KR20150091652A - Novel dehydrin gene from Cerastium arcticum and use thereof - Google Patents

Abstract

The present invention relates to a novel dehydrin gene derived from a polar microorganism and a dehydrin peptide coded thereby. In addition, the present invention relates to a composition for increasing stress resistance and a composition for increasing fermentation activity, which comprise the gene and the dehydrin peptide as active ingredients. According to the present invention, the dehydrin peptide and a polynuleotide for coding the same can be usefully used in production of biodiesel by significantly increasing resistance to non-biological stress of a cell and significantly increasing an output of ethanol in yeast.

Description

Novel dehydrin gene from Cerastium arcticum and use thereof.

The present invention relates to a novel polar microbial-derived dihydrin gene and a dihydrin protein encoded thereby.

The present invention also relates to a composition for increasing stress resistance and a composition for increasing fermentation activity comprising the gene and a dihydrin peptide as an effective ingredient.

As the fossil energy, which has been the mainstream of the global energy market in recent years, began to run down, many kinds of alternative energy began to be developed. One of them is currently being studied by many researchers for the production of bioethanol using biological methods and it is expected that it will be possible to substitute bioethanol for the part that relies on conventional fossil fuel in transportation fuel.

The US, France, and the EU, which are the most developed countries in the world, currently use E5, E10, and E15 mixed with 5 to 15% ethanol in gasoline. Brazil, which is a major exporter of bioethanol, mixes 25% ethanol with gasoline E25 as the main transport fuel.

Nevertheless, the price competitiveness of bioethanol production and distribution is far lower than that of fossil fuels. As the reserves of fossil fuels gradually decreased and the oil price policy of oil producing countries increased, the economical efficiency of bioethanol increased slightly in 2004, but the price competitiveness of bioethanol became a hot topic of bioethanol production again as oil prices stabilized.

Two methods are proposed to increase the economical efficiency of bioethanol. As a method to use lignocellulose, which is much cheaper than starch, which is the main substrate, as a main substrate of ethanol fermentation, the development of strains capable of using xylose, galactose, mannose and arabinose, which are degradation products of lignocellulose, And the development of a lignocellulase group (group), which is a biodegradation enzyme, rather than hydrolysis using biodegradable enzymes, has been carried out. In order to reduce the cost in the entire process of bioethanol fermentation, Be done

Accordingly, the present inventors have made efforts to develop a genetic resource capable of increasing the production efficiency of bioethanol, and as a result, Cerastium arcticum species-derived dihydrin gene. The present inventors confirmed that this gene imparts abiotic stress resistance to the host cell and remarkably improves the alcohol fermentation efficiency, thus completing the present invention.

One aspect of the present invention relates to a method for producing microorganism Cerastium arcticum species derived dehydrin peptides and polynucleotides encoding the same.

Another aspect of the present invention is to provide a composition for increasing stress resistance, comprising the above peptide or polynucleotide as an active ingredient.

Another aspect of the present invention is to provide a composition for increasing fermentation activity comprising the peptide or polynucleotide as an active ingredient and a method for producing alcohol using the same.

One aspect of the present invention is to provide a dihydrin peptide derived from the polar microorganism Cerastium arcticum species comprising the amino acid sequence of SEQ ID NO: 1.

Dehydrin (DHN) is a group of proteins expressed in plants under low-temperature or drought-stress conditions. They are hydrophilic and have heat-resistant activity.

The above-mentioned dihydrin peptide of the present invention can be obtained from Cerastium < RTI ID = 0.0 > (Dasan Korean Arctic Research Station) The peptide derived from arcticum L. (Caryophyllaceae) is characterized by being composed of the amino acid sequence of SEQ ID NO: 1.

Another aspect of the present invention provides a polynucleotide encoding said dihydrin peptide.

The " polynucleotide " is a polymer of epoxyribonucleotides or ribonucleotides present in single-stranded or double-stranded form. RNA genomic sequences, DNA (gDNA and cDNA) and RNA sequences transcribed therefrom, and include analogs of natural polynucleotides unless otherwise specified.

The polynucleotide encoding the dihydrin peptide may preferably consist of the nucleotide sequence of SEQ ID NO: 2.

The polynucleotide includes a nucleotide sequence encoding the dihydrin peptide as well as a complementary sequence to the sequence. The complementary sequence includes not only perfectly complementary sequences but also substantially complementary sequences. , Which means a sequence that can hybridize under stringent conditions known in the art, for example, to a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1.

The polynucleotide may also be modified. Such modifications include addition, deletion or non-conservative substitution or conservative substitution of nucleotides. The polynucleotide encoding the amino acid sequence is also interpreted to include a nucleotide sequence that exhibits substantial identity to the nucleotide sequence. The above substantial identity is determined by aligning the nucleotide sequence with any other sequence as closely as possible, and analyzing the aligned sequence using algorithms commonly used in the art to obtain a sequence having at least 80% homology, At least 90% homology or at least 95% homology.

Another aspect of the present invention provides a recombinant vector comprising the polynucleotide.

The term "vector" means means for expressing a gene of interest in a host cell. For example, viral vectors such as plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors, and adeno-associated viral vectors. The vector that can be used as the recombinant vector may be a plasmid (for example, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series, and pUC19), phage (e.g.,? gt4? B,? -charon,?? z1 and M13) or viruses (e.g., CMV, SV40 and the like).

