KR20150138233A - Composition and methods for inducing apoptosis - Google Patents

Abstract

In one aspect, the invention relates to compositions, methods, and kits for inducing apoptosis. This summary is intended as a scanning tool for purposes of searching in a particular field and is not intended to limit the invention.

Description

Technical Field [0001] The present invention relates to a composition for inducing apoptosis and a method for inducing apoptosis,

Cross-reference of related application

This application claims the benefit of U.S. Provisional Application No. 61 / 776,999, filed March 12, 2013.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

The present invention was derived from GM95606 Government Assistance from the National Institutes of Health (NIH). The government has certain rights to the invention.

Reference to the Sequence Listing

As a text file with the file name "21101_0283P1_Sequence_Listing.txt", the sequence list submitted on March 11, 2014 was created as 11 characters in March 2014, has a size of 13,576 bytes, and has 37 C.F.R. It is included here as a reference under § 1.52 (e) (5).

BACKGROUND OF THE INVENTION

Drug-free macromolecular therapeutic platforms have great potential in the treatment of several diseases and disorders. For example, as disclosed herein, cross linking of CD20 results in the induction of apoptosis and is associated with B cell malignancies, inflammatory disorders, and B cell related disorders May be used in the treatment of certain diseases and disorders, including auto-immune diseases with B cell involvement.

Non-Hodgkin's lymphoma (NHL) is a common cancer worldwide with a high mortality rate. In 2012, there were only 70,130 new NHL cases in the United States, and 18,940 NHL deaths. Approximately 85% of NHLs are malignant tumors derived from B-cells and the remaining malignant tumors are of T cell origin. The B-cell NHLs are composed of Burkitt's, diffuse large B-cell, follicular, immunoblastic large cell, precursor B-lymphoblastic ), And mantle cell lymphomas. These cancers are usually classified as either lazy or aggressive, with more than 95% of B-cell lymphomas having cell surface antigen CD20. Anti-CD20 monoclonal antibodies (mAbs), mainly rituximab, are commonly used as immunotherapeutic agents for patients with NHL. Immunotherapy, however, has a low overall response rate (<50% in recurrent / refractory NHL) and rare but potentially fatal side effects (eg, progressive multifocal leukoencephalopathy). Many researchers report clinical non-reactivity and side effects of anti-CD20 monoclonal antibodies as a result of Fc-induced cellular events.

Compositions and methods effective in treating B cell malignancies, inflammatory disorders, and B cell related autoimmune diseases are still lacking. These and other needs are met by the present invention.

A brief summary of the invention

Disclosed herein are complexes containing targeting moieties and oligonucleotides.

Disclosed herein are complexes containing a targeting moiety and an oligonucleotide wherein the targeting moiety is an Fab 'segment, wherein the Fab' segment is specific for a CD20 receptor, wherein the oligonucleotide is selected from the group consisting of morpholy Morpholino wherein the Fab 'segment is conjugated by a morpholino and thioether linkage.

Disclosed herein are complexes containing a copolymer carrier and one or more oligonucleotides.

Disclosed herein are complexes comprising a copolymer carrier and one or more oligonucleotides, wherein the copolymer carrier comprises a backbone and one or more side chains, wherein the copolymer carrier is N-methacryloyl N- (2-hydroxypropyl) methylacrylamide copolymerized with N-methacryloylglycylglycine-thiazolidine-2-thione monomers copolymerized with glycylglycine-thiazolidine- Wherein the one or more side chains can be conjugated with one or more oligonucleotides, wherein the one or more oligonucleotides is morpholino.

Disclosed herein is a kit comprising a first complex containing a targeting moiety and an oligonucleotide, and a second complex containing a copolymer carrier and one or more oligonucleotides.

Disclosed herein is a first complex comprising a targeting moiety and an oligonucleotide, a second complex containing a copolymer carrier and one or more oligonucleotides, and instructions for administering a first complex and a second complex Lt; / RTI &gt;

Disclosed herein are methods of inducing apoptosis, the method comprising contacting a population of cells with a first complex containing a targeting moiety and an oligonucleotide; Contacting a population of cells with a second complex containing a copolymer carrier and one or more oligonucleotides; And inducing apoptosis of cells by contact of the first complex and the second complex of the cells.

Disclosed herein are methods of inducing apoptosis, the method comprising contacting a population of cells with a first complex containing a targeting moiety and an oligonucleotide, and a second complex containing a copolymer carrier and one or more oligonucleotides, Is contacted with a composition containing the complex to induce apoptosis of the cells by contact with the composition of the cells.

Disclosed herein are methods of treating a subject in need of treatment comprising administering to the subject a first composition comprising a first complex containing a targeting moiety and an oligonucleotide; A method of inducing apoptosis of a target cell population of a subject by administration of a first composition and a second composition by administering to the subject a second composition containing a second complex containing a copolymer carrier and one or more oligonucleotides to be.

Disclosed herein are processes for synthesizing a complex containing a targeting moiety and an oligonucleotide, the process comprising obtaining a targeting moiety, modifying the oligonucleotide, and conjugating the targeting moiety to the oligonucleotide.

Disclosed herein are processes for synthesizing a complex comprising a copolymer carrier and one or more oligonucleotides, the process comprising the steps of obtaining a copolymer carrier, modifying one or more oligonucleotides, Lt; RTI ID = 0.0 &gt; oligonucleotides. &Lt; / RTI &gt;

Disclosed herein are processes for synthesizing a complex comprising a targeting moiety and an oligonucleotide and a complex comprising a copolymer carrier and one or more oligonucleotides, the process comprising the step of contacting a first complex comprising a targeting moiety and an oligonucleotide, With a second complex containing a copolymer carrier and one or more oligonucleotides.

A brief description of the various aspects of the drawing
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several aspects and serve to explain the principles of the invention, together with the contents of the invention.
Figure 1 shows a schematic overview of an exemplary design of a drug-free macromolecule treatment platform for the reduction of B-cells using CD20-cross linked mediated cell death induced by oligonucleotide hybridization.
Figure 2 shows the chemical structure and nucleotide sequence of an exemplary pair of complementary morpholino-MORF1-m (SEQ ID NO: 25) and MORF2-m (SEQ ID NO: 26).
Figures 3A-B show the synthesis of a Fab'-MORF1 complex and the synthesis of multiple copies of MORF2 and a copolymer-MORF2 complex.
Figure 4 shows in vitro hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex characterized by DLS (dynamic light scattering).
Figure 5 shows the biological recognition of the Fab'-MORF1 complex and the copolymer-MORF2 complex at the Raji B-cell surface analyzed by confocal fluorescence microscopy.
Figures 6A-6C show the induction of apoptosis of Raji B-cells using the Fab'-MORF1 complex and the copolymer-MORF2 complex analyzed by three methods.
Figure 7 shows the concentration-dependent apoptosis induction of Raji B-cells analyzed by Annexin V / propidium iodide (PI) binding assay.
FIG 8A- 8B are large (Raji) B- cells (CD20 ⁺⁾ and DG-75 cells (CD20 ^-) it shows the annexin V / propidium iodide binding assay study on the control.
Figure 9 shows the demonstration of self-combination hybridization nanocomposite induction of apoptosis.
FIGS. 10A-10D show synthesis and experimental results of Fab'-MORF1 complex and P-MORF2 complex.
Figures 11A-11C show in vitro hybridization of Fab'-MORF1 and P-MORF2 complexes.
Figures 12A-12C show the biological recognition on the cell surface of Fab'-MORF1 complex and P-MORF2 complex.
Figures 13A-13C show cell death in Raji B-cells using the disclosed complexes and / or compositions.
Figure 14 shows the therapeutic effect of the disclosed complexes and / or compositions on lymphoma in SCID mice.
15A-15E show removal of Raji cells using the disclosed complexes and / or compositions in SCID mice.
Figures 16A-16C show histological studies of mice administered with PBS, and Fab'-MORF1 and P-MORF2.
Figures 17A-17E show the features of the Fab'-MORF1 complex.
Figures 18A-18E illustrate the features of the P-MORF2 complex.
Figure 19 shows the hypochromic effect of free hybridization of unconjugated MORF1 and MORF2.
Figure 20 shows the hydrodynamic effective diameters of Fab'-MORF1 and P-MORF2 and the precursors Fab'-SH and P-TT.
Figures 21A-21D show free analysis of hybridization of unconjugated MORFs, conjugates and mixtures thereof with a CD spectrometer.
22A-22B show the results of analysis of the melting point (Tm) of the Fab'-MORF1 / P-MORF2 hybridization with CD spectroscopy.
Figures 23A-23C show the results of freely analyzing the melting point (Tm) of unconjugated MORF1 / MORF2 hybridization with a CD spectrometer.
24A-24B show the results of a control study of in vitro cell death in Raji cells and DG75 cells.
25A-25B show the cell death of Raji B-cells analyzed at different assays and at different incubation times.
Figures 26A-26C show T ₁ -weighted sagittal MRI after injection of Raji B-cells and contrast medium in mice exposed to different doses.
Figures 27A-27F show flow cytometric analysis of residual Raji B-cells in different organs / tissues of mice with differently dosed tumors.
Figure 28 shows the body weight of mice exposed to different doses of injected Raji B-cells.
Figure 29 shows the blood activity-time profile of ¹²⁵ I-labeled Fab'-MORF conjugates in SCID mice.
Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. It is to be understood that both the foregoing general description and the following detailed description are exemplary and are not restrictive of the claimed invention.

DETAILED DESCRIPTION OF THE INVENTION

The invention may be more readily understood by reference to the following detailed description of the invention and the embodiments contained therein.

Before the present compounds, compositions, articles, systems, devices, and / or methods are disclosed and described, they may, of course, be varied and are not limited to any particular reagent unless specified otherwise, It should be understood as not. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the exemplary methods and materials are described.

All publications mentioned herein are incorporated herein by reference to disclose and describe methods and / or materials relating to the cited publications. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such publication by virtue of prior invention.

A. Definitions

As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

 Ranges may be expressed herein as from "about" one particular value, and / or "about" to another particular value. Where such ranges are expressed, additional aspects include from one particular value and / or to another specific value. Similarly, where a value is expressed as an approximation, it will be understood that by use of the preceding "about" certain values form additional aspects. It will be further understood that the endpoints of each range are significant both in relation to the different endpoints and independently of the other endpoints. There are a number of values disclosed herein, and it is also understood that each value is also disclosed herein as a "about" specific value in addition to its value itself. For example, if the value "10" is initiated, then "about 10" It is also understood that each unit between two specific units is also disclosed. For example, if 10 and 15 are initiated, then 11, 12, 13, and 14 are also disclosed.

Reference in the specification and the claims of the specification and claims of weight parts of certain constituents or constituents in compositions refers to the weight relationship between constituents or constituents and any other constituents or constituents in articles or compositions expressed in terms of parts by weight . Thus, in the compounds containing 2 parts by weight of constituent X and 5 parts by weight of constituent Y, X and Y are present in a weight ratio of 2: 5 and whether or not further constituents are contained in said compound The same ratio exists.

As used herein, the terms "arbitrary" or "optionally" means that the subsequently described event or circumstance may or may not occur, that is, when such event or circumstance occurs and does not occur . For example, in one embodiment, a complex containing a targeting moiety and an oligonucleotide may optionally contain a detectable label. The methods disclosed in one embodiment may include repeated administration of the optionally disclosed compositions and / or complex.

As used herein, the term "analog" means a compound having a structure derived from the structure of a parent compound (e. G., A compound described herein), the structure of which is sufficiently similar to that disclosed herein, It will be appreciated by those skilled in the art that the compounds of the present invention will exhibit the same or similar activity and utility as the compounds claimed herein, or that they may induce the same or similar activity and utility as the precursors, &Lt; / RTI &gt;

As used herein, "homolog" or "homologue" means a polypeptide or nucleic acid that is homologous to a particular known sequence. Particularly disclosed herein is a polynucleotide comprising a nucleotide sequence having at least 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 49, 50, 51, 52, 53, 54, 55, 56, 57 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, , 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even more homologous . The skilled artisan will readily understand how to determine the homology of two or more proteins or two or more nucleic acids. For example, homology can be calculated after listing two or more sequences so that homology is at the highest level. Modifications, or derivatives of the genes and proteins disclosed herein are understood to be defined as mutants, modifications and derivatives in terms of homology with particular known sequences.

As used herein, "aptamers" means molecules that bind to a target molecule, preferably molecules that bind in a particular way. Typically, aptamers are small nucleic acids ranging in length from 15-50 bases folded into a structure defined by secondary and tertiary structures, such as a stem-loop or G-quartet. Aptamers can bind small molecules and macromolecules. Aptamers can bind very tightly to Kd's and target molecules of 10 ^-12 M or less. The aptamer can bind to the target molecule with a very high specificity. Aptamers are known in the art, and representative examples of methods and methods of making the platamers that bind to a variety of different target molecules can be found in the following non-limiting list of US patents: 5,476,766, 5,503,978, 5,631, 146, 5,731,424, 5,780,228, 5,792,613, 5,795,721, 5,846,713, 5,858,660, 5,861,254, 5,864,026, 5,869,641, 5,958,691, 6,001,988, 6,011,020, 6,013,443, 6,020,130, 6,028,186, 6,030,776, and 6,051,698.

As used herein, a "targeting moiety" may be specific to a recognition molecule on the surface of a cell or cell population, such as, for example, a B-cell. In one aspect of the compositions and methods disclosed herein, a targeting moiety, which but are not limited to, a monoclonal antibody, a polyclonal antibody, a full-length antibody, chimeric antibody, Fab ', Fab, F (ab) monoclonal antibody _2, F (ab ') ₂ , single domain antibody (DAB), Fv, short chain Fv (scFv), minibody, diabody, triabody, hybridization segment, phage display antibody, ribosome display antibody, peptide, peptide ligand, Factors, cytokines, saccharides or polysaccharides, and platamers.

As used herein, the term "subject" means an administration target, e.g., an animal. The term "subject" is intended to encompass animals such as rabbits, rabbits, rats, guinea pigs, rabbits, , Fruit flies, etc.). Thus, the subject of the methods disclosed herein may be a vertebrate animal such as a mammal, fish, algae, reptile, or amphibian. The subject of the methods disclosed herein may also be a human, a non-human primate, a horse, a pig, a rabbit, a dog, a sheep, a goat, a cat, a cat, a guinea pig or a rodent. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, are intended to be inclusive, either males or females. In one aspect, the subject may be a human patient.

A patient refers to a subject suffering from one or more diseases or disorders, such as B cell malignancies, inflammatory disorders, and B cell related autoimmune diseases. In one aspect, the diseases and disorders include, but are not limited to: non-Hodgkin's lymphoma, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, , Autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, vesicular dermatosis bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one embodiment, the subject may have one or more of the following conditions: non-Hodgkin's lymphoma, organ transplantation, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one embodiment, the patient has the JC virus. In one embodiment, the patient is a transplant recipient. In one aspect of the methods disclosed herein, the subject is diagnosed with one or more of the above mentioned diseases or disorders prior to the administration step. In one aspect of the methods disclosed herein, the patient is diagnosed as having a need to induce apoptosis of malignant cells, such as malignant B-cells.

As used herein, "non-Hodgkin's lymphoma" or "NHL" refers to cancer of the lymphatic system. As an exogenous condition, NHL can lead to hypertrophy of lymph nodes and generalized systems.

As used herein, the term "treatment" refers to the treatment, prevention, amelioration, stabilization, or prevention of a disease, pathological condition or disorder (such as B- Or &lt; / RTI &gt; the intention to prevent the disease. The term encompasses treatment that is specifically directed towards active therapy, i.e., amelioration of a disease, pathologic condition or disorder, and also includes causal treatment, i.e., elimination of the cause of the associated disease, pathological condition or disorder To-face treatment. The term also includes palliative treatment, that is, treatment designed to alleviate symptoms rather than to cure the disease, pathological condition or disorder; Prophylactic treatment, i.e., treatment directed to minimize, partially or completely inhibit the development of the associated disease, pathological condition or disorder; And supportive treatment, that is, treatment that is used to supplement another specific therapy directed at improving the associated disease, pathological condition or disorder; And treatment that is used to supplement another specific therapy directed at supportive treatment, i. E., Improvement of the associated disease, pathological condition or disorder. In various embodiments, the term encompasses any treatment of a subject, including a mammal (e.g., a human), and includes: (i) a subject that is susceptible to the disease but is not yet diagnosed as having the disease Preventing the disease from happening; (ii) inhibiting the disease, i. e., inhibiting the development of the disease; Or (iii) relieving the disease, i. E., Causing regression of the disease.

As used herein, the term "preventing" or "preventing" means interfering with, preventing, eliminating, preventing, stopping or delaying, . Decrease, inhibit, or prevent the use of any of the other two words as used herein, unless explicitly stated otherwise, it is also understood that the use of the other two words is also clearly disclosed. In one embodiment, it is intended to prevent malignant cell growth.

As used herein, the term "diagnosed" is applied to a physical test by a skilled person, for example a physician, and has a condition that can be diagnosed or treated by a compound, composition, or method disclosed herein It means load. For example, the term "diagnosed with NHL" refers to a compound that is applied to physical testing by a skilled person, for example a physician, and which prevents or inhibits malignant cell growth and / or induces apoptosis of a cell population such as B cells Or a condition that can be diagnosed or treated by the composition. For example, "diagnosed with the need to induce apoptosis" is applied to a physical test by a skilled person, for example a physician, and it is believed that inducing apoptosis of a cell population is a malignant cell growth &Lt; RTI ID = 0.0 &gt; and / or &lt; / RTI &gt; other diseases. Diagnosis as discussed herein may be a reference to a disorder, such as the NHL, and other disorders described herein.

As used herein, "one or more oligonucleotides" may mean "one or more morpholino. &Quot; For example, the copolymer carrier disclosed in one embodiment may contain one or more grafted oligonucleotides, or may contain one or more grafted morpholino. In one embodiment, "one or more oligonucleotides" or "one or more morpholino" refers to one morpholino, or two morpholino, or three morpholino, or four morpholino, or five morpholino Or 6-morpholino, or 7-morpholino, or 8-morpholino, or 9-morpholino, or 10-morpholino. For example, in one embodiment, the disclosed copolymers may contain one morpholino. In one embodiment, the disclosed copolymers may contain 3 morpholino. In one embodiment, the disclosed copolymers may contain 10 morpholino. In one embodiment, the disclosed copolymers may contain 10 grafted morpholino. In one embodiment, the one or more morpholino may contain one or more MORF2 morpholino. For example, the disclosed copolymer-MORF2 complex may contain 1 grafted morpholino, or 3 grafted morpholino, or 10 grafted morpholino, or 10 or more grafted morpholino. For example, the disclosed copolymer-MORF2 complex may contain 1 grafted MORF2, or 3 grafted MORF2, or 10 grafted MORF2, or 10 or more grafted MORF2.

As used herein, the phrase "identified as requiring treatment for a disorder" or the like, refers to the selection of an object based on the need for treatment of the disorder. For example, a subject may be identified as having a need for treatment of a disorder (e.g., other disorders associated with malignant cell growth or disorders requiring NHL or cell population apoptosis) based on early diagnosis by a skilled practitioner And then applied to the treatment of the disorder. It is contemplated that, in one aspect, the confirmation may be performed by a person different from the person making the diagnosis. It is also contemplated that, in additional embodiments, administration may be performed by a person who will subsequently perform the diagnosis.

As used herein, the terms " administering "and" administering "refer to any method of providing a composition, complex, or pharmaceutical formulation as disclosed herein to a subject. Such methods are well known to those skilled in the art and include, but are not limited to, oral, transdermal, inhalation, nasal, topical, vaginal, ophthalmic, Sublingual administration, oral administration, and parenteral administration including injection administration, such as intravenous administration, intraarterial administration, intramuscular administration, and subcutaneous administration. Administration may be continuous or intermittent. In various aspects, the agent can be administered therapeutically; That is, to treat an existing disease or condition. In further various aspects, the agent can be administered prophylactically; I. E., For the prevention of a disease or condition. In one embodiment, the skilled artisan can determine the effective dose, effective schedule, or effective route of administration of a composition or complex disclosed herein to treat a subject or induce apoptosis. In one aspect, the skilled artisan is also capable of altering or altering aspects of the administration step in order to enhance the effectiveness of the complexes or compositions disclosed herein.

As used herein, "modifying one or more administration steps" may include altering or altering the administration of one or more of the compositions or complexes disclosed herein. In one aspect, administration of a complex containing a targeting moiety and an oligonucleotide may be varied, for example, by varying the route of administration, changing the dose of the composition, or changing the time of administration, Or a combination thereof. In one embodiment, administering a complex comprising a copolymer carrier and one or more oligonucleotides may be varied, for example, by varying the route of administration, varying the dose of the composition, or changing the time of administration, or administration A change in the number of times, or a combination thereof. In one aspect, altering one or more administration steps alters the administration of a complex containing a targeting moiety and an oligonucleotide, and administering a complex comprising a copolymer carrier and one or more oligonucleotides Lt; / RTI &gt;

The term "contacting ", as used herein, refers to the ability of a composition, compound or complex disclosed herein to directly (i.e., directly or indirectly) interact with the activity of an intended target (e.g., receptor, transcription factor, (E. G., By interaction with the target itself), or indirectly (i. E., By interaction with another molecule, cofactor, factor, or protein that is dependent on the activity of the target) Refers to combining a disclosed composition, compound, or complex with a target (e.g., a cell or cell population, receptor, antigen or other biological entity, etc.). In one embodiment, the compositions or complexes disclosed herein may be contacted with cells or cell populations, such as, for example, B-cells.

As used herein, the term "determining " means measuring or determining activity or event or quantity or amount or change in expression and / or activity level or prevalence and / or incidence can do. For example, determining may mean measuring or determining the amount or amount of inducing apoptosis. Determining may mean measuring or determining the amount or total amount of caspase activity or expression. The methods and techniques used to determine activity or event or quantity or amount or change in expression and / or activity level or prevalence and / or incidence as used herein are not intended to be limiting as to what quantification This may mean measuring or determining a measurable value. The art is familiar with methods of measuring activity or event or quantity or amount or change in expression and / or activity level or prevalence and / or incidence.

As used herein, the terms "effective amount" and "effective amount" refer to an amount sufficient to achieve the desired result or to have an effect on the unwanted condition. For example, a "therapeutically effective amount" is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms, but generally represents an insufficient amount to cause adverse side effects. For example, in one aspect, an effective amount of a composition or complex disclosed herein is an amount effective to induce apoptosis in a desired cell or population of cells. The specific therapeutically effective dosage level of any particular patient will depend upon the severity of the disorder and disorder to be treated; The specific composition used; Age, weight, general health, sex and diet of the patient; Time of administration; The route of administration; The rate of excretion of the particular compound employed; Duration of treatment; The particular compound employed, and the drugs used in combination or concurrently with similar factors well known in the medical arts. For example, it is within the skill of the art to disclose the dose of a compound at a level lower than is necessary to achieve the desired therapeutic effect and to gradually increase the dosage when the desired effect is achieved. If desired, an effective daily dose can be divided into multiple doses for administration purposes. As a result, a single dose composition may contain such an amount or submultiple amount thereof to cause a daily dose to be formed. The dosage may be adjusted by the individual physician for any reason for banning the use of the drug. The dosage can be variable and can be administered in one or more doses daily for a day or several days. In further various aspects, the agent is a "prophylactically effective amount "; I. E., An amount effective to prevent the disease or condition.

The term "pharmaceutically acceptable" describes substances that are not biologically or undesirable, i.e., substances that do not cause unacceptable levels of undesirable biological effects or that do not interact in a deleterious manner. The term "pharmaceutically acceptable carrier" as used herein means a sterile aqueous or non-aqueous solution, dispersion, suspension or emulsion, as well as a sterile injectable solution or dispersion reconstituted into a sterile injectable solution or dispersion just prior to use Powder. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols such as glycerol, propylene glycol, polyethylene glycol, etc., carboxymethylcellulose and suitable mixtures thereof, vegetable oils such as olive oil, Gt; organic &lt; / RTI &gt; esters such as ethyl oleate. These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of microbial action can be ensured by including various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid and the like. It may also be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form may result from including agents that delay absorption, such as aluminum monostearate and gelatin. Injectable depot forms are prepared by forming microencapsulated matrices of the drug in biodegradable polymers such as polylactide-polyglycolide, poly (orthoester) and poly (anhydride). Depending on the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions compatible with body tissues. The injectable formulations may be sterilized by, for example, filtration through a bacteria-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions that may be dissolved or dispersed in sterile water or other sterile injectable medium immediately prior to use. . &Lt; / RTI &gt; Suitable inert carriers may include sugars such as lactose.

i) Copolymer (COPOLYMERS)

Traditional copolymers have been used in numerous laboratories around the world and have also been used in several clinical trials. (See U.S. Patent 5,037,883, incorporated herein by reference in its entirety). For example, N- (2-hydroxypropyl) methacrylamide (HPMA) copolymers have: (1) biocompatibility and a well-established safety profile; (2) has favorable pharmacokinetics when compared to water-soluble and free, non-attached drugs; And (3) excellent chemistry flexibility (i.e., monomers containing different side chains can be easily synthesized and contained within the structure). However, the HPMA polymer is not degraded, and the molecular weight of the HPMA polymer must remain below the renal threshold to maintain biocompatibility. This limits the intravenous half life and accumulation of HPMA polymers in solid tumors through EPR (enhanced permeability and retention) effects.

To overcome this limitation, a backbone of degradable HPMA copolymer carrier has been developed. The copolymer carrier comprises an enzymatically degradable sequence (i.e., cathepsin B, matrix metalloproteinase, etc.), and an enzymatically degradable side chain (i. E., For drug release) to the backbone &Lt; / RTI &gt; (See, for example, U.S. Patent Application 13 / 583,270, incorporated herein by reference in its entirety). Upon reaching the lysozyme compartment of the cell, the drug is released and the polymer carrier is degraded into molecules below the renal threshold to be removed from the target incidentally. Thus, diblock or multi-block biodegradable copolymers with increased molecular weight can be produced. It can also further increase the blood circulation time of the copolymer-MORF2 complex disclosed herein and is useful for non-drug macromolecular therapeutic targeting, e.g., circulating cancer cells (i.e., malignant B-cells). U.S. Patent No. 4,062,831 discloses a range of water-soluble polymers, and U.S. Patent No. 5,037,883 discloses various peptide sequences, all of which are incorporated herein by reference.

ii) Morpolino ( MORPHOLINOS )

In the compositions and methods disclosed herein, biocompatible, synthetic oligonucleotide analogs with chemically modified backbones may be used. Below is a list of some of the analogs, which are compared with natural DNA.

Based on these properties, the compositions and methods disclosed herein are not compatible with neutral DNA or RNA. Rather, since the analogs must be biocompatible and non-degradable, the compositions and methods disclosed herein may employ phosphorodiamidate morpholino oligonucleotides (also known as morpholino or MORF). Morpholino has four nucleobases (A, T, G and C), which are chemically-modified, non-chargeable backbones, &Lt; / RTI &gt; The subunits bind by non-ionic phosphodiester bond to produce morpholino oligonucleotides. Morpholino also has strong binding affinity (i.e., Kd at low nM to pM levels), high sequence specificity, and a well-established safety profile. In addition, the immunogenicity of morpholino is highly sequence dependent, and thus can be solved. The synthesis, structure and binding properties of morpholino are described in detail in U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,521,063, and 5,506,337, each of which is incorporated herein by reference in its entirety.

The disclosed morpholino with longer length provides higher specificity and stronger binding affinity; However, such morpholino also has less water-solubility. In the art, 14 bp-15 bp morpholino is considered to be the minimum length required to maintain an ideal targeting effect. 25 bp morpholino can ensure strong binding affinity and excellent water-solubility (about 5-30 mM). For example, when using 25 bp morpholino in the compositions and methods disclosed herein, the effect of steric hindrance on the hybridization of MORF1 and MORF2 can be compared. Longer sequences can provide better "steric flexibility" in hybridization. Thus, in the compositions and methods disclosed herein, the morpholino may contain 10 bp to 40 bp. In one aspect, for example, morpholino has a length of 10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 bp.

