KR20150104866A - Method for reversible control of mitochondrial activities by light stimulation with spatiotemporal precision - Google Patents

Abstract

The present invention relates to a recombinant nucleic acid molecule for controlling mitochondrial activities using light stimulation and, more specifically, to a recombinant nucleic acid molecule in which a gene encoding ABCB10 protein and a gene encoding rhodopsin protein are linked to each other and a recombinant vector containing the same, a composition for controlling mitochondrial activities, or a method for controlling mitochondrial activities using light. In case of using the recombinant nucleic acid molecule according to the present invention, the recombinant nucleic acid molecule in which a gene encoding ABCB10 protein and a gene encoding rhodopsin protein are linked to each other is transfected into a cell. Thus, the function or activity of rhodopsin protein can be controlled by applying light stimulation. As a result, mitochondrial activities can be reversibly controlled by light stimulation with spatiotemporal precision. In addition, since light is used as a stimulus, light can be controlled with precise in various ranges by regulating the wavelength and intensity of a light source such as LED, laser, or the like. Moreover, as optic technology is developed, the advantages can be continually applied. Thus, the method is simple and has an excellent effect in controlling mitochondrial activities. Therefore, the roles of mitochondria with various functions such as a signal transduction process, energy production, and the like in each tissue can be deeply understood, so the present invention can be importantly applied to diagnose and study diseases related to mitochondrial activities.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for regulating spontaneous reversal of mitochondrial activity by photostimulation,

The present invention relates to a recombinant nucleic acid molecule for regulating mitochondrial activity using a light stimulus. More specifically, the present invention relates to a recombinant nucleic acid molecule comprising a gene encoding an ABCB10 protein and a gene encoding a rhodopsin protein linked together, and a recombinant vector , Compositions for modulating mitochondrial activity, or methods for modulating mitochondrial activity using light.

Mitochondria are cell organelles with about 3,000 proteins that perform biomolecular structures and functions that are suitable for controlling intracellular ionic concentrations. They are capable of producing large excitation forces in a much wider signal system than simple metabolites or protein aggregates in a cell It is a key component of intracellular signaling that is exercising. In other words, mitochondria control not only energy synthesis (ATP synthesis) but also various signal substances such as calcium ion and reactive oxygen (ROS) generation and apoptosis regulatory factor production, so that energy supply and stress response, And so on.

Such degradation of mitochondria is considered to be the cause of many diseases, and more specifically, not only diseases related to metabolism such as diabetes and cancer, arteriosclerosis, heart failure and obesity, but also neurological diseases such as Alzheimer's disease, Parkinson's disease, Huntington's disease, It is pointed out as one of the factors. At present, chemical substances such as uncouplers and ionophores are mainly used as a method for controlling mitochondrial activity, because they have very limited selectivity in time and space with respect to the target, There is a problem. Due to the limitations of this methodology, there are serious technical limitations in the study of the function and signaling mechanisms of the majority of proteins currently functioning in mitochondria.

On the other hand, channelrhodopsin is a protein belonging to the rhodopsin protein subfamily, which is a light-modulated ion channel capable of sensing light and causing a change in the cell. Channel rhodopsin acts as a photoreceptor in green algae and regulates phototaxis. Since channel rehodopsin 2 (ChR2) has been found to be available as a remote control for light-regulated neurons in 2005, a variety of studies have been conducted on channel rhodopsin.

As described above, regulating mitochondrial activity using ion channel proteins has been a subject of interest, and research has been conducted (US 2007/0053996, etc.), but it has not been done yet.

Disclosure of the Invention The present invention has been made to overcome the above-mentioned problems in the prior art. As a result of efforts to control the activity of mitochondria, the present inventors have found that a rhodopsin protein, preferably channelrodoxine 2 protein, We found that the activation of mitochondria can be reversibly controlled in time and space using light stimuli, and that a recombinant nucleic acid molecule that links the mitochondrial targeting sequence with the rhodopsin gene for the expression of rhodopsin protein on the mitochondrial membrane And then transfected into the cells, the activity of mitochondria is regulated through light stimulation and the recombinant nucleic acid molecule. Based on this, the present invention has been completed.

Accordingly, it is an object of the present invention to provide a recombinant nucleic acid molecule for regulating mitochondrial activity, in which a gene encoding an ABCB10 (ATP-binding cassette sub-family B member 10) protein and a gene encoding a rhodopsin protein are operatively linked.

It is another object of the present invention to provide a recombinant vector comprising the recombinant nucleic acid molecule.

It is yet another object of the present invention to provide a composition for modulating mitochondrial activity comprising the recombinant nucleic acid molecule.

It is still another object of the present invention to provide a pharmaceutical composition for preventing or treating diseases caused by degradation of mitochondrial activity comprising the recombinant nucleic acid molecule.

In addition, it is another object of the present invention to provide a method for modulating mitochondrial activity using light in an animal, plant, microorganism, or in vitro, excluding human, comprising the steps of:

(1) preparing a recombinant vector by inserting the nucleic acid molecule into a surface expression vector containing a restriction enzyme site capable of inserting the recombinant nucleic acid molecule;

(2) transforming a host cell containing mitochondria with the recombinant vector to obtain a transformant; And

(3) culturing the transformant with light stimulation.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

The present invention provides a recombinant nucleic acid molecule for mitochondrial activity modulation that is operably linked to a gene encoding the ABCB10 (ATP-binding cassette sub-family B member 10) protein and a gene encoding the rhodopsin protein.

In one embodiment of the invention, the rhodopsin is selected from the group consisting of channel rhodopsin 2, bacteriorhodopsin, halorodoxine, and mutants thereof.

In another embodiment of the present invention, the recombinant nucleic acid molecule is a nucleotide sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23.

In still another embodiment of the present invention, the recombinant nucleic acid molecule further comprises a gene encoding a fluorescent protein linked to a gene encoding the rhodopsin protein.

In another embodiment of the present invention, the recombinant nucleic acid molecule comprises at least one of SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: , SEQ ID NO: 43, SEQ ID NO: 45 and SEQ ID NO: 47.

In another embodiment of the present invention, the recombinant nucleic acid molecule controls the activity of mitochondria by regulating expression of the rhodopsin protein according to the application of a light stimulus.

The present invention provides a recombinant vector comprising the recombinant nucleic acid molecule.

The present invention provides a composition for modulating mitochondrial activity comprising the recombinant nucleic acid molecule.

The present invention provides a pharmaceutical composition for prevention or treatment of diseases caused by degradation of mitochondrial activity comprising the recombinant nucleic acid molecule.

In one embodiment of the invention, the disease is characterized in that it is selected from the group consisting of diabetes, cancer, arteriosclerosis, heart failure, obesity, Alzheimer's, Parkinson's and Huntington's disease.

The present invention provides a method of modulating mitochondrial activity using light in an animal, plant, microorganism or in vitro, but not human, comprising the steps of:

(1) preparing a recombinant vector by inserting the nucleic acid molecule into a surface expression vector containing a restriction enzyme site capable of inserting the recombinant nucleic acid molecule;

(2) transforming a host cell containing mitochondria with the recombinant vector to obtain a transformant; And

(3) culturing the transformant with light stimulation.

The present invention provides a method of treating a disease caused by a decrease in mitochondrial activity, comprising the step of administering the pharmaceutical composition to a subject.

The present invention provides a method for using the pharmaceutical composition for preventing or treating a disease caused by a decrease in mitochondrial activity.

By using the recombinant nucleic acid molecule according to the present invention, the recombinant nucleic acid molecules to which the gene encoding the ABCB10 protein and the gene encoding the Rorocin protein are linked can be transfected into the cell, thereby regulating the function or activity of the Rorocin protein according to the application of the optical stimulus As a result, the activity of mitochondria can be reversibly controlled by light stimulus delicately temporally and spatially.

In addition, since light is used as a stimulus, it is possible to adjust the wavelength and intensity of the light source such as LED and laser, so that it is possible to adjust the time and space in various levels at a variety of levels. But the mitochondrial activity modulating effect is excellent. Therefore, it is expected that mitochondria performing various functions such as signal transduction process and energy production can deeply understand the role of each tissue, and thus, it can be applied to diagnose and study diseases related to mitochondrial activity.

FIG. 1 is a schematic diagram of a recombinant nucleic acid molecule prepared in Example 1. FIG.
FIG. 2 shows the result of confirming subcellular localization of a recombinant protein using immunocytochemistry.
FIG. 3A shows the results of the mitochondrial targeting using the channel Rhodopsin mutant CatCh, and FIG. 3B shows the results of the mitochondrial targeting using bacteriorhodopsin.
FIG. 4 shows the channel activity of channeled rhodopsin targeted to mitochondria using the recombinant nucleic acid molecule prepared in Example 1. FIG.
FIG. 5 shows the result of confirming that the mitochondrial activity is regulated through the recombinant nucleic acid molecule produced by Example 1 while applying a light stimulus.
FIG. 6 shows the results of confirming mitochondrial expression pattern of channel rhodopsin 2 when the human cytochrome c oxidase subunit VIII gene was used as a mitochondrial targeting sequence.
FIG. 7 shows the result of confirming the mitochondrial expression pattern of channel rhodopsin 2 in the case of targeting using protein hydrophobicity.

Hereinafter, the present invention will be described in detail.

The main function of the mitochondria is driven by the concentration gradient and the membrane potential of ions formed across the intima of the unique bilayer structure. In other words, it can be hypothesized that the regulation of the concentration gradient of ions formed in the mitochondrial membrane can control the membrane potential of the membrane, thereby controlling the major functions of mitochondria. Therefore, in order to control the activity of the mitochondria, if the microorganism, rhodopsin protein, which is an ion channel that reacts with light, is artificially expressed in the mitochondrial inner membrane, the activity of mitochondria can be easily and finely and temporally and spatially controlled using light.

Accordingly, the present invention provides a recombinant nucleic acid molecule for mitochondrial activity regulation, wherein a gene encoding ABCB10 (ATP-binding cassette sub-family B member 10) protein is operably linked to a gene encoding a rhodopsin protein.

As used herein, the term "operably linked" refers to a gene that is required for expression and its regulatory sequences are operably linked to each other in such a way that gene expression is enabled.

The ABCB10 protein is one of the ATP-binding cassette transporters (ABC-transporter) superfamily. In the present invention, the gene encoding the ABCB10 protein was used as a mitochondrial targeting sequence.

The rhodopsin protein is an ion channel that is capable of sensing light and causing a change in the cell, that is, a light-regulated ion channel. When the recombinant nucleic acid molecule of the present invention is transfected into a cell, the rhodopsin protein is expressed in the mitochondrial membrane to be targeted Through this, the activity of mitochondria can be easily and finely controlled in time and space using light. The rhodopsin protein that can be used in this case is preferably selected from the group consisting of channel rhodopsin 2, bacteriorhodopsin, halorodoxine, and mutants thereof. More preferably, channel rhodopsin 2, bacteriorhodopsin and mutants thereof can be used .

In one embodiment of the present invention, a channel Rhodopsin 2 (ChR2) gene encoding channelrodoxine 2 (ChR2), a Catch gene encoding a mutation (Catch) of channelrodoxine 2, and a bacteriorhodopsin gene encoding bacteriorhodopsin and an ABCB10 protein (See Example 1 and Example 3), and each of the recombinant nucleic acid molecules may be composed of the nucleotide sequence shown in SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO: 23.

In addition, the recombinant nucleic acid molecule according to the present invention may further comprise a gene encoding a fluorescent protein, and the gene may be linked to a gene encoding a rhodopsin protein. Examples of fluorescent proteins that can be used in the present invention include, but are not limited to, enhanced green fluorescent protein (EGFP), enhanced yellow fluorescent protein (EYFP), mCherry, and E2-Crimson.