The polynucleotide encoding the amino acid sequence of SEQ ID NO: 1 in the recombinant vector may be operatively linked to a promoter. The term "operatively linked" refers to the functional linkage between a nucleotide expression control regulatory sequence (e.g., a promoter sequence) and another nucleotide sequence. Thus, the regulatory sequence may thereby regulate transcription and / or translation of the other nucleotide sequence.

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be any conventional vector used in the art to express foreign proteins in plants, animals or microorganisms. The recombinant vector may be constructed by a variety of methods known in the art.

The recombinant vector may be constructed with prokaryotic or eukaryotic cells as hosts. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (for example, pL? Promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , A ribosome binding site for initiation of translation, and a transcription / translation termination sequence. When the eukaryotic cell is used as a host, the origin of replication that functions in the eukaryotic cells contained in the vector is f1 replication origin, SV40 replication origin, pMB1 replication origin, adeno replication origin, AAV replication origin, CMV replication origin, and BBV replication origin But is not limited thereto. Also, promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus (CMV) promoter and the tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

Yet another aspect of the present invention provides a host cell transformed with the recombinant vector.

The host cell can be any host cell known in the art, and examples thereof include animals, plants, fungi, bacteria, and viruses. Examples of prokaryotic cells include E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X1776, E. coli W3110, Bacillus subtilis, Bacillus strains such as Bacillus thuringiensis, and Enterobacteria and strains such as Salmonella typhimurium, Serratia marcesensus and various Pseudomonas sp., And when transforming eukaryotic cells, yeast (Saccharomyce cerevisiae) , Insect cells, plant cells and animal cells such as SP2 / 0, Chinese hamster ovary CHO, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN And MDCK cell lines.

The insertion of a polynucleotide or a recombinant vector containing the polynucleotide into a host cell can be carried out using an insertion method well known in the art. For example, when the host cell is a prokaryotic cell, the CaCl ₂ method or the electroporation method can be used. When the host cell is a eukaryotic cell, the microinjection method, the calcium phosphate precipitation method, the electroporation method, Liposome-mediated transfection methods, and gene bombardment, but the present invention is not limited thereto. When E. coli and other microorganisms are used, the productivity is higher than that of animal cells, but it is not suitable for intact Ig-type antibody production due to glycosylation problem. However, production of antigen-binding fragments such as Fab and Fv Can be used.

The method of selecting the transformed host cells can be easily carried out according to a method widely known in the art by using a phenotype expressed by a selection marker. For example, when the selection mark is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

Yet another aspect of the present invention provides a composition for increasing stress resistance, comprising the dihydrin peptide or a polynucleotide encoding the same as an active ingredient.

The stress may be an abiotic stress selected from the group consisting of moisture, salinity, low temperature, high temperature, osmotic pressure, oxidation, reduction, alcohol and starvation. The stress may also be stress on cells selected from the group consisting of animals, plants, fungi, bacteria and viruses. Most preferably, the stress may be stress on yeast cells.

In the embodiment of the present invention, in the case of the yeast transformed with the polynucleotide encoding the dihydrin of the present invention, in the presence of H ₂ O ₂ , MD, t-MD, and t-BOOH, It was confirmed that it exhibited remarkably high resistance to stress.

In addition, the stress resistance may be due to the inhibitory activity of active oxygen, or the molecular chaperone activity.

Yet another aspect of the present invention provides a composition for increasing fermentation activity comprising the dihydrin peptide or a polynucleotide encoding the same as an active ingredient. The fermentation may be an alcohol fermentation of yeast.

In one embodiment of the present invention, the fermentation using yeast transformed with CaDHN of the present invention produced significantly higher ethanol production than the wild type cells, and the residual glucose content was remarkably decreased.

Accordingly, the present invention provides a method for preparing a yeast cell, comprising: (1) inserting a polynucleotide encoding the dihydrin into yeast cells; And (2) culturing the yeast cell.

Such insertion does not limit the method as long as it can deliver the polynucleotide encoding the dihydrin to the yeast cell, and examples thereof are as described above.

In addition, the alcohol may be ethanol.

In the fermentation, the fermentation source may be a sugar, and the sugar may be a monosaccharide, a disaccharide or a polysaccharide. Further, it may be 2 to 9 carbon atoms depending on the number of carbon atoms. An example of a diose is glycol aldehyde; Examples of triose are ketotriose, ketotriose, and the like. Examples of tetrads include ketotetros, aldotetros, and the like; Examples of Pentose include ketopentose (Ribulos, xylulose), aldopentos (ribose, arabinose, xylose, ricosource), deoxy sugar (deoxyribose); Examples of Hexose include, but are not limited to, ketohexose (psicose, fructose, sorbose, tagatose), aldohexose (alos, altrose, glucose, mannose, gulose, Galactose, talos, deoxy sugar (fucose, fuculose, rhamnose), and the like.

The dihydrin peptide according to the present invention and the polynucleotide encoding the same remarkably increase the resistance to abiotic stress of the cells and significantly increase the ethanol production in the yeast so that they are very useful for the production of biodiesel .

