D2 AAATTTCCCTACATCGGCTAAGAGTACAA 7 TGCTATCAAATTATCCCTCAAGAACTGAA 8 OsWRKY67-RT * CTTCAGCAACTCCTACTCCTACT 9 TCTCGTACCTCATCATAGTGTTT 10 PR1a * TTATCCTGCTGCTTGCTGGT 11 GGTCGTACCACTGCTTCTCC 12 PR1b * GATTAACTATGGAGGTATCCAAGC 13 ACGTACGCCCGTGTGTATAAATAA 14 PR4 * CAAACTACCTCATTCTCCATCAG 15 TCCAGTATATGATCATGCAAAGAG 16 PR10a * ACCATCTACACCATGAAGCTTAAC 17 GTATTCCTCTTCATCTTAGGCGTA 18 PR10b * GGCACCATCCACATCATGAAGCTT 19 CACGCCACAGTAACATGACCACAA 20 EDS * TCAGTTGGATCCCCAGCAA 21 TCCCAAGTAATCCACGCAAAC 22 PAD4 * GCCAGCTCCCCTACGACTTC 23 CGTGTGCGGTGTAGGTTGTT 24 ICS1 * TATGGTGCTATCCGCTTCGAT 25 CGAGAACCGAGCTCTCTTCAA 26 CHS1 * CCGGCGAACTGCGTGTAC 27 TTCCTGATCTGCGACTTGTCA 28 PAL2 * GTCATGAACAGCATGATGAA 29 CATTGAGCAGCTTGGTGATG 30 PAL3 * CAGCTGTGGAGAACGGCA 31 GTGTACATTGAAGAATCCTT 32 PAL5 * TCCAAGTTGAGCTGCTCAG 33 GTCCACCTTCTTGCCATCGA 34 PAL6 * GTCATGAACAGCATGATGA 35 CTGGAGCAGAGTGTTGATG 36 PAL8 * TGAATGGCACCGACACGTAC 37 GTTGAGCAGCTTGGCGATG 38 PAL9 * GTCTTCGACAGCACCATGA 39 TGGCCTCGAAGAGCACGATC 40 LOC_Os11g38480-D TGATTGTTCAAGCCGGAGCAAGTCCTTAG 41 ACAGCCATTGATGCAAGGTAATTGCCACT 42 LOC_Os11g39310 RT * GGCACATGGATAAGACATCTTCCAG 43 AGCTCCAGCAGCACCAACAATAAG 44 LOC_Os11g39320 RT * AGAGGATGAAGTTGTCGCATGTCC 45 CTCTCCACTGATGCAGGCAAGTTT 46 LOC_Os11g38000 RT * TTTATTCTCACAAGTTCGGCAGCA 47 CGGTTATCAACACAGCACCTCTGA 48 LOC_Os11g39190 RT * AAGGCTGGGAGAATTTGAAGGATG 49 CTGGCATGTGCTTTATTTGTGTGC 50 LOC_Os11g38480
(OsWIR1) RT * AACGCCGTGATGATTTGGAAGATA 51 CTCAAGTTTCTTGGGATGGGGAAG 52 LOC_Os11g42040 RT * AAGTCCTTACCGGCATCACTGACA 53 CTGAGGTCCAAAGTTTGCAGGTTG 54 OsUBQ5 * GGAACTGGTATGGTCAAGGC 55 AGTCTCATGGATACCCGCAG 56 2715RB ATCCAGACTGAATGCCCACAGG 57

* Represents the set of primers used for RT-PCR analysis.

Measurement of ROS

4-week-old leaf discs were cut and pre-incubated overnight in sterile water. After elicitor treatment on leaf discs, ROS production was monitored using a luminol chemiluminescence assay (Schwacke and Hager, 1992, Planta 187: 136-141). Three leaf disks per sample were incubated with 100 μl of luminol (Bio-Rad Immun-Star horseradish peroxidase substrate 170-5040), 1.0 μl of horseradish peroxidase and inducer (100 nM flg22, 8 nM chitin hexa-N-acetyl-chitohexaose) or water (control). Immediately after treatment, luminescence was continuously measured at 10 second intervals for 20 minutes using a Glomax 20/20 luminometer (Promega). Each independent experiment was repeated three times. Standard errors for each treatment were calculated.

