KR20150056923A - Method for producing transgenic with increased resistance to drought stress using AtMYB96 gene and the plant thereof - Google Patents

Abstract

The present invention relates to a method for transforming a recombinant vector including myb domain protein 96 (MYB96) protein coding genes derived from Arabidopsis thaliana on a plant cell to enhance the drought resistance without inhibiting the growth of plants, a method for preparing a transgenic plant by using the recombinant vector including the MYB96 protein coding genes to enhance drought resistance without inhibiting the growth thereof, the transgenic plant prepared by using the preparation method, the seeds of the transgenic plant, a composition including the MYB96 protein coding genes as an active ingredient to enhance drought resistance without inhibiting the growth of the plants, a method for preparing biofuels by using the cuticular wax separated from the transgenic plant and refined in the included steps, and a cuticle wax biosynthesis increasing composition including the MYB96 protein coding genes.

Description

FIELD OF THE INVENTION [0001] The present invention relates to a method for producing a transgenic plant having increased drought resistance using a MYB96 gene derived from Arabidopsis thaliana and a method for producing the same,

The present invention relates to a method for producing a transgenic plant having enhanced resistance to drought using the Arabidopsis thaliana MYB96 gene and a plant, and more particularly, to a method for producing Arabidopsis a method for transforming a recombinant vector comprising a myc-domain-protein-encoding MYB96 protein-encoding gene into plant cells to increase drought resistance without inhibiting the growth of the plant, a method of using the recombinant vector comprising the MYB96 protein- A method for producing a transgenic plant having increased resistance to drought without inhibiting the growth of the plant, a transgenic plant having increased drought resistance without growth inhibition produced by the method, a seed thereof, and a gene encoding the MYB96 protein as an active ingredient A composition for increasing drought resistance without inhibiting plant growth, a method for producing a biofuel using a cuticle wax comprising separating and purifying a cuticular wax from the transgenic plant, and a method for producing a biofuel comprising the MYB96 gene To increase the biosynthesis of cuticle wax in plants Related to water.

Camelina Sativa (L.) Crantz) is a vegetable oil belonging to the family Brassicaceae. Camellia seeds contain about 30-40% of the weight of the building oil, and about 90% of the oil is composed of unsaturated fatty acids. Camellia oil is used not only for food, but also for commercial applications such as soaps, varnishes and cosmetics. Recently, it has attracted attention as a sustainable crop with the potential to produce biofuels. It is regarded as an economical crop that can be cultivated even in non-cultivated areas because it requires only minimal nutrients, is resistant to insects and diseases. Camellia also has a relatively rapid growth period (100-120 days) and has an advantage in that it can induce an easily useful trait by introducing a foreign gene through a bud flooding method using Agrobacterium. Camellia's benefits as bio-energy crops have spurred the development of research using camellia, but research to date has been limited to a limited extent due to limited genetic information. Recently, information on the camelinase genome has been revealed through studies of camelina seed transcriptiome studies and genome sequencing studies, and studies for developing useful transgenic plants using camelinase genes have been activated .

Under drought conditions, camellia showed 26% biomass reduction, 8% seed per pod reduction, and 11-19% seed yield reduction. Growth deficiency and production decline due to drought stress have been reported in camelina as well as other oil crops. Canola (Brassica napus L.) and freshly (B. juncea (L.) Czernjacw) was the seed yield in water deficit conditions decreased by 77% and 46%, sunflower (Helianthus annuus L.) showed significant decrease in plant height stress index (PHSI) and dry matter stress index (DMSI) by ~ 69% and ~ 61% by polyethylene glycol (PEG) treatment inducing water stress. And sesame treated with drought stress ( Sesamum indicum L.) decreased by about 37% compared to the control. In the case of soybean ( Glycine max (L.) Merr.), the yield was decreased by 40% under drought stress conditions. As a result, inhibition of growth and development of plants due to severe drought or water deficiency caused by global warming causes a great decrease in plant productivity. Therefore, studies to increase the drought resistance of crops as a way to overcome this are qualitative and quantitative It is very important in terms of production.

Ecological and ecological biochemical responses such as pore closure, root length growth, reduced leaf area and number, reduced photosynthetic efficiency, and the production of osmoprotectants and secondary metabolites are seen when plants are exposed to drought stress . It has been reported that one of the responses of plants to drought stress is closely related to the accumulation of cuticular wax, which controls water loss outside the plant. The cuticle wax on the outermost layer of the plant consists of an epicuticular wax and an intracuticular wax that penetrates the cuticle matrix. Cuticle wax prevents lipophilic fungal spores and dust from sticking to plant leaves, protects plants against various environmental stresses that are unsuitable for plant growth, and is involved in the development of trichomes and pore cells.