FIG. 1 shows the results of analysis of the amino acid sequence and characteristics of CaDHN of the present invention.
The S segment containing the eight serine residues conserved in Figure 1A is shown in yellow and the five K segments are shown in green.
In the upper panel of FIG. 1B, SK _n -type DHN was modeled in the conserved region of CaDHN and the lower panel. K: K-segment, S: S-segment, Φ: Φ segment, n is the number of K segments.
FIG. 2 is a graph showing the expression of the CaDHN gene and the stress resistance of transformed yeast cells. FIG.
Figure 2a shows CaDHN expression (left panel) and final CaDHN expression (right panel) after 5 hours of incubation. The results are shown in Western blotting using an anti-Dhhn antibody. S. cerevisiae-derived Tub antibody was used as a loading control.
Figure 2b shows CaDHN-mediated stress resistance in the presence of extracellular stimulation.
FIG. 2C shows the results of the redox state analysis using DCFHDA (upper panel) and cell morphology (lower panel) in the presence of 25 mM H ₂ O ₂ for 1 hour.
FIG. 3 is a graph showing the efficacy and cell viability in CaDHN-expressing yeast.
4 is a graph showing the activity of ROS scavenging activity and molecular chaperone activity of CaDHN.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example  One: CaDHN - expressing recombinant yeast and E. coli. coli Of design

C. arcticum L. (Caryophyllaceae) was obtained from Brogger-Halvoya (N75 55 ", E11 54") of Svalbard, Dasan Korean Arctic Research Station, Korea. Total RNA was isolated from the leaves of C. arcticum using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany). cDNA probes were synthesized using RT-PCR (reverse transcription-PCR) premix kit (Bioneer, Daejeon, Korea). CaDHN coding region is ExTaq polymerase (Takara Bio Inc., Tokyo, Japan ) were amplified from the cDNA by PCR using, 5'-ACG GCTAGC ATGTCGAACTTACACCCAACC-3 ' and 5'-AGC TTAGTAACCCTTGTGAGCTTTATC GGATCC-3', respectively the sense primer And antisense primers. The underlined sequences represent NheI and BamHI restriction enzyme sites. The PCR reaction conditions are as follows.

Initial denaturation is 30 minutes at 94 ° C for 3 minutes, 94 ° C for 30 seconds, 54 ° C for 30 seconds, 72 ° C for 1 minute, and final extension at 72 ° C for 7 minutes.

The PCR product was purified using Gel Extraction kit (Nucleogen, Siheung, Korea) and inserted into the TOPO TA cloning vector (Invitrogen, Carlsbad, USA). The cloned plasmid was sequenced using a T7 primer set to confirm that no mutation occurred by PCR and then digested with NheI and BamHI restriction enzymes. The digested plasmid DNA fragment was ligated into E. coli expression vector pKM260 (Euroscarf, Frankfurt, Germany) and the resulting plasmid was designated pKM260 :: CaDHN. In addition, the TOPO TA cloning vector containing the CaDHN gene was digested with EcoRI restriction enzyme, and the plasmid DNA fragment was then ligated into the enzyme expression vector p426GPD (Euroscarf, Frankfurt, Germany). The cloned plasmids were sequenced using a PF primer (5'-TGTTTTCTTCACCAATCAG-3 ') annealed to the GPD1 (glyceraldehyde-3-phosphate dehydrogenase) promoter region, which was sequenced using appropriate gene ligation and gene direction ). The resulting plasmid was designated p426GPD :: CaDHN. Each plasmid DNA was amplified in LB (Luria-Bertani) broth containing ampicillin (50 mL mL ^-1 ) using competent E. coli DH5α cells (Takara Bio Inc., Tokyo, Japan). Each plasmid DNA was isolated using a plasmid isolation kit (Nucleogen, Siheung, Korea) and the resulting plasmids were transformed into S. cerevisiae and E. coli (Table 1). S. cerevisiae BY4741 cells were cultured overnight in YPD broth (1% enzyme extract, 2% peptone, and 2% glucose), incubated in fresh YPD broth and incubated at about 600 nm (A ₆₀₀ ) until it reaches the ^{1.0 (1 × 10 7 cells mL} -1), with stirring (160 rpm), it was incubated at 30 ℃ for 4 hours. The resulting enzyme cells were then transformed with the p426GPD :: CaDHN plasmid according to the PEG / LiCl method (Gietz and Woods 2001). Transformed cells were grown in 0.192% yeast synthetic dropout agar medium (Sigma, St. Louis, USA) containing 0.67% yeast nitrogen base and no amino acid, ammonium sulfate, , And yeast synthetic dropout agar medium containing 2% glucose, and 2% agar. The samples were incubated at 30 DEG C for 3 days. Colonies grow on a medium without uracil. Transgenic strains (p426GPD or p426GPD :: CaDHN) were used in subsequent experiments. E. coli BL21 (DE3; Invitrogen, Carlsbad, USA) was transformed with the pKM260 :: CaDHN plasmid using CaCl ₂ -mediated method (Kim et al. Positive transformants ㎍mL 50 for 24 hours at 37 ℃ ^- were grown in LB agar plates containing ^1. A strain containing the transformed plasmid (pKM260 or pKM260 :: CaDHN) was used in subsequent experiments.

