KR20150137565A - Corynebacterium having an enhanced productivity for a target product and use thereof - Google Patents

Abstract

Provided are a Corynebacterium microorganism having enhanced productivity for a target product compared with a mother cell, and a use thereof.

Description

Corynebacterium sp. Microorganisms having increased target product productivity and uses thereof.

Microorganisms having increased target product productivity, and uses thereof.

Microorganisms have been used as cell factories to produce useful biomaterials such as proteins, drugs, fine chemicals, stereospecific chemicals, and the like. By combining genetic engineering and biotechnology with existing fermentation engineering techniques, it is possible to modify the metabolic pathway of bacteria, yeast, fungi, or plant and animal cells, or to over-express or inhibit or eliminate specific genes Methods for improving microorganisms have been widely studied and utilized.

Energy is required to biosynthesize materials such as proteins, nucleic acids and the like in vivo. Most of the energy used in vivo is stored and used in the form of NADH, NADPH and ATP. In particular, ATP is an energy carrier that transfers the chemical energy generated during metabolism to various activities of the organism. ATP is produced through photosynthesis, fermentation and respiration processes and is consumed in vivo activities such as biosynthesis, movement, signal transduction and cell division. Thus, intracellular ATP concentration is one of the most important factors for the physiological activity of cells, since ATP regulates a number of intracellular processes such as growth, ribosomal RNA synthesis and cell metabolic pathways. Therefore, sufficient energy is required to be generated and maintained in order for the microorganism to be used as an efficient plant for producing useful substances.

In order to produce a useful target substance using microorganisms, a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in the production of a specific target substance or removing an unnecessary gene has been mainly used. For example, a number of useful strains have been developed including E. coli capable of producing L-amino acids in high yield. However, each of the strains developed as described above can be used only for the production of a specific target substance. Regardless of the kind of the target substance, the cells that can be generally used as a cell factory for high yield production of the target substance It was not developed.

Thus, even with the prior art, strains with increased target product productivity are still required.

One aspect provides a microorganism of the genus Corynebacterium having increased target product productivity as compared to a parent cell.

Another aspect provides a method for producing a target substance using the microorganism.

One aspect of the present invention provides a microorganism of the genus Corynebacterium having an increased target product productivity as compared to a parent cell, wherein a gene encoding a phosphoenolpyruvate carboxykinase (PCK) derived from Escherichia coli is introduced.

Phosphoenolpyruvate carboxykinase (PCK) is an enzyme that catalyzes the reaction to produce phosphoenolpyruvate (PEP) from oxaloacetic acid (OAA) in the gluconeogenesis in vivo. Since the reaction catalyzed by the enzyme is reversible, in the presence of CO ₂ , PCK catalyzes the reaction to produce OAA from PEP, producing a single molecule of ATP. Therefore, unlike phosphoenolpyruvate carboxylase (ppc), which catalyzes the same reaction in the glycolysis pathway, an increase in the reaction by PCK may increase intracellular ATP production and concentration. ATP production by PCK is induced by increasing the expression of the gene encoding PCK in the cell or by changing the regulatory sequence so that the gene encoding PCK is expressed in the pathway or by increasing the activity of PCK Can be increased.

Cells with a high intracellular ATP concentration may be suitable for producing an exogenous protein because they can increase protein synthesis by increasing the expression of genes related to biosynthesis such as amino acids and ribosomal concentration. In addition, since ATP is used to transport active materials into and out of a cell, when cells have a high ATP concentration, the cells can actively transport the substance using ATP, so that a desired metabolite can be produced at a higher yield . That is, the produced metabolite can be transported to the outside of the cell, and the necessary carbon source can be transported into the cell to exclude the feedback control and activate the metabolic pathway for production of the target substance.

The microorganism belonging to the genus Corynebacterium may be Corynebacterium glutamicum.

The phosphoenolpyruvate carboxykinase (PCK) derived from Escherichia coli may have the amino acid sequence of SEQ ID NO: 1. The phosphoenolpyruvate carboxykinase (PCK) gene derived from Escherichia coli may be one encoding the amino acid sequence of SEQ ID NO: 1. The phosphoenolpyruvate carboxykinase (PCK) gene derived from Escherichia coli may have the nucleotide sequence of SEQ ID NO: 2.

The microorganism may be one which expresses the introduced gene. The microorganism may have an increased activity of phosphoenolpyruvate carboxykinase (PCK) derived from E. coli in the cell.

The target substance may be a protein, an amino acid, a nucleic acid, an antibiotic, or a metabolite. The target substance may be, for example, a protein. The protein may be CAT, or AprE. The AprE may have the amino acid sequence of SEQ ID NO: 7. The AprE gene may be one that encodes the amino acid sequence of SEQ ID NO: 7. The AprE gene may have the nucleotide sequence of SEQ ID NO: 8. The CAT may have the amino acid sequence of SEQ ID NO: 21. The CAT gene may be one which encodes the amino acid sequence of SEQ ID NO: 21. The CAT gene may have the nucleotide sequence of SEQ ID NO: 22.

The protein may be a therapeutic protein, for example, an antibody, insulin, growth hormone, or the like.

The microorganism may be one in which a foreign gene encoding a target substance is introduced or a metabolic pathway is genetically modified for production of a target substance. The term "genetically modified" as used herein refers to a method of increasing the expression of a gene involved in the production of a target substance present in the genome of a cell, inhibiting the production of the target substance, or inhibiting the expression of a gene involved in degradation of the target substance Thereby transforming the cell into a state favorable for producing the target substance.

The introduction of the gene includes, but is not limited to, transformation or transfection, and can be carried out by conventional methods known to those skilled in the art. The introduction may be, for example, by electroporation.

As used herein, the term "parent cell" refers to a gene that is modified by molecular biology techniques such as mutation or recombinant methods to increase the expression of a gene encoding phosphoenolpyruvate carboxykinase (PCK) Means a cell in which the gene is changed to be expressed in the pathway and the intracellular ATP production yield or concentration is increased.

Another aspect provides a method of producing a target material, comprising culturing the microorganism described above.

The step of culturing may be carried out under culture conditions with a suitable medium known in the art. Conditions suitable for producing the target substance can be easily determined by the person skilled in the art depending on the target substance and the cell. For example, when induction is required for expression of a gene encoding a target substance introduced from the outside, the step of culturing the recombinant Corynebacterium glutamicum further comprises inducing the expression of the gene can do. Cultivation includes, but is not limited to, batch, continuous, and fed-batch cultivation. The culture may be carried out under aerobic or anaerobic conditions.

The medium may comprise various carbon sources, nitrogen sources and trace element components.

The carbon source may comprise an assimilable sugar. The medium may be selected from, for example, glucose, sucrose, lactose, fructose, maltose, starch, carbohydrates such as cellulose, fats such as soybean oil, sunflower oil, castor oil, coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid, And alcohols such as ethanol, organic acids such as acetic acid, or combinations thereof. The culture may be performed with glucose as a carbon source. The nitrogen source may be an organic nitrogen source such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL) and soybean wheat and an inorganic nitrogen source such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate, And combinations of these. The medium can include, for example, metal salts such as potassium dihydrogenphosphate, dipotassium hydrogenphosphate and the corresponding sodium-containing salts, magnesium sulfate or iron sulfate as a source of phosphorus. In addition, amino acids, vitamins, and suitable precursors and the like may be included in the medium. The medium or the individual components may be added to the culture medium batchwise or continuously.

In addition, the pH of the culture can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the microorganism culture solution in a proper manner without otherwise controlling the pH during the culture. In addition, bubble formation can be suppressed by using a defoaming agent such as fatty acid polyglycol ester during the culture.

The method may comprise separating the target material from the culture. The separation may be selected in a suitable manner depending on the selected target material. The separation may be performed by separating cells or cultures from the culture medium. When the target substance is a protein, methods such as centrifugation, precipitation, dialysis, and chromatography may be used. The target substance may be a protein, and the microorganism may be Corynebacterium glutamicum.

According to a microorganism belonging to the genus Corynebacterium having increased target product productivity as compared to a parent cell according to one aspect, it can be used to produce a desired product.

According to the method of producing the target material according to another aspect, the target material can be efficiently produced.