Cuticle waxes contain 20 to 34 C-terminal long-chain fatty acids (VLCFAs) and their derivatives, aldehydes, alkanes, secondary alcohols, ketones, It consists of primary alcohols and wax esters and is mainly produced in epidermal cells. The biosynthesis of these cuticle waxes was confirmed by the Fatty Acids Elongase complex (FAE) in which 16 to 18 carbon atoms (acyl-CoA) were produced in the plastids and released to the cytoplasm in the ER membrane Lt; RTI ID = 0.0 > fatty acids. ≪ / RTI >

In Arabidopsis, the R2R3 family of MYB transcriptional regulators, MYB96, are important regulators of biological and abiotic stress response. PAP1 the PAP2 to MYB96 This overexpression is involved in anthocyanin biosynthesis in plants is that myb96 -1D Expression of genes and PR genes ( PR1 , PR2 and PR5 ) was increased, and expression of PAL1 , DFR and SID2 genes involved in salicylic acid (SA) biosynthesis was increased. In particular, the SID2 gene is regulated by MYB96 through abscisic acid (ABA) -salicylic acid cross talc . Myb96 - 1D showed increased resistance to pathogens by the expression of these genes, whereas MYB96 For myb96 -1 mutants lost the function of the gene it showed a reduced resistance to pathogens. In particular, the MYB96 transcription factor is known to regulate cuticle wax biosynthesis by binding directly to the cis element of the promoter of long chain fatty acid biosynthesis related genes such as KCS1 , KCS2 , KCS6 and KCR .

Korean Patent No. 1300207 discloses 'MYB gene derived from Arabidopsis thaliana and its use', and Korean Patent No. 1077938 discloses a method of controlling the amount of cuticle wax on a plant cell wall and a plant therefrom However, there is no description of a method for producing transgenic plants having improved drought resistance using the Arabidopsis thaliana MYB96 gene of the present invention, and plants therefrom.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, MYB96 The present inventors completed the present invention by producing a transgenic plant in which the gene is overexpressed in a camellia or a plant, and confirming that the transgenic camellia plant has increased drought resistance without inhibiting its growth.

In order to solve the above problems, the present invention relates to a method for producing Arabidopsis the present invention provides a method for increasing drought resistance without inhibiting the growth of a plant, comprising the step of overexpressing a MYB96 protein coding gene by transforming a plant cell with a recombinant vector containing a thaliana- derived myb domain protein 96 protein coding gene .

The present invention also relates to a method for producing a plant cell, which comprises transforming a plant cell with a recombinant vector comprising a Arabidopsis thaliana MYB96 protein coding gene; And

And regenerating the plant from the transformed plant cell. The present invention also provides a method for producing a transgenic plant having increased drought resistance without inhibiting the growth of the plant.

In addition, the present invention provides a transgenic plant and a seed thereof which have increased drought resistance without the inhibition of growth produced by the above method.

In addition, the present invention provides a composition for increasing drought resistance without inhibiting the growth of plants, comprising the Arabidopsis thaliana MYB96 protein coding gene as an active ingredient.

Also, the present invention provides a method for producing a plant, comprising: separating and purifying a cuticular wax from a transgenic plant having increased drought resistance without inhibiting the growth; And

And a step of producing biofuel from the separated and purified cuticle wax. The present invention also provides a method for producing a biofuel using cuticle wax.

The present invention also provides a composition for increasing the biosynthesis of cuticular wax of a plant, comprising the Arabidopsis thaliana MYB96 protein coding gene as an active ingredient.

In the present invention, Arabidopsis MYB96 It was confirmed that drought resistance was increased without inhibiting growth in the gene overexpressing camellia plant. Since the drought stress causes a great decrease in crop productivity, it is considered that the development of the crop having the drought resistance of the present invention can be very useful industrially.

