KR20150131559A - MicroRNA-34 for the diagnosis and treatment of muscle aging - Google Patents

MicroRNA-34 for the diagnosis and treatment of muscle aging Download PDF

Info

Publication number
KR20150131559A
KR20150131559A KR1020140058385A KR20140058385A KR20150131559A KR 20150131559 A KR20150131559 A KR 20150131559A KR 1020140058385 A KR1020140058385 A KR 1020140058385A KR 20140058385 A KR20140058385 A KR 20140058385A KR 20150131559 A KR20150131559 A KR 20150131559A
Authority
KR
South Korea
Prior art keywords
mirna
muscle
rna
aging
fragment
Prior art date
Application number
KR1020140058385A
Other languages
Korean (ko)
Inventor
권기선
김지영
김선영
이광표
권은수
이승민
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Priority to KR1020140058385A priority Critical patent/KR20150131559A/en
Priority to PCT/KR2015/004929 priority patent/WO2015174798A1/en
Publication of KR20150131559A publication Critical patent/KR20150131559A/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase chain reaction [PCR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to miRNA-34 as a diagnostic marker for muscle aging, and more specifically, to a composition for diagnosing muscle aging comprising an agent for measuring the expression level of miRNA-34 or fragments thereof, a kit for diagnosing muscle aging comprising the composition, and a method for providing information for diagnosing muscle aging including a step for measuring the expression level of the miRNA-34 or fragments thereof. The muscle aging can cause muscular atrophy and deterioration of muscle functions associated with the same, and diseases such as obesity, diabetes mellitus, and the like due to the accompanying energy hypometabolism. Various miRNAs including the miRNA-34, provided in the present invention, can be used as a marker for diagnosing the progress of muscle aging, whether the muscle aging has been detected or not, and the degree of the muscle aging, thereby being able to be widely used as a marker having excellent effects on developing a kit for diagnosing the muscle aging, and searching for a muscle aging inhibitory substance.

Description

근육노화 진단 및 치료를 위한 마이크로RNA-34{MicroRNA-34 for the diagnosis and treatment of muscle aging}MicroRNA-34 for the diagnosis and treatment of muscle aging.

본 발명은 근육노화 진단 마커로서의 마이크로RNA-34에 관한 것으로서, 보다 구체적으로 본 발명은 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는 근육노화 진단용 조성물, 상기 조성물을 포함하는 근육노화 진단용 키트 및 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화 진단을 위한 정보를 제공하는 방법에 관한 것이다.
The present invention relates to microRNA-34 as a diagnostic marker for muscle aging. More specifically, the present invention relates to a composition for diagnosing muscle aging comprising an agent for measuring the expression level of miRNA-34 or a fragment thereof, a muscle aging And a method for providing information for diagnosing muscle aging comprising the step of measuring the expression level of a diagnostic kit and miRNA-34 or fragment thereof.

노화는 생리학적 노화와 병적 노화로 크게 나뉘어진다. 생리학적 노화는 가령에 수반하여 필연적으로 일어나는 노화로서, 모발, 피부, 눈, 뼈, 뇌 등의 변화, 운동 능력이나 에너지 대사의 저하가 생긴다. Aging is largely divided into physiological aging and pathological aging. Physiological aging is an age-related aging that accompanies, for example, changes in hair, skin, eyes, bones, brain, exercise capacity and energy metabolism.

한편, 노화에 의해 생기는 근력이나 지구력의 저하는 일상의 생활 능력을 저하시킨다. 또한, 에너지 대사의 저하는 에너지 섭취와 에너지 소비의 불균형을 초래하여, 비만이나 당뇨병 등의 생활 습관병의 원인이 될 수도 있다. On the other hand, the decrease in strength and endurance caused by aging lowers daily life ability. In addition, degradation of energy metabolism causes unbalance of energy consumption and energy consumption, and may cause lifestyle diseases such as obesity and diabetes.

일반적으로, 근육의 근질량이나 근력이 감소하는 근위축(muscular atrophy)에는, 폐용성 근위축(disuse muscle atrophy)이나 사르코페니아(Sarcopenia) 등을 들 수 있는데, 근위축이 일어나면, 그에 수반하여 근기능의 저하가 나타나게 된다. 특히, 고령자는 가령에 의한 근위축이나 근력의 저하가 관찰되어, 근육 손상이나 골절이 되기 쉬워지며, 이의 치료 및 요양을 위한 안정 상태나 깁스 고정 등의 활동 제한하에 놓여지면, 폐용성 근위축이나 근기능의 저하가 급속히 진행되는 악순환에 빠지게 된다. In general, muscular atrophy, in which muscle mass or muscle strength is reduced, includes disuse muscle atrophy and Sarcopenia. When muscle atrophy occurs, muscular atrophy accompanies the muscular atrophy . ≪ / RTI > In particular, elderly people are susceptible to muscle atrophy or muscle weakness, and are liable to muscle damage or fracture. When placed under restricting conditions such as stable state or casting fixation for treatment and care, The myocardial function is rapidly declining.

노화는 유전적 요인이나 환경적 요인에 의해 진행되지만, 식사 및 운동과 같은 생활 습관을 비롯한 환경적 요인을 개선함으로써 늦추는 것은 가능하다고 여겨지고 있다. 노화에 수반하는 운동 능력 저하나 근위축이나 근기능의 저하를 방지하는 수단으로서, 특히 고령자의 경우에는 적당한 운동 또는 재활요법(rehabilitation)의 실천이 요망된다. Aging is driven by genetic or environmental factors, but it is considered possible to slow down by improving environmental factors, such as eating habits and exercise. As a means to prevent exercise capacity accompanied by aging and to prevent muscle atrophy and decrease in myocardial function, it is particularly desirable to exercise exercise or rehabilitation in the case of the elderly.

아울러, 최근에는 운동이나 이학요법 뿐만 아니라, 노화를 억제할 수 있는, 보다 구체적으로 근위축 및 그에 수반하는 근기능의 저하 등의 근육노화를 억제할 수 있는 성분 탐색 연구가 행해지고 있다. In addition, in recent years, not only exercise and physical therapies but also researches for components capable of inhibiting aging and more specifically inhibiting muscle aging such as muscle atrophy and accompanying deterioration of muscle function have been conducted.

이와 더불어, 근위축 및 그에 수반하는 근기능의 저하 뿐만 아니라, 이에 따른 에너지 대사의 저하로 비만이나 당뇨병 등의 질환까지도 수반할 수 있는 근육노화의 여부 및 정도를 진단하거나, 상기 근육노화 억제 물질을 탐색하는데 있어서 탁월한 효과가 있는 진단 마커의 개발이 절실하다. In addition to this, it is possible to diagnose the degree and the degree of muscle aging which can accompany not only muscle atrophy and accompanying muscle weakness but also metabolic degeneration resulting from obesity and diabetes, It is necessary to develop a diagnostic marker having an excellent effect in the diagnosis of cancer.

최근, 노화를 비롯한 다양한 생명현상을 조절하는 주요한 인자로 알려져 많은 관심을 받고 있는 것들 중 하나로 마이크로RNA(microRNA; miRNA)가 있다. miRNA는 약 22개의 염기서열로 이루어진 짧은 암호화되지 않은(non-coding) RNA로서, 식물에서부터 다양한 동물들에서 발견되는 유전체이다. miRNA는 전사 이후의 단계에서 상보적인 메신저RNA(messenger RNA; mRNA)의 전사과정을 방해하거나 mRNA를 분해하게 함으로써, 30% 이상의 단백질 생산 유전자 발현을 조절하는 것으로 알려져 있다. 이 miRNA는 다양한 생물학적 과정에 관여한다는 것이 많은 연구들을 통해 밝혀졌으며, 최근에는 세포, 조직 및 한 개체의 수명 등 여러 노화과정에 miRNA 발현 변화가 중요한 역할을 한다고 보고되고 있다.Recently, micro RNA (miRNA) has been recognized as a major factor controlling various life phenomena including aging. miRNA is a short non-coding RNA of about 22 nucleotides in length and is a genome found in various animals from plants. It is known that miRNAs regulate over 30% protein production gene expression by interfering with transcription of complementary messenger RNA (mRNA) or by degrading mRNA in post-transcriptional stages. Many studies have shown that these miRNAs are involved in various biological processes. Recently, miRNA expression changes have been reported to play an important role in various aging processes such as cell, tissue, and life span of an individual.

아직까지 miRNA가 노화 질환에 어떤 역할을 하는지는 잘 알려져 있지는 않으나, 노화과정에 있어서 miRNA의 발현 변화에 대한 연구가 활발히 진행되고 있다. 예컨대, 피부 노화에 대한 징후(예를 들어, 주름)를 감소시키기 위한, 노화 관련 유전자 및 miRNA를 기재한 문헌(미국공개특허, 제2011-0301091호), 마우스의 노화된 간(liver) 및 뇌(brain) 등의 기관에서 발현되는 노화와 관련된 유전자 및 miRNA의 발현량 변화 및 역할에 대해 기재한 문헌(Smith-Vikos T. et al., J Cell Sci ., 125(1):7-17, 2012) 및 마우스의 노화된 심장에서 발현되는 노화와 관련된 miRNA 및 miRNA 클러스터(cluster)의 발현량 변화에 대해 기재한 문헌(Zhang X. et al., PLoS One ., 7(4):e34688, 2012) 등이 보고된 바 있다. Although it is not yet known how miRNAs play a role in aging diseases, studies on the expression of miRNAs in the aging process are actively under way. For example, US Pat. No. 4,030,091, which describes aging-related genes and miRNAs to reduce signs of skin aging (e.g., wrinkles), aged liver and brain of mice (Smith-Vikos T. et al., J Cell < ( R) >) describing changes and roles of genes and miRNA expression levels associated with aging expressed in organs such as brain Sci . , ≪ / RTI > 125 (1): 7-17, 2012) and changes in expression levels of miRNA and miRNA clusters associated with aging expressed in aged hearts of mice (Zhang X. et al., PLoS One . , 7 (4): e34688, 2012).

이러한 노화와 관련된 miRNA는 피부 노화, 심장 및 뇌 등의 다양한 기관의 노화에 따른 질환의 예방 및 치료를 위한 물질 탐색 용도로 유용하게 활용될 수 있을 것으로 기대하고 있으나, 아직까지는 근육노화 진단 마커로서 miRNA의 용도에 대해서는 밝혀진 바가 없다.
It is expected that the miRNA associated with aging can be usefully used as a substance search for the prevention and treatment of diseases caused by aging of various organs such as skin aging, heart and brain, but miRNA Has not been disclosed.

이러한 배경하에서, 본 발명자들은 근육노화를 진단할 수 있는 방법을 개발하기 위하여 예의 연구 노력한 결과, 노화된 골격근에서 다양한 miRNA의 발현량이 변화될 수 있음을 검출함으로써, 이를 통해 근육노화를 진단할 수 있음을 확인하고 본 발명을 완성하였다.
Under these circumstances, the present inventors have made intensive researches to develop a method for diagnosing muscle aging, and as a result, it is possible to diagnose muscle aging by detecting that the expression levels of various miRNAs can be changed in aged skeletal muscle And completed the present invention.

본 발명의 하나의 목적은 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는 근육노화 진단용 조성물을 제공하는 것이다.It is an object of the present invention to provide a composition for diagnosing muscle aging comprising an agent that measures the level of expression of miRNA-34 or a fragment thereof.

본 발명의 다른 목적은 상기 조성물을 포함하는 근육노화 진단용 키트를 제공하는 것이다.Another object of the present invention is to provide a kit for diagnosing muscle aging comprising the composition.

본 발명의 또 다른 목적은 상기 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화 진단을 위한 정보를 제공하는 방법을 제공하는 것이다.
Yet another object of the present invention is to provide a method for providing information for diagnosis of muscle aging comprising the step of measuring the expression level of miRNA-34 or fragment thereof.

상기 목적을 달성하기 위한 하나의 양태로서, 본 발명은 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는, 근육노화 진단용 조성물을 제공한다.In one aspect to achieve the above object, the present invention provides a composition for diagnosing muscle aging comprising an agent for measuring the expression level of miRNA-34 or a fragment thereof.

본 발명에서 사용되는 용어 "miRNA-34"란, miRNA-34a, miRNA-34b 및 miRNA-34c 등으로 구성되며, 생물학적으로, miRNA-34 패밀리(family)는 병리학적으로 심근세포의 비후 및 파괴, 심근세포 사이를 연결하는 콜라겐의 파괴 등의 특징을 보이는 심장 리모델링(cardiac remodeling) 과정을 약화시켜, 심장 기능을 증진시키는 것으로 알려져 있는 miRNA이다. The term "miRNA-34" used in the present invention is composed of miRNA-34a, miRNA-34b and miRNA-34c. Biologically, the miRNA-34 family pathologically indicates hypertrophy and destruction of myocardial cells, It is a miRNA known to enhance cardiac function by weakening the process of cardiac remodeling, which is characterized by destruction of collagen between myocardial cells.

본 발명에서 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c를 포함할 수 있으며, 바람직하게는 miRNA-34a는 서열번호 13의 염기서열을, 그리고 miRNA-34c는 서열번호 16의 염기서열을 가지는 폴리뉴클레오타이드일 수 있다.In the present invention, the miRNA-34 may include miRNA-34a or miRNA-34c, preferably miRNA-34a is a nucleotide sequence of SEQ ID NO: 13 and miRNA-34c is a poly Lt; / RTI > nucleotides.