1 is a diagram showing a process of producing expression vectors
Fig. 2 is a view showing the structure of a strain and a plasmid used in the present embodiment.
Fig. 3 shows the chloramphenicol resistance according to the strains into which the E. coli pck gene and the CAT gene as a foreign protein are introduced into Corynebacterium glutamicum.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

I. Materials and Methods

Unless otherwise stated, the following materials and methods were used in the following examples.

(1) Strain and medium used

Corynebacterium for transformation and genetic engineering glutamicum ATCC 13032, and Escherichia coli DH10B was used. C. glutamicum and E. coli were routinely cultured in the nutrient medium LB medium (5 g yeast extract, 5 g sodium chloride, and 10 g tryptone / L) at 30 ° C and 230 rpm at 37 ° C, respectively. For plasmid-containing strains, kanamycin was added at a concentration of 25 μg / ml for C. glutamicum and 50 μg / ml for E. coli. In order to screen for chloramphenicol-resistant strains, 5, 10, 25, and 50 μg / ml concentration was used. The strains used in the experiments are shown in Table 1.

Strain characteristic Sources or references E. coli K-12 W3110 F ^- ? ^- rph -1 INV ( rrnD , rrnE ), for E. coli pck amplification ATCC E. coli DH10B F ^- mcr A DELTA (mrr - hsd RMS- mcr BC) φ80 lac Z M15 DELTA DELTA lac X74 rec A1 end A1 ara D139 DELTA (ara, leu) 7697 gal U gal K rps L nup G λ Invitrogen B. subtilis 168 trpC2 , for B. subtilis aprE amplification ATCC C. glutamicum ATCC 13032 wild type, expression host, for C. glutamicum pck , ppc amplification ATCC CgNeg wild type harboring pSK1Cat Park et al., 2004 CgCat wild type harboring pSL360 Park et al., 2004 CgAprE wild type harboring pCgBsAprECat Application CgPck wild type harboring pCgPckCat Application CgPpc wild type harboring pCgPpcCat Application CgPckAprE wild type harboring pCgPckAprECat Application CgPpcAprE wild type harboring pCgPpcAprECat Application CgEcPck wild type harboring pCgEcPckCat (pSL360- pck _Ec - cat ) Application CgEcPckAprE wild type harboring pCgEcPckAprECat (pSL360- pck _Ec - aprE - cat ) Application

(2) DNA  Operation

(1993), J Bacteriol 175 (13)), and the transformation of C. glutamicum was performed using the method of Follettie (Follettie MT et al. : 4096-4103). C. glutamicum gene pck (cg3169) and ppc (cg1787) contains the information listed in CoryneRegNet 6.0 (www.coryneregnet.de), in E. coli The K-12 W3110 pck is made up of information from PortEco (http://www.porteco.org) and B. subtilis 168 aprE used information from KEGG (www.kegg.jp), respectively. The primers used are shown in Table 2. FIG. 1 is a view showing a process of producing expression vectors. In Figure 1, aprE was amplified using two primer sets with different restriction sites, which together are intended to correspond to the restriction site of the gene introduced into the pSL360 vector.

The nucleotide sequence of the gene amplified by PCR using the primer and the amino acid sequence coded therefrom are shown in the sequence listing (E. coli pck protein and gene: SEQ ID NOS: 1 and 2, C. glutamicum pck protein and gene: 4, C. glutamicum ppc protein and gene: SEQ ID NOs: 5 and 6, B. subtilis aprE protein and gene: SEQ ID NOs: 7 and 8, CAT protein and gene: SEQ ID NOs: 21 and 22).

Primers for amplification of each gene were designed to include the coding sequence (CDS) and ribosome binding site (RBS) of the genes to be introduced, and the restriction enzyme recognition sequence for introduction into the vector was included (Macrogen, Korea). In this study, the template DNA used in the PCR was obtained from each of the cultures of C. glutamicum , E. coli , and B. subtilis by genomic DNA prep. Kit (Solgent, Korea) for genomic DNA extraction. In order to construct the expression vector, the insert DNA was amplified by Pfu (Solgent, Korea) PCR using the genomic DNA of the bacterium as a template. The PCR conditions were as follows. C. glutamicum [ pck : 95 ° C for 30 seconds, 58 ° C for 30 seconds, 72 ° C for 2 minutes / ppc : 30 sec 95 ℃, 60 ℃ 30 seconds, 72 ℃ 2 minutes and 30 seconds], each 30 cycle, E. coli [ pck : 95 ° C for 30 seconds, 62 ° C for 30 seconds, 72 ° C for 2 minutes] 30 cycles, B. subtilis [ aprE : 95 ° C for 30 seconds, 60 ° C for 20 seconds, 72 ° C for 2 minutes] 30 cycles. The amplified PCR products were treated with restriction enzymes added at the time of primer design (Table 2, and Fig. 1).

primer Sequence (5 '->3') ^a Note ^b CgPck_F gc atgcat gcactgtcgaatgacac ( NsiI ) (SEQ ID NO: 9) pCgPckCat,
pCgPckAprECat CgPck_R gc atgcat gcacctaggttaagcgtgagctg ( NsiI , AvrII) (SEQ ID NO: 10) CgPpc_F gc atgcat gccaacaccct ( NsiI ) (SEQ ID NO: 11) pCgPpcCat,
pCgPpcAprECat CgPpc_R gc atgcat gcacctaggctagccggagttgc ( NsiI , AvrII ) (SEQ ID NO: 12) EcPck_F ctgcag ggcaatacatattggctaaggagc (PstI) (SEQ ID NO: 13) pCgEcPckCat,
pCgEcPckAprECat EcPck_R ctgcag gcacctaggttacagtttcggaccagccg ( PstI , AvrII) (SEQ ID NO: 14) BsAprE_F1 ctgcag aaaaggagagggtaaagag (PstI) (SEQ ID NO: 15) pCgAprECat BsAprE_R1 ctgcag ttattgtgcagctgcttgt (PstI) (SEQ ID NO: 16) BsAprE_F2 gca cctagg cgcaggtcatttg (AvrII) (SEQ ID NO: 17) pCgPckAprECat, pCgPpcAprECat,
pCgEcPckAprECat BsAprE_R2 gca cctagg ttattgtgcagctgc (AvrII) (SEQ ID NO: 18) CAT_F aggacgcccgccataaact (SEQ ID NO: 19) Identification and sequencing of insert DNA introduction CAT_R tcgaagctcggcggatttg (SEQ ID NO: 20)

^a Underlined and shaded sequences indicate the sequence of each restriction enzyme. ^b means a plasmid constructed using the corresponding primer.

Each of the prepared insert DNA and vector DNA (pSL360) was ligation using T4 DNA ligase (Thermo Scientific, USA) and E. coli DH10B competent cells. Transformed candidates were first screened for kanamycin resistance and PCR was performed by combining the CAT_F, CAT_R primers and the primers used for the amplification of each insert DNA. Candidates whose DNAs were introduced and directed were selected by DNA sequencing (Macrogen, Korea) and screened in Table 3.

Plasmid Characteristics ^a Sources or references pSK1Cat E. coli - C. glutamicum shuttle promoter-probe vector carrying a promoterless cat gene, Km ^R , Cm ^R Park et al., 2004 pSL360 pSK1Cat :: P ₁₈₀ , Km ^R , Cm ^R Park et al., 2004 pCgAprECat pSL360 harboring B. subtilis aprE pSL360- aprE _Bs - cat , Km ^R , Cm ^R Application pCgPckCat pSL360 carrying C. glutamicum pck , pSL360- pck _Cg - cat , Km ^R Application pCgPpcCat pSL360 carrying C. glutamicum ppc , pSL360- ppc _Cg - cat , Km ^R , Cm ^R Application pCgPckAprECat pSL360 carrying C. glutamicum pck and B. subtilis aprE , pSL360- pck _Cg -aprE-cat , Km ^R , Cm ^R Application pCgPpcAprECat pSL360 carrying C. glutamicum ppc and B. subtilis aprE , pSL360- pck _Cg -aprE-cat , Km ^R , Cm ^R Application pCgEcPckCat pSL360 carrying E. coli pck and B. subtilis aprE , pSL360- pck _Ec- cat , Km ^R , Cm ^R Application pCgEcPckAprECat pSL360 carrying E. coli pck and B. subtilis aprE , pSL360- pck _Ec -aprE-cat , Km ^R , Cm ^R Application

^a superscript R, tolerance; P ₁₈₀ , 180 promoter; Km, kanamycin; Cm, chloramphenicol.