FIG. 1 is a schematic diagram (a) of a 35S: 96-MYC binary vector containing the Arabidopsis MYB96 transcription factor used in the present invention and a herbicidal resistance test result (b) for screening the transformed plants and Arabic Pole MYB96 The level of expression of the gene was confirmed by quantitative real-time RT-PCR (c). NT; Non-transgenic plants, T1-10; Transgenic plants.
2 is overexpressed in Arabidopsis MYB96 gene Carmel Lena plant genomic DNA from the results (a) and total RNA confirmed by PCR whether the MYB96 gene of MYB96 The expression level of the gene was confirmed by RT-PCR (b). NT; Non-transgenic plants, T1-10; Transgenic plants.
Figure 3 shows the 5-week-old Arabidopsis MYB 96 This is a photograph of the phenotype of camelina transgenic plants and nontransgenic plants overexpressing genes. NT; Non-transgenic plants, MYB96 OX-5,6,7; Arabic Pole MYB96 Transgenic plants overexpressing the gene.
FIG. 4 shows the Arabidopsis MYB 96 As a result of the drought tolerance test of transgenic plants with the gene overexpression, the transfection of the 18-day-old transgenic plants was stopped for 2 weeks and the survival rate after the re-supply of water was confirmed after 2 weeks. The graph (a) (b). NT; Non-transgenic plants, MYB96 OX-5,6,7; Arabic Pole MYB96 Transgenic plants overexpressing the gene.
Figure 5 shows the Arabidopsis MYB 96 (A) and the chlorophyll leaching level (b) of the transgenic plants of the gene-overexpressed camelina. NT; Non-transgenic plants, MYB96 OX-5,6,7; Arabic Pole MYB96 Transgenic plants overexpressing the gene.
Figure 6 shows the results of the 6 weeks old Arabidopsis MYB 96 The pore density of the gene-overexpressed camelina transgenic plant was determined by polarizing microscopy. NT; Non-transgenic plants, MYB96 OX-5,6,7; Transgenic plants overexpressing Arabidopsis MYB96 , bar = 100 쨉 m.
Figure 7 shows the results of the 6 week-old Arabidopsis MYB96 The photograph shows the cuticle wax crystals in the leaves of the transgenic plant-overexpressed camelina by scanning electron microscopy (SEM). NT; Non-transgenic plants, MYB96 OX-5,6,7; Arabic Pole MYB96 Transgenic plants overexpressing the gene, bar = 10 쨉 m.
FIG. 8 shows the 6-week-old Arabidopsis MYB96 The results of analysis of cuticle wax components and contents in leaves of gene-overexpressed camelina transgenic plants using gas chromatography (GC). NT; Non-transgenic plants, MYB96 OX-5,6,7; Transgenic plants overexpressing the Arabidopsis MYB96 gene.
FIG. 9 shows the Arabidopsis MYB 96 The results of quantitative real-time RT-PCR analysis of expression levels of genes related to the cuticle wax biosynthesis in leaves of transgenic plants of camelina transgenic overexpression. NT; Non-transgenic plants, MYB96 OX-5,6,7; Arabic Pole MYB96 Transgenic plants overexpressing the gene.

In order to accomplish the object of the present invention, the present invention provides a method for producing a recombinant vector comprising the step of overexpressing a MYB96 protein coding gene by transforming a recombinant vector comprising a Arabidopsis thaliana- derived MYB96 (myb domain protein 96) Thereby providing a method of increasing drought resistance without inhibiting the growth of the containing plant.

The MYB96 according to the present invention The range of the protein includes a protein having the amino acid sequence represented by SEQ ID NO: 2 and a functional equivalent of the protein. Is at least 70% or more, preferably 80% or more, more preferably 90% or more, still more preferably 90% or more, more preferably 90% or more, Quot; refers to a protein having a homology of at least 95% with a physiological activity substantially equivalent to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means an activity of regulating drought resistance without inhibiting plant growth.

The present invention also provides a gene encoding the MYB96 protein. The gene of the present invention may include the nucleotide sequence shown in SEQ ID NO: 1. In addition, homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the gene has a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more, with the nucleotide sequence of SEQ ID NO: 1 . "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In one embodiment of the invention, the plant is selected from the group consisting of Camelina sativa (L.) Crantz).

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the MYB96 gene sequence can be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors comprising the MYB96 gene sequence and appropriate transcription / translation control signals can be constructed by methods known to those skilled in the art. Such methods include in vitro recombinant DNA technology, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a so-called T-region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant genes, but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental status or cell differentiation. A continuous promoter may be preferred in the present invention, since the choice of transformants can be made by various tissues at various stages. Thus, a persistent promoter does not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

The present invention also relates to a method for producing Arabidopsis thaliana) comprising: transforming a plant cell derived from a MYB96 (myb domain protein 96) A recombinant vector containing the gene encoding the protein; And

And regenerating the plant from the transformed plant cell. The present invention also provides a method for producing a transgenic plant having increased drought resistance without inhibiting the growth of the plant.

The MYB96 according to the present invention The range of the protein is as described above.

The method of the invention comprises the step of transforming a plant cell with a recombinant vector according to the present invention, the transformant is, for example, Agrobacterium tyumeo Pacific Enschede may be mediated by (Agrobacterium tumefiaciens). In addition, the method of the present invention comprises regenerating a transgenic plant from the transformed plant cell. Any of the methods known in the art can be used for regeneration of transgenic plants from transgenic plant cells.

Transformed plant cells must be regenerated into whole plants. Techniques for the regeneration of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989, Momillan, N. Y.).

In addition, the present invention provides a transgenic plant and a seed thereof which have increased drought resistance without the inhibition of growth produced by the above method.

In one embodiment of the present invention, the plant is selected from the group consisting of camellia, potato, eggplant, cigarette, pepper, tomato, burdock, ciliaceae, lettuce, bellflower, spinach, modern sweet potato, celery, carrot, parsley, parsley, cabbage, Rice, barley, wheat, rye, corn, sorghum, oats, onion, etc., such as rice, barley, wheat, melon, cucumber, amber, pak, strawberry, soybean, mung bean, , Preferably a dicotyledonous plant, more preferably a camelina.

