KR20150038944A - Method for Analysis of Gene Methylation and Ratio Thereof - Google Patents

Abstract

The present invention relates to an analysis method of methylation and methylation ratio of gene, comprising the following processes: processing DNA containing a particular gene with sodium bisulfite to detect methylation of the gene; and performing the ligation reaction and the amplifying reaction on oligonucleotide by using DNA as a template, wherein the ligation reaction and the amplifying reaction are performed by using oligonucleotide that allows ligation when the particular gene is methylated, oligonucleotide that allows ligation when the particular gene is not methylated, and oligonucleotide which is completely complementarily bound with the base sequence next to the base which is complementarily bound with 3′ terminus of oligonucleotide. Thus, the amplification products from both methylated or non-methylated genes are formed according to methylation level of the particular gene, and different signals are generated when these amplification products are completely complementarily bound with the same capture probe, thereby analyzing methylation and methylation ratio of gene.

Description

Methods for Analysis of Gene Methylation and Ratio Thereof [

The present invention relates to a method for determining methylation of a gene and a method for analyzing the methylation of the gene. More specifically, the DNA is treated with sodium bisulfite to confirm the methylation of a specific gene, and then the oligonucleotide is ligated and amplified In carrying out the present invention, an oligonucleotide capable of ligation when the specific gene is methylated, an oligonucleotide enabling the linkage when the specific gene is unmethylated, and an oligonucleotide complementary to the 3 'end of the oligonucleotide The oligonucleotides completely complementary to the nucleotide sequence directly next to the base to be subjected to the linking reaction and the amplification reaction are used to amplify the amplified product when a specific gene is methylated according to the degree of methylation of the specific gene, If the gene is unmethylated, The products are formed and these amplification products complete with the same capture probe to a complementary binding by generating a different signal, to a method for analyzing the methylation status and rate of the gene.

The methylation phenomenon on human DNA appears to be limited in C of the CpG nucleotide sequence, which is a phenomenon that is maintained as an evolutionary phase. In general, cytosine in the CpG nucleotide sequence in vivo is relatively easily converted to uracil by deamination, which is then converted to thymine by DNA repair. Thus, the original nucleotide sequence CG is not maintained and is often converted to TG, And it has evolved to a limited extent. For this reason, the frequency of the CG sequence that actually appears among about 3 × ^{10 9} human sequences is reported to be about 15% of the arithmetic expectation. In addition, the cytosine of the conserved CG is methylated to prevent it from being deaminated and maintains the CG base sequence.

However, unlike this general state, there are base sequence regions in which CG is repeated frequently with a frequency of about 40 to 50%, which is called CpG island. This CpG island is mainly expressed in the 5 'promoter region of the gene and its length is about 500 to 2000 bp. Furthermore, the cytosine of CpG at this site is uniquely maintained in an unmethylated state, which is closely related to the binding of transcriptional inducible proteins responsible for gene expression. In the cancer suppressor genes such as RASSF1A and p16INK4A, CpG islands are present in the 5 'promoter region. In normal cases, however, they are methylated and transcription is easy to occur and the expression is maintained well. However, And the amount of expression is also considerably reduced. Based on these facts, cytosine methylation in CpG ischemia inhibits the access of the transcription inducible protein to DNA, resulting in a decrease in the expression level of the cancer suppressor gene, resulting in the failure to function and cancer. In contrast, proto-oncogene such as k-ras has a CpG island in the 5 'promoter region. It is methylated in the normal host and its expression is suppressed. Able to know. The cytosine methylation of CpG ischemia is closely related to the development of cancer and is known to occur at the early stage of cancer development. Therefore, development of a gene that can be used as an early diagnostic biomarker for cancer has been attempted. Many papers are being published in leading magazines abroad.

Currently, the most commonly used method for confirming DNA methylation in researchers is to perform MSP (methylation-specific PCR) after treating a chemical called bisulfite. When genomic DNA is purified from a sample to be methylated, and a chemical reaction using bisulfite is performed, the methylated cytosine is not retained

All remaining unmethylated cytosines are converted to uracil. PCR was performed using the thus-transformed DNA as a template, and 2 sets of unmethylated primers and methylated primers were prepared at positions where 3 to 4 CpG nucleotide sequences were included in the base sequence of a specific gene to be methylated, PCR is performed. Each of the independently reacted products is analyzed to confirm whether or not an amplification product can be obtained when a certain primer set is used, and the methylation of each sample sample is confirmed. However, in this method, since amplification reaction using a non-methylation specific primer and amplification reaction using a methylation-specific primer are performed in different test tubes in order to confirm methylation in one sample, there are some disadvantages have.