Thus, in the present invention, various recombinant nucleic acid molecules as shown in Table 1 can be prepared by variously combining a gene encoding a rhodopsin protein and a gene encoding a fluorescent protein in a gene encoding the ABCB10 protein, The recombinant nucleic acid molecule which can be used is not limited to this.

division Base sequence Amino acid sequence ABCB10-ChR2-EGFP SEQ ID NO: 25 SEQ ID NO: 26 ABCB10-Catch-EGFP SEQ ID NO: 27 SEQ ID NO: 28 ABCB10-bacteriorhodopsin-EGFP SEQ ID NO: 29 SEQ ID NO: 30 ABCB10-ChR2-EYFP SEQ ID NO: 31 SEQ ID NO: 32 ABCB10-Catch-EYFP SEQ ID NO: 33 SEQ ID NO: 34 ABCB10-bacteriorhodopsin-EYFP SEQ ID NO: 35 SEQ ID NO: 36 ABCB10-ChR2-mCherry SEQ ID NO: 37 SEQ ID NO: 38 ABCB10-Catch-mCherry SEQ ID NO: 39 SEQ ID NO: 40 ABCB10-bacteriorhodopsin-mCherry SEQ ID NO: 41 SEQ ID NO: 42 ABCB10-ChR2-E2-Crimson SEQ ID NO: 43 SEQ ID NO: 44 ABCB10-Catch-E2-Crimson SEQ ID NO: 45 SEQ ID NO: 46 ABCB10-bacteriorhodopsin-E2-Crimson SEQ ID NO: 47 SEQ ID NO: 48

In another embodiment of the present invention, the recombinant nucleic acid molecule according to the present invention was inserted into HEK293 cells, and the intracellular location of the channeled rhodopsin 2 protein was confirmed. As a result, the recombinant protein linked to the amino terminal of channeled rhodopsin 2 was successfully introduced into the mitochondrial membrane (See Example 2). At this time, "insertion" of the recombinant nucleic acid molecule can be carried out by a conventional method known in the art, for example, by a method such as transformation, transduction, or transfection , But is not limited thereto.

In another embodiment of the present invention, it has been confirmed that the channeled rhodopsin targeted to mitochondria using the recombinant nucleic acid molecule of the present invention still has channel activity (see Example 4) (Fig. 3). As a result, it was confirmed that the photoprotein degrades the function of ATP synthesis, which is the most important function of mitochondria, and controls the apoptosis process of mitochondria (see Example 5).

That is, the recombinant nucleic acid molecule of the present invention can regulate the activity of mitochondria by controlling the expression of the rhodopsin protein according to the application of a light stimulus, and thus can be usefully used for regulating mitochondrial activity.

Accordingly, the present invention provides a recombinant vector comprising the recombinant nucleic acid molecule.

As used herein, the term "vector" means a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of effecting the expression of the DNA in an appropriate host. Suitable regulatory sequences include promoters for performing transcription, any operator sequences for regulating transcription, sequences encoding suitable mRNA ribosome binding sites, and sequences controlling the termination of transcription and translation. The vector may be a plasmid, phage particle, or simply a potential genome insert. When a vector transforms a suitable host, the vector may replicate and function independently of the host genome, or, in some cases, may be inserted and integrated into the genome itself.

The present invention also provides a composition for modulating mitochondrial activity comprising the recombinant nucleic acid molecule.

Moreover, the present invention provides a method of modulating mitochondrial activity using light in an animal, plant, microorganism or in vitro, but not human, comprising the steps of:

(1) preparing a recombinant vector by inserting the nucleic acid molecule into a surface expression vector containing a restriction enzyme site capable of inserting the recombinant nucleic acid molecule;

(2) transforming a host cell containing mitochondria with the recombinant vector to obtain a transformant; And

(3) culturing the transformant with light stimulation.

In addition, the present invention provides a pharmaceutical composition for preventing or treating diseases caused by a decrease in mitochondrial activity including the recombinant nucleic acid molecule. At this time, the disease may be selected from the group consisting of diabetes, cancer, arteriosclerosis, heart failure, obesity, Alzheimer's, Parkinson's and Huntington's disease, but is not limited thereto.

As used herein, the term "prevention" means any action that inhibits a disease caused by a decrease in mitochondrial activity or delays its onset by administration of the pharmaceutical composition according to the present invention.

The term "treatment" as used in the present invention means any action that improves or alters the symptom caused by a disease caused by a decrease in mitochondrial activity by the administration of the pharmaceutical composition according to the present invention.

The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the formulation and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is determined by the type of disease, severity, , Sensitivity to the drug, time of administration, route of administration and rate of release, duration of treatment, factors including co-administered drugs, and other factors well known in the medical arts. The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, and can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take into account all of the above factors and to administer the amount in which the maximum effect can be obtained in a minimal amount without side effects, which can be easily determined by those skilled in the art.

Specifically, the effective amount of the pharmaceutical composition according to the present invention may vary depending on the age, sex, condition, body weight, absorbency, inactivation rate, excretion rate, type of disease, May be administered in an amount of 0.001 to 150 mg, preferably 0.01 to 100 mg, per 1 kg of body weight per day, every other day, or one to three times per day. However, the dosage may be varied depending on the route of administration, the severity of obesity, sex, weight, age, etc. Therefore, the dosage is not limited to the scope of the present invention by any means.

The pharmaceutical composition of the present invention may be formulated into a unit dosage form by formulating it using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or by intrusion into a multi-dose container. The formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and may additionally contain dispersing or stabilizing agents.

Accordingly, the present invention provides a method for treating a disease caused by a decrease in mitochondrial activity, comprising the step of administering the pharmaceutical composition to a subject. The term "individual" as used herein refers to a subject in need of treatment for a disease, and more specifically refers to a human or non-human primate, mouse, rat, dog, cat, It means mammals.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[Example]

Example 1. Preparation of Recombinant Nucleic Acid Molecules

Recombinant nucleic acid molecules for controlling mitochondrial activity were prepared by the following procedure.

1-1. insertion of mouse ABCB10 gene

(ATP-binding cassette, sub-family B (MDR / TAP), member 10, Mus musculus, Gene ID: 56199) was amplified on the basis of the pEGFP-N1 vector and inserted into the mitochondrial targeting sequence ).

More specifically, PCR was carried out using the mouse cDNA library as a template and the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2 as primers, thereby obtaining a 5'-terminal 420 base pair of mouse ABCB10 gene DNA amplification products were obtained.

ABCB10-N140 forward primer: 5'- ccgctcgagccaccatgcgcgccccttctgcta -3 '(SEQ ID NO: 1)

ABCB10-N140 reverse primer: 5'- cccaagcttaactgcagctgacagtctcccgc-3 '(SEQ ID NO: 2)

The pEGFP-N1-N140 (ABCB10) vector (about 5.1 kb) was prepared by treating the amplified DNA with XhoI and HindIII restriction enzymes and then ligation into the pEGFP-N1 vector digested with XhoI and HindIII restriction enzymes.

1-2. Insertion of channel rhodopsin 2 gene

PCR was carried out using the oligonucleotide of SEQ ID NO: 3 and SEQ ID NO: 4 as primers to obtain the channel-2 gene (ChR2: COP4 chlamyopsin 4 light-gated ion channel, Chlamydomonas reinhardtii , Gene ID: 5727376) The amplification product of DNA corresponding to the 933 base pair serving as the channel located at the 3 'end was obtained.

ChR2 forward primer: 5'- cccaagcttatggactatggcggcgctttgtctg -3 '(SEQ ID NO: 3)

ChR2 reverse primer: 5'- ccggaattcgcgctggcacggctccgg -3 '(SEQ ID NO: 4)

Then, the pEGFP-N1-N140 (ABCB10) vector prepared in Example 1-1 and the amplified channel rhodopsin 2 DNA were treated with HindIII and EcoR I restriction enzymes, and then channeled rhodopsin 2 DNA was ligated to the 5 'end of the mouse ABCB10 gene Followed by ligation to construct pEGFP-N1-N140 (ABCB10) -ChR2 vector (about 6.1 kb in size).

As a result, the pEGFP-N1-N140 (ABCB10) -ChR2 vector (about 6.1 kb in size) prepared in Example 1-2 was N140 (ABCB10) -ChR2 and more specifically N140 (ABCB10) -ChR2-EGFP (ABCB10) -ChR2 and N140 (ABCB10) -ChR2-EGFP recombinant nucleic acid molecules consist of the nucleotide sequence shown in SEQ ID NO: 19 and SEQ ID NO: 25, respectively.

Meanwhile, the proteins expressed by the N140 (ABCB10) -ChR2 and N140 (ABCB10) -ChR2-EGFP recombinant nucleic acid molecules were composed of the amino acids shown in SEQ ID NO: 20 and SEQ ID NO: 26, respectively.

1-3. Replacement of fluorescent protein gene

The following experiments were performed to replace the enhanced green fluorescent protein (EGFP) of pEGFP vector with EYFP (enhanced yellow fluorescent protein), mCherry or E2-Crimson.

That is, PCR was performed using the oligonucleotides of SEQ ID NO: 5 and SEQ ID NO: 6 as primers to obtain amplified products of fluorescent protein DNA corresponding to EYFP and mCherry, respectively.

EGFP / EYFP / mCherry forward primer: 5'- cgcggatccaatggtgagcaagggcgaggag -3 '(SEQ ID NO: 5)

EGFP / EYFP / mCherry reverse primer: 5'- aaatatgcggccgctttacttgtacagctcgtccatgc -3 '(SEQ ID NO: 6)

The amplified EYFP and mCherry DNAs were treated with BamHI and NotI restriction enzymes and ligated into pEGFP-N1-N140 (ABCB10) -ChR2 vector digested with BamHI and NotI restriction enzymes to obtain pEYFP-N1-N140 (ABCB10) -ChR2 vector (about 6.1 kb) and pCherry-N1-N140 (ABCB10) -ChR2 vector (about 6.1 kb).

As a result, pEYFP-N1-N140 (ABCB10) -ChR2 vector (about 6.1 kb) and pCherry-N1-N140 (ABCB10) -ChR2 vector -EYFP (SEQ ID NO: 31) and N140 (ABCB10) -ChR2-mCherry (SEQ ID NO: 37) recombinant nucleic acid molecules.

The proteins expressed by the N140 (ABCB10) -ChR2-EYFP and N140 (ABCB10) -ChR2-mCherry recombinant nucleic acid molecules were composed of the amino acids shown in SEQ ID NO: 32 and SEQ ID NO: 38, respectively.

In addition, the primers used were replaced with E2-Crimson of the far-red series by the same method as described above except for the other primers, and the primer sequences used here are as follows.

E2-Crimson forward primer: 5'- cgcggatccatggatagcactgagaacgtcatcaagcc -3 '(SEQ ID NO: 7)

E2-Crimson reverse primer: 5'- aaatatgcggccgctactggaacaggtggtggcggg -3 '(SEQ ID NO: 8)

FIG. 1 is a schematic diagram of a recombinant nucleic acid molecule prepared in Example 1. FIG. As shown in FIG. 1, the recombinant nucleic acid molecules are linked from the amino terminus with a gene encoding the mitochondrial targeting sequence, the rhodopsine gene, and a fluorescent tag at the 5 'end of the mouse ABCB10 gene, respectively .

Example 2. Confirmation of Subcellular Localization of Recombinant Protein

In order to confirm whether the position of the channel rhodopsin 2, which is known to be located on the plasma membrane, has changed, the following experiment was carried out.

2-1. Insertion of recombinant vector

HEK293 cells were cultured on cover glass for 12 hours. The pCherry-N1-N140 (ABCB10) -ChR2 vector prepared in Example 1 was inserted into HEK293 cells incubated with pFLAG-CMV2 mouse VDAC1, pcDNA3.1 myc-his mouse Mitofilin, pEGFP Rab5 and pEGFP BiP1 vectors. pFLAG-CMV2 mouse VDAC1, pcDNA3.1 myc-his mouse Mitofilin, pEGFP Rab5, and pEGFP BiP1 vectors correspond to vectors containing proteins that can be a marker for specific cell organelles, respectively.

Lipofectamine 2000 and carrygene were used as transfection reagents, and the procedure for transfection was followed for each reagent.