Microarray analysis

For microarray analysis, OsWRKY67-D1, OsWRKY67-D2 and their wild - type plant, Dongjin , were grown in a greenhouse. Three-week-old leaves were used for the experiment. For biological reproducibility, OsWRKY67-D1 and OsWRKY67-D2 seedlings were sampled 3 times independently and 2 times sampled. Total RNA was extracted using the Mini RNA kit (Qiagen) according to the manufacturer's instructions and analyzed using the Rice Gene Expression Microarray and Gene Expression Hybridization kit (Agilent). Signals were detected with an Agilent DNA microarray scanner, and signal intensities for individual probes were analyzed using Agilent Feature Extraction Software version 7.5.1. Strength was standardized by the quantile method and transformed to the log2 scale (Bolstad et al., 2003, Bioinformatics 19: 185-193).

Gene ontology Gene Ontology Analysis

GO analysis was performed on 354 genes up-regulated in OsWRKY67-D plants compared to the wild type in the biological process. We measured the fold-enrichment for each GO slim term in the querying gene list and found that there was a GO term and a GO mutation value of two- A linked gene entry with a hyper genomic p-value of less than 0.05 was identified (Figure 9). For each GO term, fold-translocation is the number of genes observed in the gene list divided by the expected number of genes, given as the size of the list of genes compared to the entire genome.

MapMan Analysis

Currently, 36 MapMan BINs are used for the rice Mapman classification, and these BINs could be expanded from hierarchical to lower bin (BIN). To incorporate important gene expression data from transcriptome analysis of various Mapman tools, the average fold-change data of 354 genes up-regulated in OsWRKY67-D plants and the MSU locus ID were compared with wild type . 10, the inventor used a bio-stress-overview of a toolkit installed in Mapman. A specific procedure has been described in a recent study by the present inventors group (Jeong and An, 2012, J Plant Biol 55: 436-449).

Example 1. Isolation of OsWRKY67 activating mutation

The first step to investigate the in vivo function of OsWRKY67, which regulates disease resistance under biological stress conditions, is to detect two activations in the T-DNA mutation population (Jeong et al., 2006, Plant J. 45: 123-132) Mutations were isolated. The isolated alleles, OsWRKY67-D1 and OsWRKY67-D2 (D means dominant ), contain T-DNA insertions upstream of the translation initiation codon of the OsWRKY67 gene at about 6.4 and 3.4 kb, respectively (FIG. 1A). Homozygous mutations were isolated from their progeny using OsWRKY67 specific primers (SEQ ID NOS: 5-6 or 7-8; see Table 1) and T-DNA specific primers (SEQ ID NO: 57; The acquisition of the OsWRKY67 transcript was confirmed by RT-PCR analysis using the primers of SEQ ID NOS: 9 and 10 (see Table 1). As a result, it was shown that the OsWRKY67 transcript in the activated mutation was higher than in the wild type (Fig. 1B).

Example 2. Intracellular location of OsWRKY67

To determine the intracellular location of the OsWRKY67 protein, an OsWRKY67-GFP fusion construct was prepared under the control of the CaMV 35S promoter. The construct was then expressed in the corn lobate protoplast. The results show that the OsWRKY67-GFP fusion protein is expressed in the nucleus of maize protoplasts (Fig. 2). Colocalization was confirmed using the nuclear marker OsABF1-RFP. The data show that OsWRKY67 is a nuclear protein and thus can play an important role as a transcription factor.

Example 3. Analysis of OsWRKY67 activated mutant plants

To test whether the OsWRKY67 gene confers resistance to rice blast isolates, the OsWRKY67-D1 and OsWRKY67-D2 inoculation experiments using the highly sensitive strains of Dongjin and Dongjin for rice blast fungus PO6-6 were performed by OsWRKY67-D1 And OsWRKY67-D2 plants were resistant to rice blast fungus PO6-6 comparable to RIL260, while wild-type control plants exhibited a susceptible phenotype (Fig. 3). Species specificity is one of the most important points to distinguish resistance ( R ) gene mediated resistance from other types of disease resistance. To investigate the resistance to race-specific blast resistance by the OsWRKY67 gene, inoculation experiments were performed with PO6-6 and other blast isolate KI-215. As a result, the OsWRKY67-D1 and OsWRKY67-D2 activating mutants exhibited a resistance phenotype for the rice blast isolate, whereas the wild type plants repeated the susceptibility phenotype (Fig. 4). These results demonstrate that the OsWRKY67 gene is required for resistance to broad- spectrum rice blast isolates. The OsWRKY67 gene is rice huinip blight fungus in order to test whether a given resistance to isolate, rice huinip blight fungus is very susceptible of Dongjin and Dongjin for PXO99 the separation in a OsWRKY67-D1 and OsWRKY67-D2 inoculation experiments mobon OsWRKY67 OsWRKY67 -D1 and D2-activating mutations have been affirmed that it has pathogen resistance is remarkably increased (Fig. 5A and 5B), this bacterial growth also consistently decreased in OsWRKY67-D mutant plants (Fig. 5C). These results suggest that the OsWRKY67-D activated mutant line isolated at the same time as the rice blast fungus isolate inoculation has strong resistance to at least two other pathogens at the same time, suggesting that OsWRKY67 supports the control of multiple plant disease resistance.