The A / T / C / G content of the morpholino disclosed herein can be determined based on three factors: (1) G + C content (# or% of G and C), (2) G content , Or (3) C content (# or% of C).

With respect to the G + C content, the morpholino disclosed herein can contain G + C in an amount from about 35% to about 65%. The range can provide any coupling efficiency and specificity. With respect to the G content, the morpholino disclosed herein may contain G in a content of less than about 36%. These G content levels can provide excellent liquid solubility; However, repeating 4 or more G's should be avoided. With respect to the C content, the morpholino disclosed herein may contain C in a content of less than 7. This level of C content can make it possible to contrast the negative effects of increasing the kidney accumulation of morpholino. In addition, conjugation with one or more morpholino copolymers can better alter the pharmacokinetic profile of morpholino and reduce renal accumulation (conjugation of morpholino and Fab &apos; When compared to one case). Table 1 shows the degree of accumulation of morpholino according to the C content level. Morpholino with 25 C showed the highest percentage accumulation in kidneys of normal mice after 3 hours of injection. (Liu et al, 2004).

In the compositions and methods disclosed herein, the morpholino conjugated with the Fab 'segment may contain more A and less C, while one or more morpholino conjugated with a copolymer may contain more C and / Lt; RTI ID = 0.0 &gt; A &lt; / RTI &gt; Thus, in one embodiment, the 25 bp morpholino may contain 3 C, 6 G, 12 A, 4 T (G + C = 36%, G = 24%). The complementary 25 bp morpholino may contain 6 C, 3 G, 4 A, 12 T (G + C = 36%, G = 12%).

After determining the nucleobase composition of each morpholino, an online sequence "scrambler" can be used that is publicly accessible to assure minimal off-target binding to human mRNA. In addition, publicly accessible, online sequencing software may be used to ensure minimum self-complementarity. The minimum base pair required for self-dimerization and the minimum base pair required for hairpin are "2" and "2" (10 bp and 12 bp); "3" and "3" (for 15 bp, 18 bp, 20 bp, 23 bp, and 25 bp); "4" and "4 " (for 28 bp, 30 bp, 32 bp, and 35 bp); And "5" and "4" (38 bp and 40 bp). Table 2 lists examples of morpholino used in the disclosed compositions and methods.

In one embodiment, hybridization between the disclosed pair of morpholino can occur by base-pairing (i.e., specific hydrogen bonding pattern). Hybridization can be maintained by base-stacking (i.e., pi interaction). The hybridization between the disclosed pair of morpholino is more specific than the formation of the coiled-coil peptide.

In one embodiment, the morpholino used in the disclosed compositions and methods may be perfectly complementary (100%) or less than perfect complementarity. Thus, in one embodiment, the% complementarity of one or more of the morpholino and copolymer-MORF2 complexes of the Fab'-MORF1 complex is 80-85%, 85-90%, 90-95%, or 95- 100% complementarity. In one embodiment, the morpholino of the Fab'-MORF1 complex and one or more of the morpholino-MORF2 complexes are 93%, 94%, 95%, 96%, 97%, 98%, 99% % May be complementary. In one embodiment, the morpholino of the Fab'-MORF1 complex and one or more morpholino of the copolymer-MORF2 complex may be at least 93% complementary.

In one embodiment, the morpholino of the Fab'-MORF1 complex and one or more morpholino of the copolymer-MORF2 complex may have an equilibrium dissociation constant Kd of? 15 nM. In one embodiment, the morpholino of the Fab'-MORF1 complex and one or more morpholino of the copolymer-MORF2 complex may have a binding constant (Kd) of less than 10 ^-7 M. In one embodiment, the morpholino of the Fab'-MORF1 complex and one or more morpholino of the copolymer-MORF2 complex may have a binding constant (Kd) of less than 10 ^-9 M.

B. COMPOSITIONS

i) a complex comprising a targeting moiety and an oligonucleotide

Disclosed herein are complexes containing targeting moieties and oligonucleotides. In one aspect, the disclosed complex contains a detectable label. Detectable labels are known to those of skill in the art and include, but are not limited to: Rhodamine, FITC, Cy3, Cy3.5, Cy5, Texas Red, Alexa Fluor 488, Alexa Fluor 610, Alexa Fluor 647 and Alexa Fluor 750 do.

In one aspect of the disclosed complex, the targeting moiety may be specific for non-internalizing cell surfaces or slowly internalizing cell surface molecules. Examples of non-internalizing cell surface molecules or slowly internalizing cell surface molecules are known to those skilled in the art. In one embodiment, non-internalizing cell surface molecules or slowly internalizing cell surface molecules may be on a cell or cell population. In one embodiment, the cell or cell population may be a B-cell. In one embodiment, the B-cells may be normal B-cells. In one embodiment, the B-cell may be a malignant B-cell.

In one aspect of the disclosed complex, the non-internalizing cell surface molecule may be a receptor. In one embodiment, the cell surface molecule that is slowly internalizing may be a receptor. For example, non-internalizing cell surface molecules or slowly internalizing cell surface molecules include, but are not limited to: CD20 receptor, protein tyrosine phosphatase receptor type C (PTPRC), cell surface death receptor, prostate stem cell antigen ) Receptors, and receptors belonging to the tumor necrosis factor receptor (TNFR) superfamily. Tumor Necrosis Factor (TNFR) superfamily is a member of the TNF-like weak inducer (DR5), FAS receptor (CD95), tumor necrosis factor receptor superfamily member 18 (TNFRSF 18) of apoptosis: TWEAK or TNFSF12). In one embodiment, the receptor may be a CD20 receptor. In one embodiment, the receptor may be a protein tyrosine phosphatase receptor type C (PTPRC). In one embodiment, the receptor may be a cell surface death receptor. In one embodiment, the receptor may be death receptor 4 (DR4). In one embodiment, the receptor may be a prostate stem cell antigen (PSCA) receptor. In one embodiment, the solvent may be death receptor 5 (DR5). In one embodiment, the receptor may be a FAS receptor (CD95). In one embodiment, the receptor may be a tumor necrosis factor receptor superfamily member 18 (TNFRSF 18). In one embodiment, the receptor may be a TNF-like weak inducer of apoptosis (TWEAK or TNFSF12).

In one aspect of the disclosed complex, the targeting moiety can be a polysaccharide, a peptide ligand, an aptamer, an Fab 'segment or a short chain variable segment. In an embodiment, the targeting moiety may be a polysaccharide. In one embodiment, the targeting moiety may be a peptide ligand. In an embodiment, the targeting moiety may be an aptamer. In one embodiment, the targeting moiety may be a short chain variable segment. In an embodiment, the targeting moiety may be an Fab 'segment. In one embodiment, the Fab 'segment may be humanized. In one embodiment, the Fab 'segment may be derived from an anti-CD20 receptor antibody. Examples of anti-CD20 receptor antibodies include, but are not limited to: 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab, Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, ublituximab, and BLX-301. In one embodiment, the anti-CD20 receptor antibody may be 1F5.

Oligonucleotides are known in the art. In one aspect of the disclosed complex, the oligonucleotide may be biocompatible. In one embodiment, the oligonucleotide may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and may be charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one aspect of the disclosed complex, the oligonucleotide may be a peptide nucleic acid. In one embodiment, the oligonucleotide can be morpholino. In one embodiment, the disclosed morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one embodiment, the disclosed morpholino is not self-complementary. In one embodiment, the morpholino can be succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) have.

In one aspect of the disclosed complex, the morpholino comprises 10 bp to 40 bp. For example, morpholino has a length of 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp , 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, It may be 40 bp in length.

In one embodiment, the morpholino may be 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1). In one embodiment, the morpholino may be 5 'ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3' (SEQ ID NO: 2). In one embodiment, the morpholino may be GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3). In one embodiment, the morpholino may be 5 ' TATGATTCGTATTGTTCTTAGTAAATAAAGAGGGTTTC3 ' (SEQ ID NO: 4). In one embodiment, the morpholino may be 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5). In one embodiment, the morpholino may be 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3' (SEQ ID NO: 6). In one embodiment, the morpholino may be 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7). In one embodiment, the morpholino may be 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3' (SEQ ID NO: 8). In one embodiment, the morpholino may be 5 'CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 9). In one embodiment, the morpholino may be 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3' (SEQ ID NO: 10). In one embodiment, the morpholino may be 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11). In one embodiment, the morpholino may be 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3' (SEQ ID NO: 12). In one embodiment, the morpholino is 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13). In one embodiment, the morpholino may be a 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3' (SEQ ID NO: 14). In one embodiment, the morpholino may be 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15). In one embodiment, the morpholino may be 5 ' TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3 '(SEQ ID NO: 16). In one embodiment, the morpholino may be 5 ' GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3 ' (SEQ ID NO: 17). In one embodiment, the morpholino may be 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3' (SEQ ID NO: 18). In one embodiment, the morpholino may be 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19). In one embodiment, the morpholino may be 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3' (SEQ ID NO: 20). In one embodiment, the morpholino may be 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21). In one embodiment, the morpholino may be 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3' (SEQ ID NO: 22). In one embodiment, the morpholino may be 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23). In one embodiment, the morpholino may be 5 ' ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3 '(SEQ ID NO: 24). In one embodiment, the morpholino may be 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25). In one embodiment, the morpholino may be 5 ' TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26). In one embodiment, the morpholino may be 5 ' AGA TGA CGA TAA AGA CGC AAA GAT T 3 ' (SEQ ID NO: 27). In one embodiment, the morpholino may be 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3' (SEQ ID NO: 28). In one embodiment, the morpholino can be a 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29). In one embodiment, the morpholino may be 5 'ATA TAT CCC TGT TTA CTT GGT CC 3' (SEQ ID NO: 30). In one embodiment, the morpholino may be 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31). In one embodiment, the morpholino may be 5 'TCA CTC TCA TAT TGG TTT TCA GC 3' (SEQ ID NO: 32). In one embodiment, the morpholino may be 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33). In one embodiment, the morpholino may be 5 'TAT CTT GTC GGT ACT TCA TC 3' (SEQ ID NO: 34). In one embodiment, the morpholino may be 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35). In one embodiment, the morpholino may be 5 'ACT GTG TTA TTC ATC CTG TC 3' (SEQ ID NO: 36). In one embodiment, the morpholino may be 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37). In one embodiment, the morpholino may be 5 'ATA TAC TTC GTT TGC TGC 3' (SEQ ID NO: 38). In one embodiment, the morpholino may be 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39). In one embodiment, the morpholino may be 5 'TAC CTG TTC TGT TAT GAC 3' (SEQ ID NO: 40). In one embodiment, the morpholino may be 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41). In one embodiment, the morpholino may be 5 'ATC CTT CTG TCT TGA 3' (SEQ ID NO: 42). In one embodiment, the morpholino may be 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43). In one embodiment, the morpholino may be 5 'CTT CCT ATG TTG CTA 3' (SEQ ID NO: 44). In one embodiment, the morpholino may be 5 ' CAG AGA GCA TAT 3 ' (SEQ ID NO: 45). In one embodiment, the morpholino may be 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46). In one embodiment, the morpholino may be 5 ' CAA GAG GTA CAT 3 ' (SEQ ID NO: 47). In one embodiment, the morpholino may be 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48). In one embodiment, the morpholino may be 5 'AAG AGG TAC A 3' (SEQ ID NO: 49). In one embodiment, the morpholino may be 5 'TGT ACC TCT T 3' (SEQ ID NO: 50). In one embodiment, the morpholino may be 5 'AAG GAC AGT A 3' (SEQ ID NO: 51). In one embodiment, the morpholino may be 5 'TAC TGT CCT T 3' (SEQ ID NO: 52).

In one aspect of the disclosed complex, the morpholino can be 25 bp in length and can contain 3 cytidine, 6 guanosine, 12 adenosine, and 4 thymidine. For example, in one embodiment, the morpholino containing 3 cytidine, 6 guanosine, 12 adenosine, and 4 thymidine may be 5 'GAGTAAGCCAAGGAGAATCAATATA 3' (SEQ ID NO: 25). In one embodiment, the morpholino of the disclosed complex may have a GC content of about 35% to 65%. In one embodiment, the morpholino can have a G content of less than 36%. In an embodiment, the morpholino may have only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &

In one aspect of the disclosed complex, the targeting moiety can be conjugated with an oligonucleotide. Conjugation types and methods are well known in the art. In one embodiment, the targeting moiety of the disclosed complexes can be conjugated with oligonucleotides, for example, by covalent bonds. In one embodiment, the targeting moiety can be conjugated with an oligonucleotide via a thiol group. Thiol groups are known in the art. In one aspect of the disclosed complex, the targeting moiety is selected from the group consisting of a thioether bond, a thiol-maleimide bond, a thiol-vinylsulfone bond, a thiol-halogeno bond, a thiol-pentafluorophenyl ester bond, a thiol- Or conjugated with an oligonucleotide via a thiol-yne linkage.

Disclosed herein are complexes containing targeting moieties and oligonucleotides, wherein the targeting moiety is a Fab 'segment, wherein the Fab' segment is specific for a CD20 receptor, wherein the oligonucleotide is morpholino , Wherein the Fab 'segment is conjugated to morpholino via a thioether linkage.

ii) Copolymer carrier  And a complex containing one or more oligonucleotides

Disclosed herein are complexes comprising a copolymer carrier and one or more oligonucleotides. In one aspect, the disclosed complex contains a detectable label. Detectable labels are known in the art and include, but are not limited to: rhodamine, FITC, Cy3, Cy3.5, Cy5, Texas Red, Alexa Fluor 488, Alexa Fluor 610, Alexa Fluor 647, and Alexa Fluor 750 .

In one aspect of the disclosed complex, the copolymer carrier may be water-soluble. In one aspect of the disclosed copolymers, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, the backbone carrier may contain an enzymatically degradable sequence. In one embodiment, one or more of the side chains may contain an enzymatically degradable sequence. In one embodiment, one or more of the side chains may be terminated at the functional group. Functional groups are known in the art and include, but are not limited to: amine reactive activated esters, maleimides, azides, and alkynes. In one embodiment, the functional groups may allow one or more oligonucleotides to associate with one or more side chains of the disclosed copolymer complex. In one embodiment, one or more side chains may be conjugated with one or more oligonucleotides through the disclosed functional groups. In one embodiment, the backbone is N-methacryloylglycylglycyl-thiazolidine-2-thione (MA-GG-TT) monomers copolymerized with N- (2-hydroxypropyl) methylacrylamide (HPMA). &Lt; / RTI &gt; In one embodiment, the backbone is N- (2-hydroxypropyl) -cyclohexane copolymerized with N-methacryloylglycylglycine-p-nitrophenyl ester (MA-GG- (2-hydroxypropyl) methylacrylamide (HPMA).

Oligonucleotides are known in the art. In one aspect of the disclosed complex, the oligonucleotide may be biocompatible. In one embodiment, the oligonucleotide may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one aspect of the disclosed complex, the one or more oligonucleotides may be a peptide nucleic acid. In one embodiment, one or more oligonucleotides can be morpholino. In one embodiment, the disclosed one or more morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one aspect, the disclosed one or more morpholino is not self-complementary. In one embodiment, one or more morpholino can be amine-derivatized. The derivatization typically involves the addition of a nucleophile as a functional group and is known in the art to include amine derivatization and thiol derivatization. In one embodiment, the disclosed one or more morpholino can be produced through the use of an amine-pentafluorophenyl ester, an amine-succinimidoxy ester, or an amine-carboxyl. In one embodiment, one or more morpholino may be thiol-derivatized. In one embodiment, the disclosed one or more morpholino may be produced through the use of a thiol-maleimide.

In one embodiment, the disclosed copolymers may include one or more grafted morpholino. In one embodiment, one or more morpholino is 1 morpholino, or 2 morpholino, or 3 morpholino, or 4 morpholino, or 5 morpholino, or 6 morpholino, or 7 morpholino, Or morpholino, or 8 morpholino, or 9 morpholino, or 10 morpholino. For example, in one embodiment, the disclosed copolymers may include one morpholino. In one embodiment, the disclosed copolymers can include 3 morpholino. In one embodiment, the disclosed copolymers can include 10 morpholino. In one embodiment, the disclosed copolymers may include 10 or more grafted morpholino. In one embodiment, the one or more morpholino may comprise one or more grafted MORF2 morpholino. For example, the disclosed copolymer-MORF2 complex may comprise one grafted morpholino. In one aspect, the disclosed copolymer-MORF2 complex may comprise three grafted morpholino. In one embodiment, the disclosed copolymer-MORF2 complex may comprise 10 grafted morpholino. In one embodiment, the disclosed copolymer-MORF2 complex may comprise 10 or more grafted morpholino. In one embodiment, one or more oligonucleotides may comprise the same oligonucleotide or may comprise other oligonucleotides. In an embodiment, one or more morpholino may comprise the same morpholino or may comprise other morpholino. In one embodiment, one or more morpholino or grafted morpholino may have the same sequence. In one embodiment, one or more morpholino may have other sequences. For example, in one embodiment, multiple morpholinos may be present, wherein one or more morpholino contains a different sequence, or wherein one or more morpholino has the same sequence or a combination thereof .

In one aspect of the disclosed complex, the one or more morpholino can have a GC content of about 35% to about 65%. In one embodiment, the one or more morpholino may have a G content of less than 36%. In one embodiment, one or more morpholino may contain only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &gt;

In one aspect of the disclosed complex, the one or more morpholino comprises 10 bp to 40 bp. For example, morpholino has a length of 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp, 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp , 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, It may be 40 bp in length.

In one embodiment, the one or more morpholino can be 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1). In one embodiment, the one or more morpholino can be 5 'ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3' (SEQ ID NO: 2). In one embodiment, one or more morpholino can be GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3). In one embodiment, the one or more morpholino can be 5 'TAT GAT TCG TAT CTG TTC TTA GCC AAT AAA TAG CGG TTT C 3' (SEQ ID NO: 4). In one embodiment, the one or more morpholino can be 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5). In one embodiment, the one or more morpholino can be 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3' (SEQ ID NO: 6). In one embodiment, the one or more morpholino can be 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7). In one embodiment, the one or more morpholino can be 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3' (SEQ ID NO: 8). In one embodiment, the one or more morpholino can be 5 ' CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3 '(SEQ ID NO: 9). In one embodiment, the one or more morpholino can be 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3' (SEQ ID NO: 10). In one embodiment, the one or more morpholino can be 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11). In one embodiment, the one or more morpholino can be 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3' (SEQ ID NO: 12). In one embodiment, the one or more morpholino can be a 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13). In one embodiment, the one or more morpholino can be 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3' (SEQ ID NO: 14). In one embodiment, the one or more morpholino can be 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15). In one embodiment, the one or more morpholino can be 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3' (SEQ ID NO: 16). In one embodiment, one or more morpholino can be 5 ' GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3 ' (SEQ ID NO: 17). In one embodiment, the one or more morpholino can be 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3' (SEQ ID NO: 18). In one embodiment, the one or more morpholino can be 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19). In one embodiment, the one or more morpholino can be 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3' (SEQ ID NO: 20). In one embodiment, the one or more morpholino can be 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21). In one embodiment, the one or more morpholino can be 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3' (SEQ ID NO: 22). In one embodiment, the one or more morpholino can be 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23). In one embodiment, the one or more morpholino can be 5 'ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3' (SEQ ID NO: 24). In one embodiment, one or more morpholino can be 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25). In one embodiment, the one or more morpholino can be 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3' (SEQ ID NO: 26). In one embodiment, the one or more morpholino can be 5 'AGA TGA CGA TAA AGA CGC AAA GAT T 3' (SEQ ID NO: 27). In one embodiment, the one or more morpholino can be 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3' (SEQ ID NO: 28). In one embodiment, the one or more morpholino can be 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29). In one embodiment, the one or more morpholino can be 5 'ATA TAT CCC TGT TTA CTT GGT CC 3' (SEQ ID NO: 30). In one embodiment, the one or more morpholino can be 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31). In one embodiment, the one or more morpholino can be 5 'TCA CTC TCA TAT TGG TTT TCA GC 3' (SEQ ID NO: 32). In one embodiment, the one or more morpholino can be 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33). In one embodiment, the one or more morpholino can be 5 'TAT CTT GTC GGT ACT TCA TC 3' (SEQ ID NO: 34). In one embodiment, the one or more morpholino can be 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35). In one embodiment, the one or more morpholino can be 5 'ACT GTG TTA TTC ATC CTG TC 3' (SEQ ID NO: 36). In one embodiment, the one or more morpholino can be 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37). In one embodiment, the one or more morpholino can be 5 'ATA TAC TTC GTT TGC TGC 3' (SEQ ID NO: 38). In one embodiment, the one or more morpholino can be 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39). In one embodiment, the one or more morpholino can be 5 'TAC CTG TTC TGT TAT GAC 3' (SEQ ID NO: 40). In one embodiment, the one or more morpholino can be 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41). In one embodiment, the one or more morpholino can be 5 'ATC CTT CTG TCT TGA 3' (SEQ ID NO: 42). In one embodiment, the one or more morpholino can be 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43). In one embodiment, the one or more morpholino can be 5 'CTT CCT ATG TTG CTA 3' (SEQ ID NO: 44). In one embodiment, the one or more morpholino can be 5 'CAG AGA GCA TAT 3' (SEQ ID NO: 45). In one embodiment, the one or more morpholino can be 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46). In one embodiment, the one or more morpholino can be 5 'CAA GAG GTA CAT 3' (SEQ ID NO: 47). In one embodiment, the one or more morpholino can be 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48). In one embodiment, the one or more morpholino can be 5 'AAG AGG TAC A 3' (SEQ ID NO: 49). In one embodiment, the one or more morpholino may be 5 'TGT ACC TCT T 3' (SEQ ID NO: 50). In one embodiment, the one or more morpholino can be 5 'AAG GAC AGT A 3' (SEQ ID NO: 51). In one embodiment, the one or more morpholino may be 5 'TAC TGT CCT T 3' (SEQ ID NO: 52).

In one embodiment, one or more of the disclosed morpholino complexes is 25 bp in length and may contain 6 cytidine, 3 guanosine, 4 adenosine, and 12 thymidine. For example, in one embodiment, one or more morpholino containing 6 cytidine, 3 guanosine, 4 adenosine, and 12 thymidine may be 5 'TATATTGATTCTCCTTGGCTTACTC 3' (SEQ ID NO: 26).

What is disclosed herein is a complex containing a copolymer carrier and one or more oligonucleotides wherein the copoly carrier comprises a main chain and one or more side chains wherein the copolymer carrier is selected from the group consisting of N-methacryloyl (2-hydroxypropyl) methylacrylamide (HPMA) copolymerized with monoglycylglycine-thiazolidin-2-thione (MA-GG-TT) monomers wherein one or more side chains are May be conjugated with one or more oligonucleotides, wherein one or more of the oligonucleotides is morpholino.

iii) Kit (KITS)

Disclosed herein are kits comprising a first complex containing a targeting moiety and an oligonucleotide, and a second complex containing a copolymer carrier and one or more oligonucleotides. In one aspect, the disclosed kit may comprise a first complex containing a targeting moiety and an oligonucleotide, and instructions for administering a second complex comprising a copolymer carrier and one or more oligonucleotides.

Disclosed herein are methods for the administration of a first complex containing a targeting moiety and an oligonucleotide and a second complex containing a copolymer carrier and one or more oligonucleotides and instructions for administering a first complex and a second complex .

In an aspect, the first complex and the second complex are co-formulated. In an aspect, the first complex and the second complex are co-packaged.

In one aspect of the disclosed kit, the targeting moiety may be specific for non-internalizing cell surface molecules or slowly internalizing cell surface molecules. Examples of non-internalizing cell surface molecules or slowly internalizing cell surface molecules are known in the art. In one embodiment, non-internalizing cell surface molecules or slowly internalizing cell surface molecules may be on a cell or cell population. In one embodiment, the cell or cell population may be a B-cell. In one embodiment, the B-cells may be normal B-cells. In one embodiment, the B-cell may be a malignant B-cell.

In one aspect of the disclosed kit, the non-internalized cell surface molecule may be a receptor. In one embodiment, the cell surface molecule that is slowly internalizing may be a receptor. For example, non-internalizing cell surface molecules or slowly internalizing cell surface molecules include, but are not limited to: CD20 receptor, protein tyrosine phosphatase receptor type C (PTPRC), cell surface death receptor, prostate stem cell antigen ) Receptors, and receptors belonging to the tumor necrosis factor receptor (TNFR) superfamily. Tumor Necrosis Factor (TNFR) superfamily is a member of the TNF-like weak inducer (DR5), FAS receptor (CD95), tumor necrosis factor receptor superfamily member 18 (TNFRSF 18) of apoptosis: TWEAK or TNFSF12). In one embodiment, the receptor may be a CD20 receptor. In one embodiment, the receptor may be a protein tyrosine phosphatase receptor type C (PTPRC). In one embodiment, the receptor may be a cell surface death receptor. In one embodiment, the receptor may be death receptor 4 (DR4). In one embodiment, the receptor may be a prostate stem cell antigen (PSCA) receptor. In one embodiment, the solvent may be death receptor 5 (DR5). In one embodiment, the receptor may be a FAS receptor (CD95). In one embodiment, the receptor may be a tumor necrosis factor receptor superfamily member 18 (TNFRSF 18). In one embodiment, the receptor may be a TNF-like weak inducer of apoptosis (TWEAK or TNFSF12).

In one embodiment, the targeting moiety of the disclosed kit can be a polysaccharide, a peptide ligand, an aptamer, an Fab 'segment or a short chain variable segment. In an embodiment, the targeting moiety may be a polysaccharide. In one embodiment, the targeting moiety may be a peptide ligand. In an embodiment, the targeting moiety may be an aptamer. In one embodiment, the targeting moiety may be a short chain variable segment. In an embodiment, the targeting moiety may be an Fab 'segment. In one embodiment, the Fab 'segment may be humanized. In one embodiment, the Fab 'segment may be derived from an anti-CD20 receptor antibody. Examples of anti-CD20 receptor antibodies include, but are not limited to: 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab, Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, ublituximab, and BLX-301. In one embodiment, the anti-CD20 receptor antibody may be 1F5.

In one aspect of the disclosed kit, the copolymer carrier may be water soluble. In one embodiment of the disclosed copolymeric carrier, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, the backbone of the copolymer carrier may contain an enzymatically degradable sequence. In one embodiment, one or more side chains of the copolymer carrier may contain enzymatically degradable sequences. In one embodiment, one or more side chains of the copolymeric carrier can be terminated at the functional group. Functional groups are known in the art and include, but are not limited to: amine reactive activated esters, maleimides, azides, and alkynes. In one embodiment, the functional groups may allow one or more oligonucleotides to associate with one or more side chains of the copolymer complex. In one embodiment, one or more side chains may be conjugated via functional groups with one or more oligonucleotides. In one embodiment, the backbone of the disclosed copolymer carrier comprises N (meth) acryloylglycylglycine-thiazolidine-2-thione (MA-GG-TT) monomers copolymerized with N - (2-hydroxypropyl) methylacrylamide (HPMA). In one embodiment, the backbone of the copolymer carrier is selected from the group consisting of N- (2- (2-methoxyethyl) acrylate) copolymerized with N-methacryloylglycylglycine-p-nitrophenyl ester (2-hydroxypropyl) methylacrylamide (HPMA). &Lt; / RTI &gt;

Oligonucleotides are known in the art. In one embodiment, the oligonucleotide may be biocompatible. In one embodiment, the oligonucleotide of the disclosed kit may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one aspect of the disclosed kits, the oligonucleotide may be a peptide nucleic acid. In one embodiment, the disclosed oligonucleotide can be morpholino. In one embodiment, the disclosed morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one embodiment, the disclosed morpholino is not self-complementary. In one aspect of the disclosed kit, the morpholino of the first complex and one or more morpholino of the second complex may be complementary. In one aspect, the morpholino of the first complex is not self-complementary. In an aspect, one or more morpholies of the second complex are not self-complementary. The morpholino of the first complex and the one or more morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁷ &gt; M. In one embodiment, the morpholino of the first complex and one or more morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁹ &gt; M.