Example  2: Western Blot  analysis

E. coli and yeast cells were cultured in LB and YPD medium, respectively. From the mid-log phase ( _A600 = 4.0; OD = 0.6) or over time yeast cells, 20 mM HEPES, pH 7.4; 5% glycerol; 1 mM DTT (dithiothreitol); 1 mM PMSF phenylmethylsulfonyl fluoride (phenylmethylsulfonyl fluoride); And crude extracts were extracted with glass beads in lysis buffer containing EDTA ethylenediaminetetraacetic acid-free protease inhibitor cocktail (Roche Applied Science, Indianapolis, USA). Protein extracts were vortexed four times for 1 minute on ice at 2 minute intervals and then centrifuged at 13,000 rpm at 4 ° C for 20 minutes. In the case of E. coli, 0.5 mM IPTG (isopropyl- beta -Dthiogalactopyranoside) was treated with medium-logarithmic cells (A ₆₆₀ = 0.4) grown in LB broth in the presence of ampicillin (50 mL mL ^-1 ) And incubated for 3 hours. Followed by 50 mM sodium phosphate, pH 8.0; 0.3 M NaCl; 10 mM imidazole; 1 mM PMSF; And an EDTA-free protease inhibitor cocktail (Roche Applied Science, Indianapolis, USA). Each crude extract was collected by centrifugation at 13,000 rpm for 30 minutes at 4 ° C.

Protein concentrations of yeast and E. coli crude extracts were determined using Protein Dye Reagent (Bio-Rad, Hercules, USA), followed by 15% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) Respectively. After electrophoresis, the proteins were transferred by electrophoresis to polyvinyl difluoride (PVDF) membranes (Bio-Rad, Hercules, USA) at 4O < 0 > C for 3 hours at 180 mA. Subsequently, the membranes were incubated at room temperature for 1 hour in blocking buffer containing 0.02% sodium azide in 5% skim milk and TBST (25 mM Tris-HCl, pH 7.4; 150 mM NaCl; and 0.05% Tween-20) Followed by overnight incubation at 4 ° C with anti-His tags (Invitrogen, Carlsbad, USA) and anti-DHN antibody diluted 1: 1,000 with blocking buffer. The blots were washed with TBST for 40 min (4 washes, each for 10 min), then horseradish peroxidase diluted 1: 2,000 to 1: 4,000 with blocking buffer absent sodium azide And anti-rabbit antibody (Santa Cruz Biotechnology, Santa Cruz, USA) conjugated with the anti-rabbit antibody for 1.5 hours at room temperature. After washing with TBST for 40 min, binding to the antibody was visualized using enhanced chemiluminescence Western blotting detection reagent (GE Healthcare, Piscataway, USA). Anti-S. cerevisiae tubulin and anti-E. The E. coli DnaJ (Santa Cruz Biotechnology, Santa Cruz, USA) antibody was used as a loading control for yeast and E. coli, respectively.

Example  3: Abiotic  ( abiotic ) Cell response to stress

Yeast cells grown in YPD broth until mid-logarithmic (A ₆₀₀ = 4.0) were incubated for 1 h at 160 rpm with 25 mM H ₂ O ₂ , 0.2 mM MD menadione (menadione, water insoluble form), 10 mM t -BOOH tert-butyl hydroperoxide, 5 M NaCl, 0.1 M ZnCl ₂ , 10 mM CuCl ₂ , 0.2% SDS, 50 mM CoCl ₂ , and 0.4 M lactic acid. It was then diluted 10-fold with fresh YPD broth. Then, 5 [mu] l of the diluted solution was loaded onto YPD agar (2% agar added YPD) plate, incubated at 30 [deg.] C for 2-3 days and then photographed. For freezing and thawing, yeast cell cultures (1.0 mL) were frozen at -70 ° C for 1 hour and allowed to thaw at room temperature for 1 hour. This process was repeated three times. Yeast cells in medium-logarithmic ( _A600 = 4.0) and stationary ( _A600 = 8.0) yeast cells were plated at various concentrations of ethanol (0, 12, 16, and 20%) for 1 hour With stirring, stepwise diluted with YPD broth, and then loaded onto YPD agar plates. All agar plates were incubated at 30 DEG C for 3 days.

Example  4: Analysis of morphological change and redox state

The morphological changes of the medium-log (A ₆₀₀ = 4.0) cells exposed to 25 mM H ₂ O ₂ for 1 hour were visualized using a x400 magnification fluorescent microscope (Nikon, Tokyo, Japan). To measure cytosolic ROS, medium-logarithmic cells were incubated with 50 μM DCFHDA (2 ', 7'-dichlorofluorescein diacetate, Invitrogen, Carlsbad, USA) at 30 ° C. for 20 minutes and resuspended in 25 mM H ₂ O ₂ for 1 hour, washed twice with PBS (pH 7.3 to pH 7.5) and resuspended in the same PBS buffer. Cells were loaded with a fluorescent probe and visualized with a fluorescence microscope (excitation wavelength, 488 nm; emission wavelength, 525 nm).

Example  5: Lab-level Batch  Fermentation ( Laboratory - scale batch fermentation )

Yeast cells were grown under aerobic fermentation conditions in a GY medium containing 20% glucose and 1% yeast extract at 30 ° C. for 84 hours or at 18 ° C. for 180 hours on a stirrer (160 rpm) . The alcohol concentration in the distillate after fermentation was determined as a percentage (v / v) using an alcohol liquid hydrometer (REF 503; Korins, Incheon, Korea). The residual total sugar concentration was measured using a N1 Hand-Held Refractometer (Atago, Tokyo, Japan). The cells were centrifuged at 3,000 rpm for 5 minutes at room temperature to remove cell debris, and alcohol and residual glucose concentration were obtained. Cells at various time points (24 and 72 hours) were harvested to determine cell viability during the fermentation process at 30 ° C., diluted stepwise to 10 ^{-9 with} YPD broth, and then plated on YPD agar plates with 5 μl of diluted The solution was loaded. Cells were incubated for 3 days at 30 < 0 > C and photographed. Cell viability was measured by streaking assay at low temperature fermentation (18 ℃). Briefly, cells were sampled at 24 and 180 hours, streaked on YPD agar plates, and incubated at 30 DEG C for 2-3 days.