Example 4. OsWRKY67 Identification of defense-related gene expression in activated mutants

Increased disease resistance is frequently observed in mutants with multiple expression developmental and / or morphological abnormalities (perturbations), which in this case are associated with defective marker genes or essential components of stress-defensive genes. The OsWRKY67-D mutant under development under normal growth conditions has morphological and morphological changes Not observed. To determine the effect of OsWRKY67 on rice defense against pathogens, RT-PCR analysis was performed comparing the expression of defense-related genes in OsWRKY67-D and wild - type dengue . The expression patterns of five PR genes were investigated by extracting total RNA from plant leaves at 0, 12 and 24 hours after inoculation with wild type, OsWRKY67-D1 and OsWRKY67-D2 by spraying method. PR1 transcript accumulation was not observed in the wild type before the inoculation of the pathogen, but a significant amount was also detected in the OsWRKY67-D plant before inoculation (Fig. 6). OsWRKY67-D plants accumulated more PR1b transcripts than wild - type plants (Fig. 6). Showed little or no change in the expression levels of the PR4 , PR10 and PR10b transcripts (Figure 6).

SA and JA are key signaling molecules in plant defense responses. Expression of OsPRl is believed to be dependent on the SA signaling pathway or the SA and JA signaling pathways. PR1b functions in defense responses to pathogens through SA- and JA-dependent signaling pathways in rice (Xie et al., 2011, Mol Plant 4: 688-696). Therefore, we hypothesized that the active site of OsWRKY67 in the defense signaling network would be downstream of SA and JA and would function in the SA- or JA-dependent defense signaling pathway in OsWRKY67-D mutants The expression of 10 genes known to be known to be involved in the development of the disease is examined. Expression of the eight genes, EDS1 , PAD4 , ISC1 , CHS , PAL2 , PAL5 , PAL8 and PAL9 was not altered by inoculation of the pathogen (FIG. 7). On the other hand, the expression level of PAL3 was higher than remarkable in OsWRKY67-D from all pathogens infect wild type (Fig. 7).

Example 5. ROS measurement

To test whether OsWRKY67 expression in rice affects ROS production after treatment with PAMP inducer, temporal ROS levels were quantified by OsWRKY67 activated mutants and ROS inhibition experiments following chitin and flg22 treatment by harvesting leaves from wild-type plants. To determine the likelihood of ROS production, 4-week - old OsWRKY67-D mutants and wild - type plant tissues were analyzed for ROS production following treatment with the bacterial inducer factor fla22 or fungal PAMP chitin. As shown in Figure 8, OsWRKY67-D mutant plants induced up to 50% of ROS production within 10 minutes after treatment with flg22 or chitin inducer compared to wild - type plants, and the results show that the basal resistance increase in OsWRKY67 activating mutants lt; RTI ID = 0.0 > ROS < / RTI > resulting from flg22 and chitin-induction.

Example 6. Microarray analysis to examine downstream genes specifically regulated by OsWRKY67

Changes in RNA expression in the OsWRKY67-D1 and OsWRKY67-D2 activated mutant lines and wild-type syngene were compared via an Agilent 60K microarray. As a result, 347 genes with at least 2-fold upregulation of the p-value less than 0.05 in the OsWRKY67 activation mutation were identified compared to the wild type.

Example 7. Gene ontology (GO) analysis related to OsWRKY67 overexpression

To identify biological pathways that may regulate the response of genes expressing differences in expression in pathogenic infection in the OsWRKY67 activating mutation, the GO category mutation analysis was used to determine the cutoff of the FDR adjusted to p- ≪ / RTI > 365 GO terns in the biological process were assigned 196 probe sets of 347 up-regulated genes. The distribution of the initiated GO term represented a GO term strongly associated with OsWRKY67 overexpression. In addition, at least twice the enrichment of the iron ion transport, endogenous bacterial biosynthesis process, cellular mechanism, apoptosis and defense reaction genes was confirmed (FIG. 9).