In one embodiment, the copolymers of the disclosed kits may comprise one or more grafted morpholino. In one embodiment, one or more morpholino is 1 morpholino, or 2 morpholino, or 3 morpholino, or 4 morpholino, or 5 morpholino, or 6 morpholino, or 7 morpholino, Or morpholino, or 8 morpholino, or 9 morpholino, or 10 morpholino. For example, in one embodiment, the disclosed copolymers may include one morpholino. In one embodiment, the disclosed copolymers can include 3 morpholino. In one embodiment, the disclosed copolymers can include 10 morpholino. In one embodiment, the disclosed copolymers may include 10 or more grafted morpholino. In one embodiment, the one or more morpholino may comprise one or more grafted MORF2 morpholino. For example, the disclosed copolymer-MORF2 complex may comprise one grafted morpholino. In one aspect, the disclosed copolymer-MORF2 complex may comprise three grafted morpholino. In one embodiment, the disclosed copolymer-MORF2 complex may comprise 10 grafted morpholino. In one embodiment, the disclosed copolymer-MORF2 complex may comprise 10 or more grafted morpholino. In one embodiment, one or more morpholino or grafted morpholino may have the same sequence. In one embodiment, one or more morpholino may have other sequences. For example, in one embodiment, multiple morpholinos may be present, wherein one or more morpholino contains a different sequence, or wherein one or more morpholino has the same sequence or a combination thereof .

In one aspect of the disclosed kit, the morpholino of the first complex comprises 10 bp - 40 bp and the one or morpholino of the second complex comprises 10 bp - 40 bp. For example, each of the morpholino of the disclosed kit is 10 bp, 12 bp, 15 bp, 18 bp, 20 bp, 23 bp, 25 bp, 28 bp, 30 bp, 32 bp, 35 bp, 38 bp, Or 40 bp in length. In one embodiment, each morpholino can have a GC content of from about 35% to about 65%. In one embodiment, each morpholino may have a G content of less than 36%. In an embodiment, each morpholino may contain only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &gt;

In one aspect of the disclosed kit, the morpholino of the first complex is 40 bp in length and the morpholino of one or more of the second complex may be 40 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1) and one or more morpholino of the second complex is 5 ' ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3 '(SEQ ID NO: 2). In one embodiment, the morpholino of the first complex is GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3) and one or morpholino of the second complex is 5' TAT GAT TCG TAT CTG TTC TTA GCC AAT AAA TAG CGG TTT C 3 '(SEQ ID NO: 4).

In one aspect of the disclosed kit, the morpholino of the first complex is 38 bp in length and the morpholino of one or more of the second complex may be 38 bp in length. In one embodiment, the morpholino of the first complex is 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5) and one or morpholino of the second complex is 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3 '(SEQ ID NO: 6). In one embodiment, the morpholino of the first complex is 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7) and one or morpholino of the second complex is 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3 '(SEQ ID NO: 8).

In one aspect of the disclosed kit, the morpholino of the first complex is 35 bp long and the morpholino of one or more of the second complex is 35 bp long. In one embodiment, the morpholino of the first complex is 5 'CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 9) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3 '(SEQ ID NO: 10). In one embodiment, the morpholino of the first complex is 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11) and one or more morpholino of the second complex is 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3 '(SEQ ID NO: 12).

In one aspect of the disclosed kit, the morpholino of the first complex is 32 bp long and the one or morpholino of the second complex is 32 bp long. In one embodiment, the morpholino of the first complex is 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13) and one or morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3 '(SEQ ID NO: 14). In one embodiment, the morpholino of the first complex is 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3 '(SEQ ID NO: 16).

In one aspect of the disclosed kit, the morpholino of the first complex is 30 bp long and the morpholino of one or more of the second complex is 30 bp long. In one embodiment, the morpholino of the first complex is 5 'GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3' (SEQ ID NO: 17) and one or more morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3 '(SEQ ID NO: 18). In one embodiment, the morpholino of the first complex is 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19) and one or morpholino of the second complex is 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3 '(SEQ ID NO: 20).

In one aspect of the disclosed kit, the morpholino of the first complex is 28 bp in length and the morpholino of the second complex is 28 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21) and one or morpholino of the second complex is 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3 '(SEQ ID NO: 22). In one embodiment, the morpholino of the first complex is 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23) and one or morpholino of the second complex is 5 'ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3 '(SEQ ID NO: 24).

In one aspect of the disclosed kit, the morpholino of the first complex is 25 bp in length and the morpholino of one or more of the second complex is 25 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25) and one or more morpholino of the second complex is 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26). In one embodiment, the morpholino of the first complex is 5 'AGA TGA CGA TAA AGA CGC AAA GAT T 3' (SEQ ID NO: 27) and one or more morpholino of the second complex is 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3 '(SEQ ID NO: 28). In one aspect, the morpholino of the first complex may comprise 3 C's, 6 G's, 12 A's, and 4 T's and one or more morpholino of the second complex may comprise C's, 3 G's, 4 A's, and 12 T's.

In one aspect of the disclosed kit, the morpholino of the first complex is 23 bp in length and the morpholino of one or more of the second complex is 23 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29) and one or more morpholino of the second complex is 5 'ATA TAT CCC TGT TTA CTT GGT CC 3 '(SEQ ID NO: 30). In one embodiment, the morpholino of the first complex is 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31) and one or morpholino of the second complex is 5 'TCA CTC TCA TAT TGG TTT TCA GC 3 '(SEQ ID NO: 32).

In one aspect of the disclosed kit, the morpholino of the first complex is 20 bp in length and the morpholino of one or more of the second complex is 20 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33) and one or morpholino of the second complex is 5 'TAT CTT GTC GGT ACT TCA TC 3 (SEQ ID NO: 34). In one embodiment, the morpholino of the first complex is 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35) and one or morpholino of the second complex is 5 'ACT GTG TTA TTC ATC CTG TC 3 (SEQ ID NO: 36).

In one aspect of the disclosed kit, the morpholino of the first complex is 18 bp in length and the morpholino of one or more of the second complex is 18 bp in length. In one embodiment, the morpholino of the first complex is 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37) and one or more morpholino of the second complex is 5 'ATA TAC TTC GTT TGC TGC 3' SEQ ID NO: 38). In one embodiment, the morpholino of the first complex is 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39) and one or morpholino of the second complex is 5 'TAC CTG TTC TGT TAT GAC 3' SEQ ID NO: 40).

In one aspect of the disclosed kit, the morpholino of the first complex is 15 bp long and the morpholino of one or more of the second complex is 15 bp long. In one embodiment, the morpholino of the first complex is 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41) and the one or more morpholino of the second complex is 5 'ATC CTT CTG TCT TGA 3' : 42). In one embodiment, the morpholino of the first complex is 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43) and the one or more morpholino of the second complex is 5 'CTT CCT ATG TTG CTA 3' : 44).

In one aspect of the disclosed kit, the morpholino of the first complex is 12 bp in length and the morpholino of one or more of the second complex is 12 bp in length. In one embodiment, the morpholino of the first complex is 5 'CAG AGA GCA TAT 3' (SEQ ID NO: 45) and the one or more morpholino of the second complex is 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46 ). In one embodiment, the morpholino of the first complex is 5 'CAA GAG GTA CAT 3' (SEQ ID NO: 47) and the one or more morpholino of the second complex is 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48 ).

In one aspect of the disclosed kit, the morpholino of the first complex is 10 bp in length and the morpholino of one or more of the second complex is 10 bp in length. In one embodiment, the morpholino of the first complex is 5 'AAG AGG TAC A 3' (SEQ ID NO: 49) and the one or more morpholino of the second complex is 5 'TGT ACC TCT T 3' (SEQ ID NO: 50 ). In one embodiment, the morpholino of the first complex is 5 'AAG GAC AGT A 3' (SEQ ID NO: 51) and the one or more morpholino of the second complex is 5 'TAC TGT CCT T 3' (SEQ ID NO: 52 ).

iv) PHARMACEUTICAL COMPOSITIONS

Disclosed herein are pharmaceutical compositions comprising the disclosed compositions containing one or more of the disclosed complexes. For example, in one aspect, the disclosed pharmaceutical compositions comprise (i) a complex containing a targeting moiety and an oligonucleotide, and (ii) a pharmaceutically acceptable carrier. In one aspect, the disclosed pharmaceutical compositions comprise (i) a complex comprising a copolymer carrier and one or more oligonucleotides, and (ii) a pharmaceutically acceptable carrier. In one embodiment, the disclosed pharmaceutical composition comprises (i) a first complex containing a targeting moiety and an oligonucleotide, (ii) a second complex containing a copolymer carrier and one or more oligonucleotides, and (iii) a &Lt; / RTI &gt; includes a pharmaceutically acceptable carrier.

In one embodiment, the disclosed pharmaceutical compositions can be administered to a subject in need of treatment for B-cell malignancies, inflammatory disorders, or B cell related autoimmune diseases. For example, in one embodiment, the disclosed pharmaceutical compositions can be administered to a subject in need of treatment of NHL. In one embodiment, the disclosed pharmaceutical compositions can be administered to a subject in need of treatment of one or more of the following conditions: rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one aspect, the subject may be a subject having one or more of the following: non-Hodgkin's lymphoma, organ transplantation, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, Systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one embodiment, the disclosed pharmaceutical compositions can be administered to a subject in need of treatment after organ transplantation. In one embodiment, the disclosed pharmaceutical composition can be administered to a subject in need of treatment, wherein the subject has the JC virus.

The pharmaceutical carrier to be introduced may be, for example, solid, liquid or gaseous. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Examples of the liquid carrier include sugar syrup, peanut oil, olives, and water. Examples of the gaseous carrier include carbon dioxide and nitrogen.

When preparing compositions for oral dosage forms, any convenient pharmaceutical media may be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, colorants and the like may be used to form oral liquid preparations such as suspensions, elixirs and solutions; On the other hand, carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrants, etc. may be used to form oral solid preparations such as powders, capsules and tablets. Tablets and capsules in which solid pharmaceutical carriers are employed are preferred oral dosage units because of their ease of administration. Optionally, tablets may be coated by standard aqueous or non-aqueous techniques. Tablets containing the compositions or complexes disclosed herein may be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants. Compressed tablets may be prepared by compressing the active ingredient in a free flowing form, for example, powder or granules, optionally in a suitable machine, mixed with a binder, lubricant, inert diluent, surface active agent or dispersing agent. Molded tablets may be prepared by molding in a suitable machine a mixture of the powdered compound wetted with an inert liquid diluent.

It is understood that the disclosed compositions can be prepared from the disclosed compounds. It is also understood that the disclosed compositions may be utilized by the disclosed use methods.

C. Method

i) Method of inducing apoptosis

What is disclosed herein is a method of inducing apoptosis, comprising contacting a population of cells with a first complex containing a targeting moiety and an oligonucleotide; Contacting a population of cells with a second complex containing a copolymer carrier and one or more oligonucleotides; Where contact of the cells with the first complex and the second complex induces apoptosis. In one aspect, the disclosed method can include repeatedly contacting a population of cells with a first complex containing a targeting moiety and an oligonucleotide. The method disclosed in one embodiment may comprise repeatedly contacting a population of cells with a second complex containing a copolymer carrier and one or more oligonucleotides. In one aspect, the disclosed method comprises contacting a population of cells with a first complex containing a targeting moiety and an oligonucleotide, and contacting the population of cells with a second complex containing a copolymer carrier and one or more oligonucleotides can do. In one embodiment, the skilled artisan can determine the effective dose, effective schedule or effective route of administration for administering the disclosed compositions or disclosed complexes, so as to induce apoptosis.

In one embodiment, the disclosed methods of inducing apoptosis can include identifying cell death. Methods for identifying cell death are well known in the art and include, but are not limited to: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and terminal deoxynucleotidyl Measurement of terminal deoxynucleotidyl transferase dUTP nick end-labeling. In one embodiment, confirming apoptosis may include one of the following: measurement of caspase-3 activity, determination of annexin V / propidium iodine binding, and determination of terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). In one embodiment, confirming apoptosis may include two of the following: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and determining terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). Confirmation of apoptosis may include all of the following: measurement of caspase-3 activity, measurement of annexin V / propidium iodine binding, and terminal deoxynucleotidyl transferase dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling).

In one embodiment for inducing apoptosis, the population of cells may be a B-cell. In one embodiment, the B-cell may be a normal B-cell. In one embodiment, the cell can be a malignant B-cell. In one embodiment, a population of cells may be present in the subject. In one embodiment, the B-cell may be in a subject. In one embodiment, the subject may have a non-Hodgkin's lymphoma. In one aspect, the subject may be a subject who has undergone organ transplantation. In one embodiment, the subject may have a JC virus. In one embodiment, the subject is selected from the group consisting of rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one aspect, the subject may have one or more of the following: non-Hodgkin's lymphoma, organ transplantation, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy.

In one aspect of the disclosed cell death process, the targeting moiety may be specific for non-internalized cell surface molecules or slowly internalizing cell surface molecules. Examples of non-internalized cell surface molecules or slowly internalizing cell surface molecules are known in the art. In one embodiment, non-internalized cell surface molecules or slowly internalized cell surface molecules may be on a cell or cell population. In one embodiment, the cell or cell population may be a B-cell. In one embodiment, the B-cells may be normal B-cells. In one embodiment, the B-cell may be a malignant B-cell.

In one aspect of the disclosed method of inducing apoptosis, the non-internalized cell surface molecule may be a receptor. In one embodiment, the cell surface molecule that is slowly internalizing may be a receptor. For example, non-internalizing cell surface molecules or slowly internalizing cell surface molecules include, but are not limited to: CD20 receptor, protein tyrosine phosphatase receptor type C (PTPRC), cell surface death receptor, prostate stem cell antigen ) Receptors, and receptors belonging to the tumor necrosis factor receptor (TNFR) superfamily. Tumor Necrosis Factor (TNFR) superfamily is a member of the TNF-like weak inducer (DR5), FAS receptor (CD95), tumor necrosis factor receptor superfamily member 18 (TNFRSF 18) of apoptosis: TWEAK or TNFSF12). In one embodiment, the receptor may be a CD20 receptor. In one embodiment, the receptor may be a protein tyrosine phosphatase receptor type C (PTPRC). In one embodiment, the receptor may be a cell surface death receptor. In one embodiment, the receptor may be death receptor 4 (DR4). In one embodiment, the receptor may be a prostate stem cell antigen (PSCA) receptor. In one embodiment, the solvent may be death receptor 5 (DR5). In one embodiment, the receptor may be a FAS receptor (CD95). In one embodiment, the receptor may be a tumor necrosis factor receptor superfamily member 18 (TNFRSF 18). In one embodiment, the receptor may be a TNF-like weak inducer of apoptosis (TWEAK or TNFSF12).

In one aspect of the disclosed method of inducing apoptosis, the targeting moiety may be a polysaccharide, a peptide ligand, an aptamer, a Fab 'segment or a short chain variable segment. In an embodiment, the targeting moiety may be a polysaccharide. In one embodiment, the targeting moiety may be a peptide ligand. In an embodiment, the targeting moiety may be an aptamer. In one embodiment, the targeting moiety may be a short chain variable segment. In an embodiment, the targeting moiety may be an Fab 'segment. In one embodiment, the Fab 'segment may be humanized. In one embodiment, the Fab 'segment may be derived from an anti-CD20 receptor antibody. Examples of anti-CD20 receptor antibodies include, but are not limited to: 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab, Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, ublituximab, and BLX-301. In one embodiment, the anti-CD20 receptor antibody may be 1F5.

In one aspect of the disclosed method of inducing apoptosis, the copolymer carrier may be water-soluble. In one embodiment of the disclosed copolymeric carrier, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, the backbone of the copolymer carrier may contain an enzymatically degradable sequence. In one embodiment, one or more side chains of the copolymer carrier may contain enzymatically degradable sequences. In one embodiment, one or more side chains of the copolymeric carrier can be terminated at the functional group. Functional groups are known in the art and include, but are not limited to: amine reactive activated esters, maleimides, azides, and alkynes. In one embodiment, the functional groups may allow one or more oligonucleotides to associate with one or more side chains of the copolymer complex. In one embodiment, one or more side chains may be conjugated via functional groups with one or more oligonucleotides. In one embodiment, the backbone of the disclosed copolymer carrier comprises N (meth) acryloylglycylglycine-thiazolidine-2-thione (MA-GG-TT) monomers copolymerized with N - (2-hydroxypropyl) methylacrylamide (HPMA). In one embodiment, the backbone comprises a backbone of the disclosed copolymer carrier, wherein the backbone of the backbone is N-methacryloylglycylglycine-p-nitrophenyl ester (MA-GG-ONp) monomers copolymerized with N-methacryloylglycylglycine- (2-hydroxypropyl) methylacrylamide (HPMA). &Lt; / RTI &gt;

Oligonucleotides are known in the art. In one aspect of the disclosed method of inducing apoptosis, the oligonucleotide may be biocompatible. In one embodiment, the oligonucleotide of the disclosed kit may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one embodiment of the disclosed method of inducing apoptosis, the oligonucleotide may be a peptide nucleic acid. In one aspect of the disclosed method, the oligonucleotide can be morpholino. In one embodiment, the disclosed morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one embodiment, the disclosed morpholino is not self-complementary. In one aspect of the disclosed kit, the morpholino of the first complex and one or more morpholino of the second complex may be complementary. In one aspect, the morpholino of the first complex is not self-complementary. In one aspect of the disclosed method, one or more morpholi of the second complex is not self-complementary. In one aspect, the morpholino of the first complex and the one or morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁷ &gt; M. In one embodiment, the morpholino of the first complex and one or more morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁹ &gt; M.

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex comprises 10 bp - 40 bp and the one or morpholino of the second complex comprises 10 bp - 40 bp. For example, each of the morpholino of the disclosed method is 10 bp, 12 bp, 15 bp, 18 bp, 20 bp, 23 bp, 25 bp, 28 bp, 30 bp, 32 bp, 35 bp, Or 40 bp in length. In one embodiment, each morpholino can have a GC content of from about 35% to about 65%. In one embodiment, each morpholino may have a G content of less than 36%. In an embodiment, each morpholino may contain only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &gt;

 In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 40 bp long and the morpholino of one or more of the second complex is 40 bp long. In one embodiment, the morpholino of the first complex is 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1) and one or morpholino of the second complex is 5 'ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3 '(SEQ ID NO: 2). In one embodiment, the morpholino of the first complex is GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3) and one or morpholino of the second complex is 5' TAT GAT TCG TAT CTG TTC TTA GCC AAT AAA TAG CGG TTT C 3 '(SEQ ID NO: 4).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 38 bp in length and the morpholino of one or more of the second complex is 38 bp in length. In one embodiment, the morpholino of the first complex is 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5) and one or morpholino of the second complex is 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3 '(SEQ ID NO: 6). In one embodiment, the morpholino of the first complex is 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7) and one or morpholino of the second complex is 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3 '(SEQ ID NO: 8).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 35 bp long and the one or morpholino of the second complex is 35 bp long. In one embodiment, the morpholino of the first complex is 5 'CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 9) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3 '(SEQ ID NO: 10). In one embodiment, the morpholino of the first complex is 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11) and one or more morpholino of the second complex is 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3 '(SEQ ID NO: 12).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 32 bp long and the one or morpholino of the second complex is 32 bp long. In one embodiment, the morpholino of the first complex is 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13) and one or morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3 '(SEQ ID NO: 14). In one embodiment, the morpholino of the first complex is 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3 '(SEQ ID NO: 16).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 30 bp in length and the morpholino of one or more of the second complex is 30 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3' (SEQ ID NO: 17) and one or more morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3 '(SEQ ID NO: 18). In one embodiment, the morpholino of the first complex is 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19) and one or morpholino of the second complex is 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3 '(SEQ ID NO: 20).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 28 bp in length and the morpholino of one or more of the second complex is 28 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21) and one or morpholino of the second complex is 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3 '(SEQ ID NO: 22). In one embodiment, the morpholino of the first complex is 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23) and one or morpholino of the second complex is 5 'ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3 '(SEQ ID NO: 24).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 25 bp long and the one or morpholino of the second complex is 25 bp long. In one embodiment, the morpholino of the first complex is 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25) and one or more morpholino of the second complex is 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26). In one embodiment, the morpholino of the first complex is 5 'AGA TGA CGA TAA AGA CGC AAA GAT T 3' (SEQ ID NO: 27) and one or more morpholino of the second complex is 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3 '(SEQ ID NO: 28). In one embodiment, the morpholino of the first complex may contain 3 cytidine, 6 guanosine, 12 adenosine and 4 thymidine, and one or more morpholino of the second complex may contain 6 cytidine, 3 guanosine, 4 &lt; / RTI &gt; adenosine and 12 thymidine.

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 23 bp in length and the one or morpholino of the second complex is 23 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29) and one or more morpholino of the second complex is 5 'ATA TAT CCC TGT TTA CTT GGT CC 3 '(SEQ ID NO: 30). In one embodiment, the morpholino of the first complex is 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31) wherein one or more morpholino of the second complex is a 5 'TCA CTC TCA TAT TGG TTT TCA GC 3 '(SEQ ID NO: 32).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 20 bp in length and the morpholino of one or more of the second complex is 20 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33) and one or morpholino of the second complex is 5 'TAT CTT GTC GGT ACT TCA TC 3 (SEQ ID NO: 34). In one embodiment, the morpholino of the first complex is 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35) and one or morpholino of the second complex is 5 'ACT GTG TTA TTC ATC CTG TC 3 (SEQ ID NO: 36).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 18 bp in length and the morpholino of one or more of the second complex is 18 bp in length. In one embodiment, the morpholino of the first complex is 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37) and one or more morpholino of the second complex is 5 'ATA TAC TTC GTT TGC TGC 3' SEQ ID NO: 38). In one embodiment, the morpholino of the first complex is 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39) and one or morpholino of the second complex is 5 'TAC CTG TTC TGT TAT GAC 3' SEQ ID NO: 40).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 15 bp long and the one or morpholino of the second complex is 15 bp long. In one embodiment, the morpholino of the first complex is 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41) and the one or more morpholino of the second complex is 5 'ATC CTT CTG TCT TGA 3' : 42). In one embodiment, the morpholino of the first complex is 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43) and one or more morpholino of the second complex is 5 'CTT CCT ATG TTG CTA 3' No. 44).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 12 bp in length and the one or morpholino of the second complex is 12 bp in length. In one embodiment, the morpholino of the first complex is 5 'CAG AGA GCA TAT 3' (SEQ ID NO: 45) and the one or more morpholino of the second complex is 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46 ). In one embodiment, the morpholino of the first complex is 5 'CAA GAG GTA CAT 3' (SEQ ID NO: 47) and the one or more morpholino of the second complex is 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48 ).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 10 bp in length and the morpholino of one or more of the second complex is 10 bp in length. In one embodiment, the morpholino of the first complex is 5 'AAG AGG TAC A 3' (SEQ ID NO: 49) and the one or more morpholino of the second complex is 5 'TGT ACC TCT T 3' (SEQ ID NO: 50 ). In one embodiment, the morpholino of the first complex is 5 'AAG GAC AGT A 3' (SEQ ID NO: 51) and the one or more morpholino of the second complex is 5 'TAC TGT CCT T 3' (SEQ ID NO: 52 ).

ii) Method of inducing apoptosis

The method of inducing apoptosis disclosed herein comprises introducing into a composition comprising a first complex containing a targeting moiety and an oligonucleotide and a second complex containing a copolymer carrier comprising a copolymer carrier and one or more oligonucleotides, Wherein contacting the cell with the composition induces apoptosis of the cell. The disclosed methods may include repeating contact of the cell with the composition. The disclosed methods can include identifying cell death of the cells. Methods for identifying cell death are well known in the art and include, but are not limited to: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and terminal deoxynucleotidyl Measurement of terminal deoxynucleotidyl transferase dUTP nick end-labeling. In one embodiment, confirming apoptosis may include one of the following: measurement of caspase-3 activity, determination of annexin V / propidium iodine binding, and determination of terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). In one embodiment, confirming apoptosis may include two of the following: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and determining terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). Confirmation of apoptosis may include all of the following: measurement of caspase-3 activity, measurement of annexin V / propidium iodine binding, and terminal deoxynucleotidyl transferase dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). In one embodiment, the skilled artisan can determine the effective dose, effective schedule or effective route of administration for administering the disclosed compositions or disclosed complexes, so as to induce apoptosis.

In one embodiment of the disclosed method of inducing apoptosis, the cell population may be a B-cell. In one embodiment, the B-cells may be normal B-cells. In one embodiment, the B-cell may be a malignant B-cell. In one embodiment, a population of cells may be present in the subject. In one embodiment, the B-cell may be in a subject. In one embodiment, the subject may have a non-Hodgkin's lymphoma. In one aspect, the subject may be a subject who has undergone organ transplantation. In one embodiment, the subject may have a JC virus. In one embodiment, the subject is selected from the group consisting of rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one aspect, the subject may have one or more of the following: non-Hodgkin's lymphoma, organ transplantation, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy.

In one aspect of the disclosed method of inducing apoptosis, the non-internalizing cell surface molecule may be a receptor. In one embodiment, the cell surface molecule that is slowly internalizing may be a receptor. For example, non-internalizing cell surface molecules or slowly internalizing cell surface molecules include, but are not limited to: CD20 receptor, protein tyrosine phosphatase receptor type C (PTPRC), cell surface death receptor, prostate stem cell antigen ) Receptors, and receptors belonging to the tumor necrosis factor receptor (TNFR) superfamily. Tumor Necrosis Factor (TNFR) superfamily is a member of the TNF-like weak inducer (DR5), FAS receptor (CD95), tumor necrosis factor receptor superfamily member 18 (TNFRSF 18) of apoptosis: TWEAK or TNFSF12). In one embodiment, the receptor may be a CD20 receptor. In one embodiment, the receptor may be a protein tyrosine phosphatase receptor type C (PTPRC). In one embodiment, the receptor may be a cell surface death receptor. In one embodiment, the receptor may be death receptor 4 (DR4). In one embodiment, the receptor may be a prostate stem cell antigen (PSCA) receptor. In one embodiment, the solvent may be death receptor 5 (DR5). In one embodiment, the receptor may be a FAS receptor (CD95). In one embodiment, the receptor may be a tumor necrosis factor receptor superfamily member 18 (TNFRSF 18). In one embodiment, the receptor may be a TNF-like weak inducer of apoptosis (TWEAK or TNFSF12).

In one aspect of the disclosed method of inducing apoptosis, the targeting moiety may be a polysaccharide, a peptide ligand, an aptamer, a Fab 'segment or a short chain variable segment. In an embodiment, the targeting moiety may be a polysaccharide. In one embodiment, the targeting moiety may be a peptide ligand. In an embodiment, the targeting moiety may be an aptamer. In one embodiment, the targeting moiety may be a short chain variable segment. In an embodiment, the targeting moiety may be an Fab 'segment. In one embodiment, the Fab 'segment may be humanized. In one embodiment, the Fab 'segment may be derived from an anti-CD20 receptor antibody. Examples of anti-CD20 receptor antibodies include, but are not limited to: 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab, Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, ublituximab, and BLX-301. In one embodiment, the anti-CD20 receptor antibody may be 1F5.