First, it is impossible to determine the ratio of the methylated DNA of the sample. In methylpyrrolidone, the methylation primer and the unmethylated primer are selected from a site containing 3 to 4 CpG nucleotide sequences, so that the Tm value of each of these primers differs by 6 to 10 degrees. In order to compensate for the difference in the amplification ratio between the Tm values, the unmethylated primer is usually made of an oligonucleotide longer than the methylation primer by 4 to 6, or the annealing temperature is lowered when the unmethylated primer is used The PCR conditions of the PCR reaction are different. Because of these results, even though some degree of correction is made, the amount of the amplified products will eventually differ. In addition, because the amount of amplification product is exponentially amplified as the cycle progresses, the ratio of methylated DNA in the sample prior to amplification is lower than that of unmethylated product and methylation product after amplification It is not maintained in city. Therefore, in general MSP method, it is only possible to confirm whether methylation is present in the DNA of the sample sample, and it is practically difficult to confirm the ratio.

Second, it concerns the amount and use of sample samples. Generally, after the biosulfite chemical reaction using 1 microgram of DNA, the amount of converted DNA that can be obtained is about 200 to 300 nanograms, which can be performed about 5 to 6 times There is a quantity. Therefore, when the amplification reaction using the unmethylated primer and the methylated primer is independently performed, the number of genes that can be methylated is only about 3 to 4. If the number of genes to be methylated is large, this general MSP method may have limitations.

Third, there is a difficulty in confirming the success of PCR due to the absence of the internal control gene. When the result of the amplification reaction using the unmethylated primer and the methylated primer is negative, there is a definite problem that it can not be confirmed whether or not it is caused by a simple PCR error.

To solve these problems, various solutions such as bisulfite sequencing, Combination of Bisulfite and Restriction enzyme assay (COBRA), Pyrosequencing, Methyl Light and Golden Gate Methods were studied. However, these methods have many additional difficulties that many researchers can easily use in a general laboratory, which limits their use. In the case of bisulfite sequencing, it is advantageous to obtain amplified products by PCR using only one common primer set after DNA transformation through bisulfite treatment. However, since the site to be methylated is a region having a high frequency of CpG nucleotide sequence , There is a restriction of the nucleotide sequence in designing a site that can simultaneously amplify the unmethylated methylated amplification product as a primer, and sequencing through cloning after amplification reaction must be further performed for several clones There are disadvantages. In the case of Pyrosequencing, Methyllight, and Golden Gate methods, it is difficult to carry out the experiment analysis with expensive analytical instruments and reagents, which can be used only for each method. In case of COBRA assay, There is a complicated problem such as an additional experiment in which an amplification product is cleaved with an enzyme and a cleavage pattern of the amplification product is confirmed by electrophoresis. Therefore, there is a growing demand and desire for a technology that can easily and accurately determine the methylation status and the ratio of sample samples without purchasing expensive equipment or additional reagents separately.

In the present invention, a sample DNA containing a specific gene to be analyzed is treated with sodium bisulfite, the oligonucleotide having a methylation-related base sequence is ligated to the amplified product, and the amplified product produced by the amplification reaction is used as a capture probe And to provide a method for determining the methylation status and the ratio of the gene.

One aspect of the present invention relates to a method for determining whether or not methylation of a gene occurs and a ratio thereof. This analysis method includes the following steps.

Referring to FIG. 1, the method comprises: treating a sample DNA containing a specific gene to be analyzed with sodium bisulfite; Methylation related oligonucleotides (MROs) composed of an oligonucleotide enabling ligation when the specific gene is methylated and an oligonucleotide enabling the linkage when the specific gene is unmethylated, And preparing a target specific oligonucleotide (TSO) completely complementary to the base sequence complementary to the base sequence complementary to the 3 'end of the MROs; Hybridizing the sodium bisulfite-treated nucleic acid with the prepared MROs and TSO to form a partial double-stranded nucleic acid; Linking the 3 'end of the MROs and the 5' end of the TSO in the partial double strand to form a double stranded nucleic acid; Amplifying the double strand as a template with a signal primer pair to form an amplification product having a methylation-related base sequence with a labeling substance; And a step of hybridizing the amplification product and the capture probe to analyze a signal generated in the acquisition probe in which the labeling substance and the base sequence of the single-stranded nucleic acids having the methylation-related base sequence are completely complementary to each other And the methylation of the gene using the oligonucleotide having the methylation-related base sequence and the capture probe.