In Table 3, Park et al., 2004, Park et al., 2004, J. Microbiol. Biotechnol. 14 (4), 789-795.

Fig. 2 is a view showing the structure of a strain and a plasmid used in the present embodiment. In Figure 2, P180 is the 180 promoter; SD is Shine-Dalgarno sequence; The subscripts Cg , Ec , and Bs indicate that the genes are derived from C. glutamicum , E. coli , and B. subtilis , respectively.

(3) CAT  ( chloramphenicol acetyltransferase ) Active measurement

CAT activity was measured using crude extracts from the culture medium of the late stage of exponential growth (15 hours) in LB for enzyme activity measurement. The culture was centrifuged and the recovered cells were disrupted using a glass bead to prepare a crude extract. Measurement of the activity of chloramphenicol acetyltransferase (CAT, EC 2.3.1.28) followed the method based on DTNB (5, 5'-dithiobis (2-nitrobenzoic acid) reduction method (Shaw WV (1975) Methods Enzymol. 43: 737-755 The reaction solution was reacted by adding 2 ml of a protein sample to 100 mM Tris-HCl (pH 7.8), 1 mM DTNB, 0.1 mM acetyl-CoA and 0.25 mM chloramphenicol. ) Was measured at a wavelength of 412 nm for about 5 minutes. After the reaction, the change in OD412 per minute (OD412 / min) per minute was measured in the linear section and calculated based on the following formula.

CAT activity (μmmol / mg · min) = (Δ OD412 / min) / (13.6 · x · y)

13.6 =? 412, extinction coefficient; x = sample volume ([mu] l); y = protein concentration (mg / ml)

(4) Chloramphenicol  Resistance comparison

In addition to comparing the levels of CAT (chloramphenicol acetyl transferase) enzyme activity in the strains into which each gene was introduced, resistance against chloramphenicol concentration was compared to confirm the cell physiological characteristics of each strain. Kanamycin (25 μg / ml) contained after 16 hours of incubation in LB medium, kanamycin (25 μg / ml) and chloramphenicol (0, 5, 25, and _{50 μg / ml) OD 600 =} 0.05 in LB medium containing And growth was compared when cultured. The chloramphenicol resistance of strains 4, 8, 18, and 25 hours after inoculation was compared.

(5) Alkaline protease  ( AP ) Measurement of activity

The pCgAprECat, pCgPckAprECat, pCgPpcAprECat, and pCgEcPckAprECat vectors were constructed by introducing the alkaline protease (AprE) derived from B. subtilis 168 into pSL360 vector and pCgPckCat, pCgPpcCat, and pCgEcPckCat to express the above. (CgAprE, CgPckAprE, CgPpcAprE, and CgEcPckAprE strains were produced respectively (Table 1 and Table 3).

The enzymatic activity was determined by the Folin-Ciocalteu method (Folin O et al. (1929), J. Biol. Chem. 73: 627-650) and the Sigma-Aldrich protocol (Cupp-Enyard C (2008) J. Vis . ), e899) (eg, pH 7.5 -> pH 10.0). To measure the enzyme activity, the culture broth which had been cultured in LB for 16 hours was centrifuged and the supernatant was collected and used in the experiment. 1 ml of the supernatant and 1 ml of 2% casein (50 mM Tris buffer, pH 10) were mixed, reacted at room temperature for 30 minutes, and 2 ml of 0.11 M trichloroacetic acid (TCA) was added to stop the reaction for 30 minutes. After standing for 30 minutes, the reaction solution was filtered using a membrane filter (0.25 μm) and a syringe. 2 ml of the filtered reaction mixture was mixed with 5 ml of 0.5 M sodium carbonate and 1 ml of 0.5 N Folin-Ciocalteu's phenol reagent, reacted at 37 ° C for 30 minutes, and the absorbance was measured at 660 nm.

As a standard solution for standard curve generation, 1.1 mM L-tyrosine was used in the same manner as above using 0, 0.05, 0.1, 0.2, and 0.4 ml, respectively. Using the measured A660 values, ㅿ A660nm was calculated and the concentration of tyrosine released and cleaved in the casein used as a substrate was calculated using a standard curve, and the enzyme activity per unit volume was calculated using the following formula .

(Units) / ml Enzyme = [(tyrosine equivalents released) (7 ml)] / [(1 ml) (30 min) (2 ml)]

7 ml = total volume of analysis, 1 ml = volume of enzyme used; 30 min = time of analysis;

2 ml = volume used for color development

The protein concentration measured by the Bradford assay was introduced into the following equation to calculate the enzyme activity per protein mass.

Units / mg protein = [units / ml enzyme] / [mg protein / ml enzyme]

Example  1: Escherichia coli pck  Gene overexpressed Corynebacterium Glutamicum  Confirmation of exogenous protein productivity

In this example, Escherichia coli pck gene and foreign protein CAT gene or AP gene were introduced into Corynebacterium glutamicum and cultured to confirm the productivity of the foreign protein according to the strain.

Table 4 shows CAT productivity as a value of CAT activity according to strains into which Escherichia coli pck gene and Corynebacterium glutamicum, a foreign protein, were introduced into Corynebacterium glutamicum.

Strain CAT active CgCat Relative activity (%) Explanation CgNeg 0.12 + 0.06 0.75 음적 제어 CgCat 15.8 ± 0.63 100 정정 제어 CgPckCat 13.6 ± 0.28 86.1 Cg PCK + CAT CgPpcCat 5.74 + - 0.41 36.3 Cg PPC + CAT CgEcPckCat 20.7 ± 0.34 131 Ec PCK + CAT

As shown in Table 4, activity near 0 was confirmed in CgNeg, and activities of 13.6, 5.74, and 20.7 were confirmed in CgPckCat, CgPpcCat, and CgEcPckCat strains, respectively. This corresponds to activities of 86, 36, and 131%, respectively, on the basis of CgCat.

Fig. 3 shows the chloramphenicol resistance according to the strains into which the E. coli pck gene and the CAT gene as a foreign protein are introduced into Corynebacterium glutamicum.

As shown in Fig. 3, in the culture medium containing only kanamycin, all strains showed similar resistance at each time, whereas in the culture medium supplemented with chloramphenicol, differences in tolerance were observed depending on the concentration. The degree of tolerance was confirmed in the order of EcPckCat> CgPckCat> CgCat> CgPpc> CgNeg at the highest concentration of 50 μg / ml chloramphenicol added.

The results in Table 4 and Fig. 3 show that only the Cat gene-introduced strain or C. glutamicum Compared with strains into which the Cat gene was introduced together with the derived pck gene, the Cat productivity was unexpectedly high in strains into which the Cat gene was introduced together with the Escherichia coli-derived pck gene.

Table 5 shows the AP activity of the Escherichia coli pck gene in Corynebacterium glutamicum and the AP gene as a foreign protein, that is, the AP productivity according to the strain into which AprE was introduced.

Strain AP activity
(units / mg protein) Relative activity
(%) Explanation CgCat 5.91 ± 0.32 45.1 음적 제어 CgAprE 13.1 ± 0.42 100 정정 제어 CgPckAprE 8.07 + - 0.67 61.6 Cg PCK + AP CgPpcAprE 8.58 0.37 65.5 Cg PPC + AP CgEcPckAprE 15.8 ± 0.43 120 Ec PCK + AP

As shown in Table 5, activities of 5.91, 13.1, 8.07, 8.58, and 15.8 were confirmed in CgCat, CgAprE, CgPckAprE, CgPpcAprE, and CgEcPckAprE strains, respectively. And 62, 66, and 120% activity in the CgPckAprE, CgPpcAprE, and CgEcPckAprE strains, respectively.

The results in Table 5 show that only the AprE gene-introduced strain or C. glutamicum The AprE productivity was unexpectedly high in strains into which the AprE gene was introduced together with the Escherichia coli-derived pck gene, compared with the strain in which the AprE gene was introduced together with the derived pck gene.