Also, the present invention provides a composition for increasing drought resistance without inhibiting the growth of a plant, which comprises, as an active ingredient, a gene encoding the MYB96 protein consisting of the amino acid sequence of SEQ ID NO: 2. The above composition contains a gene encoding the MYB96 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. By transforming the gene into a plant, the drought resistance can be increased without inhibiting the growth of the plant.

The present invention also provides a process for the production of a cuticle wax comprising a step of separating and purifying a cuticular wax from a transgenic plant having increased drought resistance without inhibiting the growth and a step of producing a biofuel from the separated and purified cuticle wax The present invention provides a method for producing a biofuel using the same. Any method known in the art can be used as a method for producing the biofuel from the wax.

Preferably, the biofuel may be bio-alcohol or biodiesel, but is not limited thereto. Preferably, the bioalcohol may be bioethanol or bio-methanol, but is not limited thereto.

In addition, the present invention provides a composition for increasing cuticular wax biosynthesis of a plant, comprising a MYB96 protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2. The composition of the present invention includes an MYB96 protein coding gene consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. The MYB96 protein coding gene is transformed into a plant to express the cuticular wax biosynthesis of the plant. It is.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Materials and methods

Plant material and growing conditions

Camelina sativa (L.) Crantz, USDA GRIN seed accession PI 650140, "CAME" source population] Seeds are mixed soil (bed soil: vermiculite: perlite, 4: 2: 1, v / v / v) and seeded in long-day conditions (23 ± 2 ° C, 16 hrs / 8 hrs.).

Camelina  Transformation and Non-transfection  Selection of plants

To introduce the Arabidopsis MYB96 gene into Camellina , 35S: 96- MYC The binary vector was transformed with Agrobacterium strain GV3101 using the cold agar method, and transformed with camelina using a modified bud ingress method. Agrobacterium containing 35S: 96- MYC was inoculated into a YEP liquid medium containing 50 μg / ml rifampicin and 25 μg / ml kanamycin and cultured at 30 ° C. and 180 rpm at 16-20 Lt; / RTI > The cultured Agrobacterium was suspended in a transformation solution (5% sucrose and 0.05% silwet L-77) and used for transformation after the concentration was adjusted to OD ₆₀₀ = 1.0. After removing flowering flowers and molds of Camellia plants grown for 5-6 weeks, the buds were submerged in a transformation solution containing Agrobacterium with 35S: 96- MYC . After immersion for about 2 minutes, the flower buds were wrapped in a plastic bag for a day to maintain the humidity.

Transgenic first-generation seeds obtained from the transgenic plants were sown on the mixed soil and sprayed twice with 0.03% herbicide (Bastar Solution, Bayer Cropscience, USA) on the 10th day after germination. Transgenic plants showing resistance to herbicides were selected and used in the experiments.

Genome DNA And gun RNA  Extraction and Polymerase Chain Reaction PCR ) analysis

Genomic DNA was extracted from 10 Camelina transformed second generation plants surviving herbicide application using DNA extraction solution (200 mM Tris-HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA and 0.5% SDS). Introduction of the MYB96 gene was confirmed by PCR using myc-pBA F1 and MYB96-NR1 primers shown in Table 1 below.

Plant Mini Kit(QIAGEN, 미국)를 사용하여 총 RNA를 추출하였다. 추출한 총 RNA는 Gostrip^TM Reverse Transcriptase(Promega, 미국)를 사용하여 역전사 시킨 다음, RT-PCR과 qRT-PCR 분석에 사용하였다. qRT-PCR은 20㎕ 용량으로 KAPA SYBR

FAST qPCR Kit를 이용하여 수행하였다. 하기 표 1에 명시되어 있는 유전자 특이적인 프라이머를 가지고 Bio-Rad CFX96 Real-Time PCR system(Bio-Rad, 미국)을 이용하여 PCR 반응을 수행하였다.In order to confirm the expression of the gene, 3-6 weeks old RNeasy

Total RNA was extracted using Plant Mini Kit (QIAGEN, USA). Total RNA extracted was reverse-transcribed using Gostrip ^TM Reverse Transcriptase (Promega, USA) and then used for RT-PCR and qRT-PCR analysis. qRT-PCR was performed in 20 μl volume with KAPA SYBR

FAST qPCR Kit. PCR reactions were performed using the Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, USA) with the gene-specific primers set forth in Table 1 below.