In one aspect of the disclosed method of inducing apoptosis, the copolymer carrier may be water-soluble. In one embodiment of the disclosed copolymeric carrier, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, the backbone of the copolymer carrier may contain an enzymatically degradable sequence. In one embodiment, one or more side chains of the copolymer carrier may contain enzymatically degradable sequences. In one embodiment, one or more side chains of the copolymeric carrier can be terminated at the functional group. Functional groups are known in the art and include, but are not limited to: amine reactive activated esters, maleimides, azides, and alkynes. In one embodiment, the functional groups may allow one or more oligonucleotides to associate with one or more side chains of the copolymer complex. In one embodiment, one or more side chains may be conjugated via functional groups with one or more oligonucleotides. In one embodiment, the backbone is N-methacryloylglycylglycyl-thiazolidine-2-thione (MA-GG-TT) monomers copolymerized with N- (2-hydroxypropyl) methylacrylamide (HPMA). &Lt; / RTI &gt; In one embodiment, the backbone of the copolymer carrier is selected from the group consisting of N- (2- (2-methoxyethyl) acrylate) copolymerized with N-methacryloylglycylglycine-p-nitrophenyl ester (2-hydroxypropyl) methylacrylamide (HPMA). &Lt; / RTI &gt;

Oligonucleotides are known in the art. In one aspect of the disclosed method, oligonucleotides may be biocompatible. In one embodiment, the oligonucleotide may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and may be charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one embodiment of the disclosed method of inducing apoptosis, the oligonucleotide may be a peptide nucleic acid. In one aspect of the disclosed method, the oligonucleotide can be morpholino. In one embodiment, the disclosed morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one embodiment, the disclosed morpholino is not self-complementary. In one aspect of the disclosed method, the morpholino of the first complex and one or more morpholino of the second complex are complementary. In one aspect, one or more morpholino of the second complex is not self-complementary. In one aspect, the morpholino of the first complex and the one or morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁷ &gt; M. In one embodiment, the morpholino of the first complex and one or more morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁹ &gt; M.

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex comprises 10 bp - 40 bp and the one or morpholino of the second complex comprises 10 bp - 40 bp. For example, each morpholino may be 10, 12, 15, 18, 20, 23, 25, 28, 30, 32, Lt; / RTI &gt; In one embodiment, each morpholino can have a GC content of from about 35% to about 65%. In one embodiment, each morpholino may have a G content of less than 36%. In an embodiment, each morpholino may contain only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &gt;

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 40 bp long and the morpholino of one or more of the second complex is 40 bp long. In one embodiment, the morpholino of the first complex is 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1) and one or morpholino of the second complex is 5 'ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3 '(SEQ ID NO: 2). In one embodiment, the morpholino of the first complex is GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3) and one or morpholino of the second complex is 5' TAT GAT TCG TAT CTG TTC TTA GCC AAT AAA TAG CGG TTT C 3 '(SEQ ID NO: 4).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 38 bp in length and the morpholino of one or more of the second complex is 38 bp in length. In one embodiment, the morpholino of the first complex is 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5) and one or morpholino of the second complex is 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3 '(SEQ ID NO: 6). In one embodiment, the morpholino of the first complex is 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7) and one or morpholino of the second complex is 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3 '(SEQ ID NO: 8).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 35 bp long and the one or morpholino of the second complex is 35 bp long. In one embodiment, the morpholino of the first complex is 5 'CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 9) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3 '(SEQ ID NO: 10). In one embodiment, the morpholino of the first complex is 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11) and one or more morpholino of the second complex is 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3 '(SEQ ID NO: 12).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 32 bp long and the one or morpholino of the second complex is 32 bp long. In one embodiment, the morpholino of the first complex is 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13) and one or morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3 '(SEQ ID NO: 14). In one embodiment, the morpholino of the first complex is 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3 '(SEQ ID NO: 16).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 30 bp in length and the morpholino of one or more of the second complex is 30 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3' (SEQ ID NO: 17) and one or more morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3 '(SEQ ID NO: 18). In one embodiment, the morpholino of the first complex is 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19) and one or morpholino of the second complex is 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3 '(SEQ ID NO: 20).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 28 bp in length and the morpholino of one or more of the second complex is 28 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21) and one or morpholino of the second complex is 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3 '(SEQ ID NO: 22). In one embodiment, the morpholino of the first complex is 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23) and one or morpholino of the second complex is 5 'ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3 '(SEQ ID NO: 24).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 25 bp long and the one or morpholino of the second complex is 25 bp long. In one embodiment, the morpholino of the first complex is 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25) and one or more morpholino of the second complex is 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26). In one embodiment, the morpholino of the first complex is 5 'AGA TGA CGA TAA AGA CGC AAA GAT T 3' (SEQ ID NO: 27) and one or more morpholino of the second complex is 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3 '(SEQ ID NO: 28). In one embodiment, the morpholino of the first complex may comprise 3 cytidine, 6 guanosine, 12 adenosine, and 4 thymidine, and one or more morpholino of the second complex may comprise 6 cytidine, 3 guanosine , 4 adenosine, and 12 thymidine.

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 23 bp in length and the one or morpholino of the second complex is 23 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29) and one or more morpholino of the second complex is 5 'ATA TAT CCC TGT TTA CTT GGT CC 3 '(SEQ ID NO: 30). In one embodiment, the morpholino of the first complex is 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31) wherein one or more morpholino of the second complex is a 5 'TCA CTC TCA TAT TGG TTT TCA GC 3 '(SEQ ID NO: 32).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 20 bp in length and the morpholino of one or more of the second complex is 20 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33) and one or morpholino of the second complex is 5 'TAT CTT GTC GGT ACT TCA TC 3 (SEQ ID NO: 34). In one embodiment, the morpholino of the first complex is 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35) and one or morpholino of the second complex is 5 'ACT GTG TTA TTC ATC CTG TC 3 (SEQ ID NO: 36).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 18 bp in length and the morpholino of one or more of the second complex is 18 bp in length. In one embodiment, the morpholino of the first complex is 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37) and one or more morpholino of the second complex is 5 'ATA TAC TTC GTT TGC TGC 3' SEQ ID NO: 38). In one embodiment, the morpholino of the first complex is 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39) and one or morpholino of the second complex is 5 'TAC CTG TTC TGT TAT GAC 3' SEQ ID NO: 40).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 15 bp long and the one or morpholino of the second complex is 15 bp long. In one embodiment, the morpholino of the first complex is 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41) and the one or more morpholino of the second complex is 5 'ATC CTT CTG TCT TGA 3' : 42). In one embodiment, the morpholino of the first complex is 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43) and the one or more morpholino of the second complex is 5 'CTT CCT ATG TTG CTA 3' : 44).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 12 bp in length and the one or morpholino of the second complex is 12 bp in length. In one embodiment, the morpholino of the first complex is 5 'CAG AGA GCA TAT 3' (SEQ ID NO: 45) and the one or more morpholino of the second complex is 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46 ). In one embodiment, the morpholino of the first complex is 5 'CAA GAG GTA CAT 3' (SEQ ID NO: 47) and the one or more morpholino of the second complex is 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48 ).

In one embodiment of the disclosed method of inducing apoptosis, the morpholino of the first complex is 10 bp in length and the morpholino of one or more of the second complex is 10 bp in length. In one embodiment, the morpholino of the first complex is 5 'AAG AGG TAC A 3' (SEQ ID NO: 49) and the one or more morpholino of the second complex is 5 'TGT ACC TCT T 3' (SEQ ID NO: 50 ). In one embodiment, the morpholino of the first complex is 5 'AAG GAC AGT A 3' (SEQ ID NO: 51) and the one or more morpholino of the second complex is 5 'TAC TGT CCT T 3' (SEQ ID NO: 52 ).

iii) Treatment

Disclosed herein is a method of treating a subject in need thereof, the method comprising administering to the subject a first composition comprising a first complex containing a targeting moiety and an oligonucleotide; The method comprising administering to the subject a second composition comprising a second complex comprising a copolymer carrier and one or more oligonucleotides wherein administration of the first and second compositions comprises administering to the subject a population of target cells Induce death. In one embodiment, the administration comprises intravenous administration. In one embodiment, the disclosed methods can include repeating administration of the first composition. In one embodiment, the disclosed methods can include repeating administration of the second composition. In one embodiment, the disclosed methods can include repeating administration of the first composition, and repeating administration of the second composition. In one embodiment, the disclosed methods can include identifying cell death in a targeted cell population. In one aspect, the skilled artisan can determine an effective dose, effective schedule, or effective route of administration for administering the disclosed compositions or disclosed complexes, thereby treating the subject in need of treatment.

Methods for identifying cell death are well known in the art and include, but are not limited to: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and terminal deoxynucleotidyl Measurement of terminal deoxynucleotidyl transferase dUTP nick end-labeling. In one embodiment, confirming apoptosis may include one of the following: measurement of caspase-3 activity, determination of annexin V / propidium iodine binding, and determination of terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). In one embodiment, confirming apoptosis may include two of the following: measuring caspase-3 activity, measuring annexin V / propidium iodine binding, and determining terminal deoxynucleotidyl transferase Measurement of dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling). Confirmation of apoptosis may include all of the following: measurement of caspase-3 activity, measurement of annexin V / propidium iodine binding, and terminal deoxynucleotidyl transferase dUTP nick end-labeling (terminal deoxynucleotidyl transferase dUTP nick end-labeling).

In one aspect of the disclosed method of treatment, the cell population may be a B-cell. In one embodiment, the B-cells may be normal B-cells. In one embodiment, the B-cell may be a malignant B-cell. In one embodiment, a population of cells may be present in the subject. In one embodiment, the B-cell may be in a subject. In one embodiment, the subject may have a non-Hodgkin's lymphoma. In one aspect, the subject may be a subject who has undergone organ transplantation. In one embodiment, the subject may have a JC virus. In one embodiment, the subject is selected from the group consisting of rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy. In one aspect, the subject may have one or more of the following: non-Hodgkin's lymphoma, organ transplantation, rheumatoid arthritis, chronic lymphocytic leukemia, multiple sclerosis, systemic lupus erythematosus, systemic lupus erythematosus, autoimmune hemolytic anemia, pure red cell aplasia, idiopathic thrombocytopenic purpura, Evans syndrome, vasculitis, Bullous skin disorders, type 1 diabetes mellitus, Sjogren's syndrome, Devic's disease, or Graves' disease ophthalmopathy.

In one aspect of the disclosed method of treatment, the non-internalizing cell surface molecule may be a receptor. In one embodiment, the cell surface molecule that is slowly internalizing may be a receptor. For example, non-internalizing cell surface molecules or slowly internalizing cell surface molecules include, but are not limited to: CD20 receptor, protein tyrosine phosphatase receptor type C (PTPRC), cell surface death receptor, prostate stem cell antigen ) Receptors, and receptors belonging to the tumor necrosis factor receptor (TNFR) superfamily. Tumor Necrosis Factor (TNFR) superfamily is a member of the TNF-like weak inducer (DR5), FAS receptor (CD95), tumor necrosis factor receptor superfamily member 18 (TNFRSF 18) of apoptosis: TWEAK or TNFSF12). In one embodiment, the receptor may be a CD20 receptor. In one embodiment, the receptor may be a protein tyrosine phosphatase receptor type C (PTPRC). In one embodiment, the receptor may be a cell surface death receptor. In one embodiment, the receptor may be death receptor 4 (DR4). In one embodiment, the receptor may be a prostate stem cell antigen (PSCA) receptor. In one embodiment, the solvent may be death receptor 5 (DR5). In one embodiment, the receptor may be a FAS receptor (CD95). In one embodiment, the receptor may be a tumor necrosis factor receptor superfamily member 18 (TNFRSF 18). In one embodiment, the receptor may be a TNF-like weak inducer of apoptosis (TWEAK or TNFSF12).

In one aspect of the disclosed method of treatment, the targeting moiety may be a polysaccharide, a peptide ligand, an aptamer, an Fab 'segment or a short chain variable segment. In an embodiment, the targeting moiety may be a polysaccharide. In one embodiment, the targeting moiety may be a peptide ligand. In an embodiment, the targeting moiety may be an aptamer. In one embodiment, the targeting moiety may be a short chain variable segment. In an embodiment, the targeting moiety may be an Fab 'segment. In one embodiment, the Fab 'segment may be humanized. In one embodiment, the Fab 'segment may be derived from an anti-CD20 receptor antibody. Examples of anti-CD20 receptor antibodies include, but are not limited to: 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab, Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, ublituximab, and BLX-301. In one embodiment, the anti-CD20 receptor antibody may be 1F5.

In one aspect of the disclosed method of treatment, the copolymeric carrier may be water-soluble. In one embodiment, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, the backbone of the copolymer carrier may contain an enzymatically degradable sequence. In one embodiment, one or more side chains of the copolymer carrier may contain enzymatically degradable sequences. In one embodiment, one or more side chains of the copolymeric carrier can be terminated at the functional group. Functional groups are known in the art and include, but are not limited to: amine reactive activated esters, maleimides, azides, and alkynes. In one embodiment, the functional groups may allow one or more oligonucleotides to associate with one or more side chains of the copolymer complex. In one embodiment, one or more side chains may be conjugated via functional groups with one or more oligonucleotides. In one embodiment, the backbone of the disclosed copolymer carrier comprises N (meth) acryloylglycylglycine-thiazolidine-2-thione (MA-GG-TT) monomers copolymerized with N - (2-hydroxypropyl) methylacrylamide (HPMA). In one embodiment, the backbone of the disclosed copolymer carrier is selected from the group consisting of N- (2 (meth) acryloylglycylglycine-p-nitrophenyl ester - (2-hydroxypropyl) methylacrylamide: HPMA).

Oligonucleotides are known in the art. In one aspect of the disclosed method of treatment, the oligonucleotide may be biocompatible. In one embodiment, the oligonucleotide may be non-degradable. In one embodiment, the oligonucleotide may be water-soluble. In one embodiment, the oligonucleotide may be charge-neutral. In one embodiment, the oligonucleotide is biocompatible and non-degradable. In one embodiment, the oligonucleotide is water soluble and may be charge-neutral. In one embodiment, the oligonucleotide can be one or more: biocompatible, non-degradable, water soluble, and charge-neutral. For example, in one embodiment, the oligonucleotide is biocompatible, non-degradable, water soluble, and charge-neutral.

In one aspect of the disclosed method of treatment, the oligonucleotide may be a peptide nucleic acid. In one aspect of the disclosed method, the oligonucleotide can be morpholino. In one embodiment, the disclosed morpholino does not bind any mRNA target of a genome, e. G., A human genome. In one embodiment, the disclosed morpholino is not self-complementary. In one aspect of the disclosed method, the morpholino of the first complex and one or more morpholino of the second complex are complementary. In one aspect, one or more morpholino of the second complex is not self-complementary. In one aspect, the morpholino of the first complex and the one or morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁷ &gt; M. In one embodiment, the morpholino of the first complex and one or more morpholino of the second complex may have a Kd of less than 10 &lt;&quot; ⁹ &gt; M.

In one aspect of the disclosed method of treatment, the morpholino of the first complex comprises 10 bp to 40 bp and the one or more morpholino of the second complex comprises 10 bp to 40 bp. For example, in one embodiment, each of the morpholino of the disclosed methods is 10 bp, 12 bp, 15 bp, 18 bp, 20 bp, 23 bp, 25 bp, 28 bp, 30 bp, 32 bp, 35 bp , 38 bp, or 40 bp. In one embodiment, each morpholino can have a GC content of from about 35% to about 65%. In one embodiment, each morpholino may have a G content of less than 36%. In an embodiment, each morpholino may contain only &lt; RTI ID = 0.0 &gt; 7 C. &lt; / RTI &gt;

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 40 bp long and the morpholino of one or more of the second complex is 40 bp long. In one embodiment, the morpholino of the first complex is 5 'GAA CTA ATG CAA TAA CTA TCA CGA ATG CGG GTA ACT TAA T 3' (SEQ ID NO: 1) and one or morpholino of the second complex is 5 'ATT AAG TTA CCC GCA TTC GTG ATA GTT ATT GCA TTA GTT C 3 '(SEQ ID NO: 2). In one embodiment, the morpholino of the first complex is GAA ACC GCT ATT TAT TGG CTA AGA ACA GAT ACG AAT CAT A 3 '(SEQ ID NO: 3) and one or morpholino of the second complex is 5' TAT GAT TCG TAT CTG TTC TTA GCC AAT AAA TAG CGG TTT C 3 '(SEQ ID NO: 4).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 38 bp in length and the morpholino of one or more of the second complex is 38 bp in length. In one embodiment, the morpholino of the first complex is 5 'GTA AAC GCG ACA AAT GCC GAT AAT GCT TCG ATA ATA AT 3' (SEQ ID NO: 5) and one or morpholino of the second complex is 5 'ATT ATT ATC GAA GCA TTA TCG GCA TTT GTC GCG TTT AC 3 '(SEQ ID NO: 6). In one embodiment, the morpholino of the first complex is 5 'GAC AGA GTT CAC TAT GAC AAA CGA TTT CAC GAG TAA TA 3' (SEQ ID NO: 7) and one or morpholino of the second complex is 5 'TAT TAC TCG TGA AAT CGT TTG TCA TAG TGA ACT CTG TC 3 '(SEQ ID NO: 8).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 35 bp in length and the morpholino of one or more of the second complex is 35 bp in length. In one embodiment, the morpholino of the first complex is 5 'CCT GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 9) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TCA GG 3 '(SEQ ID NO: 10). In one embodiment, the morpholino of the first complex is 5 'GAA CAA CGA GAG GTG CTC AAT ACA GAT ATC AAT CA 3' (SEQ ID NO: 11) and one or more morpholino of the second complex is 5 'TGA TTG ATA TCT GTA TTG AGC ACC TCT CGT TGT TC 3 '(SEQ ID NO: 12).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 32 bp in length and the morpholino of one or more of the second complex is 32 bp in length. In one embodiment, the morpholino of the first complex is 5 'AGT CAT AGA TAG ACA GAA TAG CCG GAT AAA CT 3' (SEQ ID NO: 13) and one or morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTC TAT CTA TGA CT 3 '(SEQ ID NO: 14). In one embodiment, the morpholino of the first complex is 5 'GAT ACA GAA GTA GAA AGC AGT CAC GCA ATA TA 3' (SEQ ID NO: 15) and one or more morpholino of the second complex is 5 'TAT ATT GCG TGA CTG CTT TCT ACT TCT GTA TC 3 '(SEQ ID NO: 16).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 30 bp long and the morpholino of one or more of the second complex is 30 bp long. In one embodiment, the morpholino of the first complex is 5 'GGC ATA GAT AAC AGA ATA GCC GGA TAA ACT 3' (SEQ ID NO: 17) and one or more morpholino of the second complex is 5 'AGT TTA TCC GGC TAT TCT GTT ATC TAT GCC 3 '(SEQ ID NO: 18). In one embodiment, the morpholino of the first complex is 5 'GAC CAG TAG ATA AGT GAA CCA GAT TGA ACA 3' (SEQ ID NO: 19) and one or morpholino of the second complex is 5 'TGT TCA ATC TGG TTC ACT TAT CTA CTG GTC 3 '(SEQ ID NO: 20).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 28 bp in length and the morpholino of one or more of the second complex is 28 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAC AGC CAG AGA GAG AAT CAA TAT A 3' (SEQ ID NO: 21) and one or morpholino of the second complex is 5 'TAT ATT GAT TCT CTC TCT GGC TGT ACT C 3 '(SEQ ID NO: 22). In one embodiment, the morpholino of the first complex is 5 'GTG AAC ACG AAA GAG TGA CGC AAT AAA T 3' (SEQ ID NO: 23) and one or morpholino of the second complex is 5 'ATT TAT TGC GTC ACT CTT TCG TGT TCA C 3 '(SEQ ID NO: 24).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 25 bp in length and the morpholino of one or more of the second complex is 25 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25) and one or more morpholino of the second complex is 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26). In one embodiment, the morpholino of the first complex is 5 'AGA TGA CGA TAA AGA CGC AAA GAT T 3' (SEQ ID NO: 27) and one or more morpholino of the second complex is 5 'AAT CTT TGC GTC TTT ATC GTC ATC T 3 '(SEQ ID NO: 28). In one embodiment, the morpholino of the first complex may comprise 3 cytidine, 6 guanosine, 12 adenosine, and 4 thymidine, and one or more morpholino of the second complex may comprise 6 cytidine, 3 guanosine , 4 adenosine, and 12 thymidine.

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 23 bp in length and the morpholino of one or more of the second complex is 23 bp in length. In one embodiment, the morpholino of the first complex is 5 'GGA CCA AGT AAA CAG GGA TAT AT 3' (SEQ ID NO: 29) and one or more morpholino of the second complex is 5 'ATA TAT CCC TGT TTA CTT GGT CC 3 '(SEQ ID NO: 30). In one embodiment, the morpholino of the first complex is 5 'GCT GAA AAC CAA TAT GAG AGT GA 3' (SEQ ID NO: 31), wherein one or more morpholino of the second complex is a 5 'TCA CTC TCA TAT TGG TTT TCA GC 3 '(SEQ ID NO: 32).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 20 bp in length and the morpholino of one or more of the second complex is 20 bp in length. In one embodiment, the morpholino of the first complex is 5 'GAT GAA GTA CCG ACA AGA TA 3' (SEQ ID NO: 33) and one or morpholino of the second complex is 5 'TAT CTT GTC GGT ACT TCA TC 3 (SEQ ID NO: 34). In one embodiment, the morpholino of the first complex is 5 'GAC AGG ATG AAT AAC ACA GT 3' (SEQ ID NO: 35) and one or morpholino of the second complex is 5 'ACT GTG TTA TTC ATC CTG TC 3 (SEQ ID NO: 36).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 18 bp in length and the morpholino of one or more of the second complex is 18 bp in length. In one embodiment, the morpholino of the first complex is 5 'GCA GCA AAC GAA GTA TAT 3' (SEQ ID NO: 37) and one or more morpholino of the second complex is 5 'ATA TAC TTC GTT TGC TGC 3' SEQ ID NO: 38). In one embodiment, the morpholino of the first complex is 5 'GTC ATA ACA GAA CAG GTA 3' (SEQ ID NO: 39) and one or morpholino of the second complex is 5 'TAC CTG TTC TGT TAT GAC 3' SEQ ID NO: 40).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 15 bp long and the morpholino of one or more of the second complex is 15 bp long. In one embodiment, the morpholino of the first complex is 5 'TCA AGA CAG AAG GAT 3' (SEQ ID NO: 41) and the one or more morpholino of the second complex is 5 'ATC CTT CTG TCT TGA 3' : 42). In one embodiment, the morpholino of the first complex is 5 'TAG CAA CAT AGG AAG 3' (SEQ ID NO: 43) and the one or more morpholino of the second complex is 5 'CTT CCT ATG TTG CTA 3' : 44).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 12 bp in length and the morpholino of the second complex is 12 bp in length. In one embodiment, the morpholino of the first complex is 5 'CAG AGA GCA TAT 3' (SEQ ID NO: 45) and the one or more morpholino of the second complex is 5 'ATA TGC TCT CTG 3' (SEQ ID NO: 46 ). In one embodiment, the morpholino of the first complex is 5 'CAA GAG GTA CAT 3' (SEQ ID NO: 47) and the one or more morpholino of the second complex is 5 'ATG TAC CTC TTG 3' (SEQ ID NO: 48 ).

In one aspect of the disclosed method of treatment, the morpholino of the first complex is 10 bp in length and the morpholino of the second complex is 10 bp in length. In one embodiment, the morpholino of the first complex is 5 'AAG AGG TAC A 3' (SEQ ID NO: 49) and the one or more morpholino of the second complex is 5 'TGT ACC TCT T 3' (SEQ ID NO: 50 ). In one embodiment, the morpholino of the first complex is 5 'AAG GAC AGT A 3' (SEQ ID NO: 51) and the one or more morpholino of the second complex is 5 'TAC TGT CCT T 3' (SEQ ID NO: 52 ).

D. Synthesis

i) Targeting Moiety  And oligonucleotides &lt; RTI ID = 0.0 &gt; Complex  synthesis

Disclosed herein are processes for synthesizing a complex containing a targeting moiety and an oligonucleotide, the process comprising obtaining a targeting moiety, modifying the oligonucleotide, and conjugating the targeting moiety to the oligonucleotide . In one embodiment, the targeting moiety can be conjugated with an oligonucleotide via a thioether linkage. In one embodiment, the oligonucleotide can be a modified SMCC. In one embodiment, the oligonucleotide may contain a 3'-maleimido group. In one aspect, the process of synthesizing the disclosed complexes may include introducing a detectable label. In one aspect of the disclosed complex process, the targeting moiety may be the disclosed targeting moiety. For example, the targeting moiety may be a Fab 'segment specific for CD20. In one aspect of the disclosed synthetic process, the one or more oligonucleotides may be one or more of the disclosed oligonucleotides. For example, the disclosed one or more oligonucleotides may be morpholino that contain 10 bp to 40 bp, respectively.

ii) Copolymer The carrier  Synthesis of a complex containing one or more oligonucleotides

Disclosed herein is a process for synthesizing a complex comprising a copolymer carrier and one or more oligonucleotides, the process comprising: obtaining a copolymer carrier; modifying one or more oligonucleotides; Or more oligonucleotides. In one embodiment, the copolymeric carrier may contain a backbone and one or more side chains. In one embodiment, RAFT polymerization can be used to form the disclosed backbone. In one aspect, the process of synthesizing the disclosed complexes may include introducing a detectable label. In one aspect of the disclosed process of synthesizing the complex, the copolymer carrier may be the disclosed copolymer carrier. For example, the disclosed copolymer carrier may comprise an HPMA copolymer co-polymerized with MA-GG-TT monomers. In one aspect of the synthetic process of the disclosed complex, one or more oligonucleotides may be one or more of the disclosed oligonucleotides. For example, one or more oligonucleotides may be morpholino that contains 10 bp to 40 bp, respectively.

iii) Targeting Moisture  Oligonucleotide-containing Complex  And Copolymer The carrier  One or more &lt; RTI ID = 0.0 &gt; oligonucleotides &lt; Complex  Synthesis of compositions containing

Disclosed herein is a process for synthesizing a complex comprising a targeting moiety and an oligonucleotide and a complex containing a copolymer carrier and one or more oligonucleotides, the process comprising: contacting a first and second oligonucleotide containing a targeting moiety and an oligonucleotide, Complex and a second complex containing a copolymer carrier and one or more oligonucleotides. In one embodiment, the oligonucleotide of the first complex is hybridized with one or more oligonucleotides of the second complex. In one aspect, the disclosed process may comprise fabricating a first complex. In one aspect, the disclosed process may comprise fabricating a second complex. In one aspect, the disclosed process can include producing a first complex, and producing a second complex. In one embodiment, the first complex may be any disclosed complex containing a targeting moiety and an oligonucleotide. In one embodiment, the first complex may be any disclosed complex containing a targeting moiety and an oligonucleotide. In one embodiment, the second complex may be any disclosed complex containing a copolymer carrier and one or more oligonucleotides. For example, in one aspect of the disclosed process, the targeting moiety may be a Fab 'segment specific for CD20, and the copolymer carrier may comprise an HPMA copolymer co-polymerized with MA-GG-TT monomers, May be a morpholino containing 10 bp - 40 bp, wherein the morpholino of the first complex is complementary to one or more morpholino of the second complex.

It is contemplated that each of the disclosed methods may include additional steps, operations, and / or components. It is also contemplated that any one or more of the steps, operations, and / or components may be optionally omitted. It is understood that the disclosed methods can be used to provide the disclosed compounds. It is also understood that the products according to the disclosed methods can be introduced into the disclosed methods of use.