2-2. Cell immobilization and culture

The cells inserted in Example 2-1 were incubated for 18 hours at 37 ° C and 5% CO ₂ in the absence of light to allow sufficient expression of the proteins, followed by washing the culture solution with PBS at 37 ° C. Subsequently, para-formaldehyde in PBS was added to the cell fixation solution dissolved in 4% concentration and fixed at room temperature for 10 minutes. The cells were then washed with PBS and the cells were incubated in blocking solution (2% horse or goat serum, 1% Triton X-100 in PBS) for 15 min.

2-3. Antibody treatment that can detect proteins that can be the label of cell organelles

① Treatment of primary antibody

In Example 2-2, the cells that had been subjected to cell fixation and blocking were treated with antibodies capable of detecting the label of each organelles at room temperature for 2 hours. The antibody information was as follows.

(1: 1000, F1804, SIGMA-ALDRICH), anti-myc (1: 200, 9E10, Santa Cruz Biotechnology)

When using protein of cells: anti-TOM20 (1: 200, F-10, Santa Cruz Biotechnology)

② Treatment of secondary fluorescent antibody

After washing the primary antibody with PBS, the cells were treated with a secondary fluorescent antibody at room temperature for 1 hour. AlexaFluor 488-conjugated goat anti-mouse IgG (1: 200, Molecular Probe) was used as the secondary fluorescent antibody.

Then, the secondary antibody was rinsed with PBS and fixed on a slide glass using a mounting medium (M01, biomeda) to prepare a microscope specimen.

2-4. Identification of subcellular localization of channeled rhodopsin 2 protein by immunocytochemistry

After confirmation of fluorescence through Confocal microscopy, it was confirmed that the intracellular location was changed into mitochondria using the analysis program Image J colocalization analysis plugin, and the result is shown in FIG.

As shown in FIG. 2, it was confirmed that a recombinant protein having the amino terminal 140 amino acid sequence of the ABCB10 protein linked to the amino terminal of the channel rhodopsin 2 was successfully expressed in the mitochondrial membrane. In this case, red fluorescence indicates the protein of the recombinant nucleic acid molecule, green fluorescence indicates the mitochondrial label, and the expression patterns of Mitofilin (mitochondrial inner membrane protein, overexpression), VDAC1 (mitochondrial outer membrane protein, overexpression) and Tom20 (mitochondrial outer membrane protein) .

Example 3 Confirmation of Protein Expression Pattern in the Case of Using Various Rodocin Gene

The protein expression pattern in the case of using a different rhodopsin gene other than channel rhodopsin 2 was confirmed as follows.

3-1. Using a mutation (Catch) of channel rhodopsin 2

To utilize the mutation of channel rhodopsin 2, a mutation of channel rhodopsin 2 was first made. That is, in the vector prepared in Example 1, in order to modify leucine, which is 132 th amino acid of channel rhodopsin 2, into cysteine in a vector using E2-crimson or EYFP as a labeling protein, the following oligonucleotide was used as a primer, By performing the same PCR, amplification products of mutant DNA with modified genetic information of channel rhodopsin were obtained.

Catch forward primer: 5'- cacttgtcctgtcatctgtatccacctgagcaac -3 '(SEQ ID NO: 9)

Catch reverse primer: 5'- gttgctcaggtggatacagatgacaggacaagtg -3 '(SEQ ID NO: 10)

The amplified DNA was treated with Dpn I restriction enzyme to remove template DNA and ligated to a vector (pE2-Crimson-N1-N140 (ABCB10) -CatCh vector and pEYFP-N1-N140 (ABCB10) -CatCh vector).

The recombinant nucleic acid molecule replaced with the mutant (Cat Ch) of the channel rhodopsin 2 was inserted into the cells, and the expression of the protein was confirmed. The results are shown in FIG.

In FIG. 3A, red fluorescence indicates a protein expression pattern of a recombinant gene that is targeted to mitochondria by attaching an E2-crimson marker protein to a mutant channel of rhodopsin CatCh, and a green fluorescence is a pattern of a mitochondrial EYFP widely used as a mitochondrial marker .

3-2. Using bacteriorhodopsin

To utilize the mutation of channel rhodopsin 2, a mutation of channel rhodopsin 2 was first made. That is, in order to replace the channeled rhodopsin 2 with the bacteriorhodopsin, which is one of the microbes of other species, in the vector using the EGFP as a labeling protein in the vector prepared in Example 1, the following oligonucleotide was used as the primer PCR was performed to obtain a DNA amplification product corresponding to bacteriorhodopsin.

bacteriorhodopsin forward primer: 5'- cccaagcttatgttggagtt attgccaaca gcagtgg -3 '(SEQ ID NO: 11)

bacteriorhodopsin reverse primer: 5'- ccggaattcggtcgctggtcgcggccgc -3 '(SEQ ID NO: 12)

The amplified bacteriorhodopsin DNA was treated with HindIII and EcoRI restriction enzymes and ligated to a vector cut with HindIII and EcoRI restriction enzymes to construct a vector with bacteriorhodopsin inserted instead of channeled rhodopsin.

After the recombinant nucleic acid molecule replaced with bacteriorhodopsin was inserted into the cells, the expression of the protein was confirmed, and the result is shown in Fig. 3B.

In Fig. 3B, the protein expression pattern of the recombinant gene, which is obtained by attaching EGFP-labeled protein to bacteriorhodopsin and then targeted to mitochondria, and the expression pattern of Mitofilin used as a mitochondrial marker for red fluorescence are shown.

Example 4. Confirmation of channel activity of recombinant protein

In order to confirm that the channeled rhodopsin targeted to the mitochondria using the recombinant nucleic acid molecule according to the present invention still has channel activity, the following experiment was conducted.

4-1. Measurement of mitochondrial membrane potential

The pE2-Crimson-N1-N140 (ABCB10) -CatCh vector prepared in Example 3 was inserted into HEK293 cells and cultured for 24 hours. Then, the cells were transferred to a glass-bottomed dish for culturing for 24 hours.

To measure the mitochondrial membrane potential, TMRM, a mitochondrial membrane potential dye, was added to the cell culture solution at a concentration of 20 nM to 50 nM. After 10 minutes, the culture solution was removed, and KCl buffer (120 mM KCl and 10 mM Hepes, pH 7.4, with KOH), and the intensity of TMRM fluorescence was measured every 6 seconds through confocal microscopy. The results are shown in FIGS. 4A and 4B. Meanwhile, 488 nm argon laser was used for activation of channel rhodopsin and wildtype HEK293 cells were used as a control. For the mitochondrial membrane potential monitoring, if the rotenone reagent, which is a mitochondrial respiratory chain complex inhibitor, is required, it is incubated at 1 μM concentration for 7 hours in the culture solution before TMRM treatment.

As shown in FIGS. 4A and 4B, it was confirmed that mutant Cat Ch of the channel rhodopsin targeted to mitochondria using TMRM fluorescence, which is a mitochondrial membrane potential sensor, responds to light and the mitochondrial membrane potential is reduced (see A in FIG. 4) , Mitochondrial respiratory chain complexes that are important for maintaining mitochondrial membrane potential were inhibited by the rotenone reagent (see FIG. 4B).

4-2. Determination of calcium ion permeability of mitochondria

The pE2-Crimson-N1-N140 (ABCB10) -CatCh vector with mitochondrial GCaMP or mitochondrial RCaMP, which is a fluorescence sensor capable of detecting the calcium ion concentration in the mitochondria, was inserted into HEK293 cells and cultured for 24 hours. The cells were transferred to a glass-bottomed dish and cultured again for 24 hours.

To investigate the calcium ion permeability of mitochondria, KCl buffer was treated with 1 mM CaCl ₂ and 2 μM ionomycin, and the fluorescence of mitochondrial GCaMP or mitochondrial RCaMP was measured every 6 sec through confocal microscopy. 4 < / RTI > Meanwhile, 488 nm argon laser was used for activation of channel rhodopsin and wildtype HEK293 cells were used as a control.

As shown in FIG. 4C, the calcium ion concentration in the mitochondria was measured using mitochondrial RCaMP, which is a fluorescence sensor, in the absence of light stimulus (dark, Cr + R) or in the mitochondria not expressing channel rhodopsin (Light, Cr + R) in the mitochondria expressing the mitochondrial-targeted mutant Cat ch mutant targeted to the mitochondria (light, R only). In addition, it was confirmed that the calcium ion concentration in the mitochondria was significantly high in the mitochondria expressing the mutant Cat ch mutant channeled with the mitochondria using the fluorescent sensor, mitochondrial GCaMP.

Example 5. Confirmation of Mitochondrial Activity Controllability Using Light Stimulation and Recombinant Nucleic Acid Molecules

In order to confirm that the mitochondrial activity is regulated through the recombinant nucleic acid molecule according to the present invention while applying a light stimulus, the following experiment was conducted.

5-1. ATP measurement

The pmCherry-N1-N140 (ABCB10) -CatCh vector prepared in Example 3 was inserted into HEK293 cells and the cells were cultured for 24 hours in the absence of light stimulus and light (dark) after 24 hours . After each cell was washed with PBS at 37 ° C, it was incubated for 10 minutes in 600 μl of 1.5% TCA (trichloroethanoic acid) solution (12-well plate), and the solution was then neutralized with 0.1 M Tris-Acetate (pH 7.85) . Thereafter, the amount of ATP contained was measured using ENLITEN ATP assay kit (Promega). The results are shown in FIG. 5A. A 450nm LED array was used as a light stimulus.

As shown in Fig. 5A, there was no difference in intracellular ATP levels between wildtype (ctrl) HEK293 cells and mitochondrial channel rhodopsin (mtCatCh) expressing HEK293 cells in the absence of light stimulus, while wild type ATP levels were decreased when mitochondrial channeled rhodopsin was expressed. From the above results, it was found that ATP synthesis function, which is the most pivotal function of mitochondria, is degraded by light stimulation.

5-2. PI / Heochst staining

pE2-Crimson-N1-N140 (ABCB10) -CatCh vector was inserted into HEK293 cells and the cells were cultured for 24 hours in the absence of light stimulus and light (dark) for 5 days. Then, PI (Propidium iodide) and Hoechst 33342 reagent were added to the culture solution for 10 minutes, and then the number of cells reacting with PI and Hoechst was counted by fluorescence microscopy. The results were shown in FIG. 5B . A 450nm LED array was used as a light stimulus.

As shown in FIG. 5B, when light stimulus was present, it was confirmed that apoptosis was induced at a higher level in cells expressing mitochondrial channel rhodopsin (mtCatCh) than wildtype. From the above results, And the mitochondrial cell death process was regulated.

Example 6. Comparison with conventional methods for expressing protein in mitochondrial membrane

6-1. human cytochrome c oxidase subunit VIII gene was used as a mitochondrial targeting sequence

In order to use the human cytochrome c oxidase subunit VIII gene as a mitochondrial targeting sequence, PCR was carried out using the following oligonucleotide as a template with the HEK293 cell-line cDNA library as a template and the mitochondrial targeting sequence of the human cytochrome c oxidase subunit VIII gene DNA amplification products were obtained.

human cytochrome c oxidase subunit VIII forward primer: 5'-ccgctcgaggccaccatgtccgtcctgacgccgct -3 '(SEQ ID NO: 13)

human cytochrome c oxidase subunit VIII reverse primer: 5'-cccaagcttcaacgaatggatcttggcgcg -3 '(SEQ ID NO: 14)

The pEGFP-N1-N29aa (hCox-VIII) vector (about 5.1 kb) was prepared by treating the amplified DNA with XhoI and HindIII restriction enzymes and then ligation into the pEGFP-N1 vector digested with XhoI and HindIII restriction enzymes.

Thereafter, the channel-rhodopsin 2 gene was inserted in the same manner as in Example 1-2, and a gene encoding a fluorescent protein was ligated in the same manner as in Example 1-3 to prepare a recombinant nucleic acid molecule. The rhodopsin 2 channel expression pattern was confirmed, and the results are shown in FIG.