Example 8. Mapman analysis related to OsWRKY67 overexpression

Gene ontology analysis showed that the "defense response" gene showed an increased expression level in the OsWRKY67 activation mutation, so use the MapMan software (http://mapman.gabipd.org) I analyzed it. In the mapper graph (Fig. 10), a biotic stress overview consisting of genes up-regulated in the OsWRKY67-D mutants was shown compared to the wild type, indicating that the gene encoding the enzymes involved in the major disease- Represents an overview of the control pattern. Selection of genes for a summary of plant responses to pathogens revealed a number of regulated genes in the functional categories of Mapman: "recognition by the R gene,""respiratoryburst,"" (Protein kinase), "heat shock protein", "various functions", "signaling", "MAPK cascades", "transcription factor", ""Secondarymetabolites". In the following, the components of each category are described.

Pathogen recognition by the R gene: In microarray experiments, 22 genes involved in the defense response were up-regulated by OsWRKY67 and 19 genes were down-regulated. Table 2 is up-regulated in the defense-related OsWRKY67-D mutant R Lt; / RTI > These six defense related R genes, LOC_Os11g39310, LOC_Os11g39320, LOC_Os11g3800, LOC_Os11g39190, LOC_Os11g38480 and LOC_Osllg42040 are clustered on chromosome 11. Among these genes, the LOC-Osllg38480 gene is a Panicle blast 1 (Pb1) -like gene having the NB-LRR domain (Hayashi et al., 2010, Plant J 64: 498-510). These studies indicate that OsWRKY67 upregulates the R gene group at high amplitudes and induces stronger defense responses.

OsWRKY67-Summary of microarray data on R-genes involved in inductive defenses MSU_ID annotation Fold Change
(OsWRKY67-D1 / Dongjin) P.Value LOC_Os11g39310 NB-ARC domain containing protein, expressed 6.54 1.6E-05 LOC_Os11g39320 NZ-NBS-LRR class, putative, expressed 4.86 6.3E-05 LOC_Os11g38000 NB-ARC domain containing protein, expressed 4.58 1.4E-04 LOC_Os11g39190 NB-ARC domain containing protein, putative, expressed 4.60 8.6E-05 LOC_Os11g38480 NBS-LRR type disease resistance protein, putative, expressed 3.82 6.3E-04 LOC_Os11g42040 non-TIR-NBS-LRR type resistance protein, putative, expressed 2.28 4.7E-04

Signal transduction components: Within the signal transduction, subclinical receptor kinase was shown to be significantly upregulated (Table 3). As shown in the following Table 3, overexpression of receptor kinase suggests that signal perception is widely activated for rice blast infection. The calcium / calmodulin dependent protein kinase gene (Calcium / calmodulin dependent protein kinase gene. CDPKs) was also upregulated, suggesting that calcium signaling is well associated (Table 3).

List of genes involved in disease resistance stress response in the signaling category Gene model ^a Putative function Fold change ^b LOC_Os08g39550.1 receptor kinases.leucine rich repeat XI 1.25 LOC_Os11g36160.1 receptor kinases.leucine rich repeat XI 2.28 LOC_Os02g06270.1 receptor kinases.leucine rich repeat XI 1.06 LOC_Os11g35980.1 receptor kinases.leucine rich repeat XI 1.13 LOC_Os08g29980.1 receptor kinases. DUF 26 1.04 LOC_Os05g31600.1 receptor kinases. DUF 26 1.10 LOC_Os07g43560.1 receptor kinases S-locus glycoprotein like 1.09 LOC_Os06g13320.1 receptor kinases S-locus glycoprotein like 1.22 LOC_Os07g43570.1 receptor kinases S-locus glycoprotein like 1.07 LOC_Os11g35220.1 receptor-like kinase.WAK117 1.58 LOC_Os02g58730.1 G-proteins 1.40 LOC_Os08g34240.1 calcium.calmodulin dependent protein kinase 2.04

^a Gene model; A gene model annotated by the rice genome annotation project at Michigan State University. ^b Fold change; Log2 ratio of OsWRKY67-D mutant leaf sample to wild-type leaf sample.

Hormonal Signaling: Plant hormones play an important role in a variety of plant responses to biological and abiotic stress as well as to various growth and developmental processes. In particular, WRKY proteins regulate plant hormone signaling. We have identified three factors associated with jasmonite ( LOC_Os02g10120 ) and ethylene ( LOC_Os08g30080 and LOC_Os11g33394 ) signaling (Table 4). It has been reported that as much as ethylene, jasmonate plays an important role in plant pathogen resistance.

List of genes showing disease-resistant stress response in the hormone signaling category Gene model ^a Putative function Fold change ^b LOC_Os02g10120.1 jasmonate.synthesis-degradation. LOX2 1.92 LOC_Os08g30080.1 ethylene.synthesis-degradation. 2-oxoglutarate-dependent dioxygenase 1.32 LOC_Os11g33394.1 ethylene.signal transduction. unknown protein 2.31

^a Gene model; A gene model annotated by the rice genome annotation project at Michigan State University. ^b Fold change; Log2 ratio of OsWRKY67-D mutant leaf sample to wild-type leaf sample.