본 발명에서 사용되는 용어 miRNA-34의 "단편"이란, miRNA의 참조서열(reference sequence)과 비교할 때 결실되거나, 참조 서열과 상응하는 위치와 동일한 서열의 분절을 포함하는 것일 수 있으며, 본 발명의 용어 "참조서열"이란, 서열 비교의 근거로서 사용되도록 지정된 서열이다. 본 발명의 miRNA-34a 단편은, 바람직하게는 서열 번호 14 또는 서열번호 15, 그리고 miRNA-34c 단편은, 서열번호 17 또는 서열번호 18의 서열을 가지는 폴리뉴클레오티드일 수 있다.
As used herein, the term "fragment" of miRNA-34 may be deleted when compared to a reference sequence of a miRNA, or may comprise a segment of the same sequence as the position corresponding to the reference sequence, The term "reference sequence" is a sequence designated to be used as a basis for sequence comparison. The miRNA-34a fragment of the present invention may preferably be a polynucleotide having the sequence of SEQ ID NO: 14 or SEQ ID NO: 15 and the miRNA-34c fragment of SEQ ID NO: 17 or SEQ ID NO: 18.

microRNAmicroRNA 서열order 서열번호 1
(miRNA-136)
SEQ ID NO: 1
(miRNA-136)
GAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAAGCUCCAUCAUCGUCUCAAAUGAGUCUUCGAGGACUCCAUUUGUUUUGAUGAUGGAUUCUUAAGCUCCAUCAUCGUCUCAAAUGAGUCUUC
서열번호 2
(miRNA-136-3p)
SEQ ID NO: 2
(miRNA-136-3p)
AUCAUCGUCUCAAAUGAGUCUUAUCAUCGUCUCAAAUGAGUCUUU
서열번호 3
(miRNA-136-5p)
SEQ ID NO: 3
(miRNA-136-5p)
ACUCCAUUUGUUUUGAUGAUGGACUCCAUUUGUUUUGAUGAUGG
서열번호 4
(miRNA-337)
SEQ ID NO: 4
(miRNA-337)
CAGUGUAGUGAGAAGUUGGGGGGUGGGAACGGCGUCAUGCAGGAGUUGAUUGCACAGCCAUUCAGCUCCUAUAUGAUGCCUUUCUUCACCCCCUUCACAGUGUAGUGAGAAGUUGGGGGGUGGGAACGGCGUCAUGCAGGAGUUGAUUGCACAGCCAUUCAGCUCCUAUAUGAUGCCUUUCUUCACCCCCUUCA
서열번호 5
(miRNA-337-3p)
SEQ ID NO: 5
(miRNA-337-3p)
UUCAGCUCCUAUAUGAUGCCUUUCAGCUCCUAUAUGAUGCCU
서열번호 6
(miRNA-337-5p)
SEQ ID NO: 6
(miRNA-337-5p)
GAACGGCGUCAUGCAGGAGUU
GAACGGCGUCAUGCAGGAGUU
서열번호 7
(miRNA-127)
SEQ ID NO: 7
(miRNA-127)
CCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGG
서열번호 8
(miRNA-127-3p)
SEQ ID NO: 8
(miRNA-127-3p)
UCGGAUCCGUCUGAGCUUGGCUUCGGAUCCGUCUGAGCUUGGCU
서열번호 9
(miRNA-127-5p)
SEQ ID NO: 9
(miRNA-127-5p)
CUGAAGCUCAGAGGGCUCUGAUCUGAAGCUCAGAGGGCUCUGAU
서열번호 10
(miRNA-411)
SEQ ID NO: 10
(miRNA-411)
UGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCAUGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCA
서열번호 11
(miRNA-411-3p)
SEQ ID NO: 11
(miRNA-411-3p)
UAUGUAACACGGUCCACUAACCUAUGUAACACGGUCCACUAACC
서열번호 12
(miRNA-411-5p)
SEQ ID NO: 12
(miRNA-411-5p)
UAGUAGACCGUAUAGCGUACGUAGUAGACCGUAUAGCGUACG
서열번호 13
(miRNA-34a)
SEQ ID NO: 13
(miRNA-34a)
CCAGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGUCCAGCUGUGAGUAAUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGUAUUAGCUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACAUUGU
서열번호 14
(miRNA-34a-3p)
SEQ ID NO: 14
(miRNA-34a-3p)
AAUCAGCAAGUAUACUGCCCUAAUCAGCAAGUAUACUGCCCU
서열번호 15
(miRNA-34a-5p)
SEQ ID NO: 15
(miRNA-34a-5p)
UGGCAGUGUCUUAGCUGGUUGUUGGCAGUGUCUUAGCUGGUUGU
서열번호 16
(miRNA-34c)
SEQ ID NO: 16
(miRNA-34c)
AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACAGCCAGGUAAAAAGACUAGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACAGCCAGGUAAAAAGACU
서열번호 17
(miRNA-34c-3p)
SEQ ID NO: 17
(miRNA-34c-3p)
AAUCACUAACCACACAGCCAGGAAUCACUAACCACACAGCCAGG
서열번호 18
(miRNA-34c-5p)
SEQ ID NO: 18
(miRNA-34c-5p)
AGGCAGUGUAGUUAGCUGAUUGCAGGCAGUGUAGUUAGCUGAUUGC
서열번호 19
(miRNA-143)
SEQ ID NO: 19
(miRNA-143)
CCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGG
서열번호 20
(miRNA-143-3p)
SEQ ID NO: 20
(miRNA-143-3p)
UGAGAUGAAGCACUGUAGCUCUGAGAUGAAGACACUGUAGCUC
서열번호 21
(miRNA-143-5p)
SEQ ID NO: 21
(miRNA-143-5p)
GGUGCAGUGCUGCAUCUCUGGGGUGCAGUGCUGCAUCUCUGG
서열번호 22
(miRNA-144)
SEQ ID NO: 22
(miRNA-144)
GGCUGGGAUAUCAUCAUAUACUGUAAGUUUGUGAUGAGACACUACAGUAUAGAUGAUGUACUAGUCGGCUGGGAUAUCAUCAUAUACUGUAAGUUUGUGAUGAGACACUACAGUAUAGAUGAUGUACUAGUC
서열번호 23
(miRNA-144-3p)
SEQ ID NO: 23
(miRNA-144-3p)
UACAGUAUAGAUGAUGUACUUACAGUAUAGAUGAUGUACU
서열번호 24
(miRNA-144-5p)
SEQ ID NO: 24
(miRNA-144-5p)
GGAUAUCAUCAUAUACUGUAAGUGGAUAUCAUCAUAUACUGUAAGU
서열번호 25
(miRNA-146a)
SEQ ID NO: 25
(miRNA-146a)
AGCUCUGAGAACUGAAUUCCAUGGGUUAUAUCAAUGUCAGACCUGUGAAAUUCAGUUCUUCAGCUAGCUCUGAGAACUGAAUUCCAUGGGUUAUAUCAAUGUCAGACCUGUGAAAUUCAGUUCUUCAGCU
서열번호 26
(miRNA-146a-3p)
SEQ ID NO: 26
(miRNA-146a-3p)
CCUGUGAAAUUCAGUUCUUCAGCCUGUGAAAUUCAGUUCUUCAG
서열번호 27
(miRNA-146a-5p)
SEQ ID NO: 27
(miRNA-146a-5p)
UGAGAACUGAAUUCCAUGGGUUUGAGAACUGAAUUCCAUGGGUU
서열번호 28
(miRNA-148a)
SEQ ID NO: 28
(miRNA-148a)
AGCCAGUUUGGUCUUUUGAGACAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUCUAGAGGCUGUGGUCAGCCAGUUUGGUCUUUUGAGACAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUCUAGAGGCUGUGGUC
서열번호 29
(miRNA-148a-3p)
SEQ ID NO: 29
(miRNA-148a-3p)
UCAGUGCACUACAGAACUUUGUUCAGUGCACUACAGAACUUUGU
서열번호 30
(miRNA-148a-5p)
SEQ ID NO: 30
(miRNA-148a-5p)
AAAGUUCUGAGACACUCCGACUAAAGUUCUGAGACACUCCGACU
서열번호 31
(miRNA-185)
SEQ ID NO: 31
(miRNA-185)
AGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCAGGGGCUGGCUUUCCUCUGGUCCUUAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCAGGGGCUGGCUUUCCUCUGGUCCUU
서열번호 32
(miRNA-185-3p)
SEQ ID NO: 32
(miRNA-185-3p)
AGGGGCUGGCUUUCCUCUGGUAGGGGCUGGCUUUCCUCUGGU
서열번호 33
(miRNA-185-5p)
SEQ ID NO: 33
(miRNA-185-5p)
UGGAGAGAAAGGCAGUUCCUGAUGGAGAGAAAGGCAGUUCCUGA
서열번호 34
(miRNA-190a)
SEQ ID NO: 34
(miRNA-190a)
CUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAGCAUAUUCCUACAGCUGUGUGAUAUGUUUGAUAUAUUAGGUUGUUAUUUAAUCCAACUAUAUAUCAAGCAUAUUCCUACAG
서열번호 35
(miRNA-190a-3p)
SEQ ID NO: 35
(miRNA-190a-3p)
ACUAUAUAUCAAGCAUAUUCCUACUAUAUAUCAAGCAUAUUCCU
서열번호 36
(miRNA-190a-5p)
SEQ ID NO: 36
(miRNA-190a-5p)
UGAUAUGUUUGAUAUAUUAGGUUGAUAUGUUUGAUAUAUUAGGU
서열번호 37
(miRNA-193a)
SEQ ID NO: 37
(miRNA-193a)
GAGAGCUGGGUCUUUGCGGGCAAGAUGAGAGUGUCAGUUCAACUGGCCUACAAAGUCCCAGUCCUCGAGAGCUGGGUCUUUGCGGGCAAGAUGAGAGUGUCAGUUCAACUGGCCUACAAAGUCCCAGUCUCUCUC
서열번호 38
(miRNA-193a-3p)
SEQ ID NO: 38
(miRNA-193a-3p)
AACUGGCCUACAAAGUCCCAGUAACUGGCCUACAAAGUCCCAGU
서열번호 39
(miRNA-193a-5p)
SEQ ID NO: 39
(miRNA-193a-5p)
UGGGUCUUUGCGGGCAAGAUGAUGGGUCUUUGCGGGCAAGAUGA
서열번호 40
(miRNA-196b)
SEQ ID NO: 40
(miRNA-196b)
AACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUGAACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACGACACUGCCUUCAUUACUUCAGUUG
서열번호 41
(miRNA-196b-3p)
SEQ ID NO: 41
(miRNA-196b-3p)
UCGACAGCACGACACUGCCUUCUCGACAGCACGACACUGCCUUC
서열번호 42
(miRNA-196b-5p)
SEQ ID NO: 42
(miRNA-196b-5p)
UAGGUAGUUUCCUGUUGUUGGGUAGGUAGUUUCCUGUUGUUGGG
서열번호 43
(miRNA-215)
SEQ ID NO: 43
(miRNA-215)
AGCUCUCAGCAUCAACGGUGUACAGGAGAAUGACCUAUGAUUUGACAGACCGUGCAGCUGUGUAUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCACUGCUACUUAAAAGCUCUCAGCAUCAACGGUGUACAGGAGAAUGACCUAUGAUUUGACAGACCGUGCAGCUGUGUAUGUCUGUCAUUCUGUAGGCCAAUAUUCUGUAUGUCACUGCUACUUAAA
서열번호 44
(miRNA-215-3p)
SEQ ID NO: 44
(miRNA-215-3p)
UCUGUCAUUCUGUAGGCCAAUUCUGUCAUUCUGUAGGCCAAU
서열번호 45
(miRNA-215-5p)
SEQ ID NO: 45
(miRNA-215-5p)
AUGACCUAUGAUUUGACAGACAUGACCUAUGAUUUGACAGAC
서열번호 46
(miRNA-223)
SEQ ID NO: 46
(miRNA-223)
UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAGUCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG
서열번호 47
(miRNA-223-3p)
SEQ ID NO: 47
(miRNA-223-3p)
UGUCAGUUUGUCAAAUACCCCAUGUCAGUUUGUCAAAUACCCCA
서열번호 48
(miRNA-223-5p)
SEQ ID NO: 48
(miRNA-223-5p)
CGUGUAUUUGACAAGCUGAGUUGCGUGUAUUUGACAAGCUGAGUUG
서열번호 49
(miRNA-369)
SEQ ID NO: 49
(miRNA-369)
GGUACUUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUGGCUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAGUAUCGGUACUUGAAGGGAGAUCGACCGUGUUAUAUUCGCUUGGCUGACUUCGAAUAAUACAUGGUUGAUCUUUUCUCAGUAUC
서열번호 50
(miRNA-369-3p)
SEQ ID NO: 50
(miRNA-369-3p)
AAUAAUACAUGGUUGAUCUUUAAUAAUACAUGGUUGAUCUUU
서열번호 51
(miRNA-369-5p)
SEQ ID NO: 51
(miRNA-369-5p)
AGAUCGACCGUGUUAUAUUCGCAGAUCGACCGUGUUAUAUUCGC
서열번호 52
(miRNA-483)
SEQ ID NO: 52
(miRNA-483)
GAGGGGGAAGACGGGAGAAGAGAAGGGAGUGGUUUUUGGGUGCCUCACUCCUCCCCUCCCGUCUUGUUCUCUCGAGGGGGAAGACGGGAGAAGAGAAGGGAGUGGUUUUUGGGUGCCUCACUCCUCCCCUCCCGUCUUGUUCUCUC
서열번호 53
(miRNA-483-3p)
SEQ ID NO: 53
(miRNA-483-3p)
UCACUCCUCCCCUCCCGUCUUUCACUCCUCCCCUCCCGUCUU
서열번호 54
(miRNA-483-5p)
SEQ ID NO: 54
(miRNA-483-5p)
AAGACGGGAGAAGAGAAGGGAGAAGACGGGAGAAGAGAAGGGAG
서열번호 55
(miRNA-615)
SEQ ID NO: 55
(miRNA-615)
UCGGGAGGGGCGGGAGGGGGGUCCCCGGUGCUCGGAUCUCGAGGGUGCUUAUUGUUCGGUCCGAGCCUGGGUCUCCCUCUUCCCCCCAUCCCUCGGGAGGGGCGGGAGGGGGGGUCCCCGGUGCUCGGAUCUCGAGGGUGCUUAUUGUUCGGUCCGAGCCUGGGUCUCCCUCUUCCCCCCAUCCC
서열번호 56
(miRNA-615-3p)
SEQ ID NO: 56
(miRNA-615-3p)
UCCGAGCCUGGGUCUCCCUCUUUCCGAGCCUGGGUCUCCCUCUU
서열번호 57
(miRNA-615-5p)
SEQ ID NO: 57
(miRNA-615-5p)
GGGGGUCCCCGGUGCUCGGAUCGGGGGUCCCCGGUGCUCGGAUC
서열번호 58
(miRNA-155)
SEQ ID NO: 58
(miRNA-155)
CUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAGCUGUUAAUGCUAAUUGUGAUAGGGGUUUUGGCCUCUGACUGACUCCUACCUGUUAGCAUUAACAG
서열번호 59
(miRNA-155-3p)
SEQ ID NO: 59
(miRNA-155-3p)
CUCCUACCUGUUAGCAUUAACCUCCUACCUGUUAGCAUUAAC
서열번호 60
(miRNA-155-5p)
SEQ ID NO: 60
(miRNA-155-5p)
UUAAUGCUAAUUGUGAUAGGGGUUUAAUGCUAAUUGUGAUAGGGGU
서열번호 61
(miRNA-203)
SEQ ID NO: 61
(miRNA-203)
GCCUGGUCCAGUGGUUCUUGACAGUUCAACAGUUCUGUAGCACAAUUGUGAAAUGUUUAGGACCACUAGACCCGGCGCCUGGUCCAGUGGUUCUUGACAGUUCAACAGUUCUGUAGCACAAUUGUGAAAUGUUUAGGACCACUAGACCCGGC
서열번호 62
(miRNA-203-3p)
SEQ ID NO: 62
(miRNA-203-3p)
GUGAAAUGUUUAGGACCACUAGGUGAAAUGUUUAGGACCACUAG
서열번호 63
(miRNA-203-5p)
SEQ ID NO: 63
(miRNA-203-5p)
AGUGGUUCUUGACAGUUCAACAAGUGGUUCUUGACAGUUCAACA
서열번호 64
(miRNA-434)
SEQ ID NO: 64
(miRNA-434)
UCGACUCUGGGUUUGAACCAAAGCUCGACUCAUGGUUUGAACCAUUACUUAAUUCGUGGUUUGAACCAUCACUCGACUCCUGGUUCGAACCAUCUCGACUCUGGGUUUGAACCAAAGCUCGACUCAUGGUUUGAACCAUUACUUAAUUCGUGGUUUGAACCAUCACUCGACUCCUGGUUCGAACCAUC
서열번호 65
(miRNA-434-3p)
SEQ ID NO: 65
(miRNA-434-3p)
UUUGAACCAUCACUCGACUCCUUUUGAACCAUCACUCGACUCCU
서열번호 66
(miRNA-434-5p)
SEQ ID NO: 66
(miRNA-434-5p)
GCUCGACUCAUGGUUUGAACCAGCUCGACUCAUGGUUUGAACCA
서열번호 67
(miRNA-92b)
SEQ ID NO: 67
(miRNA-92b)
GGUGGGCGGGAGGGACGGGACGUGGUGCAGUGUUGUUCUUUCCCCUGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCUCGGGUGGGCGGGAGGGACGGGACGUGGUGCAGUGUUGUUCUUUCCCCUGCCAAUAUUGCACUCGUCCCGGCCUCCGGCCCCCUCG
서열번호 68
(miRNA-92b-3p)
SEQ ID NO: 68
(miRNA-92b-3p)
UAUUGCACUCGUCCCGGCCUCCUAUUGCACUCGUCCCGGCCUCC
서열번호 69
(miRNA-92b-5p)
SEQ ID NO: 69
(miRNA-92b-5p)
AGGGACGGGACGUGGUGCAGUGUUAGGGACGGGACGUGGUGCAGUGUU