<110> Industry-Academic Cooperation Foundation of Catholic University <120> Corynebacterium having an enhanced productivity for a target          product and use thereof <130> PN105783 <160> 22 <170> Kopatentin 2.0 <210> 1 <211> 540 <212> PRT <213> E. coli K-12 W3110 <400> 1 Met Arg Val Asn Asn Gly Leu Thr Pro Gln Glu Leu Glu Ala Tyr Gly   1 5 10 15 Ile Ser Asp Val His Asp Ile Val Tyr Asn Pro Ser Tyr Asp Leu Leu              20 25 30 Tyr Gln Glu Glu Leu Asp Pro Ser Leu Thr Gly Tyr Glu Arg Gly Val          35 40 45 Leu Thr Asn Leu Gly Ala Val Ala Val Asp Thr Gly Ile Phe Thr Gly      50 55 60 Arg Ser Pro Lys Asp Lys Tyr Ile Val Arg Asp Asp Thr Thr Arg Asp  65 70 75 80 Thr Phe Trp Trp Ala Asp Lys Gly Lys Gly Lys Asn Asp Asn Lys Pro                  85 90 95 Leu Ser Pro Glu Thr Trp Gln His Leu Lys Gly Leu Val Thr Arg Gln             100 105 110 Leu Ser Gly Lys Arg Leu Phe Val Val Asp Ala Phe Cys Gly Ala Asn         115 120 125 Pro Asp Thr Arg Leu Ser Val Arg Phe Ile Thr Glu Val Ala Trp Gln     130 135 140 Ala His Phe Val Lys Asn Met Phe Ile Arg Pro Ser Asp Glu Glu Leu 145 150 155 160 Ala Gly Phe Lys Pro Asp Phe Ile Val Met Asn Gly Ala Lys Cys Thr                 165 170 175 Asn Pro Gln Trp Lys Glu Gln Gly Leu Asn Ser Glu Asn Phe Val Ala             180 185 190 Phe Asn Leu Thr Glu Arg Met Gln Leu Ile Gly Gly Thr Trp Tyr Gly         195 200 205 Gly Glu Met Lys Lys Gly Met Phe Ser Met Met Asn Tyr Leu Leu Pro     210 215 220 Leu Lys Gly Ile Ala Ser Met His Cys Ser Ala Asn Val Gly Glu Lys 225 230 235 240 Gly Asp Val Ala Val Phe Phe Gly Leu Ser Gly Thr Gly Lys Thr Thr                 245 250 255 Leu Ser Thr Asp Pro Lys Arg Arg Leu Ile Gly Asp Asp Glu His Gly             260 265 270 Trp Asp Asp Asp Gly Val Phe Asn Phe Glu Gly Gly Cys Tyr Ala Lys         275 280 285 Thr Ile Lys Leu Ser Lys Glu Ala Glu Pro Glu Ile Tyr Asn Ala Ile     290 295 300 Arg Arg Asp Ala Leu Leu Glu Asn Val Thr Val Arg Glu Asp Gly Thr 305 310 315 320 Ile Asp Phe Asp Asp Gly Ser Lys Thr Glu Asn Thr Arg Val Ser Tyr                 325 330 335 Pro Ile Tyr His Ile Asp Asn Ile Val Lys Pro Val Ser Lys Ala Gly             340 345 350 His Ala Thr Lys Val Ile Phe Leu Thr Ala Asp Ala Phe Gly Val Leu         355 360 365 Pro Pro Val Ser Arg Leu Thr Ala Asp Gln Thr Gln Tyr His Phe Leu     370 375 380 Ser Gly Phe Thr Ala Lys Leu Ala Gly Thr Glu Arg Gly Ile Thr Glu 385 390 395 400 Pro Thr Pro Thr Phe Ser Ala Cys Phe Gly Ala Phe Leu Ser Leu                 405 410 415 His Pro Thr Gln Tyr Ala Glu Val Leu Val Lys Arg Met Gln Ala Ala             420 425 430 Gly Ala Gln Ala Tyr Leu Val Asn Thr Gly Trp Asn Gly Thr Gly Lys         435 440 445 Arg Ile Ser Ile Lys Asp Thr Arg Ala Ile Asp Ala Ile Leu Asn     450 455 460 Gly Ser Leu Asp Asn Ala Glu Thr Phe Thr Leu Pro Met Phe Asn Leu 465 470 475 480 Ala Ile Pro Thr Glu Leu Pro Gly Val Asp Thr Lys Ile Leu Asp Pro                 485 490 495 Arg Asn Thr Tyr Ala Ser Pro Glu Gln Trp Gln Glu Lys Ala Glu Thr             500 505 510 Leu Ala Lys Leu Phe Ile Asp Asn Phe Asp Lys Tyr Thr Asp Thr Pro         515 520 525 Ala Gly Ala Ala Leu Val Ala Ala Gly Pro Lys Leu     530 535 540 <210> 2 <211> 1653 <212> DNA <213> E. coli K-12 W3110 <400> 2 ggcaatacat attggctaag gagcagtgaa atgcgcgtta acaatggttt gaccccgcaa 60 gaactcgagg cttatggtat cagtgacgta catgatatcg tttacaaccc aagctacgac 120 ctgctgtatc aggaagagct cgatccgagc ctgacaggtt atgagcgcgg ggtgttaact 180 aatctgggtg ccgttgccgt cgataccggg atcttcaccg gtcgttcacc aaaagataag 240 tatatcgtcc gtgacgatac cactcgcgat actttctggt gggcagacaa aggcaaaggt 300 aagaacgaca acaaacctct ctctccggaa acctggcagc atctgaaagg cctggtgacc 360 aggcagcttt ccggcaaacg tctgttcgtt gtcgacgctt tctgtggtgc gaacccggat 420 actcgtcttt ccgtccgttt catcaccgaa gtggcctggc aggcgcattt tgtcaaaaac 480 atgtttattc gcccgagcga tgaagaactg gcaggtttca aaccagactt tatcgttatg 540 aacggcgcga agtgcactaa cccgcagtgg aaagaacagg gtctcaactc cgaaaacttc 600 gtggcgttta acctgaccga gcgcatgcag ctgattggcg gcacctggta cggcggcgaa 660 atgaagaaag ggatgttctc gatgatgaac tacctgctgc cgctgaaagg tatcgcttct 720 atgcactgct ccgccaacgt tggtgagaaa ggcgatgttg cggtgttctt cggcctttcc 780 ggcaccggta aaaccaccct ttccaccgac ccgaaacgtc gcctgattgg cgatgacgaa 840 cacggctggg acgatgacgg cgtgtttaac ttcgaaggcg gctgctacgc aaaaactatc 900 aagctgtcga aagaagcgga acctgaaatc tacaacgcta tccgtcgtga tgcgttgctg 960 gaaaacgtca ccgtgcgtga agatggcact atcgactttg atgatggttc aaaaaccgag 1020 aacacccgcg tttcttatcc gatctatcac atcgataaca ttgttaagcc ggtttccaaa 1080 gcgggccacg cgactaaggt tatcttcctg actgctgatg ctttcggcgt gttgccgccg 1140 gtttctcgcc tgactgccga tcaaacccag tatcacttcc tctctggctt caccgccaaa 1200 ctggccggta ctgagcgtgg catcaccgaa ccgacgccaa ccttctccgc ttgcttcggc 1260 gcggcattcc tgtcgctgca cccgactcag tacgcagaag tgctggtgaa acgtatgcag 1320 gcggcgggcg cgcaggctta tctggttaac actggctgga acggcactgg caaacgtatc 1380 tcgattaaag atacccgcgc cattatcgac gccatcctca acggttcgct ggataatgca 1440 gaaaccttca ctctgccgat gtttaacctg gcgatcccaa ccgaactgcc gggcgtagac 1500 acgaagattc tcgatccgcg taacacctac gcttctccgg aacagtggca ggaaaaagcc 1560 gaaaccctgg cgaaactgtt tatcgacaac ttcgataaat acaccgacac ccctgcgggt 1620 gccgcgctgg tagcggctgg tccgaaactg taa 1653 <210> 3 <211> 610 <212> PRT <213> C. glutamicum ATCC13032 <400> 3 Met Thr Thr Ala Ala Ile Arg Gly Leu Gln Gly Glu Ala Pro Thr Lys   1 5 10 15 Asn Lys Glu Leu Leu Asn Trp Ile Ala Asp Ala Val Glu Leu Phe Gln              20 25 30 Pro Glu Ala Val Val Phe Val Asp Gly Ser Gln Ala Glu Trp Asp Arg          35 40 45 Met Ala Glu Asp