Example  5: ROS  Cleaner ( scavenger ) And molecules Chaperone  ( chaperone ) In Similar Activity for In vitro Assay

For CaDHN protein purification, E. coli BL21 (DE3) cells containing the pKM260 :: CaDHN plasmid were incubated with LB medium supplemented with 50 ug mL- ¹ of ampicillin at 37 ° C with stirring (200 rpm). When the culture reached an intermediate logarithmic (A ₆₆₀ = 0.4), IPTG was added to a final concentration of 0.5 mM and the culture was incubated at 37 ° C for 3 hours. The cells were then centrifuged at 5,000 rpm for 10 min at 4 ° C and washed with cold PBS. The resulting cell pellet was resuspended in 50 mM sodium phosphate, pH 7.5; 0.3 M NaCl; 10 mM imidazole; 1 mM PMSF; EDTA-deficient protease inhibitor cocktail (Roche Applied Science, Indianapolis, USA); And lysosomes (0.3 mg mL ^-1 ; Sigma, St. Louis, USA). Suspended eggs were incubated on ice for 30 minutes and sonicated for cell destruction. For removal of cell debris, homogenate was centrifuged at 15,000 rpm for 30 minutes at 4 ° C, and the supernatant containing soluble protein was purified using IMAC (immobilized metal affinity chromatography) at 4 ° C. All subsequent steps were carried out at 4 ° C. The purified supernatant was loaded onto a column containing Ni-NTA affinity resin (Qiagen, Hilden, Germany) using gravity and the column was preequilibrated with lysis buffer free of lysozyme. The column was then washed twice with wash buffer (50 mM sodium phosphate, pH 7.5; 0.3 M NaCl; and 50 mM imidazole) and CaDHN protein bound to Ni-NTA resin was eluted with elution buffer (50 mM phosphate, pH 7.5 ; 0.3 M NaCl; and 0.25 M imidazole). The eluted CaDHN protein was filtered through a size-separation membrane. The CaDHN protein attached to the membrane was resuspended in cold 20 mM potassium phosphate, pH 7.2, containing 1 mM PMSF and protease inhibitory cocktail at 4 ° C. The purified CaDHN protein (2 [mu] g) was loaded on 15% SDS-PAGE, performed at 50 V, stained with CBB R-250 and discolored. ROS scavenging activity was measured using a ferrooxidation of xylenol-orange (FOX) reagent (Kim et al. 2011) containing 100 μM xylitol orange, 250 μM ammonium ferrous sulfate, 100 mM sorbitol and 25 mM sulfuric acid Respectively. 5 μg each of CaDHN and catalase (Sigma, Hercules, USA) was added to 17 μM H ₂ O ₂ solution, and the solution was incubated at 25 ° C for 15 minutes. Thereafter, 50 [mu] l of the reaction mixture was added to 950 [mu] l of FOX reagent. The mixture was then incubated at room temperature for 1 hour, followed by centrifugation to remove any coagulant before measurement of absorbance at 560 nm. The ROS scavenging activity was determined using an enzyme-free 17 [mu] M H ₂ O ₂ Solution was considered to be 100%.

Chaperone-like activity was also measured by analyzing the molecular chaperone activity of CaDHN. Catalase (1 μg; CAT; Sigma, Hercules, USA) and CaDHN solution (1 μg) were added to 50 mM potassium phosphate (pH 7.5) and heated for 15 minutes at 50 ° C. G6PDH containing catalase (1 μg) (Sigma, Hercules, USA) and Hsp90 (human heat shock protein 90; 1,, Sigma, Hercules, USA) were used as negative control and positive control, respectively. Was recovered at a specific time and the catalase activity was measured based on the absorbance at 240 nm for 1 min. The enzyme activity of the solution containing catalase alone was regarded as 100%.

Example  6: DHN  Multiple sequence alignment of amino acids ( Multiple sequence alignment )

CaDHN was aligned with the existing DHN sequence using the DNA Data Bank of Japan (DDBJ) ClustalW software ( http://clustalw.ddbj.nig.ac.jp/ ). The amino acid sequences used are as follows: C. arcticum (CaDHN; accession number ADM14335), Oryza sativa (OsDHN; accession number ABS44866), Phaseolus vulgaris (PvDHN; accession number AAB00554), Citrus paradisi (CpDHN; accession number AAN78125) , Accession number AAA33480), Glycine max (GmDHN; accession number AAB71225), Arabidopsis thaliana (AtDHN; accession number CAA62449), Citrus unshiu (CuDHN; accession number BAA74736), H. vulgare (HvDHN; accession number AAF01696), Zea mays ), And Nicotiana tabacum (NtDHN; accession number BAD13498).

Example  7: Statistical analysis

All experiments were performed at least 3 times independently and the results were expressed as mean and standard deviation. The spotting, streaking assay, redox status, and efficacy experiments were performed at least twice independently under the same conditions.