FIG. 6 is a graph showing the relationship between the mitochondrial targeting sequence of the human cytochrome c oxidase subunit VIII gene and the amino terminus of the channel rhodopsin 2 when a recombinant gene is expressed, which is most commonly used to send a non-mitochondrial protein to mitochondria, Showing that the failure to send rhodopsin 2 to the mitochondria is accompanied by several mitochondrial markers. In Fig. 6A, red fluorescence represents the pattern of mitochondrial endothelial mitochondrial protein mitochondrial protein expression, which is known to be expressed in the cell membrane, and that the green fluorescence is over-expressed by the myc-tagged channel. In FIG. 6B, the red fluorescence indicates the expression patterns of the recombinant protein using the expression pattern and the targeting sequence of the recombinant protein in which the mitochondrial targeting sequence of the human cytochrome c oxidase subunit VIII gene is linked to the channel rhodopsin 2, This shows the expression pattern of Mitofilin used as a mitochondrial marker. In FIG. 6C, the red fluorescence shows a protein expression pattern of a recombinant gene in which the amino sequence of the mitochondrial single-pass intima protein, mitofilin, before the transmembrane region is linked to the amino terminus of the channel rhodopsin 2, and the green fluorescence is used as the mitochondrial label Expression pattern of Mitofilin. In Fig. 6D, red fluorescence represents a protein expression pattern of a recombinant gene synthesized with mitochondrial multi-pass intimal protein ANT1 and channel rhodopsin 2, and green fluorescence represents an expression pattern of Mitofilin used as a mitochondrial marker.

6-2. Using protein hydrophobicity Targeting  Occation

The hydrophobicity of proteins has been reported to be an important factor in mitochondrial targeting of proteins. In order to produce a mutant with low hydrophobicity by causing gene mutation in the first α-helix and the sixth α-helix of the channeled rhodopsin 2 having high hydrophobicity, the vector produced in Example 6-1 was subjected to the following oligonucleotides Were used as primers to obtain two types of DNA amplification products.

① Combination 1

ABCB10-N140 forward primer: 5'- ccgctcgagccaccatgcgcgccccttctgcta -3 '(SEQ ID NO: 1)

hChR2 TM1 bulky reverse primer: 5'- tttcgcggccgcaatgctgaatcctgctgcaagc -3 '(SEQ ID NO: 16)

② Combination 2

hChR2 TM1 bulky forward primer: 5'-aaatatgcggccgcgatgttctatgcctaccaaacctgg -3 '(SEQ ID NO: 15)

ABCB10-N140 reverse primer: 5'- cccaagcttaactgcagctgacagtctcccgc-3 '(SEQ ID NO: 2)

Next, PCR was carried out using the following oligonucleotides as primers for two kinds of DNA amplification products as a template to obtain a DNA amplification product of mutant 1 of channel dodecyl 2 -phosphate.

ABCB10-N140 forward primer: 5'- ccgctcgagccaccatgcgcgccccttctgcta -3 '(SEQ ID NO: 1)

ABCB10-N140 reverse primer: 5'- cccaagcttaactgcagctgacagtctcccgc-3 '(SEQ ID NO: 2)

Thereafter, the amplified channel rhodopsin 2 hydrophobic lowering mutation 1 DNA was treated with HindIII and EcoRI restriction enzymes, and then the vector prepared in Example 6-1 was ligated with vector DNA truncated with HindIII and EcoRI restriction enzymes, Mutant 1 (LLL65AAA) vector was constructed.

Then, the above procedure was repeated using the primer corresponding to combination 3 and combination 4 instead of combination 1 and combination 2 to prepare a mutant 2 (LLL65AAA, F220A, W223A, F226A, F230A) .

③ Combination 3

ABCB10-N140 forward primer: 5'- ccgctcgagccaccatgcgcgccccttctgcta -3 '(SEQ ID NO: 1)

hChR2 TM6 bulky reverse primer: 5'- gagaattggggccatacccgcgctcacggcaaacagccatgccatgccg -3 '(SEQ ID NO: 18)

④ Combination 4

hChR2 TM6 bulky forward primer: 5'- gagcgcgggtatggccccaattctcgccattttggggcccgaagg -3 '(SEQ ID NO: 17)

ABCB10-N140 reverse primer: 5'- cccaagcttaactgcagctgacagtctcccgc-3 '(SEQ ID NO: 2)

The mitochondrial expression pattern of channelrodoxine 2 in the case of using the recombinant protein in which the mutation produced above is linked to the mitochondrial targeting sequence of human cytochrome c oxidase subunit VIII, which is the most commonly used targeting sequence, was confirmed. Respectively.

As shown in Fig. 7, when the recombinant protein produced by the method of Example 6-2 was used, it was confirmed that the channel rhodopsin 2 failed to be sent to the mitochondria. In Fig. 7, red fluorescence represents the expression pattern of this recombinant protein, and green fluorescence represents the expression patterns of mitofilin (mitochondrial inner membrane protein, overexpression) and VDAC1 (mitochondrial outer membrane protein, overexpression).