E. Example

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, apparatus and / or methods claimed herein are made and evaluated and are merely illustrative of the present invention And are not intended to limit the scope of what the inventors regard as their invention. It will be apparent, however, to one skilled in the art, in light of the present disclosure, that many changes may be made in the specific embodiments disclosed, and that the same or similar results may still be obtained without departing from the spirit and scope of the invention I have to understand. Efforts have been made to ensure accuracy with respect to numbers (eg, quantity, temperature, etc.), but some errors and deviations should be accounted for.

i) In vitro  evaluation

a. Morpholino  design

A pair of 25 bp complementary morpholino (MORF1-m = 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25) and MORF2-m = 5 'TAT ATT GAT TCT CCT TGG CTT ACT C 3 '(SEQ ID NO: 26)) was designed. Morpholino was modified with 3 'primary amines using conjugation. (Fig. 2, Gene Tools, LLC (Philomath, OR)). Selection of the 25 bp oligonucleotide ensures strong binding affinity in subsequent experiments because the Kd of the two morpholino hybridizations each having 25 bp is usually at the pM level. The sequence compositions of each of the two morpholino were designed to have optimal binding efficiency and specificity. Here, the GC content of each morpholino was about 35-65%. To ensure good liquid solubility, the total G content was less than 36%. To ensure favorable pharmacokinetics by avoiding rapid renal clearance, the total number of C nucleobases was reduced to less than 7. After determining the base composition of each morpholino, a publicly accessible, online sequence "scrambler" was used to ensure minimal off-target binding with human and murine mRNA (www.sirnawizard.com/scrambled. php). In addition, publicly accessible, online sequencing software was used to ensure minimum self-complementarity (www.basic.northwestern.edu/biotools/oligocalc.html).

b. FAB '- MORF1 Complex  synthesis

Rat anti-CD20 IgG antibody (1F5) was prepared from hybridoma clone 1F5 in a bioreactor (CellMax) and purified with protein G column. The antibody was digested with pepsin to give F (ab ') ₂ fragments and further reduced with tris (2-carboxyethyl) phosphine (TCEP) to give Fab' fragments. Conjugation with Fab 'segments with succinimidyl-4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) modified morpholino (ie, morpholino with 3'-maleimide group) . Wherein the morpholino is represented by SEQ ID NO: 25, has a thiol-reactive 3'-maleimido group, and the conjugation is via a thioether linkage. The final product was a Fab'-MORF1 complex (Figure 3A). The Fab'-MORF1 complex was labeled with rhodamine for imaging.

c. Copolymer - MORF2 Complex  synthesis

HPMA copolymers containing side chains with amine-reactive thiazolidin-2-thione (TT) groups were synthesized by reversible addition-fragmentation chain transfer (RAFT) polymerization. RAFT polymerisation is known in the art (Figure 3B). N-methacryloylglycylglycine-TT (MA-GG-TT) monomers were used to introduce TT through a glycine-glycine spacer. A small amount of co-monomer containing FITC (fluorescein isothiocyanate) was optionally added for imaging purposes. Using RAFT polymerization, a polymer backbone with a narrow molecular weight distribution was reproducibly synthesized. The side chain TT group was reacted with amine-derivatized MORF2 (SEQ ID NO: 26) to produce HPMA copolymer grafted with multiple copies of MORF2 via stable amide linkages. The product obtained is a copolymer-MORF2 complex. A copolymer-MORF2 complex (i.e., a number of morpholino grafted with a copolymer chain) having different valences was synthesized to enable comparison of the biological effects of these complexes. The copolymer-MORF2 complex was labeled with FITC for imaging purposes (Fig. 3B).

d. Complex In vitro  evaluation

In vitro hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex was determined by the following three methods: (1) UV-Vis spectrophotometer (absorbance reduction effect at absorbance 260 nm or higher due to hybridization), (2) SDS-PAGE (resulting in gel retardation due to hybridization), and (3) dynamic light scattering (hydrodynamic effective diameter changes due to hybridization). At the cellular level, the human bucket's B cell non-Hodgkin's lymphoma Raji cells (ATCC, Bethesda, MD) were incubated with the biological recognition of the Fab'-MORF1 complex and the copolymer-MORF2 complex was used to study biorecognition. Recognition and binding of complexes on the cell surface of large cells were examined by confocal fluorescence microscopy. The induction of apoptosis was analyzed using three different methods: (1) caspase-3 activation (i.e., apoptosis gene expression), (2) annexin V / propidium iodide (PI) (3) terminal deoxynucleotidyltransferase dUTP nick end-labeling (TUNEL) analysis (i. E., Genomic DNA segmentation in the late apoptotic process). Through this study, goat anti-mouse (GAM) secondary Ab and hyper-cross-linked 1F5 mAb were used as clinically relevant positive controls. In addition, human NHL DG-75 B-cells that did not express CD20 or expressed at low levels were used as negative control cell lines.

A series of control experiments were performed to evaluate the hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex, as well as to assess the direct impact of this hybridization on induction of apoptosis. In particular, the following experimental procedure was performed: (1) single-component treatment of the Fab'-MORF1 complex, (2) single-component treatment of the copolymer-MORF2 complex, (3) Fab'-MORF1 complex + Component processing of (4) the copolymer-MORF2 complex plus the free Fab 'segment, and (5) an excess of (i) free and unconjugated MORF1 and (ii) free and conjugated "Blocking " control handled with non-MORF2 (e.g., pre-MORF1 and pre-MORF2 that compete with the combination of the complex).

The Fab'-MORF1 complex and the copolymer-MORF2 complex were successfully synthesized, as confirmed by FPLC, HPLC, UV-Vis spectrophotometer and MALDI-ToF mass spectrometer. In vitro hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex was performed by (1) UV-Vis spectrophotometer (absorbance reduction at absorbance above 260 nm due to hybridization), (2) SDS-PAGE Gel retardation), and (3) dynamic light scattering (DLS) (Fig. 4). The fast binding rate (~ 10 min) of hybridization between the Fab'-MORF1 complex and the copolymer-MORF2 complex was demonstrated by the remarkable and rapid increase in the hydrodynamic effective diameter of the particles when mixing the two complexes ( Confirmed by DLS). In this experiment, the hydrodynamic effective diameter of each MORF complex as well as the two MORF complex mixtures (MORF1: MORF2 molar ratio of 1: 1) was analyzed. Fast hybridization (~ 10 min) of the Fab'-MORF1 complex and the copolymer-MORF2 complex is reflected by similar particle sizes measured at 10 min, 30 min, and 60 min after mixing. Measurements were made 3 times. Hybridization was very rapid compared to the hybridization of coiled-coil peptide formation (~ 60 min) (Wu et al, 2010, see self-assembly of anti-CD20 Fab'-CCE peptide and HPMA copolymer-CCK peptide) .

e. Experiment result

Non-Hodgkin's lymphoma (NHL) is a common cancer worldwide with a high mortality rate. About 85% of the NHL is B-cell origin and has cell surface antigen CD20 in over 95% of B-cell lymphomas. Thus, the biological recognition of the two MORF complexes on the cell surface of large B-cells (Raji B-cells) (i.e., cells exhibiting high CD20 expression) was measured by confocal fluorescence microscopy (Fig. 5). In Figure 5, the following abbreviations apply: Trans-Transfected-cell images obtained under transmitted light; R-red channel; G-Green channel; O-R and G overlay. When B cells were exposed to a Fab'-MORF1 complex (labeled with rhodamine), the Fab'-MORF1 complex bound to CD20 (indicated by a red signal) and the B cell surface was "decorated" with the Fab'-MORF1 complex ". Cells exposed to the copolymer-MORF2 complex (labeled with FITC) showed no fluorescence signal and appeared to be due to the absence of a biological recognition pair. However, when both complexes are used (the Fab'-MORF1 complex and the copolymer-MORF2 complex), both treatment protocols (ie, the process of simultaneously exposing the two complexes ("premixed" Exposure treatment) appeared to co-localize the two complexes on the B-cell surface, thus resulting in hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex (indicated by yellow fluorescence ). This hybridization is indicated by the overlay of the fluorescent signal on the surface of the B-cell.

Simultaneous or preparative treatment protocols have been shown to produce stronger fluorescence signals at the cell surface and are the result of the multivalency of preformulated complexes with higher binding affinities. In the control experiments, a preliminary blend of FITC-labeled Fab'-MORF1 complex and pre-polymer (i.e., not the copolymer-MORF2 complex) appeared only as a red signal on the B-cell surface. Similarly, in the control experiments, preliminary blends of Fab'-MORF1 complex and excess free, unconjugated MORF1 appeared only as red signals on the B-cell surface. These results confirm that the MORF1 complex hybridizes to the MORF2 complex, resulting in excellent biological recognition.

The efficiency of hybridization between the two MORF complexes has proven to be much better than that between other molecules (eg, coiled-coil peptides). For example, a molar ratio of 1: 1 (MORF1: MORF2) was applied. In contrast to the excellent hybridization efficiency and biological recognition provided by the compositions and methods disclosed herein, the co-ed coil peptide was required to exceed 25X of the second peptide to achieve observable biological recognition. These experiments demonstrate that the morpholino on the copolymer chain exhibits better accessibility than the co-ordinated-coil peptide. The improved accessibility of the conjugated morpholino with a faster binding rate (as evidenced by the DLS results in Figure 4) demonstrates that the disclosed compositions containing morpholino have advantages in inducing apoptosis and in in vivo therapeutic efficacy .

The induction of apoptosis of large B-cells (Raji B-cells) after the disclosed complex treatment with morpholino was confirmed in three distinct ways: (A) caspase-3 activation, (B) annexin V / Propidium iodide (PI) bond, and (C) TUNEL assay method. (Figs. 6A-6C). Treatment of the two complexes (Fab'-MORF1 complex and the copolymer-MORF2 complex) resulted in a detectable level of apoptosis when treated consecutively or with a premix. The level of induction of apoptosis in the control (i. E., The single-treatment group (Fab'-MORF1 complex alone or copolymer-MORF2 complex alone) was not statistically different from that in untreated cells. When the molar ratio of MORF1: MORF2 was 1: 10, the level of induction of apoptosis was not different from that of the group using MORF1: MORF2 molar ratio of 1: 1. These experimental results indicate that the MORF1 binding site on the cell surface is potentially saturated. These experimental results also confirm that the accessibility of the morpholino to the copolymer chains is very good. In the experiment shown in Fig. 6A-6C, two different morpholino complex or 1F5 mAb is 2x 10 ⁵ cells /0.4 mL (caspase-3 (Figure 6A) and annexin V / PI analysis of 0.5 μM (Figure 6B ) Or 10 ⁶ cells / 0.5 mL (TUNEL assay (Fig. 6C)). All experiments were performed three times.

Table 3 shows the results of a side-by-side comparison of apoptosis between the morpholino complex and the coiled-coil peptide disclosed herein. In this experiment, the apoptosis index (%) of human NHL large B-cells was evaluated for the same number of cells and concentration (2 x 10 ⁵ cells in 400 μL culture). The molar ratio between the two components is 1: 1 (CCE: CCK or MORF1: MORF2). The molecular weight of the polymer backbone is also very similar (~ 100 kDa). Experimental results showed that morpholino-based compositions and methods, which were tested at lower concentrations or lower valencies of the polymer conjugate, induced a higher level of apoptosis as compared to the Coil-coil system. Experimental results have been presented in both treatment protocols (i.e., treating the complexes sequentially here, or where the complexes are treated with a premix composition).

In Table 3, the cell death index (%) was assessed via annexin V / PI binding assay and quantitated by flow cytometry. Both systems were compared at time intervals corresponding to maximum apoptosis (i.e., 12 hours in the case of coiled-coil peptides (CCE-CCK) and 48 hours in the case of MORF1-MORF2 hybridization). The molarity of the Fab '(CCE- or MORF1-equivalent) and the valence of the polymer conjugate (# CCK or # MORF2 / chain) are listed.

As shown in Fig. 7, as the concentration of the complex increases (from 0.5 μM to 1 μM, 2 μM, and 5 μM in FIG. 6), the cell death level increases (FIG. 7). The dose-dependence of the level of induction of apoptosis was measured in both treatment protocols (i.e., treatment of the two complexes with the premix composition or sequential treatment of the two complexes) as well as in the positive control (1F5 mAb + goat anti-mouse secondary antibody) All were observed. When the concentration increased from 2 to 5 μM, the cell death index of the positive control cells began to saturate. However, saturation was not observed in the treatment protocol using hybridization of the Fab'-MORF1 complex and the copolymer-MORF2 complex. In Figure 7, morpholino complex or 1F5 mAb was administered to 2 x 10 ⁵ cells in 0.4 mL of culture medium to 1 μM, 2 μM, or the concentration of 5 μM. The incubation time was 48 hours and analyzed by flow cytometry.

Figures 8A-8B show some control experiment results. (i) pre-blended Fab'-MORF1 complex and pre-polymer (i.e., no MORF2) or (ii) preprogrammed copolymer-MORF2 complex and pre-Fab ' Similar induction of apoptosis was observed when compared to the induction of apoptosis of treated cells. In the case of a protocol using a continuously treated "blocking" control (i.e., when the complexes were premixed with excess free MORF1 or excess free MORF2 to compete at the binding site for hybridization), induction of apoptosis was also not observed. Experimental results have shown that the hybridization of MORF1-MORF2 is necessary for inducing apoptosis. Finally, negative control (Figure 8B) was analyzed by Annexin V / propidium iodide assay using the NHL B-cell line DG-75 without cell surface CD20 expression. DG-75 cell exposure did not induce very low or even no apoptosis. The experimental results demonstrate that the disclosed morpholino-based approach is mediated by CD20 cross linking in vitro. 8A and 8B, P-deMF2 represents a pre-formulated copolymer-MORF2 complex (20X excess, 1 hour at room temperature) pre-mixed with pre-MORF1 and Fab'-deMF1 represents a Fab'-MORF1 complex preformulated with pre-MORF2 (20X excess, 1 hour at room temperature).

ii) In vivo  Experiment

a. In vivo  Experiment # 1

To provide a high-order NHL animal model, large SCID (C. B-17) mice can be transplanted with large B-cells (Raji B-cells) intravenously. In this model, dissemination, infiltration, and growth of malignant (NHL) B-cells in various organs, especially spinal cord and bone marrow, occur. In subjects, hind limb paralysis and lethality occur. Thus, after administration of the composition disclosed in the subject or the disclosed complex, the elapsed time to the onset of the hind palsy can be measured. Here, the elapsed time until the paralysis after administration can be used as an index of the therapeutic effect.

Immunogenicity of the Fab'-MORF1 complex and the copolymer-MORF2 complex can be assessed in immunologically competent (eg Balb / C) mice. Enzyme-linked immunosorbent assay (ELISA) can detect early cytokine release (eg, IFNα, TNFα) in mouse blood when iv-injected with conjugate and can detect intestinal secretions from the blood and spleen of immunized Balb / - Period antibody production can be detected.

b. In vivo  Experiment # 2

Hybridized nanomaterials composed of synthesized biological building blocks have high potential for designing nanomedicine. A therapeutic platform was designed to mimic the mechanism of immune effector cells cross-linked to the surface receptors of target cells and induce apoptosis. The platform was tested for B-cell lymphoma highly expressing surface antigen CD20. Two nanoconjugates were synthesized: (1) an anti-CD20 Fab 'segment covalently linked to a single-stranded morpholino oligonucleotide (MORF1) and (2) a multi-copy grafted N- terminus of the complementary oligonucleotide MORF2 (2-hydroxypropyl) methacrylamide (HPMA). The two conjugates are self-assembled via MORF1-MORF2 hybridization at the surface of CD20 ⁺ malignant B-cells and cross-linked with the CD20 antigen to initiate cell death. When tested in a murine model of human non-Hodgkin's lymphoma, both conjugates removed cancer cells when administered consecutively or as a premix, and survived for a long time. The experiments disclosed herein demonstrate that the disclosed methods and compositions and complexes do not contain small-molecule cytotoxic compounds and are immuno-independent.

Molecular biological cognition is a fundamental feature of life - many biological processes are governed by the complexity, specific interactions between macromolecules, such as antibody-antigen binding and DNA base pairs. This kind of high-fidelity awareness motif has been used in many studies such as drug delivery (Douglas et al, 2012; Mulvey et al, 2013; Lu et al, 1999), tissue engineering (Gungormus et al, 2010; Holmes et al, Can be applied to the design of self-assembled nanobiomaterials to be applied to other applications (Yuan et al, 2008; Ehrick et al., 2005; Liu et al, 2006). A new direction of research is the use of materials that are precisely defined as so-called "smart" substances that incite or modulate cellular activity (Wu et al., 2010; Cho et al, 2012; Kopecek et al. , 2012). As disclosed herein, the sole use of a substance exhibits a therapeutic effect, without any conventional drugs.

Non-Hodgkin's lymphoma (NHL) is a globally common cancer with high mortality (Siegel et al, 2013). Traditional chemotherapy and radiation therapy have serious side effects, especially cytopenias, which increase the risk of infection and require transfusion. Since most of the NHLs are B-cell origin, immunotherapy using monoclonal antibodies (mAbs) targeting B-cell surface antigen CD20 has become a common treatment (Cheson et al, 2008). However, most patients are unresponsive to immunotherapy, especially in the relapse setting. For example, rituximab is the most commonly used anti-CD20 mAb and has a total response rate of less than 50% for recurrent / intractable NHL (Molina et al, 2008). This is due to the depuration of hyper-cross-linked aged mAbs in immune effector cells (Cartron et al, 2002; Smith et al, 2003). In addition, mAb administration leads to rare, but fatal, side effects such as progressive multifocal leukoencephalopathy (Allison 2010) and lung injury (Lands 2010; Kamei et al, 2010) Cell events (eg, complemment activation) (van der Kolk, et al., 2001).

A biomimetic material platform (Fig. 9) consisting of a self-assembled hybridization nano-conjugate was designed as a treatment system for B-cell lymphoma (Fig. 1). (P), a pair of complementary phosphorodiamidate morpholino oligomers (MORF1 and MORF2), and N- (2-hydroxypropyl) methacrylamide (HPMA) linear polymer (P) . Experiments described herein (1) expose malignant CD20 ⁺ B-cells to anti-CD20 Fab 'and a conjugate of MORF1 (Fab'-MORF1), the cell surface is decorated with MORF1; And (2) additionally, when decorated B-cells are co-administered with multi-copy grafted HPMA copolymer (P-MORF2) of MORF2, MORF1-MORF2 hybridization occurs with the cell surface cross- And induces apoptosis (FIG. 1). In particular, Figure 1 shows the induction of B-cell apoptosis by cross-linking CD20 antigen mediated by extracellular hybridization (MORF1-MORF2) of complementary morpholino oligonucleotides. In particular, Figure 9 shows the general design concept of the treatment platform. The two nanoconjugates self-assembled via biological recognition can be administered sequentially with pretargeting and cross linking doses, or they can be pre-formulated and used in a single dose to form constructs.

When CD20-binding antibodies are hyper-cross-linked by Fc receptor (FcR) -expressing immunoreactive cells (e.g., macrophages, natural killer cells), CD20 clustering occurs in lipid rafts, (Deans et al, 2002). Each component of the disclosed system (e. G., Fab ', morpholino oligos, HPMA polymers), when used individually, has no pharmacological effect. Induction of apoptosis is direct (i. E., Independent of immune function), specific (i. E. Targeting CD20); Thereby avoiding the side effects and problems of immunotherapy, chemotherapy and radiation therapy currently used.

The disclosed system is based on a pair of sequences complementary to morpholino (MORF) oligonucleotides. MORF Oligo forms a duplex structure by Watson-Creek base pairing (hybridization) and acts as a physical cross linker. MORF oligos have charge-neutral phosphorodiamidate backbones and have a much stronger binding affinity than DNA or RNA (Nielsen 1995). MORF Oligo is biocompatible, resistant to nuclease; This ensures in vivo stability and safety (Summerton et al, 1997). Because of these advantages, MORF oligos have been successfully used as macromolecular binders to promote therapeutic delivery (Mulvey et al, 2013; Liu et al, 2004; Mang'era et al, 2001). The HPMA copolymer disclosed herein is water-soluble and circulates for a long time in the bloodstream. The disclosed copolymers have a well-established stability profile and are widely used as therapeutic carriers (Kopecek et al, 2010). Among the liquid solutions, the linear HPMA copolymer has a random coil form and can be effectively present in the targeting moiety grafted to the side chain (Ulbrich et al, 2010).

In the experiments described herein, the development and preclinical evaluation of the proposed anti-lymphoma composition and complex (i. E., Nano medicine) was undertaken. The biological recognition of the two nanoconjugates (Fab'-MORF1 and P-MORF2) was measured. Therapeutic systems have been optimized to achieve induction of apoptosis of effective malignant B-cell lines. Excellent anticancer efficacy (100% survival without residual tumor) was demonstrated in mouse models of human NHL.

To demonstrate the concept of hybridization-mediated drug-free macromolecule therapy, CD20 was selected as a pharmacological target. CD20 is a non-internalizing receptor that is expressed on normal B-cells as well as on most NHL malignant B-cells (Stashenko et al, 1980). However, CD20 is not expressed in plasma cells (potent B-cells) and stem cells. As a result, normal human B-cells can be recovered after treatment without seriously affecting the patient's humoral immunity (Anderson et al, 1984; Kimby et al., 2005). ^{3 In} this disclosure, the anti-CD20 Fab 'segments may be introduced into a therapeutic system and the NHL may be used as a disease model to demonstrate the first case of the disclosed system.

(One) MORF1  And Of MORF2  design

The MORF oligo used was 25 bp and was about 8.5 kDa (Fig. 10A, Fig. 10C, and Fig. 2). Their 3 'ends were modified via conjugation to primary amines. The A / T / C / G content was used to achieve optimal binding effects (GC = 35-65%) and to maintain liquid solubility (G <36% (Summerton, et al, 1997)) and favorable pharmacokinetics C number <7, to prevent rapid renal absorption (Liu et al, 2004)). After determining the base composition, scrambling software generated sequences to minimize off-target binding between human and murine mRNA and was further optimized to prevent self-complementarity.

(2) FAB '- MORF1  And P- Of MORF2  Synthetic and Feature Life

The Fab 'segment from mouse anti-human CD20 IgG2a mAb (1F5) (Press et al, 1987) was ligated to the 3' end of MORF1 with a thioether linkage to produce a Fab'-MORF1 conjugate (Figure 10A) . In Figure 10A, * denotes SMCC or succinylthiamidyl-4- ( N -maleimidomethyl) cyclohexane-1-carboxylate heterobifunctional linker. The conjugate is labeled with rhodamine (RHO) for random imaging purposes. Fab'-MORF1 was successfully synthesized and confirmed by HPLC (Fig. 10B, Buffer A (H ₂ O + 0.1% trifluoroacetic acid v / v) using an Agilent Zorbax 300SB-C18 column (4.6 x 250 mm) And separation with a gradient of buffer B (acetonitrile + 0.1% trifluoroacetic acid v / v), and size exclusion chromatography (SEC) (Fig. 17A, with PBS using Sephacryl S-100 HR 16/60 column) The coupling reaction 1: 1 stoichiometry was performed and characterized by a MALDI-ToF mass spectrometer (Figure 17B) and a UV-visible light spectroscope (Figures 17C-17E) In Figure 17, the Fab'-MORF1 profile was demonstrated by a purification procedure by AKTA FPLC and the first peak (separated at 53 mL) yielded the conjugate (obtained during the purification procedure The second peak (separated at 70 mL) represents unconjugated MORF1 (removed). Fab'-MORF1 is Fab'-S In Figure 17B, the main fraction was shown to have a molecular weight of about 57.5 kDa (Fab ': ~ 48.8 kDa, MORF1: ~ 8.6 kDa), compared to H (56 mL) (FIG. 17C), unconjugated MORF1 (FIG. 17D), and Fab 'segments (FIG. 17E) of Fab'-MORF1 The concentration of all components was 2.5 [mu] M. The Fab'-MORF1 conjugate is characterized by a mixture of absorbance 260 nm (by MORF1) and 280 nm (by Fab ').

To prepare a multivalent P-MORF2 conjugate (Fig. 10C), an HPMA copolymer containing glycyl-glycine (GG; spacer) side chains terminated with (amine-reactive) thiazolidin- Were synthesized. In FIG. 10C, MA-GG-TT refers to N-methacryloylglycylglycine thiazolidin-2-thione (MA-GG-TT). The polymer precursor (P-TT) was synthesized by reversible addition-fragmentation chain transfer (RAFT) polymerization. Polymerizable fluorene isothiocyanate (FITC) derivatives were optionally added for imaging purposes. Using RAFT polymerization, a polymer backbone with a narrow MW distribution (measured by SEC, polydispersity index ≤ 1.15) was reproducibly synthesized. In addition, amine-derived oligonucleotide MORF2 shoe (MORF2-NH ₂₎ is grafted through a stable amide bond to the side chain of HPMA was approached generate P-MORF2. The conjugate was purified and measured by SEC (Fig. 10D). Figure 10D shows SEC analysis of representative P-TT and P-MORF2 (valence = 3) using Superose 6 HR10 / 30 column (acetate buffer + 30% acetonitrile v / v). Three different P-MORF2's with various backbone MW and valencies (i.e., the number of MORF2 per polymer chain) were synthesized (Figures 18A-18E). The backbone number average molecular weight (Mn) of the conjugate ranged from 70 to 136 kDa. The valences of the three P-MORF2 materials were 2, 3 and 10, respectively.

Figure 18 depicts the results of the ELISA using a SEC-purified P-MORF2 conjugate (1 mg / mL (Figure 18A)), unconjugated MORF2 (2.5 M (Figure 18B), and HPMA polymer (P) 18C)). &Lt; / RTI &gt; The multivalent P-MORF2 conjugate is characterized by a UV absorbance at 260 nm (due to MORF2). Figure 18D is synthesized to provide a table summarizing the physico-chemical properties of the different P-MORF2 conjugates and their polymer precursors (P-TT) used in the experiments described herein. The number average molecular weight (Mn) and polydispersity (Pd) were measured by SEC. The number of thiazolidin-2-thione (TT) groups (TT / P) per polymer chain was determined by UV absorbance at 305 nm; The FITC number per chain (FITC / P) was determined by the absorbance at 495 nm; The number of MORF2 oligos per chain (MORF2 / P) was determined by UV absorbance at 260 nm. Figure 18E shows size exclusion chromatography (SEC) by PTA MORF2 # 3 and AKTA FPLC of its P-TT polymer precursor; Super Rose 6 HR10 / 30 column (acetate buffer pH 6.5 + 30% acetonitrile v / v) analysis. The retention limit for this column is about 7 mL.

(3) FAB '- MORF1  And P- Of MORF2 In vitro Hybridization

Hybridization via MORF1-MORF2 biological recognition of the two conjugates was first evaluated with a UV-visible light spectrometer. The two conjugates were mixed at different ratios and the optical density (by bases) was measured at 260 nm. When Fab'-MORF1 and P-MORF2 were mixed, a " hypochromic effect "was observed (Fig. 11A); When a molar ratio of 1: 1 (MORF1: MORF2) was used, OD260 nm reached its minimum value. This reduction is due to the hydrogen bonding between the complementary bases which limits the resonance of the aromatic ring. Using the same method, hybridization of free, unconjugated MORF1 and MORF2 and the same hemoglobin reduction were observed (Figure 19). In Figure 19, the optical density (OD) at 260 nm decreased when both MORFs (in PBS, pH = 7.4) were mixed (at different%). The experimental values represent the mean value SD (n = 3). The results indicate that the MORF1-MORF2 hybridization function is retained after conjugation to Fab 'or polymer.