본 발명에서 사용되는 용어 "근육노화"란, 노화에 수반하여 생기는 근육의 쇠퇴, 예를 들어 근기능(근력, 근지구력, 근순발력 등) 저하나 근위축 등을 포괄하는 의미로서, 상기 근위축이란 근세포의 감소나 축소에 의해 근량이 저하되는 것을 의미한다.As used herein, the term "muscle aging" refers to a decrease in muscular strength caused by aging, such as a decrease in muscular strength (muscle strength, muscle endurance, muscle strength, etc.) or muscle atrophy, This means that the muscle mass is decreased by the decrease or reduction of muscle cells.

본 발명에서 사용되는 용어 "진단"이란, 병리 상태의 존재 또는 특징을 확인하는 것을 의미한다. 본 발명에 있어서, 상기 진단은 근육노화의 진행 또는 발병 여부를 확인하는 것으로 해석될 수 있다.
As used herein, the term "diagnosis" means identifying the presence or characteristic of a pathological condition. In the present invention, the diagnosis can be interpreted as confirming whether or not the progression of muscle aging has occurred.

본 발명에서 상기 근육노화 진단용 조성물은 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 추가로 포함할 수 있다.In the present invention, the composition for diagnosing muscle aging includes miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA- One or more members selected from the group consisting of miRNA-193, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA- lt; RTI ID = 0.0 > miRNA < / RTI > or fragment thereof.

본 발명에서 상기 miRNA-146은 miRNA-146a를, miRNA-148은 miRNA-148a를, miRNA-190은 miRNA-190a를, miRNA-193은 miRNA-193a, miRNA-196은 miRNA-196b를, miRNA-92는 miRNA-92b를 포함할 수 있다.In the present invention, miRNA-146, miRNA-148, miRNA-190, miRNA-193, miRNA-193, miRNA-196a and miRNA- 92 may contain miRNA-92b.

이에 제한되지는 않으나, 상기 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146a, miRNA-148a, miRNA-185, miRNA-190a, miRNA-193a, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92b의 서열 또는 이들의 단편의 서열은 상기 표 1에 개시한 염기서열로 이루어진 것일 수 있다.But are not limited to, miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146a, miRNA- 148a, miRNA- sequence of miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA- May be composed of the nucleotide sequence shown in Table 1.

본 발명에서 상기 miRNA들은 서열번호 1 내지 69로 기재된 염기서열일 수 있으며, 상기 서열번호 1 내지 69로 기재된 염기서열은 근육노화의 진행 또는 발병 여부를 진단할 수 있는 진단 마커로 활용될 수 있으며, 상기 서열은 근육노화의 진행 또는 발병 여부를 진단하는데 있어서 일정정도 변형이 가능하다. 본 기술 분야의 당업자라면 이러한 인위적인 변형에 의해 80% 이상, 바람직하게는 90% 이상, 보다 바람직하게는 95% 이상, 가장 바람직하게는 98%의 상동성이 유지되는 염기서열이 본 발명에서 목적하는 근육노화 진단 마커로서 정상 개체와 노화 개체 간에 발현량 차이를 유의있게 비교 가능하는 한, 본 발명의 상기 염기서열과 균등한 것임을 쉽게 이해할 것이다.In the present invention, the miRNAs may be the nucleotide sequences shown in SEQ ID NOS: 1 to 69, and the nucleotide sequences shown in SEQ ID NOS: 1 to 69 may be used as diagnostic markers to diagnose progression or development of muscle aging. The sequence may be modified to some degree in diagnosing progression or onset of muscle aging. Those skilled in the art will appreciate that nucleotides that retain more than 80% homology, preferably more than 90% homology, more preferably more than 95% homology, and most preferably 98% homology, As long as it is possible to compare the difference in the expression level between the normal individuals and the aging individuals as the muscle aging diagnostic markers, it will be easily understood that they are equivalent to the above base sequences of the present invention.

본 발명에서 사용되는 용어 "마커 또는 진단 마커(diagnosis marker)"란 근육노화 세포 또는 근육노화 질환을 가진 개체를 정상세포 또는 정상 개체와 구분하여 진단할 수 있는 물질로, 정상 세포에 비하여 근육노화가 진행 또는 발병된 세포 또는 개체에서 증가 또는 감소를 보이는 폴리펩티드, 단백질 또는 핵산(예: mRNA 등), 지질, 당지질, 당단백질 또는 당(단당류, 이당류, 올리고당류 등) 등과 같은 유기 생체 분자들을 포함한다. 본 발명의 목적상, 본 발명의 근육노화 진단 마커는 정상 세포 또는 조직의 세포에 비하여, 근육노화 세포에서 특이적으로 발현 수준의 차이를 보이는 miRNA 또는 해당 miRNA의 단편이다. As used herein, the term "marker or diagnosis marker" refers to a substance capable of differentiating individuals having muscle aging cells or aging diseases from normal cells or normal individuals, Such as polypeptides, proteins or nucleic acids (such as mRNA), lipids, glycolipids, glycoproteins or sugars (monosaccharides, disaccharides, oligosaccharides, etc.) which show an increase or decrease in the progressed or developed cells or individuals . For the purpose of the present invention, the marker for diagnosing muscle aging according to the present invention is a miRNA or a fragment of the miRNA which shows a difference in expression level specifically in muscle aging cells as compared with normal cells or tissues.

본 발명에서 사용되는 용어 "miRNA-34 또는 이의 단편의 수준을 측정하는 제제"란, 시료에 포함된 miRNA-34 또는 이의 단편의 발현 여부를 확인하는 방법에 사용되는 제제를 의미하는데, 바람직하게는 RT-PCR, 경쟁적 RT-PCR(Competitive RT-PCR), 실시간 RT-PCR(Real-time RT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블럿팅(Northern blotting), 유전자 칩 분석법 등의 방법에 사용되는 표적 유전자에 특이적으로 결합할 수 있는 프라이머 또는 프로브가 될 수 있으나, 특별히 이에 제한되지는 않는다.The term "agent for measuring the level of miRNA-34 or a fragment thereof " used in the present invention means a preparation used in a method for confirming the expression of miRNA-34 or a fragment thereof contained in a sample, RT-PCR, Competitive RT-PCR, Real-time RT-PCR, RNase protection assay, Northern blotting, A primer or a probe capable of specifically binding to a target gene used in the method of the present invention, but the present invention is not particularly limited thereto.

본 발명에서 사용되는 용어 "프라이머"란, 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 가지는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시할 수 있다.
The term "primer" as used herein refers to a nucleic acid sequence having a short free 3 'hydroxyl group and capable of forming a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. The primers can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

본 발명에서 사용되는 용어 "프로브"란, 유전자 또는 mRNA와 특이적 결합을 이룰 수 있는 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하는데, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있고, 보다 용이하게 검출하기 위하여 라벨링될 수 있다.
As used herein, the term "probe" refers to a nucleic acid fragment such as RNA or DNA corresponding to a few nucleotides or hundreds of nucleotides, which can specifically bind to a gene or mRNA. An oligonucleotide, A probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like, and can be labeled for easier detection.

본 발명의 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체 (예: 메틸 포스포네이트, 포스소트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체 (예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.
The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).

구체적으로, 본 발명의 일 실시예에서는 근육노화를 진단할 수 있는 마커로서 활용될 수 있는 miRNA를 도출하였다. 상기 miRNA는, 솔렉사(Solexa) 또는 SOLID 시퀀서를 이용하여 DNA의 염기서열을 대량으로 동시에 분석할 수 있는 새로운 염기서열 분석 방법인, 차세대염기서열(next generation sequence; NGS) 방법을 이용하여 어린 마우스와 노화 마우스의 골격근에 발현하는 miRNA의 발현량을 추정함으로써, 노화 마우스 골격근 특이 miRNA를 도출하였다. Specifically, one embodiment of the present invention derives an miRNA that can be used as a marker for diagnosing muscle aging. The miRNA can be obtained by using a next generation sequence (NGS) method, which is a new method for analyzing the nucleotide sequence of a DNA in a large amount at the same time using a Solexa or SOLID sequencer. And the amount of expression of miRNA expressed in the skeletal muscle of the aged mouse was estimated to derive the aged mouse skeletal muscle specific miRNA.

표 2 및 표 3에 개시한 바와 같이, 어린 마우스와 노화 마우스의 골격근에서 발현되는 miRNA의 비교 결과, 노화 마우스의 골격근에서 특이적으로, 그 발현량이 하향 조절 또는 상향 조절되는 miRNA를 도출할 수 있었다. As shown in Table 2 and Table 3, miRNAs expressed in skeletal muscle of young mice and aged mice were able to derive miRNAs whose expression levels were down-regulated or up-regulated specifically in skeletal muscle of aging mice .

노화 마우스의 골격근에서 상향 조절되는 miRNA에는 miRNA-34를 비롯하여, miRNA-146a, miRNA-185, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 등이 있음을 확인할 수 있었고, 하향 조절되는 miRNA에는 miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148a, miRNA-190a, miRNA-193a 및 miRNA-434 등이 있음을 확인할 수 있었다(도 3). The miRNAs up-regulated in the skeletal muscle of the aged mouse include miRNA-34 as well as miRNA-146a, miRNA-185, miRNA-196b, miRNA-215, miRNA-223, miRNA-369, miRNA- MiRNA-143, miRNA-144, miRNA-148a, miRNA-131, miRNA-203 and miRNA-92 were detected in the downregulated miRNA, miRNA-190a, miRNA-193a and miRNA-434, and the like (Fig. 3).

또한, 상기와 같이 도출되어진, 어린 마우스와 노화 마우스의 골격근에서 발현되는 miRNA들의 발현량 차이 재검증을 위하여, 실시간 정량 PCR(real-time quantitative PCR)을 수행해 본 결과, 마찬가지로 노화 마우스의 골격근에서 miRNA-34a를 비롯하여, miRNA-146a, miRNA-155, miRNA-203 및 miRNA-92b 등이 상향 조절됨을 확인할 수 있었고, miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-434 및 miRNA-148a 등의 발현량이 하향 조절됨을 확인할 수 있었다(도 4).
In addition, real-time quantitative PCR was performed to reexamine the differences in the expression levels of miRNAs expressed in skeletal muscle of young and aged mice as described above. As a result, miRNAs in skeletal muscle of aging mice MiRNA-146, miRNA-147, miRNA-143, and miRNA-143, as well as miRNA-146a, miRNA- -148a and the like were down-regulated (Fig. 4).

이러한 결과를 통하여, 상기 다양한 miRNA들은 근육노화가 진행됨에 따라 발현량이 감소 또는 증가함을 확인할 수 있었고, 본 발명의 miRNA-34를 비롯한 상기 다양한 miRNA의 발현 수준을 측정하는 제제를 이용하면 근육노화를 효과적으로 진단할 수 있음을 알 수 있었다.
These results indicate that the expression levels of the various miRNAs are decreased or increased as the muscle aging progresses. When the agent for measuring the expression levels of various miRNAs including miRNA-34 of the present invention is used, It can be diagnosed effectively.

상기 목적을 달성하기 위한 다른 실시양태로서, 본 발명은 상기 근육노화 진단용 조성물을 포함하는 근육노화 진단용 키트를 제공한다.
According to another aspect of the present invention, there is provided a kit for diagnosing muscle aging comprising the composition for diagnosing muscle aging.

본 발명의 진단 키트는 근육노화의 발병이 의심되는 개체의 시료로부터 miRNA-34를 비롯하여 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정함으로써 근육노화를 진단하는데 사용될 수 있는데, 특별히 이에 제한되지 않으나, 상기 miRNA-34를 비롯한 상기 다양한 miRNA 또는 이에 해당하는 단편의 발현 수준을 측정하기 위한 프라이머 또는 프로브 뿐만 아니라 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치가 포함될 수도 있다. MiRNA-144, miRNA-146, miRNA-144, miRNA-144, miRNA-147, miRNA-143, miRNA-144, miRNA-183, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA- 434 and miRNA-92 or fragments corresponding to the miRNAs. The expression of the various miRNAs or their corresponding fragments, including but not limited to miRNA-34, One or more other component compositions, solutions or devices suitable for the assay method may be included, as well as primers or probes for measuring the level.

구체적인 일례로서, 본 발명의 miRNA-34 또는 이의 단편, 그리고 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정하기 위한 진단 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는, 상기 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오타이드(dNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한, 정량 대조구로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다. As a specific example, miRNA-34 or a fragment thereof of the present invention and miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA- miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA- A diagnostic kit for determining the level of expression of a fragment corresponding to miRNAs may be a kit containing the necessary elements to perform RT-PCR. The RT-PCR kit can be used in combination with a test tube or other appropriate container, a reaction buffer (pH and magnesium concentration varies), deoxynucleotides (dNTPs), Taq polymerase and reverse transcriptase , DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. In addition, it may contain a primer pair specific to a gene used as a quantitative control.