Type of primer Sequence information, 5 '- > 3' (SEQ ID NO: myc-pBAF1 GGCGCGCCTGTACAGACGTCT (3) MYB96 NF1 CCCCGGGAATGGGAAGACCACCTTGC (4) MYB96 NR1 GGTCGACCTTTTTGAGCTTCTTCTTC (5) CsACT_F ACAATTTCCCGCTCTGCTGTTGTG (6) CsACT_R AGGGTTTCTCTCTTCCACATGCCA (7) CsKCS2-1_F1 GATTCACATCACATATCTTCAATCC (8) CsKCS2-1_R1 GCCAGTTTCTTTTAAACACAGCG (9) CsKCS6-1_F1 GAAGTTGTCAAACTCTGAACGG (10) CsKCS6-1_R1 CCACAAGTTATTAATTACAGCACG (11) CsKCR1-1_F2 GATCCGGAATAAGTGAACTCAGG (12) CsKCR1-1_R2 GGATATACAAAGATTCAGGAGCAT (13) CsKCR1-2_F1 GTGAAACGGATTAAAGAGGCG (14) CsKCR1-2_R1 ACGCTTCCTCGCTAGCAGAC (15) CsECR-3_F2 CCCTTGTACACACCGGTCG (16) CsECR-3_R2 GGTAGCCTCCAGACCCACTG (17) CsCER1-1_F1 TGGACCGGTGGAGTTCCTC (18) CsCER1-1_R1 TGCGGCATAGAGATCAAGGT (19) CsCER3-1_F1 CAAGTGACCAAATACAATGCCGCA (20) CsCER3-1_R1 CAAGTTGCGAGTCCTTCACCATC (21) CsMAH1-1_F1 GTCAACAAGGTTGGCGACTTTAAG (22) CsMAH1-1_R1 CACTTGTGGATGCTCTGCTTCAC (23) CsCER4_F2 CTGGTTAAGCATGTCTTCTAATAAGTTC (24) CsCER4_R2 CATTACAGAGATGCAAATTAATGCTG (25) CsWSD1-1_F1 GACGACCAGGGATGCAGAGG (26) CsWSD1-1_R1 GTCATCCGTATCACCTCCGC (27)

Drought stress treatment

Drought stress was treated by the method described in the study (Plant Physiol. 2009, 151: 275-289). Camelina plants grown in mixed soil (about 300 g) for 18 days were not fed with water for two weeks, and after two weeks they were again supplied with water. After 3 days, the survival rate of the plants was calculated.

Identification of pore cell number

To determine the number of pore cells present in camellia leaves, the leaves were treated with methanol for 16-24 hours, after which chlorophyll was removed and fixed with lactic acid. Camellina leaves were observed using a Leica DM2500 microscope (Leica, Germany) and pore cells were identified by dividing the front and back sides of the leaves.

Cuticle  Experiments on the Evaporation and Chlorophyl Leaching Experiment

To confirm the rate of proliferation through the cuticle, 5 to 6 weeks old Camellia plants with sufficient water supply were treated with cancer for 5 hours. The 4-5 leaf was treated with water again for 1 hour in the dark. The weight of the leaves per hour was measured using a fine scale. In the chlorophyll leaching experiment, chlorinated leaves were treated with 80% ethanol to check the chlorophyll content extracted per hour, and the leached percentage was shown based on the chlorophyll content extracted after 24 hours.

Scanning Electron Microscope ( scanning electron microscope ) analysis

A scanning electron microscope was used to observe the cuticle wax crystals. Six-week-old transgenic plants and Arabidopsis thaliana Blots of MYB96 gene-overexpressed Camelliana plants were cut and fixed with 1% osmium tetroxide for 24 hours and then dried. The fixed leaves were placed on standard aluminum stubs and coated with platinum using a Hitachi E-1030 sputter coater (Hitachi Science System, Japan). The surface of the coated leaves was observed using a Hitachi S4700 Field-Emission Scanning Electron Microscope.

Cuticle  Wax analysis

The cuticle wax analysis was performed using the method specified in the study such as this (Plant J. 2009, 60: 462-475). Cuticle wax was extracted with chloroform in two leaves of a plant grown for 6 weeks for 30 seconds. At this time, n-octacosane, docosanoic acid, and 1-tricosanol were added as internal standard substances. The extracted solution was evaporated using nitrogen gas and the remaining wax mixture was mixed with pyridine and bis-N, N- (trimethylsilyl) amide to make all compounds having hydroxyl groups as trimethylsilyl derivatives. ) (Bis-N, N- (trimethylsilyl) trifluoroacetamide) were added to each well and reacted at 90 ° C for 30 minutes. Finally, the mixture was evaporated using nitrogen gas, and then the wax component was dissolved in heptane: toluene (1: 1) solution. The extracted wax components were analyzed using a gas chromatography mass spectrometer (GCMS-QP2010, Shimazu, Japan; column 60 m HP-5, 0.32 mm id, df = 0.25 mm, Agilent, USA) and gas chromatography. The analysis conditions are injected at 220 캜 and maintained for 4.5 minutes. The temperature is increased by 3 ° C per minute to 290 ° C and maintained for 10 minutes. The temperature is increased up to 300 ° C at 2 ° C per minute and then maintained at 300 ° C for 15 minutes. The analyzed wax components were analyzed by comparing the retention time and peak area of the internal standard material.