Leu Val Glu Ala Gly Thr Leu Ile Lys Leu Asn Glu      50 55 60 Glu Lys Arg Pro Asn Ser Tyr Leu Ala Arg Ser Asn Pro Ser Serp Val  65 70 75 80 Ala Arg Val Glu Ser Arg Thr Phe Ile Cys Ser Glu Lys Glu Glu Asp                  85 90 95 Ala Gly Pro Thr Asn Asn Trp Ala Pro Pro Gln Ala Met Lys Asp Glu             100 105 110 Met Ser Lys His Tyr Ala Gly Ser Met Lys Gly Arg Thr Met Tyr Val         115 120 125 Val Pro Phe Cys Met Gly Pro Ile Ser Asp Pro Asp Pro Lys Leu Gly     130 135 140 Val Gln Leu Thr Asp Ser Glu Tyr Val Val Met Ser Ser Met Arg Ile Met 145 150 155 160 Thr Arg Met Gly Ile Glu Ala Leu Asp Lys Ile Gly Ala Asn Gly Ser                 165 170 175 Phe Val Arg Cys Leu His Ser Val Gly Ala Pro Leu Glu Pro Gly Gln             180 185 190 Glu Asp Val Ala Trp Pro Cys Asn Asp Thr Lys Tyr Ile Thr Gln Phe         195 200 205 Pro Glu Thr Lys Glu Ile Trp Ser Tyr Gly Ser Gly Tyr Gly Gly Asn     210 215 220 Ala Ile Leu Ala Lys Lys Cys Tyr Ala Leu Arg Ile Ala Ser Val Met 225 230 235 240 Ala Arg Glu Glu Gly Trp Met Ala Glu His Met Leu Ile Leu Lys Leu                 245 250 255 Ile Asn Pro Glu Gly Lys Ala Tyr His Ile Ala Ala Ala Phe Pro Ser             260 265 270 Ala Cys Gly Lys Thr Asn Leu Ala Met Ile Thr Pro Thr Ile Pro Gly         275 280 285 Trp Thr Ala Gln Val Val Gly Asp Asp Ile Ala Trp Leu Lys Leu Arg     290 295 300 Glu Asp Gly Leu Tyr Ala Val Asn Pro Glu Asn Gly Phe Phe Gly Val 305 310 315 320 Ala Pro Gly Thr Asn Tyr Ala Ser Asn Pro Ile Ala Met Lys Thr Met                 325 330 335 Glu Pro Gly Asn Thr Leu Phe Thr Asn Val Ala Leu Thr Asp Asp Gly             340 345 350 Asp Ile Trp Trp Glu Gly Met Asp Gly Asp Ala Pro Ala His Leu Ile         355 360 365 Asp Trp Met Gly Asn Asp Trp Thr Pro Glu Ser Asp Glu Asn Ala Ala     370 375 380 His Pro Asn Ser Arg Tyr Cys Val Ala Ile Asp Gln Ser Pro Ala Ala 385 390 395 400 Ala Pro Glu Phe Asn Asp Trp Glu Gly Val Lys Ile Asp Ala Ile Leu                 405 410 415 Phe Gly Gly Arg Arg Ala Asp Thr Val Pro Leu Val Thr Gln Thr Tyr             420 425 430 Asp Trp Glu His Gly Thr Met Val Gly Ala Leu Leu Ala Ser Gly Gln         435 440 445 Thr Ala Ala Ser Ala Glu Ala Lys Val Gly Thr Leu Arg His Hisp Pro     450 455 460 Met Ala Met Leu Pro Phe Ile Gly Tyr Asn Ala Gly Glu Tyr Leu Gln 465 470 475 480 Asn Trp Ile Asp Met Gly Asn Lys Gly Gly Asp Lys Met Pro Ser Ile                 485 490 495 Phe Leu Val Asn Trp Phe Arg Arg Gly Glu Asp Gly Arg Phe Leu Trp             500 505 510 Pro Gly Phe Gly Asp Asn Ser Arg Val Leu Lys Trp Val Ile Asp Arg         515 520 525 Ile Glu Gly His Val Gly Ala Asp Glu Thr Val Val Gly His Thr Ala     530 535 540 Lys Ala Glu Asp Leu Asp Leu Asp Gly Leu Asp Thr Pro Ile Glu Asp 545 550 555 560 Val Lys Glu Ala Leu Thr Ala Pro Ala Glu Gln Trp Ala Asn Asp Val                 565 570 575 Glu Asp Asn Ala Glu Tyr Leu Thr Phe Leu Gly Pro Arg Val Ala             580 585 590 Glu Val His Ser Gln Phe Asp Ala Leu Lys Ala Arg Ile Ser Ala Ala         595 600 605 His Ala     610 <210> 4 <211> 1866 <212> DNA <213> C. glutamicum ATCC13032 <400> 4 gcactgtcga atgacacaaa atctggagaa gtaatgacta ctgctgcaat caggggcctt 60 cagggcgagg cgccgaccaa gaataaggaa ctgctgaact ggatcgcaga cgccgtcgag 120 ctcttccagc ctgaggctgt tgtgttcgtt gatggatccc aggctgagtg ggatcgcatg 180 gcggaggatc ttgttgaagc cggtaccctc atcaagctca acgaggaaaa gcgtccgaac 240 agctacctag ctcgttccaa cccatctgac gttgcgcgcg ttgagtcccg caccttcatc 300 tgctccgaga aggaagaaga tgctggccca accaacaact gggctccacc acaggcaatg 360 aaggacgaaa tgtccaagca ttacgctggt tccatgaagg ggcgcaccat gtacgtcgtg 420 cctttctgca tgggtccaat cagcgatccg gaccctaagc ttggtgtgca gctcactgac 480 tccgagtacg ttgtcatgtc catgcgcatc atgacccgca tgggtattga agcgctggac 540 aagatcggcg cgaacggcag cttcgtcagg tgcctccact ccgttggtgc tcctttggag 600 ccaggccagg aagacgttgc atggccttgc aacgacacca agtacatcac ccagttccca 660 gagaccaagg aaatttggtc ctacggttcc ggctacggcg gaaacgcaat cctggcaaag 720 aagtgctacg cactgcgtat cgcatctgtc atggctcgcg aagaaggatg gatggctgag 780 cacatgctca tcctgaagct gatcaaccca gagggcaagg cgtaccacat cgcagcagca 840 ttcccatctg cttgtggcaa gaccaacctc gccatgatca ctccaaccat cccaggctgg 900 accgctcagg ttgttggcga cgacatcgct tggctgaagc tgcgcgagga cggcctctac 960 gcagttaacc cagaaaatgg tttcttcggt gttgctccag gcaccaacta cgcatccaac 1020 ccaatcgcga tgaagaccat ggaaccaggc aacaccctgt tcaccaacgt ggcactcacc 1080 gacgacggcg acatctggtg ggaaggcatg gacggcgacg ccccagctca cctcattgac 1140 tggatgggca acgactggac cccagagtcc gacgaaaacg ctgctcaccc taactcccgt 1200 tactgcgtag caatcgacca gtccccagca gcagcacctg agttcaacga ctgggaaggc 1260 gtcaagatcg acgcaatcct cttcggtgga cgtcgcgcag acaccgtccc actggttacc 1320 cgacctacg actgggagca cggcaccatg gttggtgcac tgctcgcatc cggtcagacc 1380 gcagcttccg cagaagcaaa ggtcggcaca ctccgccacg acccaatggc aatgctccca 1440 ttcattggct acaacgctgg tgaatacctg cagaactgga ttgacatggg taacaagggt 1500 ggcgacaaga tgccatccat cttcctggtc aactggttcc gccgtggcga agatggacgc 1560 ttcctgtggc ctggcttcgg cgacaactct cgcgttctga agtgggtcat cgaccgcatc 1620 gaaggccacg ttggcgcaga cgagaccgtt gttggacaca ccgctaaggc cgaagacctc 1680 gacctcgacg gcctcgacac cccaattgag gatgtcaagg aagcactgac cgctcctgca 1740 gagcagtggg caaacgacgt tgaagacaac gccgagtacc tcactttcct cggaccacgt 1800 gttcctgcag aggttcacag ccagttcgat gctctgaagg cccgcatttc agcagctcac 1860 gcttaa 1866 <210> 5 <211> 919 <212> PRT <213> C. glutamicum ATCC13032 <400> 5 Met Thr Asp Phe Leu Arg Asp Asp Ile Arg Phe Leu Gly Gln Ile Leu   1 5 10 15 Gly Glu Val Ile Glu Glu Glu Glu Glu Glu Val Tyr Glu Leu Val              20 25 