The binding of Fab'-MORF1 and P-MORF2 was also measured by dynamic light scattering (DLS) (FIG. 11B, FIG. 20). As shown in FIG. 11B, a remarkable and rapid increase in hydrodynamic size was observed when the two conjugates were mixed (MORF1 / MORF2 of the same mole). The fastest diameter achieved (~ 40 nm) reflects the fast binding rate (<10 min) of the MORF1-MORF2 hybridization of the conjugate. This feature is advantageous for the design of drug-free macromolecular therapy. In Fig. 11B, the valence of P-MORF2 was 3. Statistics were performed as compared to mixtures with P-MORF2 (* p <0.05, ** p <0.005, n.s .: = no significant difference) unless otherwise stated. In Figure 20, all components were dissolved in PBS (pH = 7.4) and the lines were measured with a Nanosphere ™ polystyrene size standard with a diameter of 102 ± 3 nm (STD 100 nm). The experimental values represent the mean value SD (n = 3).

The melting point (Tm) at physiological conditions (PBS pH = 7.4) of the Fab'-MORF1 / P-MORF2 complex was measured using a circular dichroism (CD) spectrometer (FIG. 11C). First, a distinct optical feature (maximum at 260 nm, minimum at 210 nm) representing the A-type double helix structure (Johnson et al., 2000) was observed when the two conjugates were mixed; A similar CD profile was observed when unconjugated MORF1 and MORF2 were mixed (Fig. 21A-21D).

For example, Figure 21 shows CD spectra of free, unconjugated MORFs, conjugates, and mixtures thereof for hybridization assays. All components were dissolved in PBS (pH 7.4) at 50 μM MORF equivalent concentration. The y-axis represents the molar ellipticity (?). Figure 21A shows free MORF1, MORF2, and equimolar mixtures thereof. When mixed, optical characteristics (maximum at 260 nm, minimum at 210 nm) indicate that an A-type double helix structure has been obtained. Figure 21B shows a comparison of P-MORF2 (valence = 3) with free MORF2. The same spectrum was observed. Figure 21C shows the Fab'-MORF1 conjugate compared to the pre-Fab 'segment and free MORF1. The conjugate appeared to have mixed optical properties of Fab 'and MORF1. Figure 21D shows that when the P-MORF2 is mixed with one of the free MORF1 or Fab'-MORF1 (equimolar MORF1 / MORF2), the CD spectrum is shifted to that of the single strand MORF2 to represent the A- type double stranded oligos. This shift in spectrum indicates that the MORF1-MORF2 hybridization function is retained even after conjugation with the Fab 'or polymer.

Second, thermal melting studies were performed to analyze the Fab'-MORF1 and P-MORF2 mixtures. The above-mentioned CD characteristics are no longer present at 95 캜; The positive band was bathochromic shifted at 260 nm and peaked at about the center of about 275 nm (Figs. 22A-22B, Figs. 23A-23C). The heat-melt curve shown in Fig. 11C demonstrates that the signal at 260 nm decreases to an sigmoidal pattern with increasing temperature. The nonlinear regression results show a Tm value of about 57 to 62 ° C. Tm is the above-mentioned body temperature, and indicates binding stability in vivo. The melting point Tm in FIG. 11C can be obtained by fitting the data to a logistic function using nonlinear regression (GraphPad Prism 5 software). All experiments were performed under physiological conditions (PBS, pH = 7.4). The experimental values represent the mean value SD (n = 3)

Figures 22A-22B show the melting point (Tm) analysis results for hybridizing Fab'-MORF1 / P-MORF2 with a CD spectrometer. Figure 22A shows CD spectra of Fab'-MORF1 (5 μM MORF1-eqv.) And P-MORF2 / v3 (5 μM MORF2-eqv .; valence = 3) in PBS (pH 7.4) at different temperature conditions. As the temperature increased from 25 캜 to 60 캜 and 95 캜, the positive band was bathochromic shifted at 260 nm, indicating that a peak was located at the center near about 275 nm. The molar ellipticity (θ) at 260 nm was used in the next thermal melting study. 22B shows the CD column melting curve of the hybridized Fab'-MORF1 / P-MORF2. As the temperature increased, sigmoidal decay of the θ at 260 nm appeared. The experimental values represent the mean value SD (n = 3). Said data fitting according to a logistic function to obtain Tm; The nonlinear regression results were Tm = 60-62 ℃. The forward scan (as the temperature increases) analysis as shown here has similar results to the reverse scan (with temperature reduction - see Figure 11C).

Figure 23 shows the melting point (Tm) analysis result of MORF1 / MORF2 hybridization that was not pre-conjugated to a CD spectrometer. For example, Figure 23A shows CD spectra of a mixture of MORF1 (5 [mu] M) and MORF2 (5 [mu] M) in PBS (pH 7.4) at different temperature conditions. As the temperature increased from 25 캜 to 60 캜 and 95 캜, the positive band was bathochromic shifted at 260 nm, indicating that a peak was located at the center near about 275 nm. The molar ellipticity (θ) at 260 nm was used in the next thermal melting study. Figure 23B shows the forward CD thermal-melting curve of the hybridized MORF1 / MORF2, and the data is collected as the temperature increases. Figure 23C shows the reverse CD thermal-melt curve of the hybridized MORF1 / MORF2, and the data is collected as the temperature decreases. The profiles showing S-shaped changes of θ at 260 nm were the same for both forward and reverse scans. The experimental values represent the mean value SD (n = 3). The nonlinear regression results using the logistic function are Tm = 57-61 ° C.

(4) On the B-cell surface FAB '- MORF1  And P- Of MORF2  Biological recognition

Study of the biological recognition of Fab'-MORF1 and P-MORF2 (valence = 2) at the cell surface by human B-cell lymphoma Raji cell line (CD20 ⁺ ) (Stashenko et al, 1980; Shan et al, 1998) . Confocal fluorescence microscopy was used in this experiment. First, when Raji cells were exposed to rhodamine-labeled Fab'-MORF1, Fab'-MORF1 bound to CD20 and decorated with red signal (RHO) on the cell surface; Cells exposed only to FITC-labeled P-MORF2 did not show any fluorescence signal (Fig. 12A, Fab'-MORF1, 0.4 μM or P-MORF2, 0.4 μM, MORF2 equivalent). Second, Raji cells were all transfected with fluorescently labeled conjugates (Fab'-MORF1 + P-MORF2), consecutively (hourly intervals) or as preliminary blends (ie, Fab'-MORF1 (0.4 μM) and P-MORF2 0.4 [mu] M), a mixture of MORF2 equivalents), red and green (FITC) signals appeared to co-locate well on the surface of B-cells (Figure 12B). These results indicate that MORF1-MORF2 hybridization has been successfully performed on the cell surface. FIG. 12C shows the results of two groups of control: (1) cells exposed to a pre-combination of Fab'-MORF1 (-RHO) and HPMA copolymer with a FITC die but no MORF2 (P-FITC, excess); (2) Cells were exposed to a continuous mixture of Fab'-MORF1 (0.5 μM) (-RHO) and P-MORF2 (-FITC) and excess unconjugated MORF1 P-dsMORF) &lt; / RTI &gt; represents a microscope image obtained in a "pre-blocking" control. In all control administrations, the absence of a biological recognition pair resulted in a red signal on the cell surface (FIG. 12C). Experimental results of the control group indicated that, in fact, the cell surface biological recognition of Fab'-MORF1 and P-MORF2 was mediated by MORF1-MORF2 hybridization.

(5) induction of apoptosis of human NHL B-cells

The induction of apoptosis of human B-cell lines (Raji and DG75) was evaluated in three ways: caspase-3 activity assay, annexin V / propidium iodide (PI) binding assay, and terminal deoxynucleotidyl Transferase dUTP nick end-labeling (TUNEL) analysis. In this experiment, the function of FcR + immunoreactor cells was mimicked using a goat anti-mouse secondary antibody (2 ° antibody) and hyper-cross-linked anti-CD20 1F5 mAb as a positive control (Shan et al, 1998 ). The control group partially showed the therapeutic effect of anti-CD20 mAbs. Experimental results have shown that Fab'-MORF1 and P-MORF2, when treated together or continuously in the form of a premix, effectively induce apoptosis of Raji B-cells (FIG. 13). Conversely, when one of Fab'-MORF1 or P-MORF2 was treated as a single-component, apoptosis was not initiated. A series of control experiments (FIG. 24) demonstrated the hypothesis that cross-linking, which occurs simultaneously with the CD20 antigen of MORF1-MORF2, induces induction of apoptosis. Raji cells were exposed to: (1) a mixture of Fab'-MORF1 and the polymer precursor P-TT; (2) a mixture of Fab 'and P-MORF2; (3) A "pre-blocked" conjugate in which the RF1 or MORF2 binding site is blocked by excess unconjugated complementary MORFs before treatment. All of the treatment groups did not induce apoptosis, as there was no MORF1-MORF2 hybridization (Fig. 24A). In addition, apoptosis of negative control B-cell line (DG75) that did not (or at least expressed) CD20 was evaluated (Ben-Bassat et al., 1977). The level of apoptosis after treatment of the two nanocomposites together was very low, similar to that of untreated cells (Figure 24B). The results indicate that CD20 binding is a necessary step in inducing apoptosis.

For example, Figure 24 shows in vitro cell death control studies by Annexin V / PI binding assay. Figure 24A shows induction of Raji B-cell apoptosis (high expression of CD20). The incubation time was 48 hours. Figure 24B shows the induction of apoptosis of DG75 B-cells (minimal or no CD20 expression). The incubation time was 48 hours. The following indication applies to Figures 24A and 24B: untreated: cells in culture; mAb + 2 ° Ab: 1F5 mAb (0.5 μM) followed by (after 1 hour) goat anti-mouse secondary Ab (0.25 μM); Fab'-MORF1: 0.5 μM single-component; P-MORF2: single-component (MORF2 equivalent) of P-MORF2 / v3 at 0.5 [mu] M; Consecutive: Fab'-MORF1 (0.5 μM) followed by (after 1 hour) P-MORF2 / v3 (0.5 μM MORF2-eqv.); Premixed: pre-combination of Fab'-MORF1 (0.5 μM) and P-MORF2 / v3 (0.5 μM MORF2-eqv.); Fab'-MORF1 + P-TT: preformulation of the polymer precursor (1 mg / mL) of Fab'-MORF1 (0.5 μM) and P-TT # 2; Pre-combination of Fab'-MORF1 + P-TT: Fab'-SH + P-MORF2: free Fab '(0.5 μM) and P-MORF2 (0.5 μM MORF2-eqv.); (1-h intervals) of Fab'-MORF1 + P-dsMORF: Fab'-MORF1 (0.5 μM) and "pre-blocked" P-MORF2 Of free MORF1 (1 hour before dosing); Fab'-dsMORF + P-MORF2: Sequential administration (1-h spacing) of "pre-blocked" Fab'-MORF1 (0.5 μM) and P-MORF2 (0.5 μM MORF2- The MORF1 binding site of MORF1 was blocked by an excess of free MORF2 (1 hour before dosing). Percentage of killed cells was quantified by flow cytometry. The experimental values represent the mean value SD (n = 3).

(6) Optimization of cell death induction

To optimize the disclosed therapeutic system, several factors affecting the apoptosis of Raji B-cells, including the concentration of the conjugate, the ratio between the two conjugates, the valency of P-MORF2, and the exposure time, The effects were tested. P-MORF2 (P-MORF2 / v3) containing about 3 oligos per polymer chain was first used. Analysis of annexin V / PI staining revealed that 1 μM Fab'-MORF1 and equimolar P-MORF2 / v3 (MORF1: MORF2 = 1: 1) induce apoptosis by about 40% Higher) (Fig. 13A). In Fig. 13A, the following applies: what has been done: cells in culture; mAb + 2 ° Ab: 1F5 mAb (1 μM) followed by (after 1 hour) goat anti-mouse secondary Ab (0.5 μM); Fab'-MORF1: 1 [mu] M single-component; P-MORF2: 1 [mu] M P-MORF2 / v3 single-component (MORF2-eqv.); Consecutive: Fab'-MORF1 (1 μM) followed by P-MORF2 / v3 (1 μM) (after 1 hour); Pre-formulated: pre-combination of Fab'-MORF1 (1 μM) and P-MORF2 / v3 (1 μM). Unless otherwise noted, each group was compared to the untreated group (*** p <0.0001, n.s = statistically insignificant).

All conditions were kept the same except for the concentration of Fab'-MORF1 (and the corresponding P-MORF2 / v3), and concentration-dependent apoptosis induction was observed (FIG. 13B). In Figure 13B, the following applies: ** p < 0.005, n. = Statistically insignificant. Experimental results show that increasing the conjugate concentration from 0.5 μM to 2 and 5 μM (Fab 'equivalent) also leads to higher cell death. A dose-dependent trend was also observed in both the continuous and pre-combination regimen as well as in the positive control (mAb + 2 ° Ab). At the highest concentration tested (5 μM), apoptosis induced by the drug-free macromolecular therapeutic agent (Fab'-MORF1 + P-MORF2 / v3) was approximately seven times that of the untreated control. In addition, the percentage of killed cells induced by mAb + 2 [deg.] Ab was found to be saturated when the concentration of 1F5 mAb increased from 2 to 5 [mu] M; However, this saturation was not observed for the disclosed compositions and complexes in the sub-treatment group. This difference appears to be due to P-MORF2 having multiple binding interactions, which is in contrast to the mAbs having only two binding sites.

In addition, the effect of the valency of P-MORF2 and the ratio between Fab'-MORF1 and P-MORF2 on the induction of apoptosis of Raji B-cells was examined. High-valence P-MORF2 (P-MORF2 / v10) and P-MORF2 / v3 (3 oligos per chain) containing 10 oligoglypses per chain were compared. As a result of the experiment, the same results were obtained at all treatment conditions (0.5 μM Fab ', MORF1: MORF2 = 1: 1 or 1:10) and the P-MORF2 / v10 conjugate was twice as high as P-MORF2 / v3 Indicating the level of apoptosis (Figure 13C). In the case of continuous administration of Fab'-MORF1 and P-MORF2 / v10, chlorine anti-mouse secondary Ab (0.25 [mu] M) after positive control (continuous administration of mAb and 2 [ Induced apoptosis more effectively. The observed higher levels of apoptosis induction appear to be due to the multivalency of P-MORF2 / v10, which is due to more effective CD20 clustering as well as higher avidity for B-cells (Johnson et al., 2009, 2012; Chu et al, 2012). (MORF1: MORF2 = 1: 10) using a 10-fold excess of P-MORF2, whereas the equimolar MORF1 / MORF2 (Fig. 13C), compared with the case where the cells were treated with the control. Statistically, by comparison with each of the "high-valency" and "low-valence" groups (** p <0.005, n.s .: statistically insignificant). All experimental values represent the mean value SD (n = 3). The MORF1 binding site on the surface of the Fab'-MORF1-decorated cells is saturated, which means that the MORFs on the polymer chain for hybridization are accessible (minimal steric hindrance by the polymer chain). At different cell death assays and at different exposure times, the same cell death-inducing tendency was observed (FIG. 25A-FIG. 25B).

Figure 25 shows the apoptosis of Raji B-cells analyzed at different assay and at different times of culture. 25A shows a caspase-3 activation assay. Figure 25B shows the TUNEL assay. The incubation time is as shown. The following indications apply to both drawings: - the cells in culture; mAb + 2 ° Ab: 1F5 mAb (0.5 μM) followed by (after 1 hour) goat anti-mouse secondary Ab (0.25 μM); Fab'-MORF1: 0.5 μM single-component; P-MORF2: 5 mu M M-MORF2 single-component (MORF2 equivalent); Continuous (1: 1): Fab'-MORF1 (0.5 μM) followed by P-MORF2 / v3 (0.5 μM MORF2-eqv.); Continuous (1:10): Fab'-MORF1 (0.5 μM) followed by P-MORF2 / v3 (5 μM MORF2-eqv.) After (1 hour); Pre-formulated (1: 1): pre-formulation of Fab'-MORF1 (0.5 μM) and P-MORF2 / v3 (0.5 μM MORF2-eqv.); Pre-formulated (1:10): pre-combination of Fab'-MORF1 (0.5 μM) and P-MORF2 / v3 (5 μM MORF2-eqv.). The percentage of cells killed was quantitated by flow cytometry. The experimental values represent the mean value SD (n = 3). The cell death rate of Raji cells was similar to that of 10-fold excess of P-MORF2 (1: 10) when treated with equimolar MORF1 / MORF2 (1: 1). These results indicate that the MORF1 binding site on the surface of the Fab'-MORF1-decorated cells is saturated.

(7) Human NHL Rats  In the model Preclinical  evaluation

The in vivo therapeutic effect of the hybridization-mediated drug-free macromolecular therapy was tested in SCID (C. B-17) with Raji B-cells distributed throughout the body. The animal model has a tumor incidence rate of almost 100% (Ghetie et al, 1990), and survival time without posthandle paralysis after treatment reflects accurately anticancer efficacy (Ghetie et al, 1992; Griffiths et al, 203). Four million Raji B-cells were injected into the tail vein on day 0; Hindlimb ratio, or mouse survival was monitored for up to 125 days. The conjugate, Fab'-MORF1 and P-MORF2 / v10 were injected continuously into the tail vein of the mice or in a premix. Mice were grouped into different groups (n = 6-7) and started to give 1- or 3-treatment doses, including compositions and complexes that were initiated 24 hours after tumor injection. Give 1-treatment capacity on day 1; Two-dose doses were given on days 1, 3 and 5. The animal survival curves are shown in Fig. Negative control mice received PBS (n = 8) and hind limb paralysis occurred 17-35 days after cancer cell injection; The median survival time was 24 days. These experimental results are consistent with the literature (Griffiths et al, 2003; Wu et al, 2012). In the case of a single administration of consecutive treatment (Cons x1; MORF1: MORF2 = 1: 1), substantially animal survival was prolonged (median survival time was 81 days). In the case of single premixing dose (Prem x1; MORF1: MORF2 = 1: 1), similar effects to continuous treatment were shown, with median survival time of 78 days. (MORF1 / MORF2 = 1: 5), giving the same dose of Fab'-MORF1 (57.5 μg / 20 g) and 5-fold excess of P-MORF2 / v10 Was significantly improved compared to when it was treated. A single dose of this treatment (Cons (1: 5) x1) showed a 67% survival rate (4/6-term survival; 125 days). The difference between in vivo and in vitro data (Fig. 13C) can be explained by the inhibition of binding saturation by diluting the conjugate in the blood when excess P-MORF2 is used. In summary, in Figure 14 the following applies: PBS: mice injected with PBS (n = 8); Cons x1: Continuous treatment of Fab'-MORF1 and P-MORF2 / v10, 1-dose (n = 7); Premix of Prem x1: Fab'-MORF1 and P-MORF2 / v10, 1 dose (n = 7); Cons (1: 5) x 1: continuous processing, MORF1: MORF2 = 1: 5, 1-capacity (n = 6); Cons x3: continuous treatment 3-dose (n = 7); Prem x3: 3 doses of the preformulation (n = 7); 1F5 mAb x3: 3 volumes of 1F5 mAb (n = 7). The survival of paralytic mice was expressed as Kaplan-Meierplat. The number of long-term viable mice in each group was expressed (if any). Statistics were performed by log-rank test (* p < 0.05, *** p < 0.0001, n.s. = Statistically insignificant)

Excellent therapeutic efficacy was observed in mice in three consecutive dosing doses (Cons x3; n = 7) or in three premix dosing doses (Prem x3; n = 7). All mice survived until the end of the test period (125 days). The survival rate was 86% for the positive control (n = 7) receiving the (i.v.) dose of the 3F equivalent of 1F5 mAb. Although the differences in the 3-dose administration groups (i.e., the disclosed compositions and complexes) were not statistically significant, the anticancer activity of the disclosed compositions and complexes, as opposed to mAbs, was associated with antibody-dependent cellular cytotoxicity (ADCC) And independent of immuno-efficacy mechanisms such as complement-dependent cytotoxicity (CDC) (Okroj et al, 2013). These experimental results indicate that the disclosed direct induction of apoptosis system can be as effective as immunotherapy while simultaneously reducing the concern of side effects associated mostly with ADCC and CDC (van der Kolk et al., 2001; Okroj et al., 2013 ).

(8) In vivo  Analysis of anti-lymphoma efficacy

0 day 4 x 10 ⁶ Raji B-cells were then exposed to another dose - PBS: mice injected with PBS; Cons x3: Fab'-MORF1 and P-MORF2 / v10 for 1, 3 and 5 consecutive days; Prem x3: 3-dose of pre-combination of Fab'-MORF1 and P-MORF2 / v10 on days 1, 3 and 5. The removal of Raji cells from SCID mice after administration of Fab'-MORF1 and P-MORF2 was confirmed by MRI, flow cytometry and histology. MRI was performed at 4-5 weeks after injection of cancer cells with a gadolinium-based contrast agent, resulting in a tumor in the lumbar spinal cord in PBS-treated control mice (Fig. 15A), whereas in mice dosed with three doses of the disclosed composition and complex , Tumor development was prevented (Figures 15B-15C). Figs. 15A-15C show T ₁ -united arrow-shaped MRIs focused on the lumbar spine of the mouse post-contrast administration. (Red arrows) were observed in the vertebrae of control mice (PBS, n = 4, Fig. 15A), but not in control mice (Cons x3 and Prem x3, n = 4). Survival of mice administered Cons x3 (Figure 15B) or Prem x3 (Figure 15C) was imaged again at 16 weeks; No recurrence of disease was observed (Figs. 26A-26C).

26 is large (Raji) injection of B- cells and after contrast medium administration in mice exposed to a different dose T ₁ - shows a bias arrow-shaped MRI. Figure 26A shows the development of tumors in the lumbar spinal cord characterized by irregular-shaped masses indicating a heterogeneous contour and tumor nodules (arrows) in PBS-treated control mice. And a gray reference indicating a range of MR signal strength (arbitrary unit). Figure 26B shows MR images of the mice injected with the disclosed composition and the complex (Cons x3), and Figure 26C shows MR images of the mice injected with the disclosed composition and complex (Prem x3), focusing on lumbar spine. Imaging was performed 105 days after cancer cell injection; No tumors were found in any of the scanned mice (n = 4).

After the mice were sacrificed, analysis of residual Raji cells (human CD10 ⁺ CD19 ⁺ ) in the femoral bone marrow was performed by flow cytometry (Fig. 15D). Two fluorescently labeled antibodies, PE-labeled mouse anti-human CD10 and APC-labeled mouse anti-human CD19 were used for flow cytometric analysis (Wu et al., 2012; Chen et al, 2010). Experimental results showed that the paralyzed animals (PBS-administered) had significantly more Raji cells in their bone marrow (obtained from the thigh), whereas in all long-lived treatment groups (Cons x3 and Prem x3) (Fig. 15E). Flow cytometry revealed Raji cells in the spinal cord of paralyzed mice (PBS-dosed), whereas in long-term survived mice (Figures 27A-27F), they were consistent with MRI data. Figure 15E also shows the effect of Raji (Raji) on the control mice (PBS, n = 6) and the disclosed compositions and complex administered mice (Cons x3 and Prem x3, n = 7 per group) as analyzed by flow cytometry (Figure 15D) ) Cells (human CD10 ⁺ CD19 ⁺ ). The points of each experimental value represent each mouse; Average%. Statistics were performed by Student's t-test (unpaired Student's t test of samples) of a non-paired samples (* p <0.05).

Fig. 27 shows flow cytometric analysis results of residual Raji B-cells in different organs / tissues of mice having tumors, in which other administrations were performed. FIG. 27 shows the results of immunohistochemical staining of cells separated from inguinal and mesenteric lymph nodes (LN) of mice and treated with PBS (FIG. 27A), cells isolated from three consecutive dose groups (FIG. 27B), and pre- (Fig. 27C). Figure 27 shows cells isolated from the spinal cord (SC) of PBS (Figure 27D), triplicate (Figure 27E), and pre-compound administration (Figure 27F) mice. The cells were stained with PE mouse anti-human CD10 and APC mouse anti-human CD19 antibody; The upper right quadrant (CD10 ⁺ CD19 ⁺ ) represents the Raji cell. Experimental results showed that PBS-administered paralytic mice (PBS) had both Raji cells in LN (n = 6) and SC (n = 3), whereas the treatment group (Cons x3, Prem x3 27B, 27C, 27E, and 27F), long-term survival mice were found to be tumor free (n = 6 per group).

In addition, histological examination revealed lymphoma distribution in liver, lung and brain of PBS-administered mice (Figs. 16A-16C). On the other hand, no tumors were found in long-term surviving mice. No toxicity was shown by administration to any tissues as supported by histological results and stable weight gain of the administered animals (Figure 28). Figure 28 shows the body weight of a mouse injected with Raji B-cells through the tail vein and exposed to different dosing conditions. Administer a single dose at day 1; 3-dose was administered on days 1, 3 and 5. Body weight was expressed as mean ± SD. The black dashed line indicates 80% of the initial average body weight of all mice. The results indicate that the disclosed compositions and complexes successfully inhibit lymphoma cell growth / distribution in vivo without acute toxicity. In FIG. 16A, in a control mouse in which Raji cells were injected and administered with PBS, metastatic tumors were detected in the liver (2 mice found in tumors / 4 mice examined) / 4) and in the brain (1/4), which is evidenced by infiltration of monomorphic lymphoma cells (asterisk) and destruction of normal tissue structures. In FIG. 16B, continuous dosing of Fab'-MORF1 and P-MORF2 3 doses (Cons x3) had no evidence of lymphoma infiltration (0/3, in all organs). In FIG. 16C, dissemination of lymphoma was prevented (0/3, in all organs) in the case of 3 doses of premixed administration (Prem x3). Were tested by blinded veterinary pathologists for hematoxylin and eosin (H & E) -stained tissue samples. No toxicity due to administration occurred in any organ tested.

(9) Related materials and methods

(a) MORF1  And MORF2

Both complementary 3'-amine-derivatized 25-mer (25-mer) phosphorodiamidate morpholino oligomers are from Gene Tools, LLC (Philomath, OR). MORF1: 5'-GAGTAAGCCAAGGAGAATCAATATA-Linker-amine-3 '(MW = 8630.5 Da); MORF2: 5'-TATATTGATTCTCCTTGGCTTACTC-Linker-amine-3 '(MW = 8438.5 Da). The structure of the linker is shown in Fig. For sequencing design, sequence scrambling software (http://www.sirnawizard.com/scrambled.php) and sequencing software (http://www.basic.northwestern.edu/biotools/oligocalc.html) were used .

(b) Fab '- Of MORF1  Produce

1F5 mAb is murine hybridoma cell sub- was prepared in bioreactor CellMax ^® (Spectrum Laboratories, Rancho Dominguez, CA ) from clones 1F5 (ATCC, Bethesda, MD) . Antibodies were harvested from the culture medium and purified with the protein G Sepharose 4 Fast Flow column (GE Healthcare, Piscataway, NJ). The Fab ' from the mAb was in accordance with the protocol presented in Fowers et al, 2001. Briefly, the mAb was digested with 10% (w / w) pepsin (Sigma, St. Louis, MO) in citric buffer (pH 4.0) to form F (ab ') ₂ . F (ab ') ₂ was reduced to Fab' using 10 mM tris (2-carboxyethyl) phosphine (Thermo Scientific, Waltham, Mass.) Just prior to conjugation. To prepare Fab'-MORF1 conjugates, MORF1 oligos containing 3'-primary amines were reacted with succinimidyl-4- ( N -maleimidomethyl) cyclohexane-1-carboxylate (SMCC) Terminated (thiol-reactive) maleimide group. Thus, MORF1 (MORF1-mal) having 3'-maleimide is prepared. MORF1-mal was conjugated with Fab '(containing a terminal thiol group) via a thioether linkage to give Fab'-MORF1. The conjugate was purified using SEC to remove free, unconjugated Fab 'and MORF1.