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Method for reversible control of mitochondrial activities          light stimulation with spatiotemporal precision <130> PB12-11066 <160> 48 <170> Kopatentin 2.0 <210> 1 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> ABCB10-N140 forward primer <400> 1 ccgctcgagc caccatgcgc gccccttctg cta 33 <210> 2 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> ABCB10-N140 reverse primer <400> 2 cccaagctta actgcagctg acagtctccc gc 32 <210> 3 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> ChR2 forward primer <400> 3 cccaagctta tggactatgg cggcgctttg tctg 34 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> ChR2 reverse primer <400> 4 ccggaattcg cgctggcacg gctccgg 27 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> EGFP / EYFP / mCherry forward primer <400> 5 cgcggatcca atggtgagca agggcgagga g 31 <210> 6 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> EGFP / EYFP / mCherry reverse primer <400> 6 aaatatgcgg ccgctttact tgtacagctc gtccatgc 38 <210> 7 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> E2-Crimson forward primer <400> 7 cgcggatcca tggatagcac tgagaacgtc atcaagcc 38 <210> 8 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> E2-Crimson reverse primer <400> 8 aaatatgcgg ccgctactgg aacaggtggt ggcggg 36 <210> 9 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Catch forward primer <400> 9 cacttgtcct gtcatctgta tccacctgag caac 34 <210> 10 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Catch reverse primer <400> 10 gttgctcagg tggatacaga tgacaggaca agtg 34 <210> 11 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Bacteriorhodopsin forward primer <400> 11 cccaagctta tgttggagtt attgccaaca gcagtgg 37 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Bacteriorhodopsin reverse primer <400> 12 ccggaattcg gtcgctggtc gcggccgc 28 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Human cytochrome c oxidase subunit VIII forward primer <400> 13 ccgctcgagg ccaccatgtc cgtcctgacg ccgct 35 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Human cytochrome c oxidase subunit VIII reverse primer <400> 14 cccaagcttc aacgaatgga tcttggcgcg 30 <210> 15 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> hChR2 TM1 bulky forward primer <400> 15 aaatatgcgg ccgcgatgtt ctatgcctac caaacctgg 39 <210> 16 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> hChR2 TM1 bulky reverse primer <400> 16 tttcgcggcc gcaatgctga atcctgctgc aagc 34 <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> hChR2 TM6 bulky forward primer <400> 17 gagcgcgggt atggccccaa ttctcgccat tttggggccc gaagg 45 <210> 18 <211> 49 <212> DNA <213> Artificial Sequence <220> <223> hChR2 TM6 bulky reverse primer <400> 18 gagaattggg gccatacccg cgctcacggc aaacagccat gccatgccg 49 <210> 19 <211> 1362 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -ChR2: DNA <400> 19 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatcc ttatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgt aa 1362 <210> 20 <211> 453 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -ChR2: Protein <400> 20 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Leu Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala     450 <210> 21 <211> 1362 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -CatCh: DNA <400> 21 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatct gtatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgt aa 1362 <210> 22 <211> 453 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -CatCh: Protein <400> 22 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala     450 <210> 23 <211> 1215 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin: DNA <400> 23 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgt tggagttatt gccaacagca gtggaggggg tatcgcaggc ccagatcacc 480 ggacgtccgg agtggatctg gctagcgctc ggtacggcgc taatgggact cgggacgctc 540 tatttcctcg tgaaagggat gggcgtctcg gacccagatg caaagaaatt ctacgccatc 600 acgacgctcg tcccagccat cgcgttcacg atgtacctct cgatgctgct ggggtatggc 660 ctcacaatgg taccgttcgg tggggagcag aaccccatct actgggcgcg gtacgctgac 720 tggctgttca ccacgccgct gttgttgtta gacctcgcgt tgctcgttga cgcggatcag 780 ggaacgatcc ttgcgctcgt cggtgccgac ggcatcatga tcgggaccgg cctggtcggc 840 gt; ctgtacatcc tgtacgtgct gttcttcggg ttcacctcga aggccgaaag catgcgcccc 960 gaggtcgcat ccacgttcaa agtactgcgt aacgttaccg ttgtgttgtg gtccgcgtat 1020 cccgtcgtgt ggctgatcgg cagcgaaggt gcgggaatcg tgccgctgaa catcgagacg 1080 ctgctgttca tggtgcttga cgtgagcgcg aaggtcggct tcgggctcat cctcctgcgc 1140 agtcgtgcga tcttcggcga agccgaagcg ccggagccgt ccgccggcga cggcgcggcc 1200 gcgaccagcg actga 1215 <210> 24 <211> 404 <212> PRT <213> Artificial Sequence <220> <223> N140 (ABCB10) -Bacteriorhodopsin: Protein <400> 24 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Leu     130 135 140 Glu Leu Leu Pro Thr Ala Val Glu Gly Val Ser Gln Ala Gln Ile Thr 145 150 155 160 Gly Arg Pro Glu Trp Ile Trp Leu Ala Leu Gly Thr Ala Leu Met Gly                 165 170 175 Leu Gly Thr Leu Tyr Phe Leu Val Lys Gly Met Gly Val Ser Asp Pro             180 185 190 Asp Ala Lys Lys Phe Tyr Ala Ile Thr Thr Leu Val Pro Ala Ile Ala         195 200 205 Phe Thr Met Tyr Leu Ser Met Leu Leu Gly Tyr Gly Leu Thr Met Val     210 215 220 Pro Phe Gly Gly Glu Gln Asn Pro Ile Tyr Trp Ala Arg Tyr Ala Asp 225 230 235 240 Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala Leu Leu Val                 245 250 255 Asp Ala Asp Gln Gly Thr Ile Leu Ala Leu Val Gly Ala Asp Gly Ile             260 265 270 Met Ile Gly Thr Gly Leu Val Gly Ala Leu Thr Lys Val Tyr Ser Tyr         275 280 285 Arg Phe Val Trp Trp Ala Ile Ser Thr Ala Ala Met Leu Tyr Ile Leu     290 295 300 Tyr Val Leu Phe Phe Gly Phe Thr Ser Lys Ala Glu Ser Met Arg Pro 305 310 315 320 Glu Val Ala Ser Thr Phe Lys Val Leu Arg Asn Val Thr Val Val Leu                 325 330 335 Trp Ser Ala Tyr Pro Val Val Trp Leu Ile Gly Ser Glu Gly Ala Gly             340 345 350 Ile Val Pro Leu Asn Ile Glu Thr Leu Leu Phe Met Val Leu Asp Val         355 360 365 Ser Ala Lys Val Gly Phe Gly Leu Ile Leu Leu Arg Ser Ser Ala Ile     370 375 380 Phe Gly Glu Ala Glu Ala Pro Glu Pro Ser Ala Gly Asp Gly Ala Ala 385 390 395 400 Ala Thr Ser Asp                 <210> 25 <211> 2118 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-EGFP: DNA <400> 25 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatcc ttatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 1440 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 1500 gagggcgatg ccacctacgg caagctgacc ctgaagctga tctgcaccac cggcaagctg 1560 cccgtgccct ggcccaccct cgtgaccacc ctgggctacg gcctgcagtg cttcgcccgc 1620 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 1680 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 1740 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 1800 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcacc 1860 gccgacaagc agaagaacgg catcaaggcc aacttcaaga tccgccacaa catcgaggac 1920 ggcggcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 1980 ctgctgcccg acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag 2040 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 2100 gacgagctgt acaagtaa 2118 <210> 26 <211> 705 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-EGFP: Protein <400> 26 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro 465 470 475 480 Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val                 485 490 495 Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys             500 505 510 Leu Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val         515 520 525 Thr Thr Leu Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His     530 535 540 Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val 545 550 555 560 Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg                 565 570 575 Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu             580 585 590 Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu         595 600 605 Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln     610 615 620 Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile Arg His Asn Ile Glu Asp 625 630 635 640 Gly Gly Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly                 645 650 655 Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser             660 665 670 Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu         675 680 685 Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr     690 695 700 Lys 705 <210> 27 <211> 2118 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-EGFP: DNA <400> 27 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatct gtatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 1440 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 1500 gagggcgatg ccacctacgg caagctgacc ctgaagctga tctgcaccac cggcaagctg 1560 cccgtgccct ggcccaccct cgtgaccacc ctgggctacg gcctgcagtg cttcgcccgc 1620 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 1680 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 1740 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 1800 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcacc 1860 gccgacaagc agaagaacgg catcaaggcc aacttcaaga tccgccacaa catcgaggac 1920 ggcggcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 1980 ctgctgcccg acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag 2040 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 2100 gacgagctgt acaagtaa 2118 <210> 28 <211> 705 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-EGFP: Protein <400> 28 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro 465 470 475 480 Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val                 485 490 495 Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys             500 505 510 Leu Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val         515 520 525 Thr Thr Leu Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His     530 535 540 Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val 545 550 555 560 Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg                 565 570 575 Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu             580 585 590 Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu         595 600 605 Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln     610 615 620 Lys Asn Gly Ile Lys Ala Asn Phe Lys Ile Arg His Asn Ile Glu Asp 625 630 635 640 Gly Gly Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly                 645 650 655 Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser             660 665 670 Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu         675 680 685 Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr     690 695 700 Lys 705 <210> 29 <211> 1971 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-EGFP: DNA <400> 29 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgt tggagttatt gccaacagca gtggaggggg tatcgcaggc ccagatcacc 480 ggacgtccgg agtggatctg gctagcgctc ggtacggcgc taatgggact cgggacgctc 540 tatttcctcg tgaaagggat gggcgtctcg gacccagatg caaagaaatt ctacgccatc 600 acgacgctcg tcccagccat cgcgttcacg atgtacctct cgatgctgct ggggtatggc 660 ctcacaatgg taccgttcgg tggggagcag aaccccatct actgggcgcg gtacgctgac 720 tggctgttca ccacgccgct gttgttgtta gacctcgcgt tgctcgttga cgcggatcag 780 ggaacgatcc ttgcgctcgt cggtgccgac ggcatcatga tcgggaccgg cctggtcggc 840 gt; ctgtacatcc tgtacgtgct gttcttcggg ttcacctcga aggccgaaag catgcgcccc 960 gaggtcgcat ccacgttcaa agtactgcgt aacgttaccg ttgtgttgtg gtccgcgtat 1020 cccgtcgtgt ggctgatcgg cagcgaaggt gcgggaatcg tgccgctgaa catcgagacg 1080 ctgctgttca tggtgcttga cgtgagcgcg aaggtcggct tcgggctcat cctcctgcgc 1140 agtcgtgcga tcttcggcga agccgaagcg ccggagccgt ccgccggcga cggcgcggcc 1200 gcgaccagcg accgaattct gcagtcgacg gtaccgcggg cccgggatcc aatggtgagc 1260 aagggcgagg agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta 1320 aacggccaca agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg 1380 accctgaagc tgatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc 1440 accctgggct acggcctgca gtgcttcgcc cgctaccccg accacatgaa gcagcacgac 1500 ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac 1560 gacggcaact acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc 1620 atcgagctga agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag 1680 tacaactaca acagccacaa cgtctatatc accgccgaca agcagaagaa cggcatcaag 1740 gccaacttca agatccgcca caacatcgag gacggcggcg tgcagctcgc cgaccactac 1800 cagcagaaca cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc 1860 taccagtccg ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag 1920 ttcgtgaccg ccgccgggat cactctcggc atggacgagc tgtacaagta a 1971 <210> 30 <211> 656 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-EGFP: Protein <400> 30 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Leu     130 135 140 Glu Leu Leu Pro Thr Ala Val Glu Gly Val Ser Gln Ala Gln Ile Thr 145 150 155 160 Gly Arg Pro Glu Trp Ile Trp Leu Ala Leu Gly Thr Ala Leu Met Gly                 165 170 175 Leu Gly Thr Leu Tyr Phe Leu Val Lys Gly Met Gly Val Ser Asp Pro             180 185 190 Asp Ala Lys Lys Phe Tyr Ala Ile Thr Thr Leu Val Pro Ala Ile Ala         195 200 205 Phe Thr Met Tyr Leu Ser Met Leu Leu Gly Tyr Gly Leu Thr Met Val     210 215 220 Pro Phe Gly Gly Glu Gln Asn Pro Ile Tyr Trp Ala Arg Tyr Ala Asp 225 230 235 240 Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala Leu Leu Val                 245 250 255 Asp Ala Asp Gln Gly Thr Ile Leu Ala Leu Val Gly Ala Asp Gly Ile             260 265 270 Met Ile Gly Thr Gly Leu Val Gly Ala Leu Thr Lys Val Tyr Ser Tyr         275 280 285 Arg Phe Val Trp Trp Ala Ile Ser Thr Ala Ala Met Leu Tyr Ile Leu     290 295 300 Tyr Val Leu Phe Phe Gly Phe Thr Ser Lys Ala Glu Ser Met Arg Pro 305 310 315 320 Glu Val Ala Ser Thr Phe Lys Val Leu Arg Asn Val Thr Val Val Leu                 325 330 335 Trp Ser Ala Tyr Pro Val Val Trp Leu Ile Gly Ser Glu Gly Ala Gly             340 345 350 Ile Val Pro Leu Asn Ile Glu Thr Leu Leu Phe Met Val Leu Asp Val         355 360 365 Ser Ala Lys Val Gly Phe Gly Leu Ile Leu Leu Arg Ser Ser Ala Ile     370 375 380 Phe Gly Glu Ala Glu Ala Pro Glu Pro Ser Ala Gly Asp Gly Ala Ala 385 390 395 400 Ala Thr Ser Asp Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg Asp                 405 410 415 Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile             420 425 430 Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Ser Ser         435 440 445 Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Leu     450 455 460 Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr 465 470 475 480 Thr Leu Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met                 485 490 495 Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln             500 505 510 Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala         515 520 525 Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys     530 535 540 Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu 545 550 555 560 Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Thr Ala Asp Lys Gln Lys                 565 570 575 Asn Gly Ile Lys Ala Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly             580 585 590 Gly Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp         595 600 605 Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala     610 615 620 Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu 625 630 635 640 Phe Val Thr Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys                 645 650 655 <210> 31 <211> 2118 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-EYFP: DNA <400> 31 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatcc ttatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 1440 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 1500 gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg 1560 cccgtgccct ggcccaccct cgtgaccacc ttcggctacg gcctgcagtg cttcgcccgc 1620 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 1680 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 1740 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 1800 