다른 일례로서, 본 발명의 키트는 유전자 칩 분석법을 수행하기 위해 필요한 필수 요소를 포함할 수 있다. 유전자 칩 분석용 키트는, 유전자 또는 그의 단편에 해당하는 cDNA가 프로브로 부착되어 있는 기판, 및 형광표식 프로브를 제작하기 위한 시약, 제제, 효소 등을 포함할 수 있다. 또한, 기판은 정량 대조구 유전자 또는 그의 단편에 해당하는 cDNA를 포함할 수 있다.
As another example, the kit of the present invention may contain necessary elements necessary for performing gene chip analysis. The kit for gene chip analysis may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and a reagent, a preparation, and an enzyme for producing a fluorescent-labeled probe. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

또 다른 양태로서, 본 발명은 상기 진단용 조성물 또는 키트를 이용하여 근육노화 진단을 위한 정보를 제공하는 방법을 제공하는데, 구체적으로, (a) 개체로부터 분리된 생물학적 시료에서 miRNA-34 또는 이의 단편, 그리고 miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 측정하는 단계; 및 (b) 상기 측정된 miRNA-34를 비롯한 상기 다양한 miRNA 또는 이에 해당하는 단편의 발현 수준이 정상 대조군 시료로부터 측정된 수준과 비교하여, 유의하게 증가하는 경우 근육노화가 진행 또는 발병된 것으로 판정하는 단계를 포함한다. In yet another aspect, the present invention provides a method for providing information for the diagnosis of muscle aging using the diagnostic composition or kit, comprising: (a) contacting miRNA-34 or fragments thereof, And miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 and miRNA- Measuring the expression level of a fragment or the like that is to be detected; And (b) if the level of expression of the various miRNAs or fragments thereof, including the measured miRNA-34, is significantly increased compared to the level measured from a normal control sample, it is determined that the aging of the muscle has progressed or developed .

또한, (a) 개체로부터 분리된 생물학적 시료에서 miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 측정하는 단계; 및 (b) 상기 측정된 miRNA-411을 비롯한 상기 다양한 miRNA 또는 이에 해당하는 단편의 발현 수준이 정상 대조군 시료로부터 측정된 수준과 비교하여, 유의하게 감소하는 경우 근육노화가 진행 또는 발병된 것으로 판정하는 단계를 포함한다. MiRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193, and miRNA-193 in a biological sample isolated from an individual, 434 or fragments corresponding to the miRNAs; And (b) if the level of expression of the various miRNAs or fragments thereof, including the measured miRNA-411, is significantly reduced compared to the level measured from a normal control sample, it is determined that the aging of the muscle has progressed or developed .

이때, 상기 miRNA-34 또는 이의 단편, 그리고 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편의 발현 수준을 측정하는 방법은 상술한 바와 동일하다.
The miRNA-34 or its fragment and the miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA- , miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 and miRNA- The method for measuring the expression level of the fragment is the same as described above.

상기 목적을 달성하기 위한 또 다른 실시양태로서, 본 발명은 근육노화의 진행 또는 발병을 예방 또는 치료할 수 있을 것으로 예상되는 후보물질을 투여하고, miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계를 포함하는 근육노화의 예방 또는 치료용 제제를 스크리닝하는 방법을 제공한다.
In another aspect of the present invention, there is provided a method for preventing or treating progression or onset of muscle aging, comprising administering a candidate substance which is expected to prevent or treat the progression of muscle aging and measuring the expression level of miRNA-34 or fragment thereof A method for screening an agent for preventing or treating muscle aging which comprises

구체적으로, 본 발명의 근육노화 예방 또는 치료용 제제를 스크리닝하는 방법은 (a) 대조군인 근육노화가 발병된 실험동물의 시료로부터 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계; (b) 상기 실험동물에서 근육노화를 치료할 수 있을 것으로 예상되는 후보물질을 투여하는 단계; (c) 실험군인 상기 후보물질이 투여된 실험동물의 시료로부터 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계; 및, (d) 대조군에서 측정된 miRNA-34 또는 이의 단편의 수준을 실험군에서 측정된 것과 비교하여, 대조군에서 측정된 것보다도 실험군에서 측정된 것이 낮은 수준을 나타내는 경우, 상기 후보물질을 근육노화의 진행 또는 발병을 방지하는 예방용 제제 또는 근육노화를 치료하는 치료용 제제로서 사용할 수 있는 것으로 판정하는 단계를 포함한다. Specifically, the method for screening a preparation for preventing or treating muscle aging according to the present invention comprises the steps of: (a) measuring the expression level of miRNA-34 or fragment thereof from a sample of an experimental animal in which muscle aging has occurred; (b) administering a candidate agent expected to be able to treat muscle aging in said experimental animal; (c) measuring the expression level of miRNA-34 or fragment thereof from a sample of an experimental animal to which said candidate agent is administered; And (d) comparing the level of miRNA-34 or fragment thereof measured in the control with that measured in the experimental group, compared to that measured in the experimental group, the candidate agent is selected from the group of muscle aging Or prophylactic agent for preventing progression or onset, or a therapeutic agent for treating muscle aging.

근육노화를 예방 또는 치료할 수 있는 후보 물질의 부재 하에 세포, 보다 바람직하게는 근육줄기세포(satellite cell)에서의 본 발명의 miRNA-34 또는 이의 단편의 발현 수준을 측정하고, 또한, 상기 후보 물질의 존재 하에서 본 발명의 상기 miRNA-34 또는 이의 단편의 수준을 측정하여 양자를 비교한 후, 상기 후보 물질이 존재할 때의 본 발명의 상기 miRNA-34 또는 이의 단편의 발현 수준이 상기 후보 물질의 부재 하에서의 수준보다 감소시키는 물질을 근육노화의 예방용 제제로 예측할 수 있다.The present invention provides a method for measuring the expression level of miRNA-34 or fragment thereof of the present invention in a cell, more preferably a muscle cell, in the absence of a candidate substance capable of preventing or treating muscle aging, Or the fragment thereof of the present invention is measured in the presence of the candidate substance and the expression level of the miRNA-34 or fragment thereof of the present invention when the candidate substance is present is measured in the absence of the candidate substance Of the total body weight can be predicted as a preventive agent for muscle aging.

또한, 노화 마우스의 골격근에서 상향 조절되는 miRNA인, miRNA-34 외에, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 감소시키는 물질을 근육노화 예방용 또는 치료용 제제로 예측할 수 있다.In addition to miRNA-34, which is an up-regulated miRNA in the skeletal muscle of aging mice, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA- miRNA-155, miRNA-203 and miRNA-92 or fragments corresponding to the miRNAs can be predicted by agents for preventing or treating muscle aging.

아울러, 노화 마우스의 골격근에서 하향 조절되는 miRNA인, miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434 또는 상기 miRNA들에 해당하는 단편 등의 발현 수준을 증가시키는 물질을 근육노화 예방용 또는 치료용 제제로 예측할 수 있다.
In addition, miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 and miRNA- -434 or fragments corresponding to the miRNAs can be predicted by agents for preventing or treating muscle aging.

상기 목적을 달성하기 위한 또 다른 실시양태로서, 본 발명은 miRNA-34 또는 이의 단편을 표적으로 한 억제제를 유효성분으로 포함하는 근육노화 억제용 조성물을 제공한다.
In another aspect of the present invention, there is provided a composition for inhibiting muscle senescence comprising an inhibitor targeting miRNA-34 or a fragment thereof as an active ingredient.

상기 근육노화 억제용 조성물은 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 miRNA들에 해당하는 단편 등을 표적으로 한 증진제 또는 miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 억제제를 포함할 수 있다.
The composition for inhibiting muscle senescence is selected from the group consisting of miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-148, miRNA- A miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA- 615, miRNA-155, miRNA-203 and miRNA-92, or fragments corresponding to the miRNAs, and the like.

구체적으로, 노화 마우스의 골격근에서 하향 조절되는 miRNA인, miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 증진제는 상기 miRNA 및 이에 해당하는 단편들의 발현 수준을 증가시킴으로써, 근육노화를 억제할 수 있다. Specifically, miRNA-411, miRNA-136, miRNA-337, miRNA-127, miRNA-143, miRNA-144, miRNA-148, miRNA-190 and miRNA-193, which are downregulated in the skeletal muscle of the aged mouse, enhancers targeting miRNA-434 or fragments corresponding to the miRNAs or the like can inhibit muscle aging by increasing the expression level of the miRNA and the corresponding fragments.

아울러, 노화 마우스의 골격근에서 상향 조절되는 miRNA인, miRNA-34 외에, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92 또는 상기 miRNA들에 해당하는 단편 등을 표적으로 한 억제제는 상기 miRNA 및 이에 해당하는 단편들의 발현 수준을 감소시킴으로써, 근육노화를 억제할 수 있다.
In addition, miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA- Inhibitors targeting miRNA-155, miRNA-203, and miRNA-92 or fragments corresponding to such miRNAs, etc., can inhibit muscle aging by decreasing the expression levels of the miRNA and corresponding fragments.

상기 miRNA들 또는 이의 단편을 표적으로 한 증진제에는, 이에 제한되지는 않으나 바람직하게는, 상기 miRNA들 또는 이의 단편에 특이적인 화합물 또는 그 유사체(mimic) 형태일 수 있다.Promoters targeting the miRNAs or fragments thereof may include, but are not limited to, compounds or mimic forms specific for the miRNAs or fragments thereof.

또한, 상기 miRNA들 또는 이의 단편을 표적으로 한 억제제에는, 이에 제한되지는 않으나 바람직하게는, 상기 miRNA들 또는 이의 단편에 특이적인 siRNA, 앱타머, 안티센스 올리고뉴클레오티드, 리보자임 또는 화합물 형태일 수 있다.
In addition, inhibitors targeting such miRNAs or fragments thereof may include, but are not limited to, siRNAs, aptamers, antisense oligonucleotides, ribozymes, or compound forms specific for the miRNAs or fragments thereof .

본 발명에서 사용되는 용어 "유사체(mimic)"란, miRNA 작용을 모방하는 폴리뉴클레오티드로서, 상기 유사체에 의해 치료적으로 표적이 될 수 있다.As used herein, the term "mimic" is a polynucleotide that mimics miRNA action and can be therapeutically targeted by the analog.

본 발명에서 사용되는 용어 "siRNA"란, RNA 방해 또는 유전자 사일런싱(silencing)을 매개할 수 있는 핵산 분자로서, 표적 유전자의 발현을 억제할 수 있기 때문에 효율적인 유전자 넉다운(knockdown) 방법 또는 유전자 치료 방법으로 사용될 수 있다.The term "siRNA" used in the present invention is a nucleic acid molecule capable of mediating RNA interference or gene silencing, and can inhibit the expression of a target gene. Therefore, an effective gene knockdown method or gene therapy method .

본 발명에서 사용되는 용어 "앱타머(aptamer)"란, 단일가닥 올리고 뉴클레오티드로서, 20~60 뉴클레오티드 정도의 크기이며, 소정의 표적 분자에 대한 결합 활성을 갖는 핵산 분자를 말한다. 서열에 따라 다양한 3차원 구조를 가지며, 항원-항체 반응처럼 특정 물질과 높은 친화력을 가질 수 있다. 앱타머는 소정의 표적 분자에 대하여 결합함으로써, 소정의 표적 분자의 활성을 저해할 수 있다. 본 발명의 앱타머는 RNA, DNA, 변형된(modified) 핵산 또는 이들의 혼합물일 수 있으며, 또한 직쇄상 또는 환상의 형태일 수 있다. As used herein, the term "aptamer " refers to a single-stranded oligonucleotide which is about 20 to 60 nucleotides in size and has a binding activity to a given target molecule. Depending on the sequence, it has various three-dimensional structures and can have a high affinity with a specific substance such as an antigen-antibody reaction. The aptamer can inhibit the activity of a given target molecule by binding to a predetermined target molecule. The aptamers of the present invention may be RNA, DNA, modified nucleic acids, or mixtures thereof, and may also be in linear or cyclic form.

본 발명에서 사용되는 용어 "안티센스"란, 유전자 발현을 방해하고 특정한 원하는 표적 폴리뉴클레오티드 서열을 인지하거나 결합할 수 있도록 설계된 분자를 말한다. 안티센스 분자는 전형적으로 RNA 분자 상에 존재하는 표적 서열에 특이적으로 결합할 수 있는 올리고뉴클레오티드 또는 올리고뉴클레오티드 유사체를 포함한다. As used herein, the term "antisense " refers to a molecule designed to interfere with gene expression and recognize or bind to a particular desired target polynucleotide sequence. Antisense molecules typically include oligonucleotides or oligonucleotide analogs capable of specifically binding to a target sequence present on the RNA molecule.

본 발명에서 사용되는 용어 "올리고뉴클레오티드"란, DNA, RNA 또는 DNA/RNA 하이브리드로 구성된 한 분자이며, "올리고뉴클레오티드 유사체"란 용어는, 올리고뉴클레오티드-유사 구조를 포함하는 한 분자이다.As used herein, the term "oligonucleotide" is a molecule consisting of DNA, RNA or DNA / RNA hybrids, and the term "oligonucleotide analogue" is a molecule comprising an oligonucleotide-like structure.

본 발명에서 사용되는 용어 "리보자임(ribozyme)"이란, 효소 활성이 있는 RNA 분자를 의미하는 것으로서, 화학적 반응을 분자 내적으로나 또는 분자 사이에서 촉매할 수 있는 핵산 분자를 의미한다. 본 발명에서 이용할 수 있는 리보자임으로는 천연 시스템에서 발견되는 리보자임을 토대로 한 뉴클레아제나 핵산 중합효소 타입 반응을 촉매하는 리보자임의 상이한 유형들 모두 가능하며, 생체 내 특이한 반응을 촉매하기 위해 공학적으로 처리되는 리보자임도 이용 가능하다. 리보자임은 RNA 또는 DNA 기질을 절단할 수 있으며, 본 발명의 목적상 RNA 기질을 절단할 수 있다. 리보자임은 전형적으로 표적 기질의 인식 및 결합과 이어지는 절단을 통하여 핵산 기질을 절단하게 되는데, 이러한 인식은 대부분 염기쌍 상호작용을 토대로 하므로, 표적 특이적 절단이 가능한 특징을 가질 수 있다.
The term "ribozyme " as used in the present invention means an RNA molecule having an enzyme activity, and means a nucleic acid molecule capable of catalyzing a chemical reaction intramolecularly or intermolecularly. The ribozymes that can be used in the present invention include all types of ribozymes capable of catalyzing nuclease and nucleic acid polymerase type reactions based on ribozymes found in natural systems and are engineered to catalyze specific reactions in vivo Lt; / RTI > are also available. A ribozyme can cleave an RNA or DNA substrate and can cleave the RNA substrate for the purposes of the present invention. Ribozymes typically cleave the nucleic acid substrate through recognition and binding and subsequent cleavage of the target substrate. This recognition is based on base pair interaction, and thus can have a characteristic that target specific cleavage is possible.