Secondary Metabolism and Protein / Cell Wall Degradation: We identified 11 secondary metabolic-related elements, 8 protein degradation-related elements, and 1 cell wall degradation-related element (Table 5). It is well known that secondary metabolites in plants perform functions associated with their ecological role in defending against biological and abiotic stresses. Five types of secondary metabolites have been identified: flavonoid (4 elements), phenylpropanoid (2 elements), terpenoid (2 elements), carotenoid (1 element) ), And others (two elements). In addition, the inventors identified eight factors associated with protein degradation (Table 5). It is presumed that the function of proteolysis in disease resistance probably regulates the level of R protein. In support of this possibility, RPM1 was rapidly degraded after activation of RPM1-mediated signaling (Boyes et al., 1998, Proc. Natl. Acad. Sci. USA 95: 15849-5854). The function of ubiquitination in disease resistance has been able to control cellular processes such as modification of signal proteins and transcription, protein transport, membrane transport or protein kinase activity (Pickart, 2001, Mol. Cell 8 : 499- 504). Cell wall degradation has been regarded as a mechanism to protect plants from active parasites (Sun et al., 2011, Plant Physiol 155: 1976-1987). One element in the analysis of the present invention was associated with cell wall degradation (Table 5).

List of genes involved in disease resistance stress response in secondary metabolism and protein / cell wall degradation categories Functional category ^a Gene model ^b Putative function Fold change ^c secondary metabolism LOC_Os07g09190.1 isoprenoids.non-mevalonate pathway.DXS1 1.34 LOC_Os05g33840.1 isoprenoids.non-mevalonate pathway.DXS1 1.58 LOC_Os07g43370.1 isoprenoids.carotenoids.amine oxidase 1.46 LOC_Os02g36210.1 isoprenoids.terpenoids.ent-kaurene synthase 1.18 LOC_Os03g22620.1 isoprenoids.terpenoids.terpene synthase 1.43 LOC_Os10g02840.1 phenylpropanoids. O-methyltransferase 1.39 LOC_Os12g04080.1 phenylpropanoids.transferase 3.16 LOC_Os02g57480.1 flavonoids.anthocyanins.anthocyanin 5-aromatic acyltransferase 1.02 LOC_Os02g28340.1 flavonoids.anthocyanins.anthocyanin 5-aromatic acyltransferase 1.27 LOC_Os07g40974.1 flavonoids. dihydroflavonols.NAD dependent epimerase / dehydratase 3.51 LOC_Os07g40986.1 flavonoids. dihydroflavonols.NAD dependent epimerase / dehydratase 3.19 protein LOC_Os04g47360.1 degradation.OsPOP9 2.16 LPC_Os05g07710.1 degradation.autophagy 1.63 LOC_Os02g57410.1 가사 2.14 LOC_Os03g26930.1 degradation.serine protease.OsSCP13 1.35 LOC_Os06g12370.1 degradation.metalloprotease.OsFtsH6 1.91 LOC_Os07g25410.1 degradation.metalloproteasepeptidase 1.41 LOC_Os10g33620.1 degradation.ubiquitin.ubiquitin.UBQ14 1.46 LOC_Os11g34270.1 degradation.ubiquitin.ubiquitin protease.UBP18 1.55 LOC_Os11g19210.1 셀 벽 부분 1.29

^a Functional category; The best level of ranking in Mapman analysis. ^b Gene model; A gene model annotated by the rice genome annotation project at Michigan State University. ^c Fold change; Log2 ratio of OsWRKY67-D mutant leaf sample to wild-type leaf sample.

Example 8. OsWRKY67 Identification of other WRKY transcription factors in mutation

The inventors have confirmed that the expression of the five WRKY genes ( OsWRKY28 , OsWRKY45 , OsWKRY62 , OsWRKY76 and OsWRKY125 ) is reduced in OsWRKY67-D mutants (Table 6). OsWRKY28 has been shown to play a role in nigryptic regulation in rice blast resistance (Delteil et al., 2012, Mol Plant Pathol 13: 72-82). Overexpression of OsWRKY62 reduces Xa21 -mediated resistance (Peng et al., 2006, Mol. Plant 1: 446-458). Overexpression of OsWRKY76 in rice decreased resistance to rice blight blight (Seo et al., 2011, PLoS Genet 7 (4): e1002020. Doi: 10.1371 / journal.pgen.1002020). The role of OsWRKY45 in defense responses to pathogens has already been discussed. OsWRKY125 contains the NB-ARC domain, which is important for recognition of pathogen infiltration and has a zinc finger motif, which functions in the transcriptional regulation of the defense gene. These results suggest that WRKYs Suggesting that it will play a key role in the rice defense response against the blast fungus.