Example  8: CaDHN Identification of molecular properties of

Gene Fishing and genome walking analysis were performed on the dehydrin gene (CaDHN) from the leaf tissue of C. arcticum obtained from the Dasan Arctic Base, Korea. The CaDHN gene consists of 813 nucleotides and contains 270 amino acids. The expected molecular weight of the CaDHN enzyme is about 30 kDa. The sequence information of the dihydrin peptide is shown in SEQ ID NO: 1, and the sequence information of the polynucleotide encoding the peptide is shown in SEQ ID NO:

MSD (multiple sequence alignment) was performed on CaDHN in order to confirm the molecular characteristics of CaDHN enzyme with the previously disclosed OsDHN, CpDHN, AtDHN, CuDHN, HvDHN, ZmDHN, GmDHN, NtDHN and PvDHN sequences. Pairwise alignment of CaDHN and other DHNs was performed using the DDBJ ClustalW software.

The results are shown in Fig. MSA showed five K segment-like regions and one S segment-like region (Fig. 1a, b). Three K-nodes were highly conserved compared to other DHNs (Fig. 1a). CaDHN showed 43, 36, 40, 32, 46, 63, 47, 63, and 37% homology to OsDHN, CpDHN, AtDHN, CuDHN, HvDHN, ZmDHN, GmDHN, NtDHN and PvDHN respectively. These results indicate that CaDHN conserved domains and non-conserved domains are present.

Example  9: CaDHN - Composition of expressed recombinant yeast

The product according to CaDHN is shown in Example 8 and Fig. 1 above in terms of the structural difference at the molecular level as compared with the product of the other DHN gene. Based on these results, we analyzed whether the heterologous expression of CaDHN affects the resistance to abiotic stress in yeast cells. For this, cDNA containing the ORF (open reading frame) of the CaDHN gene was cloned into the yeast vector p426GPD to enable the constitutive expression of the target gene under the control of the yeast GPD1 promoter. Mumberg et al. 1995). Based on the digestion according to the EcoRI restriction enzyme, it was confirmed that the inserted DNA strand was about 840 bp. Sequencing was performed to confirm that the ORF orientation was correct in the constructed yeast and then inserted into S. cerevisiae BY4741 strain.

The information on the strains used in the present invention is shown in Table 1 below.

Effective expression of the CaDHN gene was confirmed by Western blotting, and the results are shown in Fig.

As shown in FIG. 2A (left panel), immunoblot analysis using anti-CaDHN antibody showed that the product of CaDHN-expressing transgenic (TG) yeast cells grown in mid-logarithm under normal conditions is a single band appear. Under the same conditions, wild type cells (WT) containing empty vectors were not identified.

In addition, the production of CaDHN was confirmed to be highest at 6 hours (A ₆₀₀ = 3.5 to 4.0) after incubation, after which the expression of the gene became saturated (Fig. 2a, right panel). Based on these results, yeast cells corresponding to A ₆₀₀ = 4.0 were used in subsequent experiments.

Example  10: Modified CaDHN - Expression of yeast cells Abiotic  Analysis of cell response to stress

In order to confirm whether the expression of CaDHN improves the cell response to environmental stress, cell viability of yeast cells (TG and WT) transformed with p426GPD plasmid or vector containing CaDHN gene was analyzed. The response to stress was measured based on the sporting assay.

The results are shown in FIG. 2B. TG cells recovered much faster than WT cells in the presence of exogenous stimuli including H ₂ O ₂ , MD, t-BOOH, NaCl, ZnCl ₂ , freezing and thawing, whereas CuCl ₂ , SDS, and And more sensitive for CoCl ₂ (FIG. 2B). There was no difference between TG and WT cells under normal conditions.

To support this result, growth kinetics was performed. TG cells showed better adaptability than WT cells in the presence of H ₂ O ₂ , MD, t-MD, and t-BOOH.

In addition, it was determined whether the stress resistance due to CaDHN expression in TG cells improves redox homeostasis. The redox state was determined at the hydroperoxide level of the cells, which was determined using a cytosolic oxidant sensitive probe DCFHDA. The oxidative conversion of DCFHDA to the strong fluorescent compound DCF (dichlorofluorescein) was measured in the presence or absence of 25 mM H ₂ O ₂ .

The results are shown in FIG. 2C. As shown in FIG. 2C, the fluorescence of DCF was increased in both WT and TG cells at 25 mM H ₂ O ₂ for 1 hour, but intracellular hydroperoxide intensity was stronger in WT cells than in TG cells ( 2c). Under oxidative stress conditions by H ₂ O ₂ , relaxation of the redox state was inversely proportional to cell recovery. In addition, non-stained cells were imaged using a fluorescence microscope for comparison with fluorescent staining. Through morphological analysis, morphological differences between WT and TG cells were confirmed under oxidative stress conditions, but no difference was observed under normal conditions.

SEM (scanning electron microscope) and TEM (transmission electron microscope) analysis were performed to analyze the difference of oxidized cells. Although the morphology of WT and TG cells was not affected before treatment with H ₂ O ₂ , it was confirmed that WT cells were more significantly modified than TG cells after 60 minutes of treatment with H ₂ O ₂ Respectively. In the TEM analysis, the cell damage was significantly higher in WT cells than in TG cells in the presence of H ₂ O ₂ . There was no difference between WT and TG cells under normal conditions.

Therefore, these results suggest that the expression of CaDHN in yeast cells is related to the maintenance of intracellular redox homeostasis and the maintenance of morphological characteristics through the reduction of hydroperoxide caused by H ₂ O ₂ Thereby imparting resistance.