30 Glu Gln Ala Arg Leu Thr Ser Phe Asp Ile Ala Lys Gly Asn Ala Glu          35 40 45 Met Asp Ser Leu Val Gln Val Phe Asp Gly Ile Thr Pro Ala Lys Ala      50 55 60 Thr Pro Ile Ala Arg Ala Phe Ser His Phe Ala Leu Leu Ala Asn Leu  65 70 75 80 Ala Glu Asp Leu Tyr Asp Glu Glu Leu Arg Glu Gln Ala Leu Asp Ala                  85 90 95 Gly Asp Thr Pro Pro Asp Ser Thr Leu Asp Ala Thr Trp Leu Lys Leu             100 105 110 Asn Glu Gly Asn Val Gly Aslan Glu Ala Val Ala Asp Val Leu Arg Asn         115 120 125 Ala Glu Val Ala Pro Val Leu Thr Ala His Pro Thr Glu Thr Arg Arg     130 135 140 Arg Thr Val Phe Asp Ala Gln Lys Trp Ile Thr Thr His Met Arg Glu 145 150 155 160 Arg His Ala Leu Gln Ser Ala Glu Pro Thr Ala Arg Thr Gln Ser Lys                 165 170 175 Leu Asp Glu Ile Glu Lys Asn Ile Arg Arg Ile Thr Ile Leu Trp             180 185 190 Gln Thr Ala Leu Ile Arg Val Ala Arg Pro Arg Ile Glu Asp Glu Ile         195 200 205 Glu Val Gly Leu Arg Tyr Tyr Lys Leu Ser Leu Leu Glu Glu Ile Pro     210 215 220 Arg Ile Asn Arg Asp Val Ala Val Glu Leu Arg Glu Arg Phe Gly Glu 225 230 235 240 Gly Val Pro Leu Lys Pro Val Val Lys Pro Gly Ser Trp Ile Gly Gly                 245 250 255 Asp His Asp Gly Asn Pro Tyr Val Thr Ala Glu Thr Val Glu Tyr Ser             260 265 270 Thr His Arg Ala Glu Thr Val Leu Lys Tyr Tyr Ala Arg Gln Leu         275 280 285 His Ser Leu Glu His Glu Leu Ser Leu Ser Asp Arg Met Asn Lys Val     290 295 300 Thr Pro Gln Leu Leu Ala Leu Ala Asp Ala Gly His Asn Asp Val Pro 305 310 315 320 Ser Arg Val Asp Glu Pro Tyr Arg Arg Ala Val His Gly Val Arg Gly                 325 330 335 Arg Ile Leu Ala Thr Thr Ala Glu Leu Ile Gly Glu Asp Ala Val Glu             340 345 350 Gly Val Trp Phe Lys Val Phe Thr Pro Tyr Ala Ser Pro Glu Glu Phe         355 360 365 Leu Asn Asp Ala Leu Thr Ile Asp His Ser Leu Arg Glu Ser Lys Asp     370 375 380 Val Leu Ile Ala Asp Asp Arg Leu Ser Val Leu Ile Ser Ala Ile Glu 385 390 395 400 Ser Phe Gly Phe Asn Leu Tyr Ala Leu Asp Leu Arg Gln Asn Ser Glu                 405 410 415 Ser Tyr Glu Asp Val Leu Thr Glu Leu Phe Glu Arg Ala Gln Val Thr             420 425 430 Ala Asn Tyr Arg Glu Leu Ser Glu Ala Glu Lys Leu Glu Val Leu Leu         435 440 445 Lys Glu Leu Arg Ser Pro Arg Pro Leu Ile Pro His Gly Ser Asp Glu     450 455 460 Tyr Ser Glu Val Thr Asp Arg Glu Leu Gly Ile Phe Arg Thr Ala Ser 465 470 475 480 Glu Ala Val Lys Lys Phe Gly Pro Arg Met Val Pro His Cys Ile Ile                 485 490 495 Ser Met Ala Ser Val Thr Asp Val Leu Glu Pro Met Val Leu Leu             500 505 510 Lys Glu Phe Gly Leu Ile Ala Ala Asn Gly Asp Asn Pro Arg Gly Thr         515 520 525 Val Asp Val Ile Pro Leu Phe Glu Thr Ile Glu Asp Leu Gln Ala Gly     530 535 540 Ala Gly Ile Leu Asp Glu Leu Trp Lys Ile Asp Leu Tyr Arg Asn Tyr 545 550 555 560 Leu Leu Gln Arg Asp Asn Val Gln Glu Val Met Leu Gly Tyr Ser Asp                 565 570 575 Ser Asn Lys Asp Gly Gly Tyr Phe Ser Ala Asn Trp Ala Leu Tyr Asp             580 585 590 Ala Glu Leu Gln Leu Val Glu Leu Cys Arg Ser Ala Gly Val Lys Leu         595 600 605 Arg Leu Phe His Gly Arg Gly Gly Thr Val Gly Arg Gly Gly Gly Pro     610 615 620 Ser Tyr Asp Ala Ile Leu Ala Gln Pro Arg Gly Ala Val Gln Gly Ser 625 630 635 640 Val Arg Ile Thr Glu Gln Gly Glu Ile Ile Ser Ala Lys Tyr Gly Asn                 645 650 655 Pro Glu Thr Ala Arg Arg Asn Leu Glu Ala Leu Val Ser Ala Thr Leu             660 665 670 Glu Ala Ser Leu Leu Asp Val Ser Glu Leu Thr Asp His Gln Arg Ala         675 680 685 Tyr Asp Ile Met Ser Glu Ile Ser Glu Leu Ser Leu Lys Lys Tyr Ala     690 695 700 Ser Leu Val His Glu Asp Gln Gly Phe Ile Asp Tyr Phe Thr Gln Ser 705 710 715 720 Thr Pro Leu Gln Glu Ile Gly Ser Leu Asn Ile Gly Ser Arg Pro Ser                 725 730 735 Ser Arg Lys Gln Thr Ser Ser Val Glu Asp Leu Arg Ala Ile Pro Trp             740 745 750 Val Leu Ser Trp Ser Gln Ser Arg Val Met Leu Pro Gly Trp Phe Gly         755 760 765 Val Gly Thr Ala Leu Glu Gln Trp Ile Gly Glu Gly Glu Gln Ala Thr     770 775 780 Gln Arg Ile Ala Glu Leu Gln Thr Leu Asn Glu Ser Trp Pro Phe Phe 785 790 795 800 Thr Ser Val Leu Asp Asn Met Ala Gln Val Met Ser Lys Ala Glu Leu                 805 810 815 Arg Leu Ala Lys Leu Tyr Ala Asp Leu Ile Pro Asp Thr Glu Val Ala             820 825 830 Glu Arg Val Tyr Ser Val Ile Arg Glu Glu Tyr Phe Leu Thr Lys Lys         835 840 845 Met Phe Cys Val Ile Thr Gly Ser Asp Asp Leu Leu Asp Asp Asn Pro     850 855 860 Leu Leu Ala Arg Ser Val Gln Arg Arg Tyr Pro Tyr Leu Leu Pro Leu 865 870 875 880 Asn Val Ile Gln Val Glu Met Met Arg Arg Tyr Arg Lys Gly Asp Gln                 885 890 895 Ser Glu Gln Val Ser Arg Asn Ile Gln Leu Thr Met Asn Gly Leu Ser             900 905 910 Thr Ala Leu Arg Asn Ser Gly         915 <210> 6 <211> 2799 <212> DNA <213> C. glutamicum ATCC13032 <400> 6 gccaacaccc tcaatgtgaa agagtgttta aagtagttaa tgactgattt tttacgcgat 60 gacatcaggt tcctcggtca aatcctcggt gaggtaattg cggaacaaga aggccaggag 120 gtttatgaac tggtcgaaca agcgcgcctg acttcttttg atatcgccaa gggcaacgcc 180 gaaatggata gcctggttca ggttttcgac ggcattactc cagccaaggc aacaccgatt 240 gctcgcgcat tttcccactt cgctctgctg gctaacctgg cggaagacct ctacgatgaa 300 gagcttcgtg aacaggctct cgatgcaggc gacacccctc cggacagcac tcttgatgcc 360 acctggctga aactcaatga gggcaatgtt ggcgcagaag ctgtggccga tgtgctgcgc 420 aatgctgagg tggcgccggt tctgactgcg cacccaactg agactcgccg ccgcactgtt 480 tttgatgcgc aaaagtggat caccacccac atgcgtgaac gccacgcttt gcagtctgcg 540 gagcctaccg ctcgtacgca aagcaagttg gatgagatcg agaagaacat ccgccgtcgc 