Example  1. Arabian Pole MYB96  Gene overexpressed Camelina  Production of Transgenic Plants

The introduction of the Arabidopsis MYB96 transcription factor into camelinase was inhibited by 35S: 96- MYC A binary vector was used (Fig. 1A) and was carried out by a bud flooding method using Agrobacterium. Transgenic first-generation seeds were sown, and 0.03% (v / v) herbicide (Vasta liquid) was sprayed on the tenth day after germination, and transgenic camellia plants having herbicide resistance performance were selected ). Ten selected transgenic second-generation Camellia plants were confirmed by PCR analysis using the genomic DNA as a template for the stable introduction of the Arabidopsis MYB96 gene (Fig. 2a). Using quantitative real-time RT-PCR with total RNA, Arabidopsis MYB96 Gene was overexpressed in non-transgenic plants in Camellia and transgenic plants (Fig. 1C, Fig. 2B).

Interestingly, the Arabidopsis MYB96 Myb96 - ox and 35S: MYB96 , the overexpressing plants of the Arabidopsis gene Although dwarf phenotypes have been observed in plants (Seo et al., 2009, Plant Physiol. 151: 275-289), camelina transgenic plants overexpressing Arabidopsis MYB96 And there was no ecological difference in development (Fig. 3).

Example  2. The Arabian Pole MYB96  Gene overexpressed Camelina  Analysis of drought resistance of transgenic plants

Drought stress was treated on non-transgenic plants and transgenic camellia plants (third generation plants) in order to confirm the drought stress resistance performance of the Arabidopsis thaliana MYB96 gene overexpressing camelina plants produced in the present invention. FIG. 4 shows that the survival rate of untranslated camellia plants against drought stress was about 42.6% (± 5%, standard error), whereas the survival rate of Arabidopsis MYB96 gene overexpressed camellia plants ( MYB96 OX -5, MYB96 OX- 6 and MYB96 OX-7 ) showed 84.8, 85.4 and 83.2% (± 5, 3 and 9%, standard error) survival rates, respectively. This means that overexpression of the Arabidopsis MYB96 gene, like the Arabidopsis thaliana, imparts drought tolerance to Camellia or plant. The improved drought resistance performance observed in these Arabidopsis MYB96 gene overexpressing Camellia plants was the result of reduced water loss through plant leaves versus non-transgenic plants (Fig. 5A).

As the plant regulates water loss through pores in response to drought stress, the number of pores in the leaves of camelina or plant overexpressing Arabidopsis MYB96 gene was checked and the number of pores in plant leaves was not different from that of non-transgenic plants 6). It was also confirmed that the leaching rate of chlorophyll was decreased in non-transgenic plants in the leaves of Camelliana plants overexpressing the Arabidopsis MYB96 gene (Fig. 5B). The results of the transillumination through the cuticle and the chlorophyll leaching suggest that the permeability of the cuticle in the leaves of Camellia or plant-overexpressing Arabidopsis MYB96 gene has changed.

Example  3. Arabic Pole MYB96  Gene overexpressed Camelina  Transgenic plant leaves Cuticle  Wax analysis

The Arabidopsis MYB96 protein is an active factor that regulates cuticle wax biosynthesis. In previous studies, Arabidopsis MYB96 Overexpression of the gene was observed to increase the cuticle wax content of the plant. These Arabic Pole MYB96 To determine whether camelinase , a cruciferous plant with the same gene, could function as an activator of cuticle wax biosynthesis, Arabidopsis MYB96 Genetic overexpression The cuticle wax crystal structure was observed by SEM (scanning electron microscope) at the surface of leaf of Camellia plant. As a result, it was confirmed that cuticle wax crystals were excessively accumulated on the leaf surface of the camelina plant leaf overexpressing the Arabidopsis MYB96 gene (Fig. 7), unlike the non-transgenic plants.

Based on the results of excessive accumulation of cuticle wax crystals on the leaf surface of camelina leaf of Arabidopsis MYB96 gene, the components and contents of cuticle wax in non-transgenic and transgenic plant leaves were analyzed by gas chromatography Respectively. Alkane and primary alchol were present as main constituents in wax components of camellia leaves at a ratio of 32.9% and 63.7%, respectively, and a small amount (3.5%) of fatty acid was present (FIG. 8A) . Arabic Pole MYB96 The content of most of the cuticle wax components relative to the untransformed plant was increased in the gene-overexpressing camellia plant leaf (Fig. 8B). In concert with the Arabic pole MYB96 The total content of the cuticle wax in the leaves of the gene-overexpressing camellia plant was increased by 15.4 to 52% compared to the untransformed plant (Fig. 8A). These results indicate that Arabidopsis MYB96 Overexpression of Camelina plants is caused by Arabidopsis thaliana, which is an activator that regulates cuticle wax biosynthesis. MYB96 This means that the cuticle wax on the plant surface is over-accumulated by the gene, thereby obtaining the drought resistance performance.