In particular, for the production of Fab'-MORF1 conjugate was carried out the following steps: First, 200 nmol MORF1 (3'-1 which contains a primary _{amine) - NH 2 (Gene Tools,} Philomath, OR) to 170 μL DMSO Was reacted with 0.67 mg (2 μmol) succinimidyl-4- ( N -maleimidomethyl) cyclohexane-1-carboxylate (SMCC) (Soltec Ventures, Beverly, MA) MORF1-mal was prepared. The reaction was carried out at RT (room temperature) for 24 hours. The product was isolated by precipitation in 1.5 mL of acetone, purified twice by dissolution-precipitation with deionized water-acetone, and dried in vacuo. Second, 200 nmol MORF1-mal was dissolved in 200 μL 10 mM PBS (pH 6.5), and then the solution was incubated with 200 nmol (~ 10 mg) freshly reduced Fab'-SH and . The reaction was carried out at 4 DEG C for 24 hours. Finally, the Fab'-MORF1 conjugate was purified by size exclusion chromatography (SEC) to remove free, unconjugated Fab 'and MORF1. An AKTA FPLC system (GE Healthcare, Piscataway, NJ) equipped with a Sephacryl S-100 HR16 / 60 column (GE Healthcare) separated in PBS (pH 7.2) was used. Optionally, it was labeled for imaging test, (Molecular Probes ^®, Invitrogen, Carlsbad, CA) to Fab'-MORF1 5-10 molar excess of Rhodamine Red ™ -X-succinimidyl ester (R6010). The product was purified using a PD-10 desalting column (GE Healthcare). A bicinchoninic acid (BCA) protein assay (Thermo Scientific Pierce, Rockford, Ill.) Was used to determine the Fab 'equivalent concentration of the Fab'-MORF1 conjugate. The obtained experimental values were compared with the MORF1 equivalent concentration obtained from UV-visible spectroscopy (using a molar absorption capacity of 278,000 M ^{- 1} cm &lt; ^-1 &gt;). This comparison confirmed the 1: 1 stoichiometry of the coupling reaction.

(c) P- Of MORF2  Produce

The polymer precursors (P-TT and P-TT-FITC), i.e., N- (2-hydroxypropyl) methacrylamide (HPMA), N- methacryloylglycine thiazolidin- GG-TT), and optionally copolymers of N -methacryloylaminopropyl fluorene thiourea (MA-FITC) were synthesized by RAFT copolymerization. Azobis [2- (2-imidazolin-2-yl) propane] dihydrochloride (VA-044; Wako Chemicals, Richmond, Va.) Was used as initiator and 4-cyanopentanoic acid Dithiobenzoate (CPDB) was used as a chain transfer agent. CPDB (Pan et al, 2011) and HPMA monomers (Kopecek et al, 1973), MA-GG-TT (Subr et al, 2006) and MA-FITC (Omelyaneko et al, 1998) were synthesized.

The multivalent P-MORF2 conjugate was prepared in two steps. First, a polymer precursor (P-TT), namely, N - (2-hydroxypropyl) methacrylamide (HPMA), N -methacryloylglycine thiazolidin- , And optionally (for imaging purposes only) copolymers of N -methacryloylaminopropyltrifluoroethylene thiourea (MA-FITC) were synthesized by RAFT copolymerization. The second, P-TT was prepared polyhydric the P-MORF2 reacted with MORF2-NH _2.

With respect to the synthesis of P-TT, in RAFT copolymerization, 4-cyanopentanoic dithiobenzoate (CPDB) was used as a chain transfer agent and 2,2'-azobis [2- - yl) propane] dihydrochloride (VA-044) was used as the initiator. The reaction was carried out in methanol (MeOH / H ⁺ ) containing 0.3% (v / v) acetic acid. A typical procedure was as follows: HPMA (272 mg, 1.9 mmol) and MA-GG-TT (30.1 mg, 0.1 mmol) were added to the ampoule attached to the Schlenk-line. The monomers were dissolved by the addition of 1 mL of degassed MeOH / H ⁺ and the CPDB solution (0.43 mg. MeOH / H ^{+ in} 50 μL) and VA-044 solution 0.25 mg. MeOH / H ^{+ in} 50 [mu] L) was added via syringe. Prior to ampule sealing, the mixture was bubbled with nitrogen for 15 minutes; Copolymerization was carried out at 40 DEG C for 36 hours. The copolymer was separated by precipitation in acetone, purified twice under methanol-acetone conditions using the dissolution-precipitation method, and vacuum dried. The yield of P-TT was 160 mg (53%). The number average molecular weight (Mn) and molecular weight distribution (polydispersity, Pd) of P-TT were measured by SEC using AKTA FPLC (GE Healthcare) equipped with Mini DAWN and OptilabREX detector. A Superose 6 HR10 / 30 column (GE Healthcare) was used as the mobile phase with sodium acetate buffer (pH 6.5) and 30% acetonitrile (v / v). To remove the terminal (active) dithiobenzoate group, the P-TT copolymer was reacted with 2,2'-azobis (2,4-dimethylvaleronitrile) (V-65) (Wako Chemicals, Richmond, Lt; / RTI &gt; Briefly, P-TT (39 mg, Mn = 92 kDa, ~ 0.42 mmol) and V-65 (20x excess, 2.1 mg, ~ 8.47 mmol) were added to the ampoule. After three vacuum-nitrogen cycles, 0.4 mL MeOH / H ^& lt ^{; +} & gt ^; was added to remove oxygen. The solution was bubbled with nitrogen for 15 minutes, sealed and reacted at 50 ° C for 3 hours. The end-modified copolymer was purified by precipitating twice in acetone and dried in vacuo (yield 34 mg or 86% yield). The content of TT groups in the copolymer was determined by measuring the UV absorbance at 305 nm (molar absorptivity = 10,900 M ^{- 1} cm- ¹ ; in methanol) (Subr et al, 2006). The content of FITC was determined by absorbance at 495 nm (molar absorption capacity = 82,000 M ^{- 1} cm ^-1 ; borate buffer pH 9.2 + 10% (v / v) DMF) (Omelyanenko et al, 1998).

In relation to the MORF2-NH ₂ as prepared was attached to the P-P-TT MORF2, the above-mentioned P-TT generates a polyhydric P-MORF2 reacted with MORF2-NH _2. For example, the following steps are performed: 10 mg P-TT (92 kDa; containing 3.83 μmol TT group) was mixed with 6.46 mg (766 nmol) MORF2-NH ₂ in 400 μL 10 mM PBS (pH 7.4). The solution mixture in the ampoule was stirred at room temperature for 24 hours; Then, 1 μL 1-amino-2-propanol (Sigma-Aldrich, St. Louis, Mo.) was added and stirred for another 15 minutes to aminate the unreacted TT group on the polymer chain. After the reaction, the solution was filtered through a 0.22 μm filter and the conjugate was purified by SEC using an AKTA FPLC equipped with a Superose 6 HR16 / 60 column (GE Healthcare) separated into PBS (pH 7.2). P-MORF2 is characterized by exhibiting UV absorbance at 265 nm after removal of unconjugated MORF2 (if present). To quantify the content of MORF2 and determine the valency (number of MORF2 per polymer chain), the fractionated P-MORF2 conjugate was lyophilized and dissolved in 0.1 N HCl before UV-visible light analysis. 252,000 ^- molar absorption capacity of the (M ^-1 cm ¹⁾ was used to quantify the MORF2. The valence of the P-MORF2 conjugate is calculated based on the resulting MORF2 content (as previously determined by SEC) and the Mn of the polymer backbone.

(d) FAB '- MORF1  And P- Of MORF2  analysis

UV-visible spectra were used to quantify the MORF1 and MORF2 oligos as well as the content of MORFs in the conjugates. Molar absorption capacity of MORF1 and MORF2 (at 265 nm, 0.1 N HC1) are respectively 278,000 and 252,000 ^- was a (M ^-1 cm ^1). The valence of the P-MORF2 conjugate was determined using the extinction coefficient of MORF2 and the Mn of the polymer backbone. The MORF2 equivalent concentration of the P-MORF2 conjugate was quantified using a UV-visible spectrophotometer. The Fab ' equivalence of the Fab'-MORF1 conjugate was quantified by a non-synonic acid (BCA) protein assay (Thermo Scientific Pierce, Rockford, Ill.).

Analysis of the hypochromic effect upon MORF1-MORF2 hybridization was performed using a Varian Cary 400 Bio-UV-visible spectrophotometer (Agilent Technologies, Santa Clara, Calif.). MORF1 and MORF2 (or Fab'-MORF1 and P-MORF2) were first dissolved in 1 mL PBS (pH = 7.4) at a concentration of 2.5 μM (MORF equivalent) respectively and mixed at different ratios. The final concentration of MORF oligo (MORF1 + MORF2) in all solution mixtures was kept constant (2.5 [mu] M). For example, a mixture containing 75% MORF1 (or 25% MORF2) was made by mixing 0.75 mL of a 2.5 M MORF1 solution and 0.25 mL of a 2.5 M MORF2 solution. Samples were placed in a 1-cm quartz cuvette for measurement. Optical density (OD) at 260 nm (by base) was measured. All experiments were performed three times.

The hydrodynamic effective diameters of the conjugates, Fab'-MORF1 and P-MORF2, and their precursors, Fab'-SH and P-TT were determined using Brookhaven BI-200SM goniometer and He- (pH 7.4) at room temperature with dynamic light scattering (DLS) using a BI-9000AT digital coherent equipped with a spectrophotometer (? = 633 nm). The scattering angle was 90 °. Nanoseter ™ polystyrene size standard (Thermo Scientific, Waltham, MA) having a diameter of 102 ± 3 nm (STD 100 nm) was measured as a reference. Conjugates and precursors at a concentration of about 1 mg / mL were filtered through a 0.22 μm filter. All samples exhibited a polydispersity of less than 0.2 and the average particle diameter was measured. DLS was also used to measure changes in particle size upon binding of Fab'-MORF1 and P-MORF2. Analysis was performed at different times (10 min, 30 min, and 60 min) after mixing the two conjugates (with equimolar MORF1 / MORF2 concentration). All samples contained minor population populations representing unfused Fab'-MORF1 and P-MORF2, as well as a population of particles representative of hybridized conjugates (polydisperse &lt; 0.2). The mean effective diameter of the main group was measured. All experiments were performed three times.

An Aviv 62DS CD spectrometer (Aviv Biomedical, Lakewood, NJ) with a thermoelectric temperature control system was used. General measurements (except for the hot melt analysis) were performed at 25 占 폚, and each sample was scanned at 200 nm to 340 nm at 1 nm / step (bandwidth 1 nm, each step = 2 seconds). Samples were prepared in 10 mM PBS (pH 7.4) with a 50 μM MORF equivalent concentration (Fab'-SH at 50 μM Fab'-eqv.). Prior to the experiment, the sample was filtered through a 0.22 [mu] m filter and placed in a 0.1-cm path length quartz cuvet. The resulting spectrum is subtracted from background data (PBS pH = 7.4); Data from three sequential scans were averaged. For thermal melting studies, the CD signal at 260 nm was measured (n = 3).

Fab'-MORF1 and P-MORF2 (or MORF1 and MORF2) were mixed with equimolarity ratio (5 μM / 5 μM MORF1 / MORF2) in PBS pH = 7.4 at room temperature for 1 hour. Prior to the measurement, the solution mixture was filtered and placed in a 1-cm path length quartz cuvet. Each sample was first subjected to forward scanning with increasing the temperature from 25 to 95 캜 to 2 캜 / step. At each step, the samples were equilibrated (equilibrated) for 2 minutes and averaged over 30 second data points. Thereafter, a reverse scan was performed, at which time the temperature was reduced from 95 to 25 占 to -10 占 폚 / step. At each step, the samples were equilibrated for 5 minutes and averaged over 30 seconds of data points.

The measured ellipticity (ellipticity) (θ _obs) was converted using the following equation in a molar ellipticity (θ): θ = θobs / (l * c), where 1 is the optical path (path) length of the cuvette, c MORF-eqv. Lt; / RTI &gt; To analyze the melting point (Tm) of the MORF1-MORF2 hybridization, theta (at 260 nm) was plotted against the temperature T and the data fitted to the heat-melt curve by nonlinear regression (GraphPad Prism 5 software) The following 4-parameter logistic function was used:

[theta] = [theta] min + ([theta] max - theta minimum) / [1 + (T / Tm) ^ H]

Where θ _min is the minimum molar ellipticity (at 260 nm) in the graph, θ _max is the maximum molar ellipticity (at 260 nm) in the graph, and H is the Hill slope.

(e) Confocal  Fluorescence microscope

Human Burkitt's B-cell Non-Hodgkin lymphoma Raji cell line (ATCC, Bethesda, MD) was cultured in RPMI-1640 medium (Sigma, St. Louis, MO) supplemented with 10% FBS St. Louis, Mo.) and the culture conditions were humidified at 37 ° C and 5% CO ₂ (v / v). All experiments were performed using cells in the exponential growth phase. For serial treatment, cells were plated at 10 ⁶ densities per well and 0.4 mL Fab'-MORF1-RHO (0.4 μM Fab 'equivalent) was incubated in the culture medium for 1 hour at 37 ° C temperature conditions; Cells were then washed twice with PBS and incubated with 0.4 mL P-MORF2-FITC (0.4 μM MORF2 equivalent) for 1 hour. For the pre-combination treatment, Fab'-MORF1-RHO and P-MORF2-FITC were first mixed in equimolar concentrations (0.4 μM) in the culture medium for 1 hour; Cells of the same density were then co-cultured with 0.4 mL of the pre-combination solution for 1 hour. After incubation, the cells were washed twice with PBS (to remove the medium containing the conjugate) and then stained with 14-mm microwells (MatTek Corporation, Ashland, Calif.) For imaging with an Olympus laser scanning confocal microscope , MA) in a sterile 35-mm glass bottom dish. For the control study, the concentrations of all the corresponding components were made constant, and excess amounts of P-FITC and P-dsMORF were used. Prior to analysis, cells were incubated with FITC-labeled 1F5 mAb, rhodamine-labeled F (ab ') _2, and PBS was used to adjust the channel settings and confirm CD20 binding.

(f) In vitro  Cell death test

Human NHL B-cell apoptosis was tested in three ways: caspase-3 assay, Annexin V / PI assay, and TUNEL assay. The assay examines other aspects of apoptosis - the level of caspase-3 activation indicates apoptotic protein expression; Annexin V / PI binding represents cell membrane flipping, an early apoptotic response; TUNEL analysis analyzes genomic DNA fragmentation, a late cell death reaction. Quantification of apoptotic activity (% killed cells) was performed with a flow cytometer.

In vitro induction of apoptosis in buccal B-cell non-Hodgkin's lymphoma (NHL) Raji cells following treatment of Fab'-MORF1 and P-MORF2 was tested by the following three assays : Analysis of caspase-3 activation, analysis of annexin V / propidium iodide (PI) binding, and analysis of TUNEL (terminal deoxynucleotide mediated-DUTP nick end-labeling). In all experiments, 1F5 mAb hyper-cross-linked with a goat anti-mouse (GAM) secondary antibody (2 ° Ab) (KPL, Gaithersburg, Md.) Was used as a positive control (molar ratio 1F5: GAM = 2: One). Untreated cells (in culture) were used as negative control.

To test caspase-3 activity, a Phi-PhiLux kit (Oncolmunin, Gaithersburg, Md.) Was used. For continuous administration, 2 x 10 ⁵ Raji cells were suspended in new 0.4 mL growth medium containing 0.5 μM Fab'-MORF1. Cells were incubated in a humidified atmosphere at 37 ° C and 5% CO ₂ for 1 h, then washed twice with PBS + 1% bovine serum albumin (BSA) and incubated with either 0.5 μM or 5 μM (MORF2-eqv. And resuspended in 0.4 mL medium containing P-MORF2. The cell suspension was incubated for 6 or 24 hours. For preliminary compounding treatment, 0.5 μM Fab'-MORF1 was first mixed with 0.5 μM or 5 μM (MORF2-eqv.) P-MORF2 in a culture medium at room temperature for 1 hour and then 2 × 10 ⁵ Raji ) Cells were suspended in 0.4 mL of the premix solution. The cell suspension was incubated for 6 or 24 hours. For the positive control, cells were first incubated with 0.4 mL of 0.5 μM of 1F5 mAb in culture for 1 hour, then washed twice with PBS + 1% BSA and then resuspended in 0.4 mL of fresh growth medium containing 0.25 μM GAM . Cells were incubated at 37 [deg.] C for an additional 6 or 24 hours. After administration, the cells were washed twice with PBS and analyzed for caspase-3 activity according to the manufacturer's protocol. All experiments were performed three times.

Annexin V-FITC and PI staining was performed according to the RAPID (TM) protocol provided by the manufacturer (Oncogene Research Products, Boston, Mass.). For continuous treatment, 2 x 10 ⁵ Raji or DG75 (CD20 negative; control) cells were suspended in 0.4 ml fresh growth medium containing 0.5, 1, 2 or 5 μM Fab'-MORF1. Cells were incubated at 37 ° C, 5% CO ₂ , and humidified atmosphere for 1 hour, washed twice with PBS + 1% BSA and incubated with 0.5 μM, 1 μM, 2 μM, or 5 μM (MORF2-eqv. Of &lt; RTI ID = 0.0 &gt; P-MORF2. &Lt; / RTI &gt; The cell suspension was incubated for 24 or 48 hours. For pre-combination treatment, 0.5 μM, 1 μM, 2 μM, or 5 μM Fab'-MORF1 was incubated with 0.5 μM, 1 μM, 2 μM, or 5 μM (MORF2-eqv.) P- , And 2 x 10 ⁵ Raji or DG75 cells were suspended in 0.4 ml of the premix solution. The cell suspension was incubated for 24 or 48 hours. For the positive control, cells were first incubated with 0.4 ml 0.5 μM, 1 μM, 2 μM, or 5 μM of 1F5 mAb in medium for 1 hour, washed twice with PBS + 1% BSA, mu] M, 1 [mu] M, or 2.5 [mu] M GAM. Cells were incubated at 37 [deg.] C for an additional 24 or 48 hours. Cells were washed twice with PBS prior to staining. All experiments were performed three times.

For TUNEL analysis, Apo Direct TUNEL kit (Phoenix Flow Systems, San Diego, Calif.) Was used. For sequential treatment, 10 ⁶ Raji cells were suspended in 0.5 mL new growth medium containing 0.5 μM Fab'-MORF1. Cells were incubated for 1 h at 37 ° C, 5% CO ₂ and humidified atmosphere for 1 h and then washed twice with PBS + 1% BSA followed by 0.5 μM or 5 μM (MORF2-eqv.) P-MORF2 Lt; RTI ID = 0.0 &gt; mL &lt; / RTI &gt; The cell suspension was incubated for 24 or 48 hours. For pre-blending treatment, 0.5 μM Fab'-MORF1 was mixed with 0.5 μM or 5 μM (MORF2-eqv.) P-MORF2 in the medium for 1 hour at room temperature, and 10 ⁶ Raji cells were mixed with 0.5 mL . &Lt; / RTI &gt; The cell suspension was incubated for 24 or 48 hours. For the positive control, the cells were first incubated with 0.5 ml of 0.5 M of 1F5 mAb in the culture medium for 1 hour, then washed twice with PBS + 1% BSA and then with 0.5 ml of fresh growth medium containing 0.25 μM GAM And resuspended in the medium. Cells were incubated at 37 ° C for an additional 24 or 48 hours. After administration, cells were washed twice with PBS and fixed with 2% paraformaldehyde in PBS for 1 hour at room temperature. Cells were then placed in 70% ethanol overnight at 4 ° C to allow for permeability. Prior to the analysis, nick-end labeling was performed according to the manufacturer's protocol. All experiments were done in triplicate.

(g) In vivo  Measurement of anti-cancer efficacy

200 μL of 4 x 10 ⁶ Raji cells were intravenously injected intravenously into the tail vein at about 7 weeks of age in female CB-17 SCID mice (Charles River Laboratories, Wilmington, Mass.). The animal model represents dissemination, invasion, and growth in various organs, including the spinal cord of lymphoma cells, resulting in hind palsy and subsequent mortality of animals (Ghetie et al, 1990, 1992; Griffirths et al, 2003) . The onset of hind limb paralysis is the end point of the experiment; In addition, the mice were sacrificed when the weight loss was> 20%. Animals without symptoms of paralysis / disease remained up to 125 days and were seen as long-term survivors. Conjugated, Fab'-MORF1 (57.5 μg / 20 g; 1 nmol MORF1) and P-MORF2 / v10 (22 μg / 20 g; 1 nmol MORF2) were dissolved in 100 μL PBS and successively As a premix (injected 1 hour prior to administration) into the tail vein. Inoculated mice were divided into seven groups: (1) negative control (200 μL, PBS injection), (2) single dose of consecutive treatment (Cons x1), (3) single dose of Premix (5) 3 times pre-mix treatment (Prem x3), (6) continuous treatment but with 5x excess of P-MORF2 / v10 (75 μg / 20 g; 1 nmol Fab '- equivalent per dose) with single doses (Cons (1: 5) × 1) with 1 μg / Positive control group injected through the tail vein. For the single-dose group, the conjugate was administered on day 1 (24 hours post-cancer cell injection); For multi-dose groups, the conjugate (or mAb) was given on days 1, 3, and 5. It was scanning the 4, 5, and 16 weeks in a biased MRI -, the mice (2-4 per group) T ₁ to monitor disease progression. Twenty minutes before imaging, gadobenate dimeglumine (MultiHance ^® ; Bracco SpA, Milan, Italy) was injected iv in a dose of 0.3 mmol / kg. Pre-contrast images were used for comparison.

The therapeutic effects of the co-administration of the hybridization-mediated drug-free macromolecular therapies, namely Fab'-MORF1 and P-MORF2, were evaluated in an advanced NHL animal model in which SCID (CB-17) Raji B-cells were transplanted through the vein. All treatment methods are described in the main paper. After treatment, animal monitoring was performed twice a day. The weight of the mice was recorded every other day. The main aspects of the mouse were closely evaluated and included: hind limb paralysis, food / water ingestion, vital signs of abnormal movement (eg, licking, biting, scratching, And physical appearance (eg, failure to groom, irregular appearance, abnormal rest / flexion, stiffness). An animal was sacrificed (if any first appeared) if: (1) the onset of paralysis (hind paw), and (2) the weight loss was greater than 20% at the beginning (1 day before cancer treatment) . Animals without the above-mentioned indications were sacrificed for further analysis, leaving up to 125 days (after injection of cancer cells).

To obtain in vivo MRI, mice were anesthetized with 1% -2.5% isoflurane (IsoFlo ^® , Abbott Laboratories, Abbott Park, Ill.) Under oxygen conditions from a precision vaporizer. The mouse was placed in a prone position in the coil center. A 7-Tesla Bruker Biospec MRI scanner (Bruker Biospin, Billerica, MA) with a 30-cm wide cylindrical bore and a 12-cm gradient insert was used. First, obtain a precontrast picture, and then the dolrini helpful in the mouse-contrast agent of the base, go chopping carbonate dimethoxy glue Min ^{(Multihance ®; Bracco Imaging, Milan} , Italy) an amount of 0.3 mmol / kg through the tail vein (100 μL , Physiological saline). After 20 minutes of injection, images were obtained after contrast medium administration. During scanning, mouse body temperature was maintained at 37 占 폚 using a warm-air circulation system (SA Instruments, Stony Brook, NY). Respiration was monitored continuously. Scanning was performed in the ParaVision ^® 5.1 software environment. The obtained parameters are: T ₁ -weighted FLASH sequence with retrospective gating to suppress respiratory artifacts, echo time (TE) 2.9 ms, repeat time (TR) 43.2 ms, flip angle 50 °, a six-phase plane slice with a thickness of 0.5 mm, matrix 256 x 256, field-of-view (FOV) 3 cm x 3 cm, 50 iterations. After scanning, the images were analyzed and processed in an off-line workstation (OsiriX).

(h) Residual large ( Raji ) Of cells Flow cell analyzer  analysis

Immediately after sacrificing the mice, the organ / tissue was extracted for flow cytometry analysis of the remaining Raji cells: bone marrow (femur), mesentery and inguinal lymph nodes, spinal cord and spleen. Human CD19 (IgG1, kappa iso) labeled with two fluorescently labeled antibodies, R-phycoerythrin (PE) -labeled mouse anti-human CD10 (IgG1, kappa isotype) and allophycocyanin (APC) Type) (BD Biosciences, San Jose, CA) was used to stain large B-cells (Chen et al, 2010). A single-cell suspension was prepared from organ / tissue according to the following procedure. For bone marrow, 1 mL PBS was poured into the fresh femur to obtain a cell suspension. Cells were resuspended in 5 mL erythrocyte (RBC) lysis buffer and incubated at room temperature for 5 min. The cells were then washed with 5 mL PBS, centrifuged to remove debris, resuspended in 400 μL cold wash buffer, and equally divided into 4 tubes: (1) non-stained control, (2 ) CD10 single-stained, (3) CD19 single-stained, and (4) CD10 / CD19 double-stained cells. For staining, 20 μL of each antibody was added to a 100 μL cell suspension containing about 10 ⁶ cells. Prior to analysis, the cells were incubated in the dark room at 4 ° C for 30 minutes and washed with 1.5 mL of wash buffer. For lymph nodes, spinal cord, and spleen, mechanical methods were used. The tissue was carefully dissected in a Petri dish containing 1 mL PBS with the help of tweezers. The suspension was passed through a 70-μm Falcon ™ cell strainer (BD Biosciences) to remove large clumps and residues, after which the cells were centrifuged and resuspended in 5 mL RBC lysis buffer. The rest of the process is the same as mentioned above. Analysis by flow cytometry, the recorded data of 1-1.5 x 10 ⁵ cells.

(i) pathological and histopathological examination

Immediately after sacrificing the mice, organ / tissue was extracted for pathological evaluation: brain, heart, lung, liver, spleen, kidney, spinal cord and lymph node. The organ / tissue was fixed in 10% formalin overnight at room temperature, transferred to 70% ethanol and stored. Histopathologic examinations were performed by a blinded veterinary pathologist at the ARUP laboratory (Salt Lake City, UT). The sections were cut into 4-μm thick, placed on glass slides, and stained with hematoxylin and eosin (H & E).

(j) Statistical analysis

All experiments in this study were performed at least three times. Quantified data were expressed as mean ± standard deviation (SD). Statistical analysis was performed with Student's t test and compared between the two groups, or one-way analysis of variance (ANOVA) was used to compare groups of three or more groups ( p value <0.05 Meaning there is a statistically significant difference). Animal survival analysis was performed in a log-rank test using GraphPad Prism 5 software.

iii) Experimental Advantages

Disclosed herein are systems and induction of apoptosis that include hybridization-mediated cell surface antigen cross-linking. Cellular responses (cell death) are triggered by specific biological recognition, defined as molecular levels (ie, base pairing), and are suitable for the design of precise targeted therapeutic agents. The disclosed two-step (continuous) administration provides an opportunity for prior targeting (Goodwin et al, 2001; Gun et al, 2011; Zhou et al., 2009). (Zhang et al, 2005) and polyvalent anti-CD20 Fab'-functionalized polymers (Johnson et al, 2009, 2012; Chu et al, 2012). For example, the timing of administration of the cross linking capacity (P-MORF2) can be optimized based on the biological distribution of the pre-targeting capacity (Fab'-MORF1), which is the largest tumor- Accumulation, thereby enabling more effective treatment. This approach is also useful in the treatment of solid tumors as well as disseminated diseases because it limits potential side effects associated with off-target binding. In the case of blood-based carcinomas, the binding kinetics of Fab'-MORF1 pharmacokinetics and cells with a disease of Fab'-MORF1 can be further explored to determine the optimal dosing schedule for P-MORF2 administration.