본 발명에서 제공하는 miRNA-34를 비롯한 다양한 miRNA는 노화에 따른 근위축 및 그에 수반하는 근기능의 저하 뿐만 아니라, 이에 따른 에너지 대사의 저하로 비만이나 당뇨병 등의 질환까지도 수반할 수 있는, 근육노화의 진행 또는 발명 여부, 그리고 노화 정도를 진단할 수 있는 마커로 사용될 수 있으므로, 근육노화 진단 키트 개발 및 근육노화 억제 물질을 탐색하는데 있어서, 탁월한 효과가 있는 마커로 널리 활용될 수 있다.
Various miRNAs, including miRNA-34 provided by the present invention, can be used not only for the reduction of muscular atrophy and accompanying muscular dysfunction due to aging, but also for the reduction of energy metabolism resulting from aging and muscle aging which can accompany diseases such as obesity and diabetes. It can be widely used as a marker having excellent effect in development of a muscle aging diagnostic kit and searching for substances inhibiting muscle aging because it can be used as a marker for diagnosing the progress or invention and the degree of aging.

도 1은 어린(young) 마우스와 노화(aged) 마우스 간의 골격근(skeletal muscle)의 근량 차이를 나타낸 도이다.
도 2는 차세대 염기서열(next generation sequencing; NGS) 방법으로 도출된 어린 마우스의 골격근과 노화 마우스의 골격근에 발현하는 소형 리보핵산 전사체(small RNA transcriptome)의 분석 개요를 나타낸 도이다.
도 3은 고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최종 miRNA의 발현량 차이를 비교한 도이다.
도 4는 실시간 정량 PCR(real-time quantitative PCR) 방법으로 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최종 miRNA의 발현량 차이를 비교한 도이다.
Brief Description of the Drawings Fig. 1 is a diagram showing the difference in the skeletal muscle skeletal muscle between a young mouse and an aged mouse.
FIG. 2 is a diagram showing an analysis outline of a small RNA transcriptome expressed in the skeletal muscle of the young mouse and the skeletal muscle of the aged mouse derived by the next generation sequencing (NGS) method.
Figure 3 compares differences in the expression levels of the final miRNAs found in the skeletal muscle of young and aged mice by high throughput small-RNA sequencing.
FIG. 4 is a graph comparing differences in expression amounts of the final miRNAs found in the skeletal muscle of young and aged mice by real-time quantitative PCR (PCR).

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예Example 1: 근육 조직 샘플 준비 및 근육 근량 측정 1: Preparation of muscle tissue samples and measurement of muscle mass

골격근에서 노화(aging)에 관한 연구를 수행하기 위해, 어린(young) 마우스(6개월령)와 노화(aged) 마우스(24개월령) 간의 근육 근량(muscle mass)을 비교하였다.To study aging in skeletal muscle, muscle mass was compared between young mice (6 months old) and aged mice (24 months old).

구체적으로, 6마리의 어린 수컷 C57BL/6 마우스(6개월)와 6마리의 노화 수컷 C57BL/6 마우스(24개월령)는 실험동물자원센터(한국생명공학연구원)에서 구입하였다. 족저근(soleus muscle; SOL), 장지신근(extensor digitorum longus; EDL), 전경골근(tibialis anterior; TA), 및 비복근(gastrocnemius; gastroc.) 4가지 종류의 근육 해부(dessection)를 위해 희생시키기 전에, 마우스의 체중을 기록하였다. 각각의 근육량(muscle mass)을 기록하고, 비복근(gastrocnemius; gastroc.)은 다음 단계의 마이크로RNA(miRNA) 프로파일링(profiling) 실험을 위해 즉시 수집하였다. Specifically, 6 young male C57BL / 6 mice (6 months) and 6 aged male C57BL / 6 mice (24 months old) were purchased from the Laboratory Animal Resource Center (Korea Research Institute of Bioscience and Biotechnology). Before sacrificing for four types of muscle dessection, the soleus muscle (SOL), the extensor digitorum longus (EDL), the tibialis anterior (TA), and the gastrocnemius (gastroc.) , And the mice were weighed. Each muscle mass was recorded and gastrocnemius (gastroc.) Was immediately collected for the next step of microRNA (miRNA) profiling experiments.

도 1에 나타난 바와 같이, 어린 마우스(6개월령)와 노화 마우스(24개월령) 간의 근육 근량을 비교해 본 결과, 어린 마우스에 비해 노화 마우스의 전경골근(tibialis anterior; TA), 및 비복근(gastrocnemius; gastroc.) 둘 다에서 두드러진 근육량 손실이 나타났으며, 특히, 32개월령까지 나이에 따라 골격근인 비복근의 근육량이 점진적으로 감소하는 것을 확인할 수 있었다.As shown in FIG. 1, when comparing muscle weights between young mice (6 months old) and aged mice (24 months old), it was found that compared to young mice, the tibialis anterior (TA) and gastrocnemius ) Showed significant muscle mass loss, and in particular, the muscle mass of the skeletal muscle of the skeletal muscle gradually decreased with age until the age of 32 months.

이러한 결과는 근육소실이 근육노화의 주요 특징 중 하나임을 의미한다.
These results indicate that muscle loss is one of the main characteristics of muscle aging.

실시예Example 2: 마이크로 2: Micro RNARNA (( miRNAmiRNA ) 서열분석() Sequence analysis ( sequencingsequencing ) 및 데이터 분석) And data analysis

근육 노화의 분자적 메카니즘을 도출하기 위하여, 소형 리보핵산(small RNA) 서열분석(sequencing)으로 어린 마우스의 골격근과 노화 마우스의 골격근에 발현하는 전체 유전체 마이크로RNA(genome-wide miRNA)를 분석, 비교하였다. In order to elucidate the molecular mechanism of muscle aging, small RNA sequencing is used to analyze and compare genome-wide miRNAs expressed in skeletal muscle of young mice and in skeletal muscle of aged mice Respectively.

구체적으로, 제조업자의 프로토콜에 따라 mirVAna miRNA isolation kit(Ambion, Austin, TX)를 사용하여, 비복근(gastrocnemius; gastroc.)(n=12)으로부터 소형 리보핵산이 풍부한(small RNA-enriched) 토털 RNA(total RNA)를 추출하였고, miRNA 라이브러리는 Illumina library preparation protocol(Illumina Inc., San Diego, CA, USA)에 따라 준비하였다. 각각의 라이브러리는 Illumina 어댑터(adaptor)(6-염기 바코드(base barcode))로 색인화 하였다. 소형 리보핵산(small RNA) 라이브러리는 6% TBE 유레아 폴리아크릴아마이드 겔(TBE urea polyacrylamide gel)에서 크기별로 나누고(size fractionation), 140 내지 160 염기 쌍(base pair) 부분(fraction)은 겔로부터 절개하여 얻고 정제하였다. 정제된 miRNA 라이브러리는 Agilent DNA 1000 chip을 이용하여 정량화하였다. 모든 색인화된 샘플은 Illumina GAⅡx(36 bp 단편(reads))의 하나의 레인(lane)에서 풀링(pooling)하고 서열분석(sequencing)하였다. Specifically, small RNA-enriched total RNAs from gastrocnemius (gastroc.) (N = 12) using the mir vAna miRNA isolation kit (Ambion, Austin, Tex.) According to the manufacturer's protocol (total RNA), and the miRNA library was prepared according to the Illumina library preparation protocol (Illumina Inc., San Diego, CA, USA). Each library was indexed with an Illumina adapter (a 6-base barcode). The small RNA library was size fractionated on a 6% TBE urea polyacrylamide gel and a 140-160 base pair fraction was cut from the gel And purified. The purified miRNA library was quantified using an Agilent DNA 1000 chip. All indexed samples were pooled and sequenced in one lane of Illumina GAIIx (36 bp reads).

가공되지 않은 소형 리보핵산(raw small RNA) 서열분석 맵핑(mapping)전에 참조 표준 유전체(reference genome)로 해독하고, 염기 서열의 질(quality)적 해독은 FastQC(http://www.bioinformatics.babraham.ac.uk/projects/fastqc)로 평가하였으며, 3' 말단에 부착된 어댑터 시퀀스는 내부(in-house)의 펄 스크립트(PERL script)로 제거하였다. 어댑터 시퀀스 트리밍(trimming) 후, 단편 크기(read size) 분배(distribution)는 R(http://www.r-project.org.) 스크립트로 분석하였다. 어댑터 시퀀스를 트리밍한(adapter-trimmed) 소형 리보핵산 단편(read)은 디폴트 옵션(default option)을 가진 BWA(http://bio-bwa. sourceforge.net.) 소프트웨어를 따른 UCSC Genome Browser(http://genome. ucsc.edu)로부터 다운로드된 참조 표준 유전체 mm10에 맵화(mapped)하였다(Li & Durbin 2009). 맵화한 서열 단편을 RNA 계열(class)로 구분하기 위해, 마이크로RNA(microRNA; miRNA), 운반RNA(transfer RNA; tRNA), 리보솜RNA(ribosomal RNA; rRNA )및 다른 비번역 RNA(non-coading RNA)를 계열화 하기 위한 UCSC Genome Browser와 fRNAdb(http://www.ncrna.org/frnadb.)로부터의 주석 파일(annotation file)에서 소형 리보핵산과 반복서열(repeats)의 게놈 위치 정보(genomic position information)를 사용하여 수행하였다. 맵핑 위치(mapping position)와 주석 정보(annotation information)를 비교하여, 모든 맵화된 서열 단편과 부합되는 RNA 타입으로 계열화하고, 각각의 RNA 타입의 발현에 대한 상대적 빈도는 지정한 서열 단편 수에 기초하여 평가하였다. 토털 소형 RNA 서열분석 테이터에서 주요 miRNA 발현 부분을 결정하기 위해, 6마리의 어린 마우스 샘플의 풀링(pooling)된 서열 단편 셋트로부터 발현된 상위 10개의 miRNA를 선택하고, 풀링(pooling)된 어린 마우스와 노화된 마우스의 서열 단편 셋트에서 상기 가장 많은 10개의 miRNA와 적은 부분을 차지하는 서열 단편에 대한 상대적 비율(portion)을 평가하였다. 이미 알려진 miRNA(miRBase ver. 20)에 대해서는 파이썬(Python) 스크립트를 사용하여 맵화된 서열 단편으로부터 각각의 전구체(precursor)와 최종 miRNA(mature microRNA)에 대한 FPKM(fragments per kilobase of transcript per million fragments mapped)을 계산하였다. 새로운 miRNA 탐색을 위해, 디폴트 파라미터(default parameter)를 가진 mirDeep2 소프트웨어를 사용하였고, MiRBase는 알려진 miRNA를 배제하기 위해 사용하였다. 시궁쥐(Rattus norvegicus)는 근연종으로써 사용하였다. Raw small RNAs that have not been processed Before decoding, the reference genome is decoded and the quality of the sequence is decoded by FastQC (http://www.bioinformatics.babraham.com) .ac.uk / projects / fastqc), and the adapter sequence attached at the 3 'end was removed with an in-house PERL script. After trimming the adapter sequence, the read size distribution was analyzed with the R (http://www.r-project.org.) Script. A small adapter-trimmed ribonucleic acid fragment (adapter) trimming the adapter sequence is available in the UCSC Genome Browser (http: // bio-bwa. Sourceforge.net.) Software with the default option BWA // genome. ucsc.edu) (Li & Durbin 2009). In order to classify the mapped sequence fragments into RNA classes, a microRNA (miRNA), a transfer RNA (tRNA), a ribosomal RNA (rRNA) and other non-coated RNA ) In the annotation file from the UCSC Genome Browser and fRNAdb (http://www.ncrna.org/frnadb.) To serialize the genomic position information (ID) of small ribonucleic acid and repeats ). ≪ / RTI > The mapping position and annotation information are compared and sequenced into RNA types consistent with all mapped sequence fragments and the relative frequency of expression of each RNA type is assessed based on the number of sequence fragments specified Respectively. To determine the major miRNA expression site in total small RNA sequencer data, the top 10 miRNAs expressed from a pooled sequence fragment set of six young mouse samples were selected and pooled into a pool of young mice The relative proportion of the 10 largest miRNAs to the smallest portion of the sequence fragments in the set of sequenced fragments of aged mice was assessed. For known miRNAs (miRBase ver. 20), fragments per kilobase of transcript per million fragments mapped (FPKM) to each precursor and final miRNA (mature microRNA) from sequence fragments mapped using Python scripts ) Were calculated. For new miRNA searches, mir Deep2 software with default parameters was used and MiRBase was used to exclude known miRNAs. The rat ( Rattus norvegicus ) was used as a relative.

도 2에 나타난 바와 같이, 대부분의 서열(sequence)은 22nt(nucleotide)에서 피크를 가지는 20 내지 23 nt 길이인(도 2의 A), 최종 miRNA(mature miRNA)가 96.9% 로 나타났으며, 나머지 3.1%의 small RNA는 소형 핵RNA(small nuclear RNA; snRNA), 소세포질 RNA(small cytoplasmic RNA; scRNA), 신호-인식입자RNA(signal recognition particle RNA; srpRNA), 리보솜RNA(ribosomal RNA; rRNA), 운반RNA(transfer RNA; tRNA), 및 피위 단백질과 상호작용하는 RNA (piwi-interacting RNA; piRNA)인 것으로 나타났다(도 2의 B). 생식 세포(germ cell)에서 발견되는 piRNA는 노화 마우스의 골격근에서 상향조절(up-regulation) 되는 것으로 확인되었다(도 2의 C). 또한, 어린 마우스와 노화 마우스의 골격근에서 최종 miRNA의 존재비(abundance)를 확인하기 위해, 상위 10개의 miRNA로 구분해 본 결과, 골격근에서 가장 높게 발현하는 상위 10개의 최종 miRNA가 전체 miRNA의 75%를 차지하는 것으로 나타났다(도 2의 D). 상기 분석한 상위 10개의 최종 miRNA 중, 대부분을 차지하고 있는 miR-10b를 제외한, 나머지 miRNA는 이미 근육에서의 역할이 보고된 바 있는 miRNA인 것으로 확인되었다.
As shown in FIG. 2, most of the sequences showed 96.9% of the final miRNA (mature miRNA) having a length of 20 to 23 nt with a peak at 22 nt (nucleotide) (Fig. 2A) 3.1% of small RNAs are composed of small nuclear RNA (snRNA), small cytoplasmic RNA (scRNA), signal recognition particle RNA (srpRNA), ribosomal RNA (rRNA) , Transfer RNA (tRNA), and piwi-interacting RNA (piRNA) interacting with the target protein (Fig. 2B). The piRNA found in germ cells was found to be up-regulated in the skeletal muscle of aging mice (Fig. 2C). In order to identify the abundance of the final miRNA in the skeletal muscle of young and aged mice, the top 10 miRNAs expressed in the top 10 miRNAs of the skeletal muscle were 75% of the total miRNAs (Fig. 2D). Of the top 10 final miRNAs analyzed, the remaining miRNAs, except miR-10b which occupied most of them, were found to be miRNAs already reported to have a role in muscle.