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg 1860 gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac 1920 ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 1980 ctgctgcccg acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag 2040 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 2100 gacgagctgt acaagtaa 2118 <210> 32 <211> 705 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-EYFP: Protein <400> 32 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Leu Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro 465 470 475 480 Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val                 485 490 495 Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys             500 505 510 Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val         515 520 525 Thr Thr Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His     530 535 540 Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val 545 550 555 560 Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg                 565 570 575 Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu             580 585 590 Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu         595 600 605 Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln     610 615 620 Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp 625 630 635 640 Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly                 645 650 655 Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser             660 665 670 Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu         675 680 685 Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr     690 695 700 Lys 705 <210> 33 <211> 2118 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-EYFP: DNA <400> 33 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatct gtatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc 1440 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc 1500 gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg 1560 cccgtgccct ggcccaccct cgtgaccacc ttcggctacg gcctgcagtg cttcgcccgc 1620 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc 1680 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag 1740 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac 1800 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg 1860 gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac 1920 ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg 1980 ctgctgcccg acaaccacta cctgagctac cagtccgccc tgagcaaaga ccccaacgag 2040 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg 2100 gacgagctgt acaagtaa 2118 <210> 34 <211> 705 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-EYFP: Protein <400> 34 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro 465 470 475 480 Ile Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Val                 485 490 495 Ser Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys             500 505 510 Phe Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val         515 520 525 Thr Thr Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His     530 535 540 Met Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val 545 550 555 560 Gln Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg                 565 570 575 Ala Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu             580 585 590 Lys Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu         595 600 605 Glu Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln     610 615 620 Lys Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp 625 630 635 640 Gly Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly                 645 650 655 Asp Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser             660 665 670 Ala Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu         675 680 685 Glu Phe Val Thr Ala Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr     690 695 700 Lys 705 <210> 35 <211> 1971 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-EYFP: DNA <400> 35 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgt tggagttatt gccaacagca gtggaggggg tatcgcaggc ccagatcacc 480 ggacgtccgg agtggatctg gctagcgctc ggtacggcgc taatgggact cgggacgctc 540 tatttcctcg tgaaagggat gggcgtctcg gacccagatg caaagaaatt ctacgccatc 600 acgacgctcg tcccagccat cgcgttcacg atgtacctct cgatgctgct ggggtatggc 660 ctcacaatgg taccgttcgg tggggagcag aaccccatct actgggcgcg gtacgctgac 720 tggctgttca ccacgccgct gttgttgtta gacctcgcgt tgctcgttga cgcggatcag 780 ggaacgatcc ttgcgctcgt cggtgccgac ggcatcatga tcgggaccgg cctggtcggc 840 gt; ctgtacatcc tgtacgtgct gttcttcggg ttcacctcga aggccgaaag catgcgcccc 960 gaggtcgcat ccacgttcaa agtactgcgt aacgttaccg ttgtgttgtg gtccgcgtat 1020 cccgtcgtgt ggctgatcgg cagcgaaggt gcgggaatcg tgccgctgaa catcgagacg 1080 ctgctgttca tggtgcttga cgtgagcgcg aaggtcggct tcgggctcat cctcctgcgc 1140 agtcgtgcga tcttcggcga agccgaagcg ccggagccgt ccgccggcga cggcgcggcc 1200 gcgaccagcg accgaattct gcagtcgacg gtaccgcggg cccgggatcc aatggtgagc 1260 aagggcgagg agctgttcac cggggtggtg cccatcctgg tcgagctgga cggcgacgta 1320 aacggccaca agttcagcgt gtccggcgag ggcgagggcg atgccaccta cggcaagctg 1380 accctgaagt tcatctgcac caccggcaag ctgcccgtgc cctggcccac cctcgtgacc 1440 accttcggct acggcctgca gtgcttcgcc cgctaccccg accacatgaa gcagcacgac 1500 ttcttcaagt ccgccatgcc cgaaggctac gtccaggagc gcaccatctt cttcaaggac 1560 gacggcaact acaagacccg cgccgaggtg aagttcgagg gcgacaccct ggtgaaccgc 1620 atcgagctga agggcatcga cttcaaggag gacggcaaca tcctggggca caagctggag 1680 tacaactaca acagccacaa cgtctatatc atggccgaca agcagaagaa cggcatcaag 1740 gtgaacttca agatccgcca caacatcgag gacggcagcg tgcagctcgc cgaccactac 1800 cagcagaaca cccccatcgg cgacggcccc gtgctgctgc ccgacaacca ctacctgagc 1860 taccagtccg ccctgagcaa agaccccaac gagaagcgcg atcacatggt cctgctggag 1920 ttcgtgaccg ccgccgggat cactctcggc atggacgagc tgtacaagta a 1971 <210> 36 <211> 656 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-EYFP: Protein <400> 36 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Leu     130 135 140 Glu Leu Leu Pro Thr Ala Val Glu Gly Val Ser Gln Ala Gln Ile Thr 145 150 155 160 Gly Arg Pro Glu Trp Ile Trp Leu Ala Leu Gly Thr Ala Leu Met Gly                 165 170 175 Leu Gly Thr Leu Tyr Phe Leu Val Lys Gly Met Gly Val Ser Asp Pro             180 185 190 Asp Ala Lys Lys Phe Tyr Ala Ile Thr Thr Leu Val Pro Ala Ile Ala         195 200 205 Phe Thr Met Tyr Leu Ser Met Leu Leu Gly Tyr Gly Leu Thr Met Val     210 215 220 Pro Phe Gly Gly Glu Gln Asn Pro Ile Tyr Trp Ala Arg Tyr Ala Asp 225 230 235 240 Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala Leu Leu Val                 245 250 255 Asp Ala Asp Gln Gly Thr Ile Leu Ala Leu Val Gly Ala Asp Gly Ile             260 265 270 Met Ile Gly Thr Gly Leu Val Gly Ala Leu Thr Lys Val Tyr Ser Tyr         275 280 285 Arg Phe Val Trp Trp Ala Ile Ser Thr Ala Ala Met Leu Tyr Ile Leu     290 295 300 Tyr Val Leu Phe Phe Gly Phe Thr Ser Lys Ala Glu Ser Met Arg Pro 305 310 315 320 Glu Val Ala Ser Thr Phe Lys Val Leu Arg Asn Val Thr Val Val Leu                 325 330 335 Trp Ser Ala Tyr Pro Val Val Trp Leu Ile Gly Ser Glu Gly Ala Gly             340 345 350 Ile Val Pro Leu Asn Ile Glu Thr Leu Leu Phe Met Val Leu Asp Val         355 360 365 Ser Ala Lys Val Gly Phe Gly Leu Ile Leu Leu Arg Ser Ser Ala Ile     370 375 380 Phe Gly Glu Ala Glu Ala Pro Glu Pro Ser Ala Gly Asp Gly Ala Ala 385 390 395 400 Ala Thr Ser Asp Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg Asp                 405 410 415 Pro Met Val Ser Lys Gly Glu Glu Leu Phe Thr Gly Val Val Pro Ile             420 425 430 Leu Val Glu Leu Asp Gly Asp Val Asn Gly His Lys Phe Ser Ser Ser         435 440 445 Gly Glu Gly Glu Gly Asp Ala Thr Tyr Gly Lys Leu Thr Leu Lys Phe     450 455 460 Ile Cys Thr Thr Gly Lys Leu Pro Val Pro Trp Pro Thr Leu Val Thr 465 470 475 480 Thr Phe Gly Tyr Gly Leu Gln Cys Phe Ala Arg Tyr Pro Asp His Met                 485 490 495 Lys Gln His Asp Phe Phe Lys Ser Ala Met Pro Glu Gly Tyr Val Gln             500 505 510 Glu Arg Thr Ile Phe Phe Lys Asp Asp Gly Asn Tyr Lys Thr Arg Ala         515 520 525 Glu Val Lys Phe Glu Gly Asp Thr Leu Val Asn Arg Ile Glu Leu Lys     530 535 540 Gly Ile Asp Phe Lys Glu Asp Gly Asn Ile Leu Gly His Lys Leu Glu 545 550 555 560 Tyr Asn Tyr Asn Ser His Asn Val Tyr Ile Met Ala Asp Lys Gln Lys                 565 570 575 Asn Gly Ile Lys Val Asn Phe Lys Ile Arg His Asn Ile Glu Asp Gly             580 585 590 Ser Val Gln Leu Ala Asp His Tyr Gln Gln Asn Thr Pro Ile Gly Asp         595 600 605 Gly Pro Val Leu Leu Pro Asp Asn His Tyr Leu Ser Tyr Gln Ser Ala     610 615 620 Leu Ser Lys Asp Pro Asn Glu Lys Arg Asp His Met Val Leu Leu Glu 625 630 635 640 Phe Val Thr Ala Gly Ile Thr Leu Gly Met Asp Glu Leu Tyr Lys                 645 650 655 <210> 37 <211> 2109 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-mCherry: DNA <400> 37 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatcc ttatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagg ataacatggc catcatcaag 1440 gagttcatgc gcttcaaggt gcacatggag ggctccgtga acggccacga gttcgagatc 1500 gagggcgagg gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc 1560 aagggtggcc ccctgccctt cgcctgggac atcctgtccc ctcagttcat gtacggctcc 1620 aaggcctacg tgaagcaccc cgccgacatc cccgactact tgaagctgtc cttccccgag 1680 ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg gcgtggtgac cgtgacccag 1740 gactcctccc tgcaggacgg cgagttcatc tacaaggtga agctgcgcgg caccaacttc 1800 ccctccgacg gccccgtaat gcagaagaag accatgggct gggaggcctc ctccgagcgg 1860 atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa gctgaaggac 1920 ggcggccact acgacgctga ggtcaagacc acctacaagg ccaagaagcc cgtgcagctg 1980 cccggcgcct acaacgtcaa catcaagttg gacatcacct cccacaacga ggactacacc 2040 atcgtggaac agtacgaacg cgccgagggc cgccactcca ccggcggcat ggacgagctg 2100 tacaagtaa 2109 <210> 38 <211> 702 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-mCherry: Protein <400> 38 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Leu Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile Ile Lys 465 470 475 480 Glu Phe Met Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His                 485 490 495 Glu Phe Glu Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr             500 505 510 Gln Thr Ala Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala         515 520 525 Trp Asp Ile Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val     530 535 540 Lys His Pro Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu 545 550 555 560 Gly Phe Lys Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val                 565 570 575 Thr Val Thr Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys             580 585 590 Val Lys Leu Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln         595 600 605 Lys Lys Thr Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu     610 615 620 Asp Gly Ala Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp 625 630 635 640 Gly Gly His Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys                 645 650 655 Pro Val Gln Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile             660 665 670 Thr Ser His Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala         675 680 685 Glu Gly Arg His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys     690 695 700 <210> 39 <211> 2109 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-mCherry: DNA <400> 39 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatct gtatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggtgagcaag ggcgaggagg ataacatggc catcatcaag 1440 gagttcatgc gcttcaaggt gcacatggag ggctccgtga acggccacga gttcgagatc 1500 gagggcgagg gcgagggccg cccctacgag ggcacccaga ccgccaagct gaaggtgacc 1560 aagggtggcc ccctgccctt cgcctgggac atcctgtccc ctcagttcat gtacggctcc 1620 aaggcctacg tgaagcaccc cgccgacatc cccgactact tgaagctgtc cttccccgag 1680 ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg gcgtggtgac cgtgacccag 1740 gactcctccc tgcaggacgg cgagttcatc tacaaggtga agctgcgcgg caccaacttc 1800 ccctccgacg gccccgtaat gcagaagaag accatgggct gggaggcctc ctccgagcgg 1860 atgtaccccg aggacggcgc cctgaagggc gagatcaagc agaggctgaa gctgaaggac 1920 ggcggccact acgacgctga ggtcaagacc acctacaagg ccaagaagcc cgtgcagctg 1980 cccggcgcct acaacgtcaa catcaagttg gacatcacct cccacaacga ggactacacc 2040 atcgtggaac agtacgaacg cgccgagggc cgccactcca ccggcggcat ggacgagctg 2100 tacaagtaa 2109 <210> 40 <211> 702 <212> PRT <213> Artificial Sequence <220> &Lt; 223 > N140 (ABCB10) -CatCh-mCherry: Protein <400> 40 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile Ile Lys 465 470 475 480 Glu Phe Met Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His                 485 490 495 Glu Phe Glu Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr             500 505 510 Gln Thr Ala Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala         515 520 525 Trp Asp Ile Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val     530 535 540 Lys His Pro Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu 545 550 555 560 Gly Phe Lys Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val                 565 570 575 Thr Val Thr Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys             580 585 590 Val Lys Leu Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln         595 600 605 Lys Lys Thr Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu     610 615 620 Asp Gly Ala Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp 625 630 635 640 Gly Gly His Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys                 645 650 655 Pro Val Gln Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile             660 665 670 Thr Ser His Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala         675 680 685 Glu Gly Arg His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys     690 695 700 <210> 41 <211> 1962 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > N140 (ABCB10) -Bacteriorhodopsin-mCherry: DNA <400> 41 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgt tggagttatt gccaacagca gtggaggggg tatcgcaggc ccagatcacc 480 ggacgtccgg agtggatctg gctagcgctc ggtacggcgc taatgggact cgggacgctc 540 tatttcctcg tgaaagggat gggcgtctcg gacccagatg caaagaaatt ctacgccatc 600 acgacgctcg tcccagccat cgcgttcacg atgtacctct cgatgctgct ggggtatggc 660 ctcacaatgg taccgttcgg tggggagcag aaccccatct actgggcgcg gtacgctgac 720 tggctgttca ccacgccgct gttgttgtta gacctcgcgt tgctcgttga cgcggatcag 780 ggaacgatcc ttgcgctcgt cggtgccgac ggcatcatga tcgggaccgg cctggtcggc 840 gt; ctgtacatcc tgtacgtgct gttcttcggg ttcacctcga aggccgaaag catgcgcccc 960 gaggtcgcat ccacgttcaa agtactgcgt aacgttaccg ttgtgttgtg gtccgcgtat 1020 cccgtcgtgt ggctgatcgg cagcgaaggt gcgggaatcg tgccgctgaa catcgagacg 1080 ctgctgttca tggtgcttga cgtgagcgcg aaggtcggct tcgggctcat cctcctgcgc 1140 agtcgtgcga tcttcggcga agccgaagcg ccggagccgt ccgccggcga cggcgcggcc 1200 gcgaccagcg accgaattct gcagtcgacg gtaccgcggg cccgggatcc aatggtgagc 1260 aagggcgagg aggataacat ggccatcatc aaggagttca tgcgcttcaa ggtgcacatg 1320 gagggctccg tgaacggcca cgagttcgag atcgagggcg agggcgaggg ccgcccctac 1380 gagggcaccc agaccgccaa gctgaaggtg accaagggtg gccccctgcc cttcgcctgg 1440 gacatcctgt cccctcagtt catgtacggc tccaaggcct acgtgaagca ccccgccgac 1500 atccccgact acttgaagct gtccttcccc gagggcttca agtgggagcg cgtgatgaac 1560 ttcgaggacg gcggcgtggt gaccgtgacc caggactcct ccctgcagga cggcgagttc 1620 atctacaagg tgaagctgcg cggcaccaac ttcccctccg acggccccgt aatgcagaag 1680 aagaccatgg gctgggaggc ctcctccgag cggatgtacc ccgaggacgg cgccctgaag 1740 ggcgagatca agcagaggct gaagctgaag gacggcggcc actacgacgc tgaggtcaag 1800 accacctaca aggccaagaa gcccgtgcag ctgcccggcg cctacaacgt caacatcaag 1860 ttggacatca cctcccacaa cgaggactac accatcgtgg aacagtacga acgcgccgag 1920 ggccgccact ccaccggcgg catggacgag ctgtacaagt aa 1962 <210> 42 <211> 653 <212> PRT <213> Artificial Sequence <220> <223> N140 (ABCB10) -Bacteriorhodopsin-mCherry: Protein <400> 42 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Leu     130 135 140 Glu Leu Leu Pro Thr Ala Val Glu Gly Val Ser Gln Ala Gln Ile Thr 145 150 155 160 Gly Arg Pro Glu Trp Ile Trp Leu Ala Leu Gly Thr Ala Leu Met Gly                 165 170 175 