Example  4. Arab Pole MYB96  Gene overexpressed Camelina  Expression analysis of cuticle wax biosynthesis genes of transgenic plants

Arabic pole MYB96 The gene directly induces the accumulation of cuticle wax while directly regulating the expression of genes involved in the cuticle wax biosynthesis, particularly genes involved in long chain fatty acid biosynthesis. Increased cuticle wax content in Camelliana plants overexpressing Arabidopsis MYB96 gene in Arabella In order to confirm the function of MYB96 gene as a transcriptional regulator, we analyzed the expression patterns of genes involved in the biosynthesis of cuticle wax in camelina . For this purpose, genes that are presumed to be involved in the cuticle wax biosynthesis in Camelina were selected. Based on the genomic DNA or amino acid sequence of the Arabidopsis curly wax biosynthesis related genes provided on the TAIR website (http://www.arabidopsis.org/), the Camelina genome website (http://www.camelinagenomics.org/) . ≪ / RTI > As a result, the genes most similar to Arabidopsis thaliana were selected, and the expression was confirmed in leaves and stems and named as camelina or cuticle wax biosynthesis genes. The results are shown in Table 2 below.

Gene - specific primers were constructed to confirm the expression patterns of selected camelinase and cuticle wax biosynthesis - related genes. RT-PCR using total RNA and gene-specific primers extracted from Arabidopsis MYB96 gene-overexpressed camelina plants and non-transgenic plants was found to be involved in the production of cuticle wax biosynthesis in Camellia plants overexpressing the Arabidopsis MYB96 gene (Fig. 9). As shown in Fig. This means that the Arabidopsis MYB96 gene increased the content of cuticle wax by activating the expression of genes involved in the cuticle wax biosynthesis in camelina .

<110> INDUSTRY FOUNDATION OF CHONNAM NATIONAL UNIVERSITY <120> Method for producing transgenic with increased resistance to          drought stress using AtMYB96 gene and the plant thereof <130> PN13350 <160> 27 <170> Kopatentin 2.0 <210> 1 <211> 1059 <212> DNA <213> Arabidopsis thaliana <400> 1 atgggaagac caccttgctg tgaaaagatt ggagtgaaga aagggccatg gacaccagag 60 gaagacatca tcttggtttc ttacatccaa gaacatggtc ctggaaactg gagatctgtc 120 ccaacacaca caggtttgag aagatgtagc aagagctgca gattgagatg gactaattat 180 cttcgacccg gtattaagcg tggaaatttt actgagcatg aagagaagac aattgttcat 240 cttcaagccc ttttaggcaa cagatgggca gccatagcat cataccttcc agaaaggaca 300 gacaatgata taaagaacta ttggaacact cacttgaaga agaagctcaa aaagattaat 360 gaatctggtg aagaagataa tgatggtgtc tcttcatcaa acactagttc acaaaagaac 420 catcaaagca ctaacaaagg tcaatgggaa agaagacttc agacagacat taacatggca 480 aaacaagctc tttgtgaggc cttgtcttta gacaaaccat catccactct ttcatcatct 540 tcatcattac cgacaccagt aatcacacaa caaaacatcc gtaacttctc atcagctttg 600 cttgaccgtt gttatgatcc atcctcttct tcttcatcta ccacaaccac cactacaagc 660 aacactacta atccataccc atcaggggta tatgcgtcaa gtgctgagaa catcgcccgg 720 ttgcttcaag atttcatgaa agacacaccc aaggctttaa ctttatcatc ttcatctccg 780 gtttcagaga ctggaccact cactgctgca gtctcggaag aaggtggaga agggtttgaa 840 caatctttct tcagcttcaa ttcaatggac gaaactcaaa acttgactca ggagacaagc 900 ttcttccatg atcaagtgat caaaccggaa ataacaatgg accaagatca tggtctaata 960 tcacaagggt ctctgtcttt gtttgagaaa tggttatttg atgagcaaag ccacgagatg 1020 gttggtatgg cactagcagg acaagaaggg atgttctag 1059 <210> 2 <211> 352 <212> PRT <213> Arabidopsis thaliana <400> 2 Met Gly Arg Pro Pro Cys Cys Glu Lys Ile Gly Val Lys Lys Gly Pro   1 5 10 15 Trp Thr Pro Glu Glu Asp Ile Ile Leu Val Ser Tyr Ile Gln Glu His              20 25 30 Gly Pro Gly Asn Trp Arg Ser Val Pro Thr His Thr Gly Leu Arg Arg          35 40 45 Cys Ser Lys Ser Cys Arg Leu Arg Trp Thr Asn Tyr Leu Arg Pro Gly      50 55 60 Ile Lys Arg Gly Asn Phe Thr Glu His Glu Glu Lys Thr Ile Val His  65 70 75 80 Leu Gln Ala Leu Leu Gly Asn Arg Trp Ala Ala Ile Ala Ser Tyr Leu                  85 90 95 Pro Glu Arg Thr Asp Asn Asp Ile Lys Asn Tyr Trp Asn Thr His Leu             100 105 110 Lys Lys Lys Leu Lys Lys Ile Asn Glu Ser Gly Glu Glu Asp Asn Asp         115 120 125 Gly Val Ser Ser Ser Asn Thr Ser Ser Gln Lys Asn His Gln Ser Thr     130 135 140 Asn Lys Gly Gln Trp Glu Arg Arg Leu Gln Thr Asp Ile Asn Met Ala 145 150 155 160 Lys Gln Ala Leu Cys Glu Ala Leu Ser Leu Asp Lys Pro Ser Ser Thr                 165 170 175 Leu Ser Ser Ser Ser Leu Pro Thr Pro Val Ile Thr Gln Gln Asn             180 185 190 Ile Arg Asn Phe Ser Ser Ala Leu Leu Asp Arg Cys Tyr Asp Ser Ser         195 200 205 Ser Ser Ser Ser Thr Thr Thr Thr Thr Thr Ser Asn Thr Thr Asn     210 215 220 Pro Tyr Pro Ser Gly Val Tyr Ala Ser Ser Ala Glu Asn Ile Ala Arg 225 230 235 240 Leu Leu Gln Asp Phe Met Lys Asp Thr Pro Lys Ala Leu Thr Leu Ser                 245 250 255 Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Thu             260 265 270 Glu Glu Gly Gly Glu Gly Phe Glu Gln Ser Phe Phe Ser Phe Asn Ser         275 280 285 Met Asp Glu Thr Gln Asn Leu Thr Gln Glu Thr Ser Phe Phe His Asp     290 295 300 Gln Val Ile Lys Pro Glu Ile Thr Met Asp Gln Asp His Gly Leu Ile 305 310 315 320 Ser Gln Gly Ser Leu Ser Leu Phe Glu Lys Trp Leu Phe Asp Glu Gln                 325 330 335 Ser His Glu Met Val Gly Met Ala Leu Ala Gly Gln Glu Gly Met Phe             340 345 350 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggcgcgcctg tacagacgtc t 21 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ccccgggaat gggaagacca ccttgc 26 <210> 5 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggtcgacctt tttgagcttc ttcttc 26 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 acaatttccc gctctgctgt tgtg 24 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 agggtttctc tcttccacat gcca 24 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gattcacatc acatatcttc aatcc 25 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gccagtttct tttaaacaca gcg 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 gaagttgtca aactctgaac gg 22 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 ccacaagtta ttaattacag cacg 24 <210> 12 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 gatccggaat aagtgaactc agg 23 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ggatatacaa agattcagga gcat 24 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gtgaaacgga ttaaagaggc g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 acgcttcctc gctagcagac 20 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 cccttgtaca caccggtcg 19 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ggtagcctcc agacccactg 20 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tggaccggtg gagttcctc 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 tgcggcatag agatcaaggt 20 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 caagtgacca aatacaatgc cgca 24 <210> 21 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 caagttgcga gtccttcacc atc 23 <210> 22 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 gtcaacaagg ttggcgactt taag 24 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 cacttgtgga tgctctgctt cac 23 <210> 24 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ctggttaagc atgtcttcta ataagttc 28 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 cattacagag atgcaaatta atgctg 26 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gacgaccagg gatgcagagg 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 27 gtcatccgta tcacctccgc 20