실시예Example 3: 리보핵산( 3: ribonucleic acid ( RNARNA ) 서열분석() Sequence analysis ( sequencingsequencing ) 및 데이터 분석) And data analysis

골격근의 노화와 관련된 miRNA를 탐색하기 위하여, 고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 최소 5개의 서열 단편을 가지는, 최종 miRNA를 발견하였다. 이들 중, 노화된 근육에서 20개의 miRNA는 상향 조절(up-regulation)되었고, 19개의 miRNA는 하향 조절(down-regulation)되었다(>1.5 배 차이, t-test, p<0.05). 선택된 miRNA 중에는 이전에 근육 노화와 관련되어 보고된 바 있는 miRNA-206, miRNA-434, miRNA-34 등의 miRNA도 포함되어 있었다.To explore miRNAs associated with skeletal muscle senescence, we found a final miRNA with at least five sequence fragments from the skeletal muscle of young and aged mice by high throughput mini-RNA sequencing. Of these, 20 miRNAs were up-regulated in the aged muscle and 19 miRNAs were down-regulated (> 1.5-fold difference, t- test, p <0.05). Among the selected miRNAs, miRNAs such as miRNA-206, miRNA-434 and miRNA-34, which were previously reported to be associated with muscle aging, were also included.

보다 구체적으로, 토털 RNA는 제조업자의 프로토콜에 따라 RNeasy Fibrous Tissue Mini Kit(Qiagen)을 사용하여 어린 쥐와 노화된 쥐의 비복근(gastrocnemius; gastroc.)(n=5)으로부터 추출하였다. RNA의 질(quality)과 안정성(integrity)은, 아가로스 겔 전기영동(agarose gel electrophoresis)을 수행하고, 브롬화 에티듐(ethidium bromide; EtBr) 염색하여 자외선 (ultraviolet light) 하에서 육안 시험(visual examination)으로 확인하였다. 시퀀싱 라이브러리는 제조업자의 프로토콜에 따라 TruSeq RNA Sample Preparation kit v2(Illumina, CA, USA)를 사용하여 준비하였다. 간단하게, 메신저 RNA(messenger RNA; mRNA)는 토털 RNA로부터 폴리-T-올리고 부착 마그네틱 비드(poly-T oligo-attached magnetic bead)를 사용하여 정제하고, 단편화(fragmentation)하여 cDNA로 전환하였다. 어댑터(adapter)를 결찰(ligation)한 다음, 단편(fragment)은 중합효소 연쇄 반응(polymerase chain reaction; PCR)로 증폭하였고, 서열분석(sequencing)은 Genome Analyzer Ⅱx(Illumina)를 사용하여 쌍으로 된 말단 서열 단편(2×76 bp)으로 수행하였다. More specifically, total RNA was extracted from gastrocnemius (gastrocn.) (N = 5) of young and aged rats using the RNeasy Fibrous Tissue Mini Kit (Qiagen) according to the manufacturer's protocol. RNA quality and integrity were determined by agarose gel electrophoresis and ethidium bromide (EtBr) staining followed by visual inspection under ultraviolet light. Respectively. The sequencing library was prepared using the TruSeq RNA Sample Preparation kit v2 (Illumina, CA, USA) according to the manufacturer's protocol. Briefly, messenger RNA (mRNA) was purified from total RNA using poly-T oligo-attached magnetic beads and fragmented into cDNA. After ligation of the adapter, the fragment was amplified by polymerase chain reaction (PCR) and sequencing was performed using the Genome Analyzer IIx (Illumina) End sequence fragment (2 x 76 bp).

생쥐(Mus musculus)로부터 얻은 참조 표준 유전체(reference genome) 서열(sequence)은 캘리포니아 대학교 Santa Cruz Genome Browser Gateway (assembly ID: mm10)로부터 얻었다. 참조 표준 유전체 색인은 Bowtie2(ver. 2.0)과 SAMtools(ver. 0.1.18)의 Bowtie2-build 구성요소(component)를 사용하여 설계하였다. Tophat2(ver. 2.0.8)는 참조 표준 유전체에 대한 서열 단편을 맵화하기 위한 조직 샘플(tissue sample)에 적용하였다. 유전자 발현은 UCSC Browser gateway로부터 다운로드한 표준 시퀀스 유전자(Refseq gene, mm10) 모델(model)을 사용하여 각각의 유전자에 대한 FPKM(fragments per kilobase of transcript per million fragments mapped)을 계산하였고, 각각의 FPKM은 추가 분석을 위해 log2로 변환하여 도출하였다.Mouse ( Mus The reference genome sequence from the mouse was obtained from the University of California, Santa Cruz Genome Browser Gateway (assembly ID: mm10). The reference standard genetic index was designed using the Bowtie2-build component of Bowtie2 (ver. 2.0) and SAMtools (ver. 0.1.18). Tophat2 (ver. 2.0.8) was applied to a tissue sample for mapping sequence fragments for reference standard genomes. Gene expression was calculated by using the standard sequence gene (Ref 10q gene, mm10) model downloaded from the UCSC Browser gateway and the FPKM (fragments per kilobase of transcript per million fragments mapped) for each gene. And converted to log 2 for further analysis.

도 3에 나타난 바와 같이, 어린 마우스와 노화 마우스의 골격근으로부터 발견된 최소 5개의 서열 단편을 가지는 최종 miRNA 중, 본 발명의 miRNA-34의 발현 수준은 어린 마우스의 근육에서의 발현량과 비교하여, 노화 근육에서의 발현량이 상향 조절되는 것을 확인할 수 있었다.As shown in Fig. 3, the expression level of miRNA-34 of the present invention among the final miRNAs having at least 5 sequence fragments found in the skeletal muscle of young and aged mice was significantly lower than that of young mice It was confirmed that the expression level in muscle was upregulated.

추가적으로, 하기 표 2 및 하기 표 3에 나타난 바와 같이, 본 발명의 miRNA-34를 포함하여, 노화된 근육에서 상향 조절(up-regulation)되는 20개의 miRNA와 하향 조절(down-regulation)되는 19개의 miRNA를 확인할 수 있었다(>1.5 배 차이, t-test, p<0.05)
In addition, as shown in the following Table 2 and Table 3, 20 miRNAs up-regulated in aged muscle and 19 down-regulated miRNA-34, including miRNA-34 of the present invention miRNA could be identified (> 1.5-fold difference, t- test, p <0.05)

Figure pat00001
Figure pat00001

Figure pat00002
Figure pat00002

이러한 결과를 통하여 본 발명의 miRNA-34를 비롯한, 상기 miRNA들이 근육노화에 따라 상향 조절 또는 하향 조절되는 것을 검출함으로써, 근육노화를 진단할 수 있다는 것을 확인할 수 있었다.
From these results, it was confirmed that the miRNAs including the miRNA-34 of the present invention can be diagnosed by detecting up-regulation or down-regulation of the miRNAs according to muscle aging.

실시예Example 3-1: 최종  3-1: Final miRNAmiRNA (( maturemature microRNAmicroRNA ) 발현 분석 검증) Expression analysis verification

고속대량(high throughput) 소형-RNA 서열분석법(sequencing)으로 어린 마우스와 노화 마우스의 골격근으로부터 탐색된 최종 miRNA의 발현량 차이 재검증을 위하여, 실시간 정량 PCR(real-time quantitative PCR)을 수행하였다. Real-time quantitative PCR was performed in order to re-verify differences in expression levels of the final miRNAs detected from the skeletal muscle of young and aged mice by high throughput small-RNA sequencing.

보다 구체적으로, miRNA 발현 분석을 위한, TaqMan MicroRNA assay는 제조업자가 제시한 프로토콜에 따라 수행하였다(Applied Biosystems). 간단하게, 각각의 역전사 효소(reverse transcriptase; RT) 반응(reaction)은 50 nM stem-loop RT 프라이머, 0.25mM dNTP, 3.33 units/ul MultiScribe RT 효소, 및 0.25 units/ul RNase 저해제(inhibitor)와 1 × RT 버퍼(buffer)가 포함되어 있는 mirVana miRNA isolation kit를 사용하여 10 ng의 토털 RNA를 분리하였다(Applied Biosystems). 상기 반응은 16℃에서 30분, 42℃에서 30분, 85℃에서 5분 동안 인큐베이션하고, 4℃에서 반응을 정지시켰다. 각각의 정량 PCR(quantitative PCR; qPCR) 반응은 1.33ul의 역전사 산물, TaqMan MicroRNA assay의 20× 프라이머 1 ul, 프로브 믹스(probe mix), 및 H-Taq DNA polymerase 0.5 ul 그리고 10ul의 버퍼 혼합물(40 mM Tris-HCL(pH 8.4), 100 mM KCl, 6 mM MgCl2, 0.5 mM dNTP, 및 10% DMSO)을 포함하여 이루어졌다. 상기 반응은 Bio-Rad CFX96 System을 사용하여, 96 웰 플레이트 상에서 95℃에서 10분 동안 인큐베이션하고, 95℃에서 15초, 60℃에서 1분 동안, 각각 40 사이클(cycle)의 PCR을 수행하였다. 이때, PCR 반응 단계에서, 역방향 프라이머로는 TaqMan® Universial reverse primer를 사용하였고, 정방향 프라이머는 하기 표 4에 나타난 바와 같다. 감지 시작 주기(threshold cycle, Ct)는 형광 발광이 고정된 역치(threshold)를 띄는 부분 주기(fractional cycle) 수로 정의하였다. U6 snRNA(small nuclear RNA)는 표준화(normalization)를 위한 내생의 대조군(endogenous control)로서 제공되었다.
More specifically, the TaqMan MicroRNA assay for miRNA expression analysis was performed according to the manufacturer's suggested protocol (Applied Biosystems). Briefly, each reverse transcriptase (RT) reaction contained 50 nM stem-loop RT primer, 0.25 mM dNTP, 3.33 units / ul MultiScribe RT enzyme, 0.25 units / ul RNase inhibitor and 1 × 10 ng of total RNA was isolated using the mir Vana miRNA isolation kit containing RT buffer (Applied Biosystems). The reaction was incubated at 16 ° C for 30 minutes, 42 ° C for 30 minutes, 85 ° C for 5 minutes, and the reaction was stopped at 4 ° C. Each quantitative PCR (qPCR) reaction consisted of 1.33 ul of reverse transcription product, 1 μl of 20 × primer from TaqMan MicroRNA assay, probe mix, and 0.5 μl of H-Taq DNA polymerase and 10 μl of buffer mixture mM Tris-HCL (pH 8.4) , were made, including 100 mM KCl, 6 mM MgCl 2 , 0.5 mM dNTP, and 10% DMSO). The reactions were incubated on a 96-well plate at 95 DEG C for 10 minutes using a Bio-Rad CFX96 System, and PCR was performed for 40 cycles each at 95 DEG C for 15 seconds and 60 DEG C for 1 minute. At this time, in the PCR reaction step, TaqMan® universal reverse primer was used as the reverse primer and the forward primer as shown in Table 4 below. The threshold cycle (Ct) is defined as the fractional cycle number at which the fluorescence emission has a fixed threshold. U6 snRNA (small nuclear RNA) was provided as an endogenous control for normalization.

microRNAmicroRNA 프라이머 서열Primer sequence 서열번호SEQ ID NO: miRNA-136-5p primermiRNA-136-5p primer ACUCCAUUUGUUUUGAUGAUGGACUCCAUUUGUUUUGAUGAUGG 7070 miRNA-337-3p primermiRNA-337-3p primer UUCAGCUCCUAUAUGAUGCCUUUCAGCUCCUAUAUGAUGCCU 7171 miRNA-127-3p primermiRNA-127-3p primer UCGGAUCCGUCUGAGCUUGGCUUCGGAUCCGUCUGAGCUUGGCU 7272 miRNA-34a-5p primermiRNA-34a-5p primer UGGCAGUGUCUUAGCUGGUUGUUGGCAGUGUCUUAGCUGGUUGU 7373 miRNA-146a-5p primermiRNA-146a-5p primer UGAGAACUGAAUUCCAUGGGUUUGAGAACUGAAUUCCAUGGGUU 7474 miRNA-148a-3p primermiRNA-148a-3p primer UCAGUGCACUACAGAACUUUGUUCAGUGCACUACAGAACUUUGU 7575 miRNA-411-5p primermiRNA-411-5p primer UAGUAGACCGUAUAGCGUACGUAGUAGACCGUAUAGCGUACG 7676 miRNA-92b-3p primermiRNA-92b-3p primer UAUUGCACUCGUCCCGGCCUCCUAUUGCACUCGUCCCGGCCUCC 7777 miRNA-155-5p primermiRNA-155-5p primer UUAAUGCUAAUUGUGAUAGGGGUUUAAUGCUAAUUGUGAUAGGGGU 7878 miRNA-203-3p primermiRNA-203-3p primer GUGAAAUGUUUAGGACCACUAGGUGAAAUGUUUAGGACCACUAG 7979 miRNA-434-3p primermiRNA-434-3p primer UUUGAACCAUCACUCGACUCCUUUUGAACCAUCACUCGACUCCU 8080 miRNA-434-5p primermiRNA-434-5p primer GCUCGACUCAUGGUUUGAACCAGCUCGACUCAUGGUUUGAACCA 8181

도 4에 나타난 바와 같이, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 상향 조절되는 것이 확인된 본 발명의 miRNA-34가, 실시간 정량 PCR을 통해서도 어린 마우스의 근육에서의 발현량과 비교하여, 노화 근육에서 발현량이 상향 조절됨이 재입증되었다.As shown in Fig. 4, miRNA-34 of the present invention, which was confirmed to be up-regulated in the senescent muscle by sequencing, was compared with the amount of expression in muscle of young mice by real-time quantitative PCR, It was reaffirmed that the expression level was upregulated in aging muscle.

또한, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 상향 조절되는 것이 확인된 miRNA-92, miRNA-146, miRNA-155 및 miRNA-203의 경우에도, 실시간 정량 PCR을 통하여 어린 마우스의 근육에서의 발현량과 비교한 결과, 노화 근육에서 발현량이 상향 조절됨이 재입증되었다(도 4의 A).In the case of miRNA-92, miRNA-146, miRNA-155 and miRNA-203 which were confirmed to be up-regulated in the senescent muscle by sequencing, (Fig. 4A). As a result, it was confirmed that the expression level was upregulated in aging muscle (Fig. 4A).