Leu Gly Thr Leu Tyr Phe Leu Val Lys Gly Met Gly Val Ser Asp Pro             180 185 190 Asp Ala Lys Lys Phe Tyr Ala Ile Thr Thr Leu Val Pro Ala Ile Ala         195 200 205 Phe Thr Met Tyr Leu Ser Met Leu Leu Gly Tyr Gly Leu Thr Met Val     210 215 220 Pro Phe Gly Gly Glu Gln Asn Pro Ile Tyr Trp Ala Arg Tyr Ala Asp 225 230 235 240 Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala Leu Leu Val                 245 250 255 Asp Ala Asp Gln Gly Thr Ile Leu Ala Leu Val Gly Ala Asp Gly Ile             260 265 270 Met Ile Gly Thr Gly Leu Val Gly Ala Leu Thr Lys Val Tyr Ser Tyr         275 280 285 Arg Phe Val Trp Trp Ala Ile Ser Thr Ala Ala Met Leu Tyr Ile Leu     290 295 300 Tyr Val Leu Phe Phe Gly Phe Thr Ser Lys Ala Glu Ser Met Arg Pro 305 310 315 320 Glu Val Ala Ser Thr Phe Lys Val Leu Arg Asn Val Thr Val Val Leu                 325 330 335 Trp Ser Ala Tyr Pro Val Val Trp Leu Ile Gly Ser Glu Gly Ala Gly             340 345 350 Ile Val Pro Leu Asn Ile Glu Thr Leu Leu Phe Met Val Leu Asp Val         355 360 365 Ser Ala Lys Val Gly Phe Gly Leu Ile Leu Leu Arg Ser Ser Ala Ile     370 375 380 Phe Gly Glu Ala Glu Ala Pro Glu Pro Ser Ala Gly Asp Gly Ala Ala 385 390 395 400 Ala Thr Ser Asp Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg Asp                 405 410 415 Pro Met Val Ser Lys Gly Glu Glu Asp Asn Met Ala Ile I Lys Glu             420 425 430 Phe Met Arg Phe Lys Val His Met Glu Gly Ser Val Asn Gly His Glu         435 440 445 Phe Glu Ile Glu Gly Glu Gly Glu Gly Arg Pro Tyr Glu Gly Thr Gln     450 455 460 Thr Ala Lys Leu Lys Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp 465 470 475 480 Asp Ile Leu Ser Pro Gln Phe Met Tyr Gly Ser Lys Ala Tyr Val Lys                 485 490 495 His Pro Ala Asp Ile Pro Asp Tyr Leu Lys Leu Ser Phe Pro Glu Gly             500 505 510 Phe Lys Trp Glu Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr         515 520 525 Val Thr Gln Asp Ser Ser Leu Gln Asp Gly Glu Phe Ile Tyr Lys Val     530 535 540 Lys Leu Arg Gly Thr Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys 545 550 555 560 Lys Thr Met Gly Trp Glu Ala Ser Ser Glu Arg Met Tyr Pro Glu Asp                 565 570 575 Gly Ala Leu Lys Gly Glu Ile Lys Gln Arg Leu Lys Leu Lys Asp Gly             580 585 590 Gly His Tyr Asp Ala Glu Val Lys Thr Thr Tyr Lys Ala Lys Lys Pro         595 600 605 Val Gln Leu Pro Gly Ala Tyr Asn Val Asn Ile Lys Leu Asp Ile Thr     610 615 620 Ser His Asn Glu Asp Tyr Thr Ile Val Glu Gln Tyr Glu Arg Ala Glu 625 630 635 640 Gly Arg His Ser Thr Gly Gly Met Asp Glu Leu Tyr Lys                 645 650 <210> 43 <211> 2076 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-E2-Crimson: DNA <400> 43 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatcc ttatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggatagcact gagaacgtca tcaagccctt catgcgcttc 1440 aaggtgcaca tggagggctc cgtgaacggc cacgagttcg agatcgaggg cgtgggcgag 1500 ggcaagccct acgagggcac ccagaccgcc aagctgcaag tgaccaaggg cggccccctg 1560 cccttcgcct gggacatcct gtccccccag ttcttctacg gctccaaggc gtacatcaag 1620 caccccgccg acatccccga ctacctcaag cagtccttcc ccgagggctt caagtgggag 1680 cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga cccaggactc ctccctgcag 1740 gacggcaccc tcatctacca cgtgaagttc atcggcgtga acttcccctc cgacggcccc 1800 gtaatgcaga agaagactct gggctgggag ccctccactg agcgcaacta cccccgcgac 1860 ggcgtgctga agggcgagaa ccacatggcg ctgaagctga agggcggcgg ccactacctg 1920 tgtgagttca agtccatcta catggccaag aagcccgtga agctgcccgg ctaccactac 1980 gtggactaca agctcgacat cacctcccac aacgaggact acaccgtggt ggagcagtac 2040 gagcgcgccg aggcccgcca ccacctgttc cagtag 2076 <210> 44 <211> 691 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -ChR2-E2-Crimson: Protein <400> 44 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Leu Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Asp Ser Thr Glu Asn Val Ile Lys Pro Phe Met Arg Phe 465 470 475 480 Lys Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu                 485 490 495 Gly Val Gly Glu Gly Lys Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu             500 505 510 Gln Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser         515 520 525 Pro Gln Phe Phe Tyr Gly Ser Lys Ala Tyr Ile Lys His Pro Ala Asp     530 535 540 Ile Pro Asp Tyr Leu Lys Gln Ser Phe Pro Glu Gly Phe Lys Trp Glu 545 550 555 560 Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp                 565 570 575 Ser Ser Leu Gln Asp Gly Thr Leu Ile Tyr His Val Lys Phe Ile Gly             580 585 590 Val Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Leu Gly         595 600 605 Trp Glu Pro Ser Thr Glu Arg Asn Tyr Pro Arg Asp Gly Val Leu Lys     610 615 620 Gly Glu Asn His Met Ala Leu Lys Leu Lys Gly Gly Gly His Tyr Leu 625 630 635 640 Cys Glu Phe Lys Ser Ile Tyr Met Ala Lys Lys Pro Val Lys Leu Pro                 645 650 655 Gly Tyr His Tyr Val Asp Tyr Lys Leu Asp Ile Thr Ser His Asn Glu             660 665 670 Asp Tyr Thr Val Glu Gln Tyr Glu Arg Ala Glu Ala Arg His His         675 680 685 Leu Phe Gln     690 <210> 45 <211> 2076 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-E2-Crimson: DNA <400> 45 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgg actatggcgg cgctttgtct gccgtcggac gcgaactttt gttcgttact 480 aatcctgtgg tggtgaacgg gtccgtcctg gtccctgagg atcaatgtta ctgtgccgga 540 tggattgaat ctcgcggcac gaacggcgct cagaccgcgt caaatgtcct gcagtggctt 600 gcagcaggat tcagcatttt gctgctgatg ttctatgcct accaaacctg gaaatctaca 660 tgcggctggg aggagatcta tgtgtgcgcc attgaaatgg ttaaggtgat tctcgagttc 720 ttttttgagt ttaagaatcc ctctatgctc taccttgcca caggacaccg ggtgcagtgg 780 ctgcgctatg cagagtggct gctcacttgt cctgtcatct gtatccacct gagcaacctc 840 accggcctga gcaacgacta cagcaggaga accatgggac tccttgtctc agacatcggg 900 actatcgtgt ggggggctac cagcgccatg gcaaccggct atgttaaagt catcttcttt 960 tgtcttggat tgtgctatgg cgcgaacaca ttttttcacg ccgccaaagc atatatcgag 1020 ggttatcata ctgtgccaaa gggtcggtgc cgccaggtcg tgaccggcat ggcatggctg 1080 tttttcgtga gctggggtat gttcccaatt ctcttcattt tggggcccga aggttttggc 1140 gtcctgagcg tctatggctc caccgtaggt cacacgatta ttgatctgat gagtaaaaat 1200 tgttgggggt tgttgggaca ctacctgcgc gtcctgatcc acgagcacat attgattcac 1260 ggagatatcc gcaaaaccac caaactgaac atcggcggaa cggagatcga ggtcgagact 1320 ctcgtcgaag acgaagccga ggccggagcc gtgccagcgc gaattctgca gtcgacggta 1380 ccgcgggccc gggatccaat ggatagcact gagaacgtca tcaagccctt catgcgcttc 1440 aaggtgcaca tggagggctc cgtgaacggc cacgagttcg agatcgaggg cgtgggcgag 1500 ggcaagccct acgagggcac ccagaccgcc aagctgcaag tgaccaaggg cggccccctg 1560 cccttcgcct gggacatcct gtccccccag ttcttctacg gctccaaggc gtacatcaag 1620 caccccgccg acatccccga ctacctcaag cagtccttcc ccgagggctt caagtgggag 1680 cgcgtgatga acttcgagga cggcggcgtg gtgaccgtga cccaggactc ctccctgcag 1740 gacggcaccc tcatctacca cgtgaagttc atcggcgtga acttcccctc cgacggcccc 1800 gtaatgcaga agaagactct gggctgggag ccctccactg agcgcaacta cccccgcgac 1860 ggcgtgctga agggcgagaa ccacatggcg ctgaagctga agggcggcgg ccactacctg 1920 tgtgagttca agtccatcta catggccaag aagcccgtga agctgcccgg ctaccactac 1980 gtggactaca agctcgacat cacctcccac aacgaggact acaccgtggt ggagcagtac 2040 gagcgcgccg aggcccgcca ccacctgttc cagtag 2076 <210> 46 <211> 691 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -CatCh-E2-Crimson: Protein <400> 46 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Asp     130 135 140 Tyr Gly Gly Ala Leu Ser Ala Val Gly Arg Glu Leu Leu Phe Val Thr 145 150 155 160 Asn Pro Val Val Val Asn Gly Ser Val Leu Val Pro Glu Asp Gln Cys                 165 170 175 Tyr Cys Ala Gly Trp Ile Glu Ser Arg Gly Thr Asn Gly Ala Gln Thr             180 185 190 Ala Ser Asn Val Leu Gln Trp Leu Ala Ala Gly Phe Ser Ile Leu Leu         195 200 205 Leu Met Phe Tyr Ala Tyr Gln Thr Trp Lys Ser Thr Cys Gly Trp Glu     210 215 220 Glu Ile Tyr Val Cys Ala Ile Glu Met Val Lys Val Ile Leu Glu Phe 225 230 235 240 Phe Phe Glu Phe Lys Asn Pro Ser Met Leu Tyr Leu Ala Thr Gly His                 245 250 255 Arg Val Gln Trp Leu Arg Tyr Ala Glu Trp Leu Leu Thr Cys Pro Val             260 265 270 Ile Cys Ile His Leu Ser Asn Leu Thr Gly Leu Ser Asn Asp Tyr Ser         275 280 285 Arg Arg Thr Met Gly Leu Leu Val Ser Asp Ile Gly Thr Ile Val Trp     290 295 300 Gly Ala Thr Ser Ala Met Ala Thr Gly Tyr Val Lys Val Ile Phe Phe 305 310 315 320 Cys Leu Gly Leu Cys Tyr Gly Ala Asn Thr Phe Phe His Ala Ala Lys                 325 330 335 Ala Tyr Ile Glu Gly Tyr His Thr Val Pro Lys Gly Arg Cys Arg Gln             340 345 350 Val Val Thr Gly Met Ala Trp Leu Phe Phe Val Ser Trp Gly Met Phe         355 360 365 Pro Ile Leu Phe Ile Leu Gly Pro Glu Gly Phe Gly Val Leu Ser Val     370 375 380 Tyr Gly Ser Thr Val Gly His Thr Ile Ile Asp Leu Met Ser Lys Asn 385 390 395 400 Cys Trp Gly Leu Leu Gly His Tyr Leu Arg Val Leu Ile His Glu His                 405 410 415 Ile Leu Ile His Gly Asp Ile Arg Lys Thr Thr Lys Leu Asn Ile Gly             420 425 430 Gly Thr Glu Ile Glu Val Glu Thr Leu Val Glu Asp Glu Ala Glu Ala         435 440 445 Gly Ala Val Pro Ala Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg     450 455 460 Asp Pro Met Asp Ser Thr Glu Asn Val Ile Lys Pro Phe Met Arg Phe 465 470 475 480 Lys Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu                 485 490 495 Gly Val Gly Glu Gly Lys Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu             500 505 510 Gln Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser         515 520 525 Pro Gln Phe Phe Tyr Gly Ser Lys Ala Tyr Ile Lys His Pro Ala Asp     530 535 540 Ile Pro Asp Tyr Leu Lys Gln Ser Phe Pro Glu Gly Phe Lys Trp Glu 545 550 555 560 Arg Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp                 565 570 575 Ser Ser Leu Gln Asp Gly Thr Leu Ile Tyr His Val Lys Phe Ile Gly             580 585 590 Val Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Leu Gly         595 600 605 Trp Glu Pro Ser Thr Glu Arg Asn Tyr Pro Arg Asp Gly Val Leu Lys     610 615 620 Gly Glu Asn His Met Ala Leu Lys Leu Lys Gly Gly Gly His Tyr Leu 625 630 635 640 Cys Glu Phe Lys Ser Ile Tyr Met Ala Lys Lys Pro Val Lys Leu Pro                 645 650 655 Gly Tyr His Tyr Val Asp Tyr Lys Leu Asp Ile Thr Ser His Asn Glu             660 665 670 Asp Tyr Thr Val Glu Gln Tyr Glu Arg Ala Glu Ala Arg His His         675 680 685 Leu Phe Gln     690 <210> 47 <211> 1929 <212> DNA <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-E2-Crimson: DNA <400> 47 atgcgcgccc cttctgctag ggcgctactg ctgattccgc gccggggccc tgccgtgcga 60 gcgtgggccc cggccgtctc ctctcggata tggctggctt ctgaatggac cccgctcgta 120 cgcgcgtgga cctctctgat ccacaagccg ggttcgggcc tccgctttcc cgcgccccta 180 tccgggctgc ctggcggcgt ggggcagtgg gccacctcct cgggggcccg caggtgctgg 240 gtgctggcag gaccccgcgc cgcacatccc ctgttcgcca ggctccaggg tgcagctgcc 300 accggtgtgc gagaccttgg gaacgactcg cagcggcgtc ccgcggcgac cgggcgctca 360 gaagtatgga agctcctagg gctggtgcgc cccgagcgcg ggagactgtc agctgcagtt 420 aagcttatgt tggagttatt gccaacagca gtggaggggg tatcgcaggc ccagatcacc 480 ggacgtccgg agtggatctg gctagcgctc ggtacggcgc taatgggact cgggacgctc 540 tatttcctcg tgaaagggat gggcgtctcg gacccagatg caaagaaatt ctacgccatc 600 acgacgctcg tcccagccat cgcgttcacg atgtacctct cgatgctgct ggggtatggc 660 ctcacaatgg taccgttcgg tggggagcag aaccccatct actgggcgcg gtacgctgac 720 tggctgttca ccacgccgct gttgttgtta gacctcgcgt tgctcgttga cgcggatcag 780 ggaacgatcc ttgcgctcgt cggtgccgac ggcatcatga tcgggaccgg cctggtcggc 840 gt; ctgtacatcc tgtacgtgct gttcttcggg ttcacctcga aggccgaaag catgcgcccc 960 gaggtcgcat ccacgttcaa agtactgcgt aacgttaccg ttgtgttgtg gtccgcgtat 1020 cccgtcgtgt ggctgatcgg cagcgaaggt gcgggaatcg tgccgctgaa catcgagacg 1080 ctgctgttca tggtgcttga cgtgagcgcg aaggtcggct tcgggctcat cctcctgcgc 1140 agtcgtgcga tcttcggcga agccgaagcg ccggagccgt ccgccggcga cggcgcggcc 1200 gcgaccagcg accgaattct gcagtcgacg gtaccgcggg cccgggatcc aatggatagc 1260 actgagaacg tcatcaagcc cttcatgcgc ttcaaggtgc acatggaggg ctccgtgaac 1320 ggccacgagt tcgagatcga gggcgtgggc gagggcaagc cctacgaggg cacccagacc 1380 gccaagctgc aagtgaccaa gggcggcccc ctgcccttcg cctgggacat cctgtccccc 1440 cagttcttct acggctccaa ggcgtacatc aagcaccccg ccgacatccc cgactacctc 1500 aagcagtcct tccccgaggg cttcaagtgg gagcgcgtga tgaacttcga ggacggcggc 1560 gtggtgaccg tgacccagga ctcctccctg caggacggca ccctcatcta ccacgtgaag 1620 ttcatcggcg tgaacttccc ctccgacggc cccgtaatgc agaagaagac tctgggctgg 1680 gagccctcca ctgagcgcaa ctacccccgc gacggcgtgc tgaagggcga gaaccacatg 1740 gcgctgaagc tgaagggcgg cggccactac ctgtgtgagt tcaagtccat ctacatggcc 1800 aagaagcccg tgaagctgcc cggctaccac tacgtggact acaagctcga catcacctcc 1860 cacaacgagg actacaccgt ggtggagcag tacgagcgcg ccgaggcccg ccaccacctg 1920 ttccagtag 1929 <210> 48 <211> 642 <212> PRT <213> Artificial Sequence <220> N140 (ABCB10) -Bacteriorhodopsin-E2-Crimson: Protein <400> 48 Met Arg Ala Pro Ser Ala Arg Ala Leu Leu Leu Ile Pro Arg Arg Gly   1 5 10 15 Pro Ala Val Arg Ala Trp Ala Pro Ala Val Ser Ser Arg Ile Trp Leu              20 25 30 Ala Ser Glu Trp Thr Pro Leu Val Arg Ala Trp Thr Ser Leu Ile His          35 40 45 Lys Pro Gly Ser Gly Leu Arg Phe Pro Ala Pro Leu Ser Gly Leu Pro      50 55 60 Gly Gly Val Gly Gln Trp Ala Thr Ser Ser Gly Ala Arg Arg Cys Trp  65 70 75 80 Val Leu Ala Gly Pro Arg Ala Ala His Pro Leu Phe Ala Arg Leu Gln                  85 90 95 Gly Ala Ala Ala Thr Gly Val Arg Asp Leu Gly Asn Asp Ser Gln Arg             100 105 110 Arg Pro Ala Ala Thr Gly Arg Ser Glu Val Trp Lys Leu Leu Gly Leu         115 120 125 Val Arg Pro Glu Arg Gly Arg Leu Ser Ala Ala Val Lys Leu Met Leu     130 135 140 Glu Leu Leu Pro Thr Ala Val Glu Gly Val Ser Gln Ala Gln Ile Thr 145 150 155 160 Gly Arg Pro Glu Trp Ile Trp Leu Ala Leu Gly Thr Ala Leu Met Gly                 165 170 175 Leu Gly Thr Leu Tyr Phe Leu Val Lys Gly Met Gly Val Ser Asp Pro             180 185 190 Asp Ala Lys Lys Phe Tyr Ala Ile Thr Thr Leu Val Pro Ala Ile Ala         195 200 205 Phe Thr Met Tyr Leu Ser Met Leu Leu Gly Tyr Gly Leu Thr Met Val     210 215 220 Pro Phe Gly Gly Glu Gln Asn Pro Ile Tyr Trp Ala Arg Tyr Ala Asp 225 230 235 240 Trp Leu Phe Thr Thr Pro Leu Leu Leu Leu Asp Leu Ala Leu Leu Val                 245 250 255 Asp Ala Asp Gln Gly Thr Ile Leu Ala Leu Val Gly Ala Asp Gly Ile             260 265 270 Met Ile Gly Thr Gly Leu Val Gly Ala Leu Thr Lys Val Tyr Ser Tyr         275 280 285 Arg Phe Val Trp Trp Ala Ile Ser Thr Ala Ala Met Leu Tyr Ile Leu     290 295 300 Tyr Val Leu Phe Phe Gly Phe Thr Ser Lys Ala Glu Ser Met Arg Pro 305 310 315 320 Glu Val Ala Ser Thr Phe Lys Val Leu Arg Asn Val Thr Val Val Leu                 325 330 335 Trp Ser Ala Tyr Pro Val Val Trp Leu Ile Gly Ser Glu Gly Ala Gly             340 345 350 Ile Val Pro Leu Asn Ile Glu Thr Leu Leu Phe Met Val Leu Asp Val         355 360 365 Ser Ala Lys Val Gly Phe Gly Leu Ile Leu Leu Arg Ser Ser Ala Ile     370 375 380 Phe Gly Glu Ala Glu Ala Pro Glu Pro Ser Ala Gly Asp Gly Ala Ala 385 390 395 400 Ala Thr Ser Asp Arg Ile Leu Gln Ser Thr Val Pro Arg Ala Arg Asp                 405 410 415 Pro Met Asp Ser Thr Glu Asn Val Ile Lys Pro Phe Met Arg Phe Lys             420 425 430 Val His Met Glu Gly Ser Val Asn Gly His Glu Phe Glu Ile Glu Gly         435 440 445 Val Gly Glu Gly Lys Pro Tyr Glu Gly Thr Gln Thr Ala Lys Leu Gln     450 455 460 Val Thr Lys Gly Gly Pro Leu Pro Phe Ala Trp Asp Ile Leu Ser Pro 465 470 475 480 Gln Phe Phe Tyr Gly Ser Lys Ala Tyr Ile Lys His Pro Ala Asp Ile                 485 490 495 Pro Asp Tyr Leu Lys Gln Ser Phe Pro Glu Gly Phe Lys Trp Glu Arg             500 505 510 Val Met Asn Phe Glu Asp Gly Gly Val Val Thr Val Thr Gln Asp Ser         515 520 525 Ser Leu Gln Asp Gly Thr Leu Ile Tyr His Val Lys Phe Ile Gly Val     530 535 540 Asn Phe Pro Ser Asp Gly Pro Val Met Gln Lys Lys Thr Leu Gly Trp 545 550 555 560 Glu Pro Ser Thr Glu Arg Asn Tyr Pro Arg Asp Gly Val Leu Lys Gly                 565 570 575 Glu Asn His Met Ala Leu Lys Leu Lys Gly Gly Gly His Tyr Leu Cys             580 585 590 Glu Phe Lys Ser Ile Tyr Met Ala Lys Lys Pro Val Lys Leu Pro Gly         595 600 605 Tyr His Tyr Val Asp Tyr Lys Leu Asp Ile Thr Ser His Asn Glu Asp     610 615 620 Tyr Thr Val Glu Gln Tyr Glu Arg Ala Glu Ala Arg His His Leu 625 630 635 640 Phe Gln        