For example, to investigate optimized dosing schedules for subsequent administration of Fab'-MORF1 following a P-MORF2 conjugate, the pharmacokinetics of the Fab'-MORF1 conjugate were tested. The blood (radiation) activity-time profile of the ¹²⁵ I-labeled Fab'-MORF1 conjugate in mice is shown in Figure 29, wherein the closed circles represent the average radioactivity and as a percentage of the injected dose per gram of blood (% ID / g). Experimental values were expressed as mean ± standard deviation (n = 5). Experimental results show that P-MORF2 can be administered at ~ 5 hours (when most conjugates are removed from the blood) after iv injection of Fab'-MORF1 in order to obtain the maximum pretargeting effect in continuous administration Point. At this time, the pre-Fab'-MORF1 (which is not bound to B-cells), which interferes with hybridization, is minimal. The data show that the therapeutic effects of the proposed compositions and methods can be further optimized.

Animal studies according to the present invention showed that a single administration of Fab'-MORF1 + P-MORF2 (1: 1) at equivalent doses was more effective in preventing lymphoma transmission than a single administration of Fab'-CCE + P- (Continuous dosing: median survival of 81 days for MORFs vs. median for survival of 50 days for CCs; pre-dosing: median survival for MORFs of 78 days vs vs The median survival for CCs is 55 days). The experimental results show that the MORF oligos have better binding and accessibility on the HPMA polymer chain than the coiled-coil forming peptides. In addition, in the case of MORF1-MORF2 hybridization, a fast binding rate was observed (~ 10 minutes, measured by DLS; Figure 11B). Conversely, a much longer time was required for CCE-CCK coiled-coil formation (~ 60 min) (Wu et al, 2010). CCs etc. As a result of the comparison of MORFs, it can be seen that the compositions, complexes, and methods disclosed herein are advantageous for drug-free macromolecular therapy.

The compositions, complexes, and methods disclosed herein have at least two significant advantages: (1) they have excellent targeting properties to B-cells due to multivalency, (2) they reduce side effects associated with immune function Possibility. CD20 non-drug macromolecule therapy system using pentaheptad peptide forming anti-parallel coiled-coil heterodimer with bio-recognition moiety (Wu et al, 2010; Wu et al. al, 2012), the MORF oligos disclosed herein are able to bind faster and thus exhibit superior efficacy in the induction of tamoxifen and in vivo anti-lymphoma. Other advantages of the disclosed MORF oligos include (1 (I.e., nuclease resistance); (2) a definite binding specificity (i. E., To avoid the possibility of escaping the target); (3) a charge- Resulting in a strong binding affinity); (4) a well established safety profile (i. E., Concerns about the immunogenicity of the coiled-coil peptide are resolved); and (5) favorable pharmacokinetic s).

It will be apparent to those skilled in the art that various changes and modifications may be made therein without departing from the scope or spirit of the invention. Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims. All of the compositions and / or methods disclosed and claimed herein may be made and embodied without undue experimentation in light of the teachings herein.

F. References

Allison M. (2010) PML problems loom for Rituxan. Nat. Biotechnol. 28: 105-106.

Anderson K. C., et al. (1984) Expression of Human B Cell-Associated Antigens on Leukemias and Lymphomas: A Model of Human B Cell Differentiation. Blood 63: 1424-1433.

Ben-Bassat H., et al. (1977) Establishment of Continuous Culture of a New Type of Lymphocyte from a "Burkitt Like" Malignant Lymphoma (Line D.G.-75). Int. J. Cancer 19: 27-33.

Cang S, et al. (2012) Novel CD20 monoclonal antibodies for lymphoma therapy. J Hematol Oncol. 5:64.

Cartron G, et al. (2002) Therapeutic activity of humanized anti-CD20 monoclonal antibody and polymorphism in IgG Fc receptor Fcg gamma RIII gene. Blood 99: 754-758.

Chen X, et al. (2008) Synthesis and in vitro characterization of a dendrimer-MORF conjugate for amplification pretargeting. Bioconjugate Chemistry 19 (8): 1518-1525.

Chen WC, et al. (2010) In Vivo Targeting of B-Cell Lymphoma with Glycan Ligands of CD22. Blood, 115: 4778-4786.

Cheson BD, et al. (2008) Monoclonal Antibody Therapy for B-Cell Non- Hodgkin's Lymphoma. N. Engl. J. Med. 359: 613-626.

Cho et al. (2012) A magnetic switch for cell death signaling in vitro and in vivo systems. Nature Materials 1: 1038-1043.

Chu TW, et al. (2012) Anti-CD20 multivalent HPMA copolymer-Fab 'conjugates for direct induction of apoptosis. Biomaterials 33 (29): 7174-7181.

Chu TW, et al. (2014) Cell Surface Self-Assembly of Hybrid Nanoconjugates via Oligonucleotide Hybridization Induces Apoptosis. ACS Nano. (1): 719-730.

Deans JP, et al. (2002) CD20-Mediated Apoptosis: Signaling through Lipid Rafts. Immunology, 107: 176-182.

Douglas SM, et al. (2012) A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads. Science 335: 831-834.

Du et al. (2009) Structure of the Fab 'Fragment of the Therapeutic Antibody Inatumumab provides insights into the recognition mechanism with CD20. Mol Immunol 46: 2419-2423.

Ehrick JD, et al. (2005) Genetically Engineered Protein in Hydrogels Tailors Stimuli-Responsive Characteristics. Nat. Mater. 4: 298-302.

Fowers KD, et al. (2001) Preparation of Fab 'from Murine IgG2a for Thiol Reactive Conjugation. J. Drug Target. 9: 281-294.

Ghetie MA, et al. (2001) Homodimers but not monomers of rituxan (chimeric anti-CD20) induce apoptosis in human B-lymphoma cells and synergize with a chemotherapeutic agent and an immunotoxin. Blood 97: 1392-1398.

Ghetie MA, et al. (1990) Disseminated or Localized Growth of a Human B-Cell Tumor (Daudi) in SCID Mice. Int. J. Cancer 45: 481-485.

Ghetie MA, et al. (1992) The Antitumor Activity of an Anti-CD22 Immunotoxin in SCID Mice with Disseminated Daudi Lymphoma Is Enhanced by Either an Anti-CD 19 Antibody or Anti-CD 19 Immunotoxin. Blood 80: 2315-2320.

Goodwin et al. (2001) Advances in pretargeting technology. Biotechnol. Adv. 19: 435-450.

Griffiths GL, et al. (2003) Cure of SCID Mice Bearing Human B-Lymphoma Xenografts by Anti-CD74 Antibody-Anthracycline Drug Conjugate. Clin. Cancer Res. 9: 6567-6571.

Gu Z, et al. (2005) Anti-prostate stem cell monoclonal antibody 1G8 induces cell death in vitro and inhibits tumor growth in vivo via a Fc-independent mechanism. Cancer Res. 65: 9495-9500.

Gungormus, M., et al. (2010) Self-Assembled Bi-Functional Peptide Hydrogels with Biomineralization-Directing Peptides. Biomaterials 31: 7266-7274.

Gunn J, et al. (2011) A Pretargeted Nanoparticle System for Tumor Cell Labeling. Mol. Biosyst. 7: 742-748.

He J, et al. (2004) Amplification targeting: a modified pretargeting approach with potential for signal amplification-proof of a concept. J Nuclear Medicine 45 (6): 1087-1095.

He J, et al. (2007) An Improved Method for Covalently Conjugating Morpholino Oligomers to Antitumor Antibodies. Bioconjugate Chemistry 18: 983-988.

Herter S, et al. (2013) Preclinical Activity of the Type II CD20 Antibody GA101 (Obinutuzumab) Compared with Rituximab and Ofatumumab In Vitro and Xenograft Models. Mol. Cancer Ther. 12: 2031-2042.

Holmes TC, et al. (2000) Extensive Neurite Outgrowth and Active Synapse Formation on Self-Assembling Peptide Scaffolds. Proc. Natl. Acad. Sci. U.S.A. 97: 6728-6733.

Huang, et al. (2012) Multivalent structure of galectin-1-nanogold complexes as potential therapeutic for rheumatoid arthritis by enhancing receptor clustering. Eur. Cells and Materials J. 23: 170-181.

Inoue S, et al. (2011) Polymalic acid-based nanobiopolymer provides efficient systemic breast cancer treatment by inhibiting both HER2 / neu receptor synthesis and activity. Cancer Research 71 (4): 1454-1464.

Johnson RN, et al. (2012) Biological activity of anti-CD20 multivalent HPMA copolymer-Fab 'conjugates. Biomacromolecules 13: 727-735.

Johnson RN, et al. (2009) Synthesis and evaluation of multivalent branched HPMA copolymer-Fab 'conjugates targeted to the B-cell antigen CD20. Bioconjugate Chem. 20: 129-137.

Johnson WC. (2000) CD of Nucleic Acids. In Circular Dichroism: Principles and Applications; Berova, N., et al., Eds .; Wiley-VCH: New York, ed. 2: 703-718.

Kahn CR, et al. (1978) Direct Demonstration That Receptor Crosslinking or Aggregation Is Important in Insulin Action. Proc. Natl. Acad. Sci. U.S.A. 75: 4209-4213.

Kamei K, et al. (2010) Severe Respiratory Adverse Events Associated with Rituximab Infusion. Pediatr. Nephrol. 25: 1193.

Kimby E. (2005) Tolerability and Safety of Rituximab (MabThera ^® ). Cancer Treat. Rev. 31: 456-473.

Kopecek J, et al. (2010) HPMA copolymers: origins, early developments, present, and future. Adv. Drug Deliv. Rev. 62: 122-149.

Kopecek J, et al. (2012) Smart self-assembled hybrid hydrogel biomaterials. Angew Chem Int Ed Engl. 51 (30): 7396-417.

Kopecek J. (2013) Polymer-drug conjugates: Origins, progress to date and future directions. Adv. Drug Deliv. Rev. 65: 49-59.

Kopecek, J, et al. (1973) Poly [N- (2-hydroxypropyl) methacrylamide] - I. Radical Polymerization and Copolymerization. Eur. Polym. J. 9: 7-14.

Lands LC. (2010) New Therapies, New Concerns: Rituximab-Associated Lung Injury. Pediatr. Nephrol. 25: 1001-1003.

Liu G, et al. (2004) Pretargeting in Tumored Mice with Radiolabeled Morpholino Oligomer Showing Low Kidney Uptake. Eur. J. Nucl. Med. Mol. Imaging 31: 417-424.

Liu J, et al. (2006) A Simple and Sensitive "Dipstick" Test in Serum Based on Lateral Flow Separation of Aptamer-Linked Nanostructures. Angew. Chem. Int. Ed. 45: 7955-7959.

Lu ZR, et al. (1999) Polymerizable Fab ' Antibody Fragments for Targeting of Anticancer Drugs. Nat. Biotechnol. 17: 1101-1104.

Luo K, et al. (2011) Biodegradable Multiblock Poly [N- (2-hydroxypropyl) methacrylamide] via Reversible Addition-Fragmentation Chain Transfer Polymerization and Click Chemistry. Macromolecules; 44 (8): 2481-2488.

Mang'era KO, et al. (2001) Initial Investigations of ^99m Tc-Labeled Morpholinos for Radiopharmaceutical Applications. Eur. J. Nucl. Med. 28: 1682-1689.

Molina A. (2008) A decade of rituximab: improved survival in non-Hodgkin's lymphoma. Annu. Rev. Med. 59: 237-250.

Molina A. (2008) A Decade of Rituximab: Improving Survival Outcomes in Non-Hodgkin's Lymphoma. Annu. Rev. Med. 59: 237-250.

Mulvey JJ, et al. (2013) Self-Assembly of Carbon Nanotubes and Antibodies on Tumors for Targeted Amplified Delivery. Nat. Nanotechnol. 8: 763-771.

Nguyen JT, et al. (2001) CD45 Modulates Galectin-1-Induced T Cell Death: Regulation by Expression of Core 2 O-Glycans. J. Immunol. 167: 5697-5707.

Nielsen PE. (1995) DNA Analogues with Nonphosphodiester Backbones. Annu. Rev. Biophys. Biomol. Struct. 24: 167-183.

Okroj M, et al. (2013) Effector Mechanisms of Anti-CD20 Monoclonal Antibodies in B Cell Malignancies. Cancer Treat. Rev. 39: 632-639.

Omelyanenko V, et al. (1998) Targetable HPMA Copolymer-Adriamycin Conjugates. Recognition, Internalization, and Subcellular Fate. J. Control. Release 53: 25-37.

Pan H, et al. (2011) Backbone degradable multiblock N- (2-hydroxypropyl) methacrylamide copolymer conjugates via reversible addition-fragmentation chain transfer polymerization and thiol-ene coupling reaction. Biomacromolecules. 12 (1): 247-52.

Pan H, et al. (2013) Synthesis of Long-Circulating, Backbone Degradable HPMA Copolymer-Doxorubicin Conjugates and Evaluation of Molecular-Weight-Dependent Antitumor Efficacy. Macromol Biosci. 13 (2): 155-60.

Popov J, et al. (2011) Multivalent rituximab lipid nanoparticles as improved lymphoma therapies: indirect mechanisms of action and in vivo activity. Nanomedicine (Lond.) 6: 1575-1591.

Press OW, et al. (1987) Monoclonal Antibody 1F5 (Anti-CD20) Serotherapy of Human B Cell Lymphomas. Blood 69: 584-591.

Shan D, et al. (1998) Apoptosis of Malignant Human B Cells by Ligation of CD20 with Monoclonal Antibodies. Blood 91: 1644-1652.

Shimizu Y, et al. (1992) Crosslinking of the T Cell-Specific Accessory Molecules CD7 and CD28 Modulates T Cell Adhesion. J. Exp. Med. 175: 577-582.

Siegel R, et al. (2013) Cancer Statistics 2013. CA Cancer J. Clin. 63: 11-30.

Smith MR. (2003) Rituximab (monoclonal anti-CD20 antibody): mechanisms of action and resistance. Oncogene 22: 7359-7368.

Stashenko P, et al. (1980) Characterization of a human B lymphocyte-specific antigen. J. Immunol. 125: 1678-1685.

Stenzel MH. (2013) Bioconjugation Using Thiols: Old Chemistry Rediscovered to Connect Polymers with Nature's Building Blocks. ACS Macro Letters. 2 (1): 14-18.

Subr V, et al. (2006) Synthesis and Properties of New N- (2-Hydroxypropyl) methacrylamide Copolymers Containing Thiazolidine-2-thione Reactive Groups. React. Funct. Polym. 66: 1525-1538.

Summerton JE, et al. (1997) Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev. 7: 187-195.

Summerton JE. (2007) Morpholino, siRNA, and S-DNA compared: impact of structure and mechanism of action on off-target effects and sequence specificity. Curr Top Med Chem. 7 (7): 651-60.

Summerton JE. (2006) Morpholinos and PNAs compared. Peptide Nucleic Acids, Morpholinos and Related Antisense Biomolecules. Medical Intelligence Unit, Part I: 89-113.

Ulbrich K, et al. (2010) Structural and Chemical Aspects of HPMA Copolymers As Drug Carriers. Adv. Drug Deliv. Rev. 62: 150-166.

Vallat LD, et al. (2007) Temporal Genetic Program Following B-Cell Receptor Cross-Linking: Altered Balance Between Proliferation and Death in Healthy and Malignant B Cells. Blood 109: 3989-3997.

van der Kolk LE, et al. (2001) Complement activation plays a key role in the side-effects of rituximab treatment. Br. J. Haematol. 115: 807-81 1.

Wu K, et al. (2012) Coiled-coil based drug-free macromolecular therapeutics: In vivo efficacy. J. Controlled Release 157: 126-131.

Wu K, et al. (2010) Drug-free macromolecular therapeutics: induction of apoptosis by coiled-coil-mediated cross-linking of antigens on the cell surface. Angew. Chem. Int. Ed. 49: 1451-1455.

Yang J, et al. (2006) Refolding hydrogels self-assembled from N- (2-hydroxypropyl) methacrylamide graft copolymers by antiparallel coiled-coil formation. Biomacromolecules. 7 (4): 1187-1195.

Yang J, et al. (2011) Synthesis of Biodegradable Multiblock Copolymers by Click Coupling of RAFT-Generated HeterotelechelicPolyHPMA Conjugates. React Funct Polym. 71 (3): 294-302.

Yazici Y. (2011) Rheumatoid arthritis: When should we use rituximab to treat RA? Nat. Rev. Rheumatol. 7: 379-380.

Yuan W, et al. (2008) Smart Hydrogels Containing Adenylate Kinase: Translating Substrate Recognition into Macroscopic Motion. J. Am. Chem. Soc. 130: 15760-15761.

Zhang N, et al. (2005) Generation of rituximab polymer may cause hyper-cross-linking-induced apoptosis in non-Hodgkin's lymphomas. Clin. Cancer Res. 11: 5971-5980.

Zhang R, et al. (2013) Synthesis and evaluation of a backbone biodegradable multiblock HPMA copolymer nanocarrier for the systemic delivery of paclitaxel. J Control Release. 166 (1): 66-74.

Zhou Y, et al. (2013) Biological rationale for the design of polymeric anticancer nanomedicines. J Drug Target. 21 (1): 1-26.

Zhou J, et al. (2009) Development of a Novel Pretargeting System with Bifunctional Nucleic Acid Molecules. Biochem. Biophys. Res. Commun. 386: 521-525.

                         SEQUENCE LISTING <110> University of Utah Research Foundation        Kopecek, Jindrich Henry        Yang, Jiyuan        Chu, Te-Wei   <120> COMPOSITIONS AND METHODS FOR INDUCING APOPTOSIS <130> 21101.0283P1 <150> 61 / 776,999 <151> 2013-03-12 <160> 63 <170> PatentIn version 3.5 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-a <400> 1 gaactaatgc aataactatc acgaatgcgg gtaacttaat 40 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-a <400> 2 attaagttac ccgcattcgt gatagttatt gcattagttc 40 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-b <400> 3 gaaaccgcta tttattggct aagaacagat acgaatcata 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-b <400> 4 tatgattcgt atctgttctt agccaataaa tagcggtttc 40 <210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-c <400> 5 gtaaacgcga caaatgccga taatgcttcg ataataat 38 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-c <400> 6 attattatcg aagcattatc ggcatttgtc gcgtttac 38 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-d <400> 7 gacagagttc actatgacaa acgatttcac gagtaata 38 <210> 8 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-d <400> 8 gacagagttc actatgacaa acgatttcac gagtaata 38 <210> 9 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-e <400> 9 cctgatacag aagtagaaag cagtcacgca atata 35 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-e <400> 10 tatattgcgt gactgctttc tacttctgta tcagg 35 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-f <400> 11 gaacaacgag aggtgctcaa tacagatatc aatca 35 <210> 12 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-f <400> 12 tgattgatat ctgtattgag cacctctcgt tgttc 35 <210> 13 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-g <400> 13 agtcatagat agacagaata gccggataaa ct 32 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-g <400> 14 agtttatccg gctattctgt ctatctatga ct 32 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-h <400> 15 gatacagaag tagaaagcag tcacgcaata ta 32 <210> 16 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-h <400> 16 tatattgcgt gactgctttc tacttctgta tc 32 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-i <400> 17 ggcatagata acagaatagc cggataaact 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-i <400> 18 agtttatccg gctattctgt tatctatgcc 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-j <400> 19 gaccagtaga taagtgaacc agattgaaca 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-j <400> 20 tgttcaatct ggttcactta tctactggtc 30 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-k <400> 21 gagtacagcc agagagagaa tcaatata 28 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-k <400> 22 tatattgatt ctctctctgg ctgtactc 28 <210> 23 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-1 <400> 23 gtgaacacga aagagtgacg caataaat 28 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-1 <400> 24 atttattgcg tcactctttc gtgttcac 28 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-m <400> 25 gagtaagcca aggagaatca atata 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-m <400> 26 tatattgatt ctccttggct tactc 25 <210> 27 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-n <400> 27 agatgacgat aaagacgcaa agatt 25 <210> 28 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-n <400> 28 aatctttgcg tctttatcgt catct 25 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-o <400> 29 ggaccaagta aacagggata tat 23 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-o <400> 30 atatatccct gtttacttgg tcc 23 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-p <400> 31 gctgaaaacc aatatgagag tga 23 <210> 32 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-p <400> 32 tcactctcat attggttttc agc 23 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-q <400> 33 gatgaagtac cgacaagata 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-q <400> 34 tatcttgtcg gtacttcatc 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-r <400> 35 gacaggatga ataacacagt 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-r <400> 36 actgtgttat tcatcctgtc 20 <210> 37 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-s <400> 37 gcagcaaacg aagtatat 18 <210> 38 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-s <400> 38 atatacttcg tttgctgc 18 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-t <400> 39 gtcataacag aacaggta 18 <210> 40 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-t <400> 40 tacctgttct gttatgac 18 <210> 41 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-u <400> 41 tcaagacaga aggat 15 <210> 42 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-u <400> 42 atccttctgt cttga 15 <210> 43 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-v <400> 43 tagcaacata ggaag 15 <210> 44 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-v <400> 44 cttcctatgt tgcta 15 <210> 45 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-w <400> 45 cagagagcat at 12 <210> 46 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-w <400> 46 atatgctctc tg 12 <210> 47 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-x <400> 47 caagaggtac at 12 <210> 48 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-x <400> 48 atgtacctct tg 12 <210> 49 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-y <400> 49 aagaggtaca 10 <210> 50 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; MORF2-y <400> 50 tgtacctctt 10 <210> 51 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF1-z <400> 51 aaggacagta 10 <210> 52 <211> 10 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino MORF2-z <400> 52 tactgtcctt 10 <210> 53 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 53 aaaaaaaaaa aaaaaaaaaa aaaaa 25 <210> 54 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 54 tttttttttt tttttttttt ttttt 25 <210> 55 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 55 aagaagaaga agaagaagaa gaaga 25 <210> 56 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 56 tagttgtgac gta 15 <210> 57 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 57 atcaacactg cttgt 15 <210> 58 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 58 atcaacactg cttgtggg 18 <210> 59 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 59 atcaacactg cttgtgggtg gtggt 25 <210> 60 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 60 tagttgtgac gtacaccc 18 <210> 61 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 61 tagttgtgac gtacacccac cacca 25 <210> 62 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 62 caccaccccc ctcgctggtc 20 <210> 63 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> synthetic construct; morpholino <400> 63 cccccccccc cccccccccc ccccc 25

Claims (39)

(i) contacting a population of cells with a first complex containing a targeting moiety and a morpholino; And
(ii) contacting the population of cells with a second complex comprising a copolymer carrier and one or more morpholino,
Wherein contact of said cells with a first complex and a second complex comprises inducing apoptosis of cells; A method for inducing apoptosis. The method of claim 1, further comprising repeating steps (i) and (ii). 2. The method of claim 1, further comprising: (iii) confirming the death of cells. 2. The method of claim 1 wherein said cells are B-cells. 4. The method of claim 1, wherein the cells are a subject. 6. The method of claim 5, wherein the subject is a non-Hodgkin's lymphoma. 2. The method of claim 1, wherein the targeting moiety is specific for a non-internalizing cell surface molecule or a slowly internalizing cell surface molecule. 8. The method of claim 7, wherein the non-internalizing cell surface molecule or slowly internalizing cell surface molecule is selected from the group consisting of a CD20 receptor, a protein tyrosine phosphatase receptor type C, a cell surface death receptor, a prostate ) Stem cell antigen receptor, or a receptor belonging to the tumor necrosis factor receptor superfamily. 8. The method of claim 7, wherein the targeting moiety is a polysaccharide, a peptide ligand, an aptamer, an Fab 'segment, or a short chain variable segment. 10. The method of claim 9, wherein the targeting moiety is an Fab 'segment. 11. The method of claim 10, wherein the Fab 'segment is derived from an anti-CD20 receptor antibody. 12. The method of claim 11 wherein said anti-CD20 receptor antibody is selected from the group consisting of 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, eubliituximab or BLX-301. 2. The method of claim 1, wherein the morpholino of the first complex and the one or more morpholino of the second complex are complementary. The method of claim 1, wherein the morpholino of the first complex is 5 'GAG TAA GCC AAG GAG AAT CAA TAT A 3' (SEQ ID NO: 25), wherein one or more morpholino of the second complex 5 'TAT ATT GAT TCT CCT TGG CTT ACT C3' (SEQ ID NO: 26). Contacting a population of cells with a composition comprising a first complex containing a targeting moiety and a morpholino and a second complex containing a copolymer carrier and one or more morpholino, Lt; RTI ID = 0.0 &gt; cell &lt; / RTI &gt; A method for inducing apoptosis. 16. The method of claim 15, further comprising repeating contacting the cells with the composition. 16. The method of claim 15, wherein said cells are B-cells. 16. The method of claim 15, wherein the cells are a subject. 19. The method of claim 18, wherein the subject is a non-Hodgkin's lymphoma. 16. The method of claim 15, wherein the targeting moiety is specific for a non-internalizing cell surface molecule or a slowly internalizing cell surface molecule. 21. The method of claim 20, wherein the non-internalizing cell surface molecule or slowly internalizing cell surface molecule is selected from the group consisting of a CD20 receptor, a protein tyrosine phosphatase receptor type C, a cell surface death receptor, a prostate ) Stem cell antigen receptor, or a receptor belonging to the tumor necrosis factor receptor superfamily. 16. The method of claim 15, wherein the targeting moiety is a polysaccharide, a peptide ligand, an aptamer, a Fab 'segment, or a short chain variable segment. 24. The method of claim 22, wherein the targeting moiety is an Fab 'segment. 24. The method of claim 23, wherein the Fab 'segment is derived from an anti-CD20 receptor antibody. 26. The method of claim 24, wherein the anti-CD20 receptor antibody is selected from the group consisting of 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, eubliituximab or BLX-301. 16. The method of claim 15, wherein the morpholino of the first complex and the one or more morpholino of the second complex are complementary. 16. The method of claim 15, wherein the morpholino of the first complex is 5 ' GAG TAA GCC AAG GAG AAT CAA TAT A 3 ' (SEQ ID NO: 25), wherein one or more morpholino of the second complex 5 'TAT ATT GAT TCT CCT TGG CTT ACT C3' (SEQ ID NO: 26). (i) a first complex containing a targeting moiety and a morpholino, and
(ii) a second complex containing a copolymer carrier and at least one morpholino. 29. The kit of claim 28, further comprising (iii) instructions for administering the complex of (i) and the complex of (ii). 29. The kit of claim 28, wherein the first complex and the second complex are co-formulated. 29. The kit of claim 28, wherein the targeting moiety is specific for non-internalizing cell surface molecules or slowly internalizing cell surface molecules. 32. The kit of claim 31, wherein the non-internalizing cell surface molecules or slowly internalizing cell surface molecules are present on a cell. 33. The kit of claim 32, wherein the cell is a B cell. 32. The method of claim 31, wherein the non-internalizing cell surface molecule or slowly internalizing cell surface molecule is selected from the group consisting of a CD20 receptor, a protein tyrosine phosphatase receptor type C, a cell surface death receptor, Antigen receptor, or a tumor necrosis factor receptor superfamily. 29. The kit of claim 28, wherein the targeting moiety is a polysaccharide, a peptide ligand, an aptamer, a Fab 'segment, or a short chain variable segment. 36. The kit of claim 35, wherein the Fab ' segment is derived from an anti-CD20 receptor antibody. 37. The method of claim 36, wherein the anti-CD20 receptor antibody is selected from the group consisting of 1F5, rituximab, tositumomab, ibritumomab, ofatumumab, veltuzumab ), Ocrelizumab, ocaratuzumab, obinutuzumab, PRO131921, BCD-020, IBI-301, yuvulituximab or BLX-301. 29. The kit of claim 28, wherein the morpholino of the first complex and the one or more morpholino of the second complex are complementary. 29. The method of claim 28, wherein the morpholino of the first complex is 5 ' GAG TAA GCC AAG GAG AAT CAA TAT A 3 ' (SEQ ID NO: 25), wherein one or more morpholino of the second complex 5 'TAT ATT GAT TCT CCT TGG CTT ACT C3' (SEQ ID NO: 26).

Images