Summary of microarray data of OsWRKY67 -induced WRKY gene identified in the present invention MSU_ID Annotation Fold Change (OsWRKY67-D / Dongjin) P.Value LOC_Os06g44010 OsWRKY28 -2.88 0.026 LOC_Os03g21710 OsWRKY45 -3.16 0.012 LOC_Os09g25060 OsWRKY76 -3.23 0.010 LOC_Os09g25070 OsWRKY62 -3.44 0.003 LOC_Os11g45750 OsWRKY125 -5.85 0.000

Example 9. RT-PCR WRKY67 In the mutation  OsWIR1  Overexpression of genes

From these microarray experiments, it was shown that the expression of the six R genes in the NB-LRR form was significantly increased in the OsWRKY67 activating mutant than in the wild-type dengue (Table 2), and the specific expression pattern of the corresponding R gene (Fig. 11). As seen in FIG. 11, LOC_Os11g39310, LOC_Os11g39190, LOC_Os11g38480, was significantly increased the basic expression of LOC_Os11g42040, LOC_Os11g39320 level could not be induced, while that slightly increases only OsWRKY67 D-mutant before pathogen inoculation, the wild-type. No difference in expression of LOC_Os11g38000 gene was observed between the wild type and the OsWRKY67-D mutant. These results indicate that the OsWRKY-67 activating mutant continuously has an effect on the expression levels of the NB-ARC and NB-LRR genes.

Of the R genes, OsWIR1 gene (LOC_Os11g38480) was selected and functionally analyzed. A 948 bp cDNA clone deduced by the TIGR rice genome Annotation database (http://rice.plantbiology.msu.edu/cgi-bin/sequence_display.cgi?orf=LOC_Os11g38480.1) was cloned into a forward primer (5'-GGATCCATGTTACTGCTCAAGTAT- 3 '(SEQ ID NO: 58)) and a reverse primer (5'-TCTAGAATGGTTCATTACATTTAA-3' (SEQ ID NO: 59)). From sequenced analysis, OsWIR1 Lt; RTI ID = 0.0 > NB-LRR < / RTI > Pb1 is a gene coding for the CC-NB-LRR protein, which is resistant to a broad spectrum of rice blast fungus through interaction with OsWRKY45 in intracellular nuclei (Inoue et al., 2013, Proc. Natl. Acad. 113 (23): 9577-9582). These results suggest that increased expression of target NB-LRR genes selected through microarray is closely related to disease resistance.

Example 10. OsWIR1  Isolation of activated mutants

In the rice T-DNA mutant population, an increased mutation of OsWRKY67 -mediated expression of the OsBIR1 gene, the target NB-LRR gene, was isolated. The isolated allele, OsWIR1 - D (D means dominant ) is OsWIR1 The insertion of the T-DNA into the downstream of about 0.9 kb from the translation termination codon of the gene is included (Fig. 12A). OsWIR1 Gene-specific primer (SEQ ID NO: 41 and 42; see Table 1) and T-DNA-specific primers (SEQ ID NO: 57; see Table 1) was isolated the homozygous St. mutations in their offspring using the acquisition of OsWIR1 transcripts Was confirmed by RT-PCR analysis using SEQ ID NOS: 51 and 52 (FIG. 12B).