Claims (17)

Arabidopsis thaliana) a method of increasing the drought resistance without derived MYB96 (myb domain 96 protein) protein by transforming the coded recombinant vector comprising a gene into a plant cell inhibits the growth of a plant, comprising overexpressing a gene encoding a MYB96 protein. 2. The method according to claim 1, wherein the MYB96 protein comprises the amino acid sequence of SEQ ID NO: 2. The method according to claim 1, wherein the plant is camellia. The method according to claim 1, wherein the plant is camellia. Arabidopsis thaliana) comprising: transforming a plant cell derived from a MYB96 (myb domain protein 96) A recombinant vector containing the gene encoding the protein; And
And regenerating the plant from the transformed plant cell, wherein the drought resistance is increased without inhibiting the growth of the plant. 5. The method according to claim 4, wherein the MYB96 protein comprises the amino acid sequence of SEQ ID NO: 2. 5. The method according to claim 4, wherein the plant is camellia. A transgenic plant having increased drought resistance without growth inhibition produced by the method of claim 4. 8. The transgenic plant according to claim 7, wherein the plant is camellia. A seed of a plant according to claim 7. A composition for increasing drought resistance without inhibiting plant growth, comprising a gene encoding the MYB96 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. The composition according to claim 10, wherein the plant is camellia. The composition for increasing drought resistance without inhibiting growth of a plant. Separating and purifying a cuticular wax from the plant of claim 7; And
And a step of preparing biofuel from the separated and purified cuticle wax. 13. The method of claim 12, wherein the biofuel is bioalcohol or biodiesel. 14. The method of claim 13, wherein the bio-alcohol is bio-ethanol or biomethanol. 13. The method of claim 12, wherein the plant is camellia. A composition for increasing the biosynthesis of cuticular wax of a plant, which comprises the gene encoding the MYB96 protein consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient. The composition for increasing cuticular wax biosynthesis according to claim 16, wherein the plant is camellia.

Images