Example  11: Batch  Fermentation ( batch fermentation ) Conditions CaDHN  Identification of the effect of expression

First, the response to various concentrations of ethanol was investigated. Group (log phase) the yeast cell log (A ₆₀₀ = 4.0) or stationary phase (stationary phase) were cultured to (A ₆₀₀ = 8.0). Then exposed to 12, 16, and 20% ethanol with stirring for 1 hour, followed by sequential, spotting on YPD agar plates.

The results are shown in Fig. As shown in FIG. 3A, the response of TG yeast cells exposed to different ethanol at both the logger and the stator was higher than that of WT cells, and the response was proportional to concentration and phase (FIG. 3A ). In particular, ethanol adaptation in TG cells was more visible in the log than in the stasis. CaDHN-expressing TG cells are resistant to higher ethanol concentration and ROS-induced oxidative stress than WT cells, suggesting that glucose-based laboratory-scale batch fermentation in GY medium using TG cells or WT yeast cells can be performed under aerobic conditions 30 and 18 < 0 > C.

The TG and WT cells at 30 ℃, which is the temperature commonly used in industrial fermentation, showed a great difference in the alcohol yield and residual glucose content. In the case of fermentation at 30 ° C. for 84 hours, the alcohol yield of TG cells was found to be about 23% higher than that of WT cells. The final alcohol concentration was 13.3% (0.63 ± 0.03 gg ^-1 ) and 10.2% (0.48 ± 0.04 gg ^-1 ) in TG and WT cells, respectively. The residual glucose content was inversely proportional to the alcohol concentration yield (Fig. 3B). In addition, WT and TG cells during fermentation showed a large difference in cell viability. In particular, in the culture for 84 hours in the GY medium, the TG cells exhibited a remarkably high cell survival rate as compared with the WT cells (FIG. 3C). Similar results were obtained between WT and TG cells at a low temperature of 18 ° C. Although the same fermentation medium was used, the alcohol concentration and residual glucose concentration were significantly different between WT and TG cells. In particular, the yields of alcohols produced from TG cells were about 30% higher than those produced from WT cells. The final alcohol concentrations produced in TG and WT cells after fermentation at 18 ° C for 180 hours were 13.2% (0.62 ± 0.04 gg ^-1 ) and 9.4% (0.44 ± 0.02 gg ^-1 ) (FIG. 3D). In addition to the yield of fermentation, TG cells were found to be more resistant under the same fermentation conditions as WT cells (Fig. 3E).

Thus, these results indicate that the expression of CaDHN improves the ability to culture at medium or low temperatures, which is a very important factor in increasing the alcohol yield in TG cells during fermentation.

Example  12: in in vitro CaDHN of ROS  cleaning ( scavenging ) And molecules Chaperone - Identification of similar activities

To analyze the molecular characteristics of CaDHN, a combined His-CaDHN fusion construct was developed and transformed into E. coli BL21 (DE3) cells. Its expression was confirmed by Western blot using anti-His tag and anti-Dhn antibody.

The results are shown in Fig. As shown in Figure 4a, no signal was observed in CaDHN-expressing E. coli (TF) cells, whereas in the wild type (WT) control cells containing the empty vector (pKM260) under the same conditions (Fig. 4A). CaDHN protein was purified by IMAC method using Ni-NTA resin. The protein showed the same molecular weight in the presence or absence of DTT (Fig. 4b) and thus was found to be in monomeric form.

To determine whether CaDHN plays a role as a ROS scavenger in transforming H ₂ O ₂ to H ₂ O in vitro, the level of hydroperoxide was analyzed spectrophotometrically using FOX assay. This is based on the formation of color due to oxidation of ferrous ions to ferric ions by hydroperoxides under acidic conditions. The activity of CaDHN was evaluated in comparison with that of CAT (catalase), and the results are shown in FIG. 4C.

As shown in Figure 4c, the absorbance at CaDHN solution (1 ㎍) containing 17 ㎛ H ₂ O ₂ is 17 ㎛ H ₂ O ₂ The absorbance of the CaDHN solution was two times higher than that of the CAT solution. The absorbance of the CAT solution (1 ㎍) containing 17 쨉 m H ₂ O ₂ was almost similar to the blank value obtained from 20 mM potassium phosphate (pH 7.2) alone. These results indicate that CaDHN can act as a ROS scavenger to transform H ₂ O ₂ to H ₂ O.

It was also confirmed whether CaDHN had a molecular chaperone-like activity that blocked protein inactivation at high temperature (50 ° C). The result is shown in Fig. 4D.

As shown in FIG. 4d, the CAT activity in the solution containing CaDHN was about three times higher than the activity of CAT in the solution without CaDHN. Unlike Hsp90, which was used as a positive control for molecular chaperone-like activity, CaDHN stabilized CAT by slowing the rate constant for thermal inactivation. On the other hand, the activity of CAT in solutions containing G6PDH used as a negative control was similar to the CAT activity in solutions without added protein (Fig. 4d). The thermoprotective activity of CaDHN is due to the transient interaction of CaDHN with the CAT comformer, which can be either natural-like or reversible among active assays.

Thus, the results show that CaDHN acts as a ROS scavenger to neutralize H ₂ O ₂ and a molecular chaperone to mitigate heat-induced protein inactivation, making it a very important molecule to perform various functions in cell defense systems .