Example 11. OsWIR1  Analysis of activated mutant plants

Inoculation experiments were carried out with two representative strains (PO6-6 and KI-215) for the isolating strain OsWRKY67-mediated NB-LRR gene mutant isolates of wild-type Dongjin pine. As a result, it was found that the OsWIR1- D activation mutant line exhibited markedly increased disease resistance against the two strains, while the wild-type plants exhibited the susceptible phenotype (Fig. 13). These results indicate that the OsWRKY67 mediated NB-LRR immunosensor OsWIR1 gene shows increased resistance to broad- spectrum rice blast isolates.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Method for increasing plant disease resistance using          OsWRKY67-inducible resistance gene1 from Oryza sativa and the          plant thereof <130> PN14056 <160> 59 <170> Kopatentin 2.0 <210> 1 <211> 948 <212> DNA <213> Oryza sativa <400> 1 atgttactgc tcaagtatct gagcctaaag aaaacagaaa ttacccaact gcccagtgaa 60 atcaactgcc tccgtgagct agaggtattg gatatccgag aaactaaggt gcctgcaaat 120 gcaacggtta atgttctgct cttgaagcta aagcgtctac ttgctggtca cattgattca 180 agtccaagaa attctggcac tagcgttcag attcctcaca ggatagacaa gatggtaaac 240 atagaggtac tatctaatgt caaggcccaa cgccgtgatg atttggaaga tactggaaag 300 ctatggcagc taaggaagct aggtgtggtt gttgatgata agagaggtca ccttgggaat 360 ttgcttaaag caatcagcaa cctacatgag tgcatccgtt ctctgacaat cactatttcc 420 acaaccacac acaaggatac tccttcaaac ccagagttac cagatcatat tggctctgac 480 cttccccatc ccaagaaact tgagagtcta agcatcagtg gagccaggca tctttttcca 540 ttgttgatca aaagtgataa taacaagctt gccaaggtaa ctctaagtag cacaccactg 600 aaccaagatg atctggaggt cctcgccaag ctacccaagt tacagtgtgt taggctccaa 660 cacatttcat gcatagtgag tgagctcatc ttcaaggaag aaaatttcaa atgtctcaag 720 tacctactta ttgagggctt taacttgact aatatcactt ttgaggatgg atcagcctgt 780 gagctcgaga aaatggtttt atcttccacc agcatagagt ctgtctctgg agttgatgtg 840 cttccgaaat tcaaagagct tgagttgaac aacagccatg tcccgaatga gttgaaagaa 900 gccgttgaaa acaataaaag gataattctt aaatgtaatg aaccatga 948 <210> 2 <211> 315 <212> PRT <213> Oryza sativa <400> 2 Met Leu Leu Leu Lys Tyr Leu Ser Leu Lys Lys Thr Glu Ile Thr Gln   1 5 10 15 Leu Pro Ser Glu Ile Asn Cys Leu Arg Glu Leu Glu Val Leu Asp Ile              20 25 30 Arg Glu Thr Lys Val Ala Asn Ala Thr Val Asn Leu Leu Leu          35 40 45 Lys Leu Lys Arg Leu Leu Ala Gly His Ile Asp Ser Ser Pro Arg Asn      50 55 60 Ser Gly Thr Ser Val Gln Ile Pro His Arg Ile Asp Lys Met Val Asn  65 70 75 80 Ile Glu Val Leu Ser Asn Val Lys Ala Gln Arg Arg Asp Asp Leu Glu                  85 90 95 Asp Thr Gly Lys Leu Trp Gln Leu Arg Lys Leu Gly Val Val Val Asp             100 105 110 Asp Lys Arg Gly His Leu Gly Asn Leu Leu Lys Ala Ile Ser Asn Leu         115 120 125 His Glu Cys Ile Arg Ser Leu Thr Ile Thr Ile Ser Thr Thr Thr His     130 135 140 Lys Asp Thr Pro Ser Asn Pro Glu Leu Pro Asp His Ile Gly Ser Asp 145 150 155 160 Leu Pro His Pro Lys Lys Leu Glu Ser Leu Ser Ile Ser Gly Ala Arg                 165 170 175 His Leu Phe Pro Leu Leu Ile Lys Ser Asp Asn Asn Lys Leu Ala Lys             180 185 190 Val Thr Leu Ser Ser Thr Pro Leu Asn Gln Asp Asp Leu Glu Val Leu         195 200 205 Ala Lys Leu Pro Lys Leu Gln Cys Val Arg Leu Gln His Ile Ser Cys     210 215 220 Ile Val Ser Glu Leu Ile Phe Lys Glu Glu Asn Phe Lys Cys Leu Lys 225 230 235 240 Tyr Leu Leu Ile Glu Gly Phe Asn Leu Thr Asn Ile Thr Phe Glu Asp                 245 250 255 Gly Ser Ala Cys Glu Leu Glu Lys Met Val Leu Ser Ser Thr Ser Ile             260 265 270 Glu Ser Val Ser Gly Val Asp Val Leu Pro Lys Phe Lys Glu Leu Glu         275 280 285 Leu Asn Asn Ser Val Val Asn Glu Leu Lys Glu Ala Val Glu Asn     290 295 300 Asn Lys Arg Ile Leu Lys Cys Asn Glu Pro 305 310 315 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 caccatgagg tacgagagcg aggagaa 27 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gaagagcagc gagccgcctg ccgaata 27 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ctcatagcat ttgaccttca cttcctcta 29 <210> 6 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 tctttttgtg tttcttgctc tagtccttg 29 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaatttccct acatcggcta agagtacaa 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 tgctatcaaa ttatccctca agaactgaa 29 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 cttcagcaac tcctactcct act 23 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tctcgtacct catcatagtg ttt 23 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ttatcctgct gcttgctggt 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 ggtcgtacca ctgcttctcc 20 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gattaactat ggaggtatcc aagc 24 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 acgtacgccc gtgtgtataa ataa 24 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 caaactacct cattctccat cag 23 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 tccagtatat gatcatgcaa agag 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 accatctaca ccatgaagct taac 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 gtattcctct tcatcttagg cgta 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 ggcaccatcc acatcatgaa gctt 24 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 cacgccacag taacatgacc acaa 24 <210> 21 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 tcagttggat ccccagcaa 19 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 tcccaagtaa tccacgcaaa c 21 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 gccagctccc ctacgacttc 20 <210> 24 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 cgtgtgcggt gtaggttgtt 20 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 tatggtgcta tccgcttcga t 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 cgagaaccga gctctcttca a 21 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 ccggcgaact gcgtgtac 18 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 28 ttcctgatct gcgacttgtc a 21 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 29 gtcatgaaca gcatgatgaa 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 30 cattgagcag cttggtgatg 20 <210> 31 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 31 cagctgtgga gaacggca 18 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 32 gtgtacattg aagaatcctt 20 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 33 tccaagttga gctgctcag 19 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 34 gtccaccttc ttgccatcga 20 <210> 35 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 35 gtcatgaaca gcatgatga 19 <210> 36 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 36 ctggagcaga gtgttgatg 19 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 37 tgaatggcac cgacacgtac 20 <210> 38 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 38 gttgagcagc ttggcgatg 19 <210> 39 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 39 gtcttcgaca gcaccatga 19 <210> 40 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 40 tggcctcgaa gagcacgatc 20 <210> 41 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 41 tgattgttca agccggagca agtccttag 29 <210> 42 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 42 acagccattg atgcaaggta attgccact 29 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 43 ggcacatgga taagacatct tccag 25 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 44 agctccagca gcaccaacaa taag 24 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 15 <400> 45 agaggatgaa gttgtcgcat gtcc 24 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 46 ctctccactg atgcaggcaa gttt 24 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 47 tttattctca caagttcggc agca 24 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 48 cggttatcaa cacagcacct ctga 24 <210> 49 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 49 aaggctggga gaatttgaag gatg 24 <210> 50 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 50 ctggcatgtg ctttatttgt gtgc 24 <210> 51 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 51 aacgccgtga tgatttggaa gata 24 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 52 ctcaagtttc ttgggatggg gaag 24 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 53 aagtccttac cggcatcact gaca 24 <210> 54 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 54 ctgaggtcca aagtttgcag gttg 24 <210> 55 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 55 ggaactggta tggtcaaggc 20 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 56 agtctcatgg atacccgcag 20 <210> 57 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 57 atccagactg aatgcccaca gg 22 <210> 58 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 58 ggatccatgt tactgctcaa gtat 24 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 59 tctagaatgg ttcattacat ttaa 24