600 atcaccattt tgtggcagac cgcgttgatt cgtgtggccc gcccacgtat cgaggacgag 660 atcgaagtag ggctgcgcta ctacaagctg agccttttgg aagagattcc acgtatcaac 720 cgtgatgtgg ctgttgagct tcgtgagcgt ttcggcgagg gtgttccttt gaagcccgtg 780 gtcaagccag gttcctggat tggtggagac cacgacggta acccttatgt caccgcggaa 840 acagttgagt attccactca ccgcgctgcg gaaaccgtgc tcaagtacta tgcacgccag 900 ctgcattccc tcgagcatga gctcagcctg tcggaccgca tgaataaggt caccccgcag 960 ctgcttgcgc tggcagatgc agggcacaac gacgtgccaa gccgcgtgga tgagccttat 1020 cgacgcgccg tccatggcgt tcgcggacgt atcctcgcga cgacggccga gctgatcggc 1080 gaggacgccg ttgagggcgt gtggttcaag gtctttactc catacgcatc tccggaagaa 1140 ttcttaaacg atgcgttgac cattgatcat tctctgcgtg aatccaagga cgttctcatt 1200 gccgatgatc gtttgtctgt gctgatttct gccatcgaga gctttggatt caacctttac 1260 gcactggatc tgcgccaaaa ctccgaaagc tacgaggacg tcctcaccga gcttttcgaa 1320 cgcgcccaag tcaccgcaaa ctaccgcgag ctgtctgaag cagagaagct tgaggtgctg 1380 ctgaaggaac tgcgcagccc tcgtccgctg atcccgcacg gttcagatga atacagcgag 1440 gtcaccgacc gcgagctcgg catcttccgc accgcgtcgg aggctgttaa gaaattcggg 1500 ccacggatgg tgcctcactg catcatctcc atggcatcat cggtcaccga tgtgctcgag 1560 ccgatggtgt tgctcaagga attcggactc atcgcagcca acggcgacaa cccacgcggc 1620 accgtcgatg tcatcccact gttcgaaacc atcgaagatc tccaggccgg cgccggaatc 1680 ctcgacgaac tgtggaaaat tgatctctac cgcaactacc tcctgcagcg cgacaacgtc 1740 caggaagtca tgctcggtta ctccgattcc aacaaggatg gcggatattt ctccgcaaac 1800 tgggcgcttt acgacgcgga actgcagctc gtcgaactat gccgatcagc cggggtcaag 1860 cttcgcctgt tccacggccg tggtggcacc gtcggccgcg gtggcggacc ttcctacgac 1920 gcgattcttg cccagcccag gggggctgtc caaggttccg tgcgcatcac cgagcagggc 1980 gagatcatct ccgctaagta cggcaacccc gaaaccgcgc gccgaaacct cgaagccctg 2040 gtctcagcca cgcttgaggc atcgcttctc gacgtctccg aactcaccga tcaccaacgc 2100 gcgtacgaca tcatgagtga gatctctgag ctcagcttga agaagtacgc ctccttggtg 2160 cacgaggatc aaggcttcat cgattacttc acccagtcca cgccgctgca ggagattgga 2220 tccctcaaca tcggatccag gccttcctca cgcaagcaga cctcctcggt ggaagatttg 2280 cgagccatcc catgggtgct cagctggtca cagtctcgtg tcatgctgcc aggctggttt 2340 ggtgtcggaa ccgcattaga gcagtggatt ggcgaagggg agcaggccac ccaacgcatt 2400 gccgagctgc aaacactcaa tgagtcctgg ccatttttca cctcagtgtt ggataacatg 2460 gctcaggtga tgtccaaggc agagctgcgt ttggcaaagc tctacgcaga cctgatccca 2520 gatacggaag tagccgagcg agtctattcc gtcatccgcg aggagtactt cctgaccaag 2580 aagatgttct gcgtaatcac cggctctgat gatctgcttg atgacaaccc acttctcgca 2640 cgctctgtcc agcgccgata cccctacctg cttccactca acgtgatcca ggtagagatg 2700 atgcgacgct accgaaaagg cgaccaaagc gagcaagtgt cccgcaacat tcagctgacc 2760 atgaacggtc tttccactgc gctgcgcaac tccggctag 2799 <210> 7 <211> 381 <212> PRT <213> B. subtilis 168 <400> 7 Val Arg Ser Lys Lys Leu Trp Ile Ser Leu Leu Phe Ala Leu Thr Leu   1 5 10 15 Ile Phe Thr Met Ala Phe Ser Asn Met Ser Ala Gln Ala Ala Gly Lys              20 25 30 Ser Ser Thr Glu Lys Lys Tyr Ile Val Gly Phe Lys Gln Thr Met Ser          35 40 45 Ala Met Ser Ser Ala Lys Lys Lys Asp Val Ile Ser Glu Lys Gly Gly      50 55 60 Lys Val Gln Lys Gln Phe Lys Tyr Val Asn Ala Ala Ala Thr Leu  65 70 75 80 Asp Glu Lys Ala Val Lys Glu Leu Lys Lys Asp Pro Ser Val Ala Tyr                  85 90 95 Val Glu Glu Asp His Ile Ala His Glu Tyr Ala Gln Ser Val Pro Tyr             100 105 110 Gly Ile Ser Gln Ile Lys Ala Pro Ala Leu His Ser Gln Gly Tyr Thr         115 120 125 Gly Ser Asn Val Lys Val Ala Val Ile Asp Ser Gly Ile Asp Ser Ser     130 135 140 His Pro Asp Leu Asn Val Arg Gly Gly Ala Ser Phe Val Pro Ser Glu 145 150 155 160 Thr Asn Pro Tyr Gln Asp Gly Ser Ser His Gly Thr His Val Ala Gly                 165 170 175 Thr Ile Ala Leu Asn Asn Ser Ile Gly Val Leu Gly Val Ala Pro             180 185 190 Ser Ala Ser Leu Tyr Ala Val Lys Val Leu Asp Ser Thr Gly Ser Gly         195 200 205 Gln Tyr Ser Trp Ile Ile Asn Gly Ile Glu Trp Ile Ile Ser Asn Asn     210 215 220 Met Asp Val Ile Asn Met Ser Leu Gly Gly Pro Thr Gly Ser Thr Ala 225 230 235 240 Leu Lys Thr Val Val Asp Lys Ala Val Ser Ser Gly Ile Val Val Ala                 245 250 255 Ala Ala Ala Gly Asn Glu Gly Ser Ser Gly Ser Ser Ser Thr Val Gly             260 265 270 Tyr Pro Ala Lys Tyr Pro Ser Thr Ile Ala Val Gly Ala Val Asn Ser         275 280 285 Ser Asn Gln Arg Ala Ser Phe Ser Ser Ala Gly Ser Glu Leu Asp Val     290 295 300 Met Ala Pro Gly Val Ser Ile Gln Ser Thr Leu Pro Gly Gly Thr Tyr 305 310 315 320 Gly Ala Tyr Asn Gly Thr Ser Met Ala Thr Pro His Val Ala Gly Ala                 325 330 335 Ala Ala Leu Ile Leu Ser Lys His Pro Thr Trp Thr Asn Ala Gln Val             340 345 350 Arg Asp Arg Leu Glu Ser Thr Ala Thr Tyr Leu Gly Asn Ser Phe Tyr         355 360 365 Tyr Gly Lys Gly Leu Ile Asn Val Gln Ala Ala Ala Gln     370 375 380 <210> 8 <211> 1449 <212> DNA <213> B. subtilis 168 <400> 8 cgcaggtcat ttgaacgaat tttttcgaca ggaatttgcc gggactcagg agcatttaac 60 ctaaaaaagc atgacatttc agcataatga acatttactc atgtctattt tcgttctttt 120 ctgtatgaaa atagttattt cgagtctcta cggaaatagc gagagatgat atacctaaat 180 agagataaaa tcatctcaaa aaaatgggtc tactaaaata ttattccatc tattacaata 240 aattcacaga atagtctttt aagtaagtct actctgaatt tttttaaaag gagagggtaa 300 agagtgagaa gcaaaaaatt gtggatcagc ttgttgtttg cgttaacgtt aatctttacg 360 atggcgttca gcaacatgtc tgcgcaggct gccggaaaaa gcagtacaga aaagaaatac 420 attgtcggat ttaaacagac aatgagtgcc atgagttccg ccaagaaaaa ggatgttatt 480 tctgaaaaag gcggaaaggt tcaaaagcaa tttaagtatg ttaacgcggc cgcagcaaca 540 ttggatgaaa aagctgtaaa agaattgaaa aaagatccga gcgttgcata tgtggaagaa 600 gatcatattg cacatgaata tgcgcaatct