아울러, 서열분석(sequencing)에 의하여 노화 근육에서의 발현량이 하향 조절되는 것이 확인된 miRNA-337, miRNA-148, miRNA-136, miRNA-127, miRNA-434 및 miRNA-411의 경우에도, 실시간 정량 PCR을 통하여 어린 마우스의 근육에서의 발현량과 비교한 결과, 노화 근육에서 발현량이 하향 조절됨이 재입증되었다(도 4의 B).
In addition, in the case of miRNA-337, miRNA-148, miRNA-136, miRNA-127, miRNA-434 and miRNA-411 whose expression levels in aging muscle were confirmed to be down-regulated by sequencing, PCR showed that the amount of expression in the muscle of the young mouse was compared with that of the muscle in the young mouse (Fig. 4B).

따라서, 상기 실시간 정량 PCR 결과를 통하여, 본 발명의 miRNA-34를 비롯한, 상기 miRNA들이 근육노화 마커로 사용될 수 있음을 다시 한번 명확하게 알 수 있었다. Thus, through the real-time quantitative PCR results, it can be clearly seen that the miRNAs including the miRNA-34 of the present invention can be used as muscle aging markers.

<110> Korea Research Institute of Bioscience and Biotechnology <120> MicroRNA-34 for the diagnosis and treatment of muscle aging <130> KPA140127-KR <160> 81 <170> KopatentIn 2.0 <210> 1 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136 <400> 1 gaggacucca uuuguuuuga ugauggauuc uuaagcucca ucaucgucuc aaaugagucu 60 uc 62 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-3p <400> 2 aucaucgucu caaaugaguc uu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-5p <400> 3 acuccauuug uuuugaugau gg 22 <210> 4 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337 <400> 4 caguguagug agaaguuggg gggugggaac ggcgucaugc aggaguugau ugcacagcca 60 uucagcuccu auaugaugcc uuucuucacc cccuuca 97 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-3p <400> 5 uucagcuccu auaugaugcc u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-5p <400> 6 gaacggcguc augcaggagu u 21 <210> 7 <211> 70 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127 <400> 7 ccagccugcu gaagcucaga gggcucugau ucagaaagau caucggaucc gucugagcuu 60 ggcuggucgg 70 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-3p <400> 8 ucggauccgu cugagcuugg cu 22 <210> 9 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-5p <400> 9 cugaagcuca gagggcucug au 22 <210> 10 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411 <400> 10 ugguacuugg agagauagua gaccguauag cguacgcuuu aucugugacg uauguaacac 60 gguccacuaa cccucaguau ca 82 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-3p <400> 11 uauguaacac gguccacuaa cc 22 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-5p <400> 12 uaguagaccg uauagcguac g 21 <210> 13 <211> 102 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a <400> 13 ccagcuguga guaauucuuu ggcagugucu uagcugguug uugugaguau uagcuaagga 60 agcaaucagc aaguauacug cccuagaagu gcugcacauu gu 102 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-3p <400> 14 aaucagcaag uauacugccc u 21 <210> 15 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-5p <400> 15 uggcaguguc uuagcugguu gu 22 <210> 16 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c <400> 16 agucuaguua cuaggcagug uaguuagcug auugcuaaua guaccaauca cuaaccacac 60 agccagguaa aaagacu 77 <210> 17 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c-3p <400> 17 aaucacuaac cacacagcca gg 22 <210> 18 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c-5p <400> 18 aggcagugua guuagcugau ugc 23 <210> 19 <211> 63 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143 <400> 19 ccugaggugc agugcugcau cucuggucag uugggagucu gagaugaagc acuguagcuc 60 agg 63 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143-3p <400> 20 ugagaugaag cacuguagcu c 21 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143-5p <400> 21 ggugcagugc ugcaucucug g 21 <210> 22 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144 <400> 22 ggcugggaua ucaucauaua cuguaaguuu gugaugagac acuacaguau agaugaugua 60 cuaguc 66 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144-3p <400> 23 uacaguauag augauguacu 20 <210> 24 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144-5p <400> 24 ggauaucauc auauacugua agu 23 <210> 25 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a <400> 25 agcucugaga acugaauucc auggguuaua ucaaugucag accugugaaa uucaguucuu 60 cagcu 65 <210> 26 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-3p <400> 26 ccugugaaau ucaguucuuc ag 22 <210> 27 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-5p <400> 27 ugagaacuga auuccauggg uu 22 <210> 28 <211> 99 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a <400> 28 agccaguuug gucuuuugag acaaaguucu gagacacucc gacucugagu augauagaag 60 ucagugcacu acagaacuuu gucucuagag gcugugguc 99 <210> 29 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-3p <400> 29 ucagugcacu acagaacuuu gu 22 <210> 30 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-5p <400> 30 aaaguucuga gacacuccga cu 22 <210> 31 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185 <400> 31 agggauugga gagaaaggca guuccugaug guccccuccc aggggcuggc uuuccucugg 60 uccuu 65 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185-3p <400> 32 aggggcuggc uuuccucugg u 21 <210> 33 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185-5p <400> 33 uggagagaaa ggcaguuccu ga 22 <210> 34 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a <400> 34 cugugugaua uguuugauau auuagguugu uauuuaaucc aacuauauau caagcauauu 60 ccuacag 67 <210> 35 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a-3p <400> 35 acuauauauc aagcauauuc cu 22 <210> 36 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a-5p <400> 36 ugauauguuu gauauauuag gu 22 <210> 37 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a <400> 37 gagagcuggg ucuuugcggg caagaugaga gugucaguuc aacuggccua caaaguccca 60 guccuc 66 <210> 38 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a-3p <400> 38 aacuggccua caaaguccca gu 22 <210> 39 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a-5p <400> 39 ugggucuuug cgggcaagau ga 22 <210> 40 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b <400> 40 aacuggucgg ugauuuaggu aguuuccugu uguugggauc caccuuucuc ucgacagcac 60 gacacugccu ucauuacuuc aguug 85 <210> 41 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b-3p <400> 41 ucgacagcac gacacugccu uc 22 <210> 42 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b-5p <400> 42 uagguaguuu ccuguuguug gg 22 <210> 43 <211> 112 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215 <400> 43 agcucucagc aucaacggug uacaggagaa ugaccuauga uuugacagac cgugcagcug 60 uguaugucug ucauucugua ggccaauauu cuguauguca cugcuacuua aa 112 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215-3p <400> 44 ucugucauuc uguaggccaa u 21 <210> 45 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215-5p <400> 45 augaccuaug auuugacaga c 21 <210> 46 <211> 110 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223 <400> 46 ucuggccauc ugcaguguca cgcuccgugu auuugacaag cugaguugga cacucugugu 60 gguagagugu caguuuguca aauaccccaa guguggcuca ugccuaucag 110 <210> 47 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223-3p <400> 47 ugucaguuug ucaaauaccc ca 22 <210> 48 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223-5p <400> 48 ugucaguuug ucaaauaccc ca 22 <210> 49 <211> 79 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369 <400> 49 gguacuugaa gggagaucga ccguguuaua uucgcuuggc ugacuucgaa uaauacaugg 60 uugaucuuuu cucaguauc 79 <210> 50 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369-3p <400> 50 aauaauacau gguugaucuu u 21 <210> 51 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369-5p <400> 51 agaucgaccg uguuauauuc gc 22 <210> 52 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483 <400> 52 gagggggaag acgggagaag agaagggagu gguuuuuggg ugccucacuc cuccccuccc 60 gucuuguucu cuc 73 <210> 53 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483-3p <400> 53 ucacuccucc ccucccgucu u 21 <210> 54 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483-5p <400> 54 aagacgggag aagagaaggg ag 22 <210> 55 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615 <400> 55 ucgggagggg cgggaggggg guccccggug cucggaucuc gagggugcuu auuguucggu 60 ccgagccugg gucucccucu uccccccauc cc 92 <210> 56 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615-3p <400> 56 uccgagccug ggucucccuc uu 22 <210> 57 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615-5p <400> 57 gggggucccc ggugcucgga uc 22 <210> 58 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155 <400> 58 cuguuaaugc uaauugugau agggguuuug gccucugacu gacuccuacc uguuagcauu 60 aacag 65 <210> 59 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-3p <400> 59 cuccuaccug uuagcauuaa c 21 <210> 60 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-5p <400> 60 uuaaugcuaa uugugauagg ggu 23 <210> 61 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203 <400> 61 gccuggucca gugguucuug acaguucaac aguucuguag cacaauugug aaauguuuag 60 gaccacuaga cccggc 76 <210> 62 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-3p <400> 62 gugaaauguu uaggaccacu ag 22 <210> 63 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-5p <400> 63 agugguucuu gacaguucaa ca 22 <210> 64 <211> 94 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434 <400> 64 ucgacucugg guuugaacca aagcucgacu caugguuuga accauuacuu aauucguggu 60 uugaaccauc acucgacucc ugguucgaac cauc 94 <210> 65 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-3p <400> 65 uuugaaccau cacucgacuc cu 22 <210> 66 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-5p <400> 66 gcucgacuca ugguuugaac ca 22 <210> 67 <211> 83 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b <400> 67 ggugggcggg agggacggga cguggugcag uguuguucuu uccccugcca auauugcacu 60 cgucccggcc uccggccccc ucg 83 <210> 68 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-3p <400> 68 uauugcacuc gucccggccu cc 22 <210> 69 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-5p <400> 69 agggacggga cguggugcag uguu 24 <210> 70 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-5p primer <400> 70 acuccauuug uuuugaugau gg 22 <210> 71 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-3p primer <400> 71 uucagcuccu auaugaugcc u 21 <210> 72 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-3p primer <400> 72 ucggauccgu cugagcuugg cu 22 <210> 73 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-5p primer <400> 73 uggcaguguc uuagcugguu gu 22 <210> 74 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-5p primer <400> 74 ugagaacuga auuccauggg uu 22 <210> 75 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-3p primer <400> 75 ucagugcacu acagaacuuu gu 22 <210> 76 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-5p primer <400> 76 uaguagaccg uauagcguac g 21 <210> 77 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-3p primer <400> 77 uauugcacuc gucccggccu cc 22 <210> 78 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-5p primer <400> 78 uuaaugcuaa uugugauagg ggu 23 <210> 79 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-3p primer <400> 79 gugaaauguu uaggaccacu ag 22 <210> 80 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-3p primer <400> 80 uuugaaccau cacucgacuc cu 22 <210> 81 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-5p primer <400> 81 gcucgacuca ugguuugaac ca 22 <110> Korea Research Institute of Bioscience and Biotechnology <120> MicroRNA-34 for the diagnosis and treatment of muscle aging <130> KPA140127-KR <160> 81 <170> Kopatentin 2.0 <210> 1 <211> 62 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136 <400> 1 gaggacucca uuuguuuuga ugauggauuc uuaagcucca ucaucgucuc aaaugagucu 60 uc 62 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-3p <400> 2 aucaucgucu caaaugaguc uu 22 <210> 3 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-5p <400> 3 acuccauuug uuuugaugau gg 22 <210> 4 <211> 97 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337 <400> 4 caguguagug agaaguuggg gggugggaac ggcgucaugc aggaguugau ugcacagcca 60 uucagcuccu auaugaugcc uuucuucacc cccuuca 97 <210> 5 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-3p <400> 5 uucagcuccu auaugaugcc u 21 <210> 6 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-5p <400> 6 gaacggcguc augcaggagu u 21 <210> 7 <211> 70 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127 <400> 7 ccagccugcu gaagcucaga gggcucugau ucagaaagau caucggaucc gucugagcuu 60 ggcuggucgg 70 <210> 8 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-3p <400> 8 ucggauccgu cugagcuugg cu 22 <210> 9 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-5p <400> 9 cugaagcuca gagggcucug au 22 <210> 10 <211> 82 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411 <400> 10 ugguacuugg agagauagua gaccguauag cguacgcuuu aucugugacg uauguaacac 60 gguccacuaa cccucaguau ca 82 <210> 11 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-3p <400> 11 uauguaacac gguccacuaa cc 22 <210> 12 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-5p <400> 12 uaguagaccg uauagcguac g 21 <210> 13 <211> 102 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a <400> 13 ccagcuguga guaauucuuu ggcagugucu uagcugguug uugugaguau uagcuaagga 60 agcaaucagc aaguauacug cccuagaagu gcugcacauu gu 102 <210> 14 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-3p <400> 14 aaucagcaag uauacugccc u 21 <210> 15 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-5p <400> 15 uggcaguguc uuagcugguu gu 22 <210> 16 <211> 77 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c <400> 16 agucuaguua cuaggcagug uaguuagcug auugcuaaua guaccaauca cuaaccacac 60 agccagguaa aaagacu 77 <210> 17 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c-3p <400> 17 aaucacuaac cacacagcca gg 22 <210> 18 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34c-5p <400> 18 aggcagugua guuagcugau ugc 23 <210> 19 <211> 63 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143 <400> 19 ccugaggugc agugcugcau cucuggucag uugggagucu gagaugaagc acuguagcuc 60 agg 63 <210> 20 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143-3p <400> 20 ugagaugaag cacuguagcu c 21 <210> 21 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-143-5p <400> 21 ggugcagugc ugcaucucug g 21 <210> 22 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144 <400> 22 ggcugggaua ucaucauaua cuguaaguuu gugaugagac acuacaguau agaugaugua 60 cuaguc 66 <210> 23 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144-3p <400> 23 uacaguauag augauguacu 20 <210> 24 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-144-5p <400> 24 ggauaucauc auauacugua agu 23 <210> 25 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a <400> 25 agcucugaga acugaauucc auggguuaua ucaaugucag accugugaaa uucaguucu 60 cagcu 65 <210> 26 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-3p <400> 26 ccugugaaau ucagucuuc ag 22 <210> 27 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-5p <400> 27 ugagaacuga auuccauggg uu 22 <210> 28 <211> 99 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a <400> 28 agccaguuug gucuuuugag acaaaguucu gagacacucc gacucugagu augauagaag 60 ucagugcacu acagaacuuu gucucuagag gcugugguc 99 <210> 29 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-3p <400> 29 ucagugcacu acagaacuuu gu 22 <210> 30 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-5p <400> 30 aaaguucuga gacacuccga cu 22 <210> 31 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185 <400> 31 agggauugga gagaaaggca guuccugaug guccccuccc aggggcuggc uuuccucugg 60 uccuu 65 <210> 32 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185-3p <400> 32 aggggcuggc uuuccucugg u 21 <210> 33 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-185-5p <400> 33 uggagagaaa ggcaguuccu ga 22 <210> 34 <211> 67 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a <400> 34 cugugugaua uguuugauau auuagguugu uauuuaaucc aacuauauau caagcauauu 60 ccuace 67 <210> 35 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a-3p <400> 35 acuauauauc aagcauauuc cu 22 <210> 36 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-190a-5p <400> 36 ugauauguuu gauauauuag gu 22 <210> 37 <211> 66 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a <400> 37 gagagcuggg ucuuugcggg caagaugaga gugucaguuc aacuggccua caaaguccca 60 guccuc 66 <210> 38 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a-3p <400> 38 aacuggccua caaaguccca gu 22 <210> 39 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-193a-5p <400> 39 ugggucuuug cgggcaagau ga 22 <210> 40 <211> 85 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b <400> 40 aacuggucgg ugauuuaggu aguuuccugu uguugggauc caccuuucuc ucgacagcac 60 gacacugccu ucauuacuuc aguug 85 <210> 41 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b-3p <400> 41 ucgacagcac gacacugccu uc 22 <210> 42 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-196b-5p <400> 42 uagguaguuu cguguuguug gg 22 <210> 43 <211> 112 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215 <400> 43 agcucucagc aucaacggug uacaggagaa ugaccuauga uuugacagac cgugcagcug 60 uguaugucug ucauucugua ggccaauauu cuguauguca cugcuacuua aa 112 <210> 44 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215-3p <400> 44 ucugucauuc uguaggccaa u 21 <210> 45 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-215-5p <400> 45 augaccuaug auuugacaga c 21 <210> 46 <211> 110 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223 <400> 46 ucuggccauc ugcaguguca cgcuccgugu auuugacaag cugaguugga cacucugugu 60 gguagagugu caguuuguca aauaccccaa guguggcuca ugccuaucag 110 <210> 47 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223-3p <400> 47 ugucaguuug ucaaauaccc ca 22 <210> 48 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-223-5p <400> 48 ugucaguuug ucaaauaccc ca 22 <210> 49 <211> 79 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369 <400> 49 gguacuugaa gggagaucga ccguguuaua uucgcuuggc ugacuucgaa uaauacaugg 60 uugaucuuuu cucaguauc 79 <210> 50 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369-3p <400> 50 aauaauacau gguugaucui u 21 <210> 51 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-369-5p <400> 51 agaucgaccg uguuauauuc gc 22 <210> 52 <211> 73 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483 <400> 52 gagggggaag acgggagaag agaagggagu gguuuuuggg ugccucacuc cuccccuccc 60 gucuuguucu cuc 73 <210> 53 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483-3p <400> 53 ucacuccucc ccucccgucu u 21 <210> 54 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-483-5p <400> 54 aagacgggag aagagaaggg ag 22 <210> 55 <211> 92 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615 <400> 55 ucgggagggg cgggaggggg guccccggug cucggaucuc gagggugcuu auuguucggu 60 ccgagccugg gcccccc uccccccauc cc 92 <210> 56 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615-3p <400> 56 uccgagccug ggucucccuc uu 22 <210> 57 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-615-5p <400> 57 gggggucccc ggugcucgga uc 22 <210> 58 <211> 65 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155 <400> 58 cuguuaaugc uaauugugau agggguuuug gccucugacu gacuccuacc uguuagcauu 60 aac 65 <210> 59 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-3p <400> 59 cuccuaccug uuagcauuaa c 21 <210> 60 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-5p <400> 60 uuaaugcuaa uugugauagg ggu 23 <210> 61 <211> 76 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203 <400> 61 gccuggucca gugguucuug acaguucaac aguucuguag cacaauugug aaauguuuag 60 gaccacuaga cccggc 76 <210> 62 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-3p <400> 62 gugaaauguu uaggaccacu ag 22 <210> 63 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-5p <400> 63 agugguucuu gacaguucaa ca 22 <210> 64 <211> 94 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434 <400> 64 ucgacucugg guuugaacca aagcucgacu caugguuuga accauuacuu aauucguggu 60 uugaaccauc acucgacucc ugguucgaac cauc 94 <210> 65 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-3p <400> 65 uuugaaccau cacucgacuc cu 22 <210> 66 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-5p <400> 66 gcucgacuca ugguuugaac ca 22 <210> 67 <211> 83 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b <400> 67 ggugggcggg agggacggga cguggugcag uguuguucuu uccccugcca auauugcacu 60 cgucccggcc uccggccccc ucg 83 <210> 68 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-3p <400> 68 uauugcacuc gucccggccu cc 22 <210> 69 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-5p <400> 69 agggacggga cguggugcag uguu 24 <210> 70 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-136-5p primer <400> 70 acuccauuug uuuugaugau gg 22 <210> 71 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-337-3p primer <400> 71 uucagcuccu auaugaugcc u 21 <210> 72 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-127-3p primer <400> 72 ucggauccgu cugagcuugg cu 22 <210> 73 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-34a-5p primer <400> 73 uggcaguguc uuagcugguu gu 22 <210> 74 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-146a-5p primer <400> 74 ugagaacuga auuccauggg uu 22 <210> 75 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-148a-3p primer <400> 75 ucagugcacu acagaacuuu gu 22 <210> 76 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miRNA-411-5p primer <400> 76 uaguagaccg uauagcguac g 21 <210> 77 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-92b-3p primer <400> 77 uauugcacuc gucccggccu cc 22 <210> 78 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miRNA-155-5p primer <400> 78 uuaaugcuaa uugugauagg ggu 23 <210> 79 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-203-3p primer <400> 79 gugaaauguu uaggaccacu ag 22 <210> 80 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-3p primer <400> 80 uuugaaccau cacucgacuc cu 22 <210> 81 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miRNA-434-5p primer <400> 81 gcucgacuca ugguuugaac ca 22