Claims (11)

ABCB10 (ATP-binding cassette sub-family B member 10) A recombinant nucleic acid molecule for the modulation of mitochondrial activity, in which a gene encoding a protein and a gene encoding a rhodopsin protein are operably linked.
2. The recombinant nucleic acid molecule according to claim 1, wherein the rhodopsin is selected from the group consisting of channelrodoxine 2, bacteriorhodopsin, halorodoxine, and mutants thereof.
The recombinant nucleic acid molecule according to claim 1, wherein the recombinant nucleic acid molecule comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 19, SEQ ID NO: 21 and SEQ ID NO:
The recombinant nucleic acid molecule according to claim 1,
Wherein the recombinant nucleic acid molecule further comprises a gene encoding a fluorescent protein linked to a gene encoding the rhodopsin protein.
The recombinant nucleic acid molecule according to claim 4, wherein the recombinant nucleic acid molecule is selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 45 and SEQ ID NO: 47, respectively.
The recombinant nucleic acid molecule according to claim 1, wherein the recombinant nucleic acid molecule regulates mitochondrial activity by regulating expression of the rhodopsin protein upon application of a light stimulus.
A recombinant vector comprising the recombinant nucleic acid molecule according to claim 1.
A composition for modulating mitochondrial activity, comprising the recombinant nucleic acid molecule according to claim 1.
A pharmaceutical composition for preventing or treating diseases caused by decreased mitochondrial activity comprising a recombinant nucleic acid molecule according to any one of claims 1 to 6.
10. The pharmaceutical composition according to claim 9, wherein the disease is selected from the group consisting of diabetes, cancer, arteriosclerosis, heart failure, obesity, Alzheimer's, Parkinson's and Huntington's disease.
A method of modulating mitochondrial activity using light in an animal, plant, microorganism or in vitro, but not human, comprising the steps of:
(1) preparing a recombinant vector by inserting the nucleic acid molecule into a surface expression vector containing a restriction enzyme site capable of inserting a recombinant nucleic acid molecule according to any one of claims 1 to 6;
(2) transforming a host cell containing mitochondria with the recombinant vector to obtain a transformant; And
(3) culturing the transformant with light stimulation.

Images