gttccttatg gcatttctca aattaaagcg 660 ccggctcttc actctcaagg ctacacaggc tctaacgtaa aagtagctgt tatcgacagc 720 ggaattgact cttctcatcc tgacttaaac gtcagaggcg gagcaagctt cgtaccttct 780 gaaacaaacc cataccagga cggcagttct cacggtacgc atgtagccgg tacgattgcc 840 gctcttaata actcaatcgg tgttctgggc gtagcgccaa gcgcatcatt atatgcagta 900 aaagtgcttg attcaacagg aagcggccaa tatagctgga ttattaacgg cattgagtgg 960 gccatttcca acaatatgga tgttatcaac atgagccttg gcggacctac tggttctaca 1020 gcgctgaaaa cagtcgttga caaagccgtt tccagcggta tcgtcgttgc tgccgcagcc 1080 ggaaacgaag gttcatccgg aagcacaagc acagtcggct accctgcaaa atatccttct 1140 actattgcag taggtgcggt aaacagcagc aaccaaagag cttcattctc cagcgcaggt 1200 tctgagcttg atgtgatggc tcctggcgtg tccatccaaa gcacacttcc tggaggcact 1260 tacggcgctt ataacggaac gtccatggcg actcctcacg ttgccggagc agcagcgtta 1320 attctttcta agcacccgac ttggacaaac gcgcaagtcc gtgatcgttt agaaagcact 1380 gcaacatatc ttggaaactc tttctactat ggaaaagggt taatcaacgt acaagcagct 1440 gcacaataa 1449 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer CgPck_F <400> 9 gcatgcatgc actgtcgaat gacac 25 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer CgPck_R <400> 10 gcatgcatgc acctaggtta agcgtgagct g 31 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer CgPpc_F <400> 11 gcatgcatgc caacaccct 19 <210> 12 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Primer CgPpc_R <400> 12 gcatgcatgc acctaggcta gccggagttg c 31 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer EcPck_F <400> 13 ctgcagggca atacatattg gctaaggagc 30 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Primer EcPck_R <400> 14 ctgcaggcac ctaggttaca gtttcggacc agccg 35 <210> 15 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer BsAprE_F1 <400> 15 ctgcagaaaa ggagagggta aagag 25 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer BsAprE_R1 <400> 16 ctgcagttat tgtgcagctg cttgt 25 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer BsAprE_F2 <400> 17 gcacctaggc gcaggtcatt tg 22 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer BsAprE_R2 <400> 18 gcacctaggt tattgtgcag ctgc 24 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer CAT_F <400> 19 aggacgcccg ccataaact 19 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer CAT_R <400> 20 tcgaagctcg gcggatttg 19 <210> 21 <211> 219 <212> PRT <213> Artificial Sequence <220> <223> cat (Chloramphenicol acetyl transferase) amino acid sequence          obtained from pKK232-8 vector <400> 21 Met Glu Lys Lys Ile Thr Gly Tyr Thr Thr Val Asp Ile Ser Gln Ser   1 5 10 15 His Arg Lys Glu His Phe Glu Ala Phe Gln Ser Val Ala Gln Cys Thr              20 25 30 Tyr Asn Gln Thr Val Gln Leu Asp Ile Thr Ala Phe Leu Lys Thr Val          35 40 45 Lys Lys Asn Lys His Lys Phe Tyr Pro Ala Phe Ile His Ile Leu Ala      50 55 60 Arg Leu Met Asn Ala His Pro Glu Phe Arg Met Ala Met Lys Asp Gly  65 70 75 80 Glu Leu Val Ile Trp Asp Ser Val His Pro Cys Tyr Thr Val Phe His                  85 90 95 Glu Gln Thr Glu Thr Phe Ser Ser Leu Trp Ser Glu Tyr His Asp Asp             100 105 110 Phe Arg Gln Phe Leu His Ile Tyr Ser Gln Asp Val Ala Cys Tyr Gly         115 120 125 Glu Asn Leu Ala Tyr Phe Pro Lys Gly Phe Ile Glu Asn Met Phe Phe     130 135 140 Val Ser Ala Asn Pro Trp Val Ser Phe Thr Ser Phe Asp Leu Asn Val 145 150 155 160 Ala Asn Met Asp Asn Phe Phe Ala Pro Val Phe Thr Met Gly Lys Tyr                 165 170 175 Tyr Thr Gln Gly Asp Lys Val Leu Met Pro Leu Ala Ile Gln Val His             180 185 190 His Ala Val Cys Asp Gly Phe His Val Gly Arg Met Leu Asn Glu Leu         195 200 205 Gln Gln Tyr Cys Asp Glu Trp Gln Gly Gly Ala     210 215 <210> 22 <211> 660 <212> DNA <213> Artificial Sequence <220> <223> cat (Chloramphenicol acetyl transferase) nucleotide sequence          obtained from pKK232-8 vector <400> 22 atggagaaaa aaatcactgg atataccacc gttgatatat cccaatcgca tcgtaaagaa 60 cattttgagg catttcagtc agttgctcaa tgtacctata accagaccgt tcagctggat 120 attacggcct ttttaaagac cgtaaagaaa aataagcaca agttttatcc ggcctttatt 180 cacattcttg cccgcctgat gaatgctcat ccggaattcc gtatggcaat gaaagacggt 240 gagctggtga tatgggatag tgttcaccct tgttacaccg ttttccatga gcaaactgaa 300 acgttttcat cgctctggag tgaataccac gacgatttcc ggcagtttct acacatatat 360 tcgcaagatg tggcgtgtta cggtgaaaac ctggcctatt tccctaaagg gtttattgag 420 aatatgtttt tcgtctcagc caatccctgg gtgagtttca ccagttttga tttaaacgtg 480 gccaatatgg acaacttctt cgcccccgtt ttcaccatgg gcaaatatta tacgcaaggc 540 gacaaggtgc tgatgccgct ggcgattcag gttcatcatg ccgtctgtga tggcttccat 600 gtcggcagaa tgcttaatga attacaacag tactgcgatg agtggcaggg cggggcgtaa 660                                                                          660

Claims (6)

A microorganism of the genus Corynebacterium having an increased productivity of target substance compared to a parent cell, wherein a gene encoding phosphoenolpyruvate carboxykinase (PCK) derived from Escherichia coli is introduced. The microorganism according to claim 1, which is Corynebacterium glutamicum. The microorganism according to claim 1, wherein a foreign gene encoding a target substance is introduced or a metabolic pathway is genetically modified for production of a target substance. The microorganism according to claim 1, wherein the target substance is a protein. Culturing the microorganism of any one of claims 1 to 4; And
And separating the target substance from the culture. 5. The method according to claim 4, wherein the target substance is a protein and the microorganism is Corynebacterium glutamicum.

Images