Claims (17)

miRNA-34 또는 이의 단편의 발현 수준을 측정하는 제제를 포함하는, 근육노화 진단용 조성물.
A composition for diagnosing muscle aging, comprising an agent that measures the level of expression of miRNA-34 or a fragment thereof.
제 1항에 있어서, 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c인 것인, 조성물.
The composition of claim 1, wherein said miRNA-34 is miRNA-34a or miRNA-34c.
제 2항에 있어서, 상기 miRNA-34a는 서열번호 13의 염기서열로 이루어진 것인, 조성물.
3. The composition of claim 2, wherein the miRNA-34a comprises the nucleotide sequence of SEQ ID NO:
제 2항에 있어서, 상기 miRNA-34c는 서열번호 16의 염기서열로 이루어진 것인, 조성물.
3. The composition of claim 2, wherein the miRNA-34c comprises the nucleotide sequence of SEQ ID NO: 16.
제 2항에 있어서, 상기 miRNA-34a의 단편은 서열번호 14 또는 15의 염기서열로 이루어진 것인, 조성물.
3. The composition of claim 2, wherein the fragment of miRNA-34a comprises the nucleotide sequence of SEQ ID NO: 14 or 15.
제 2항에 있어서, 상기 miRNA-34c의 단편은 서열번호 17 또는 18의 염기서열로 이루어진 것인, 조성물.
3. The composition of claim 2, wherein the fragment of miRNA-34c consists of the nucleotide sequence of SEQ ID NO: 17 or 18.
제 1항에 있어서, 상기 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 제제는 상기 miRNA-34 또는 이의 단편에 특이적으로 결합하는 프라이머 또는 프로브를 포함하는 것인, 조성물.
The composition of claim 1, wherein the agent that measures the level of expression of miRNA-34 or fragment thereof comprises a primer or a probe that specifically binds to the miRNA-34 or fragment thereof.
제 7항에 있어서, 상기 miRNA-34의 단편에 특이적으로 결합하는 프라이머는 서열번호 73의 염기서열을 포함하는 것인, 조성물.
8. The composition of claim 7, wherein the primer specifically binding to the fragment of miRNA-34 comprises the nucleotide sequence of SEQ ID NO: 73.
제 1항에 있어서, miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 제제를 추가로 포함하는 것인, 조성물.
The method according to claim 1, wherein the miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA- one or more miRNAs selected from the group consisting of miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA- Wherein the composition further comprises an agent that measures the level of expression of the fragment.
제 1항 내지 제 9항 중 어느 한 항의 조성물을 포함하는, 근육노화 진단용 키트.
9. A kit for diagnosing muscle aging, comprising the composition of any one of claims 1 to 9.
제 10항에 있어서, 상기 키트는 RT-PCR 키트 또는 유전자 칩 키트인 것인 근육노화 진단용 키트.
11. The kit for diagnosing muscle aging according to claim 10, wherein the kit is an RT-PCR kit or a gene chip kit.
(a) 개체로부터 분리된 생물학적 시료에서 miRNA-34 또는 이의 단편의 발현 수준을 측정하는 단계; 및
(b) 상기 측정된 miRNA-34 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA-34 또는 이의 단편의 발현 수준보다 증가하는 경우 근육노화가 진행된 것으로 판정하는 단계를 포함하는, 근육노화 진단을 위한 정보를 제공하는 방법.
(a) determining the level of expression of miRNA-34 or fragment thereof in a biological sample separated from the individual; And
(b) determining that muscle aging has progressed if the expression level of the measured miRNA-34 or fragment thereof is increased above the expression level of the corresponding miRNA-34 or fragment thereof in a normal control sample. A method for providing information for a user.
제 12항에 있어서, 상기 miRNA-34는 miRNA-34a 또는 miRNA-34c인 것인, 방법.
13. The method of claim 12, wherein said miRNA-34 is miRNA-34a or miRNA-34c.
제 12항에 있어서, 상기 miRNA-34의 발현 수준을 측정하는 단계는 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(competitive RT-PCR), 실시간 역전사효소 중합효소반응(real time quantitative RT-PCR), RNase 보호 분석법(RNase protection method), 노던 블랏팅(Northern blotting) 또는 유전자 칩에 의하여 측정되는 것인 방법.
The method according to claim 12, wherein the step of measuring the expression level of the miRNA-34 comprises the steps of RT-PCR, competitive RT-PCR, real-time RT- time quantitative RT-PCR, RNase protection method, Northern blotting or gene chip.
제 12항에 있어서, 상기 (a) 단계에서 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-146, miRNA-148, miRNA-185, miRNA-190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA-434 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준을 측정하는 단계를 추가로 포함하는 방법.
14. The method of claim 12, wherein the step (a) comprises the steps of: (a) culturing the miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA- 190, miRNA-193, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203, miRNA- RTI ID = 0.0 &gt; miRNA &lt; / RTI &gt; or fragment thereof.
제 15항에 있어서, 상기 (b) 단계에서 miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA-144, miRNA-148, miRNA-190, miRNA-193 및 miRNA-434로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 감소하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는 방법.
18. The method of claim 15, wherein the miRNA-136, miRNA-337, miRNA-127, miRNA-411, miRNA-143, miRNA- 144, miRNA- 148, miRNA- 190, miRNA- 434 &lt; / RTI &gt; is less than the expression level of the corresponding miRNA or fragment thereof in a normal control sample.
제 15항에 있어서, 상기 (b) 단계에서 miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA-483, miRNA-615, miRNA-155, miRNA-203 및 miRNA-92로 이루어진 군에서 선택되는 하나 이상의 miRNA 또는 이의 단편의 발현 수준이 정상 대조군 시료의 해당 miRNA 또는 이의 단편의 발현 수준보다 증가하는 경우 근육노화가 진행된 것으로 판정하는 단계를 추가로 포함하는 방법.
18. The method of claim 15, wherein, in step (b), miRNA-146, miRNA-185, miRNA-196, miRNA-215, miRNA-223, miRNA-369, miRNA- 203 and miRNA-92 is determined to be higher than the expression level of the corresponding miRNA or fragment thereof in a normal control sample, determining that the aging of the muscle has progressed Way.
KR1020140058385A 2014-05-15 2014-05-15 MicroRNA-34 for the diagnosis and treatment of muscle aging KR20150131559A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020140058385A KR20150131559A (en) 2014-05-15 2014-05-15 MicroRNA-34 for the diagnosis and treatment of muscle aging
PCT/KR2015/004929 WO2015174798A1 (en) 2014-05-15 2015-05-15 Microrna for diagnosis and treatment of muscle aging

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020140058385A KR20150131559A (en) 2014-05-15 2014-05-15 MicroRNA-34 for the diagnosis and treatment of muscle aging

Publications (1)

Publication Number Publication Date
KR20150131559A true KR20150131559A (en) 2015-11-25

Family

ID=54845372

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020140058385A KR20150131559A (en) 2014-05-15 2014-05-15 MicroRNA-34 for the diagnosis and treatment of muscle aging

Country Status (1)

Country Link
KR (1) KR20150131559A (en)

Similar Documents

Publication Publication Date Title
US11111541B2 (en) Diagnostic MiRNA markers for Parkinson&#39;s disease
EP2733219B1 (en) Diagnostic miRNA markers for Alzheimer
KR102029775B1 (en) Biomarkers for diagnosis of Non-muscle invasive bladder cancer and uses thereof
WO2012093821A2 (en) Gene for predicting the prognosis for early-stage breast cancer, and a method for predicting the prognosis for early-stage breast cancer by using the same
Wang et al. Effect of cadmium on kitl pre‐mRNA alternative splicing in murine ovarian granulosa cells and its associated regulation by miRNAs
WO2019074615A2 (en) In vitro methods for skin therapeutic compound discovery using skin age biomarkers
JP2018504909A5 (en)
AU2017313455A1 (en) Biomarkers of oral, pharyngeal and laryngeal cancers
KR20200015545A (en) Determining the Age of a Human Individual
Shu et al. Deep sequencing microRNA profiles associated with wooden breast in commercial broilers
KR20150131555A (en) MicroRNA-136 for the diagnosis and treatment of muscle aging
KR20150131556A (en) MicroRNA-337 for the diagnosis and treatment of muscle aging
EP2942399B1 (en) Method for the diagnosis of breast cancer
KR101814868B1 (en) Method of determining function decreases, repressing function decreases and screeing function decreases inhibition of hippocampus using correlation of micro RNA and NADA receptor
KR20150131557A (en) MicroRNA-127 for the diagnosis and treatment of muscle aging
WO2015174798A1 (en) Microrna for diagnosis and treatment of muscle aging
EP2682752A1 (en) HMGA2 as a marker for diagnosing diabetes
KR20150131559A (en) MicroRNA-34 for the diagnosis and treatment of muscle aging
CN110777199B (en) Diagnosis and treatment of psoriasis arthritis and corresponding kit thereof
KR20150131558A (en) MicroRNA-411 for the diagnosis and treatment of muscle aging
KR101960597B1 (en) Method for analysis of Alzheimer biomarker microRNA ID using correction of expression gene
CN113444808B (en) LOC114108859 and new application thereof
WO2011120101A1 (en) Small rna molecules and methods of use
KR102293039B1 (en) miRNA marker for diagnosing muscle aging and a diagnostic method using the same
CN113604578B (en) MiRNA related to sheep fat and application thereof

Legal Events

Date Code Title Description
WITN Withdrawal due to no request for examination