Claims (13)

Rice ( Oryza sativa A plant cell is transformed with a recombinant vector containing a gene encoding OsWIR1 protein A method of increasing disease resistance of a plant compared to a non-transformant comprising the step of overexpressing the OsWIR1 gene. 2. The method according to claim 1, wherein the OsWIR1 protein is composed of the amino acid sequence of SEQ ID NO: 2. The method according to claim 1, wherein the disease resistance is resistance to blast disease, wherein the disease resistance is increased compared to the non-transformant. Transforming a plant cell with a recombinant vector comprising a gene encoding a rice-derived OsWIR1 protein; And
And regenerating the plant from the transgenic plant cell. &Lt; RTI ID = 0.0 &gt; 8. &lt; / RTI &gt; 5. The method according to claim 4, wherein the rice-derived OsWIR1 protein is composed of the amino acid sequence of SEQ ID NO: 2. [Claim 5] The method according to claim 4, wherein the disease resistance is resistance to blast disease, wherein the disease resistance is increased compared to the non-transformant. A transgenic plant having increased disease resistance compared to the non-transformant produced by the method of claim 4. A seed of a plant according to claim 7. 1. A composition for increasing disease resistance of a plant comprising as an active ingredient a gene encoding the OsWIR1 protein consisting of the amino acid sequence of SEQ ID NO: 2. A mutant plant having increased disease resistance due to increased expression of a gene encoding OsWIR1 protein consisting of the amino acid sequence of SEQ ID NO: 2. 11. The mutant plant according to claim 10, wherein the expression of the OsWIR1 protein-encoding gene is increased by a T-DNA activation tagging method. 11. The mutant plant according to claim 10, wherein said disease resistance is resistance to blast disease. 10. A plant seed according to claim 10.

Images