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Novel dehydrin gene from Cerastium arcticum and use thereof <130> 1-80 <160> 2 <170> Kopatentin 2.0 <210> 1 <211> 270 <212> PRT <213> Artificial Sequence <220> Dehydrin peptides sequence <400> 1 Met Ser Asn Leu His Pro Thr Gly Gly Glu Thr Glu Thr Thr Asn Thr   1 5 10 15 Asp Arg Gly Leu Phe Gly Phe Gly Lys Lys Thr Glu Thr Pro Val Ala              20 25 30 Thr Pro Thr Glu Pro Pro His Lys Pro Thr Leu Thr Glu Lys Leu His          35 40 45 Arg Ser Gly Ser Ser Ser Ser Ser Ser Asp Glu Glu Val Ile Glu      50 55 60 Asn Gly Ala Lys Ile Arg Lys Pro Arg Arg Lys Gly Ile Ala Gly Lys  65 70 75 80 Ile Lys Asp Lys Leu Pro Gly Gly His Lys Asp Glu Tyr Glu Thr Ala                  85 90 95 Thr Pro Ile Ala Ala Gly Glu Tyr Tyr His Gln Glu Pro Asn Lys His             100 105 110 Ala Ser Asp Arg Gly Val Ala Glu Lys Ile Lys Glu Lys Leu Pro Gly         115 120 125 Gly His Lys Asp Glu Tyr Gly Thr Ala Pro Thr Gly Asp His Cys His     130 135 140 Gln Glu Gln Asn Lys His Ala Ser Glu Met Gly Ala Ala Glu Lys Ile 145 150 155 160 Lys Asp Lys Leu Pro Gly Gly Gln Lys Asp Glu Tyr Gly Thr Ala Pro                 165 170 175 Thr Gly Asp His Tyr His Arg Asp Gln Asn Lys His Thr Ala Ala Gly             180 185 190 Asn Thr His Tyr Pro Glu Gly Asn Lys Gly Phe Val Gly Asn Val Lys         195 200 205 Asp Lys Leu Pro Gly Asn Gln Thr Asp Val Asn His His Gln Gln Gln     210 215 220 Gln Gln His Pro Ala Val His Val Ser Gln Gln Ala Val Gln Glu Pro 225 230 235 240 His His Glu Lys Lys Gly Leu Leu Asp Asn Ile Lys Asp Lys Met Pro                 245 250 255 Gly Gly His Lys Asp Asp Ala Asp Lys Ala His Lys Gly Tyr             260 265 270 <210> 2 <211> 813 <212> DNA <213> Artificial Sequence <220> <223> dehydrin nucleotides sequence <400> 2 atgtcgaact tacacccaac cggaggcgaa accgagacca ctaatactga tagaggcctg 60 tttggcttcg gtaagaagac ggaaaccccc gtcgccaccc cgactgagcc accacacaag 120 cctactctca cggagaagct tcaccgctcg ggcagtagta gctctagctc gtcagatgag 180 gaggtaatag aaaatggtgc gaagattagg aagccgagga ggaagggaat agcagggaaa 240 atcaaggaca agcttccggg tggtcacaag gatgaatacg agactgcgac tcctattgct 300 gcgggtgagt actatcacca ggagccgaac aagcacgctt cagacagggg agtagcggag 360 aagatcaagg aaaagttacc aggcggtcac aaggatgaat acgggacagc gcctaccggt 420 gaccactgcc accaggagca gaacaagcac gcttctgaga tgggtgcggc ggagaaaatc 480 aaggacaagt tgccaggcgg acagaaggat gaatacggga ctgcgcctac tggcgaccac 540 taccaccggg accagaacaa gcatactgcg gcaggaaaca cgcattaccc cgagggaaac 600 aaggggtttg ttggcaatgt taaggataaa ttgccgggaa atcagacaga cgtgaaccat 660 caccagcagc agcaacagca cccggctgtt catgtttcac aacaggcggt ccaggagccg 720 catcatgaga agaaagggct cttagacaac attaaggaca agatgcccgg cggccacaag 780 gatgatgctg ataaagctca caagggttac taa 813

Claims (14)

A dihydrin peptide derived from the Polar microorganism Cerastium arcticum species consisting of the amino acid sequence of SEQ ID NO: 1. A polynucleotide encoding the peptide of claim 1. 3. The polynucleotide of claim 2, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 1. A recombinant vector comprising the polynucleotide of claim 2. A host cell transformed with the recombinant vector of claim 4. 6. The host cell of claim 5, wherein the host cell is selected from the group consisting of an animal, a plant, a fungus, a bacterium, and a virus. A composition for increasing stress resistance, comprising the dihydrin peptide of claim 1 or the polynucleotide of claim 2 as an active ingredient. The composition according to claim 7, wherein the stress resistance is abiotic stress resistance selected from the group consisting of moisture, salinity, low temperature, high temperature, osmotic pressure, oxidation, reduction, alcohol and starvation. 8. The composition according to claim 7, wherein the stress is stress on cells selected from the group consisting of animals, plants, fungi, bacteria and viruses. The composition according to claim 9, wherein the fungal cell is yeast. [Claim 7] The composition according to claim 7, wherein the stress resistance is due to active oxygen inhibition activity, or molecular chaperone activity. A composition for increasing fermentation activity comprising the dihydrin peptide of claim 1 or the polynucleotide of claim 2 as an active ingredient. The composition for increasing fermentation activity according to claim 12, wherein the fermentation is an alcohol fermentation of yeast. (1) inserting the polynucleotide of claim 2 into a yeast cell; And
(2) culturing the yeast cells.
Alcohol production method.

Images