Step 1: Treatment of the sample DNA containing the specific gene to be methylated with sodium bisulfite

The 'methylation' of the present invention means that the methyl group is added to the 5th carbon of the cytosine of DNA.

The term 'CpG island' in the present invention refers to a plurality of CG dinucleotides separated from a CG pair that can be seen in the genome. Here, C (Cytosine) is generally methylated, and since methyl-C is highly likely to be converted to T, CpG in the genome should be observed more often than C and G independent. However, many CpGs can be found because the methylation process must be suppressed in the vicinity of the promoter and in the start region of many genes. These nucleotide sequences are called CpG islands and are typically several hundred to several thousand base lengths.

On the other hand, CpG island, a site where methylation occurs frequently, is distributed in a large amount in the promoter region. 5'-CCGG-3 ', a nucleotide sequence having a high frequency in CpG island, is a nucleotide sequence commonly recognized by methylation-specific restriction enzymes Hpa and Msp. When 5'-CCGG-3' is methylated, Hpa Enzyme action is inhibited, but in the case of Msp enzyme action occurs irrespective of methylation. This property can be used in a method for diagnosing methylation of a promoter.

"Sample DNA" means DNA isolated from a cancer cell of a patient whose methylation is to be confirmed, for example, a cancer patient to be diagnosed through methylation confirmation. The DNA may be genomic DNA or a fragment thereof. Methods for separating DNA from cells can be carried out according to conventional methods known in the art. For example, a commercially available DNA separation kit may be used.

The gene to be methylated (also referred to as a "specific gene") may be the whole of the sample DNA, or preferably a fragment thereof. In the present invention, a specific gene may be a regulatory sequence including a coding sequence, as well as a leader sequence, a polyadenylation sequence, a promoter, an enhancer, an upstream activation sequence, a signal peptide sequence and a transcription termination factor. In the present invention, a specific gene is preferably a promoter. The length of the promoter is generally about 500 to 2000 bp. In the present invention, there may be two or more specific genes.

By treating the sample DNA with 'sodium bisulfate', the methylated cytosine is retained in the base sequence of the sample DNA and the unmethylated cytosine is converted to uracil.

Step 2: Methylation-related oligonucleotides including an oligonucleotide enabling ligation when the specific gene is methylated and an oligonucleotide enabling linkage when the specific gene is unmethylated : MROs) and preparing a target specific oligonucleotide (TSO) completely complementary to a base sequence complementary to the base sequence complementary to the 3 'end of the MROs

The assay method of the present invention is characterized by using the following two types of MROs and TSOs as oligonucleotides.

The MROs may be composed of an oligonucleotide enabling ligation when the specific gene is methylated and an oligonucleotide enabling the linkage when the gene is unmethylated.

The general formula I of the MROs oligonucleotides is

5'-P? -H? -V? -3 '(I)

In the general formula I, P is a region in which the forward primer of the signal primer pair that amplifies a specific gene having the methylation-related base sequence is completely complementary to the binding site, H is a methylation A related adjacent specific region, and V is a region consisting of a nucleotide sequence complementary to two CC bases of CpG island on the nucleotide sequence of the target nucleic acid as a methylation-related region. ?,? and? represent the number of nucleotides,? and? are integers of 8 to 30,? is an integer of 3 to 4, preferably 2.

Preferably, MROs can be divided into methylation-specific oligonucleotides and unmethylated specific oligonucleotides according to the V-region. That is, an oligonucleotide consisting of a nucleotide sequence complementary to the V region containing the CC base information in the CpG nucleotide sequence is used in the nucleotide sequence of a specific gene. Depending on the physiological condition or the pathological state, the same V region may be in the non- The nucleotide sequence can be determined.

Therefore, the cytosine in the CpG nucleotide sequence to which the oligonucleotide binds is designed to be adenine (A) at the corresponding position of the oligonucleotide, assuming that the cytosine is unmethylated and changed to uracil, which is similar to thymine (T), by sodium bisulfite . In the present invention, the oligonucleotide is abbreviated as "unmethylated specific oligonucleotide ".

The cytosine (C) in the methylation-related base sequence is methylated and considered to be not converted to uracil (U) by sodium bisulfite, so that guanine (G) is designed to correspond to the corresponding position of the oligonucleotide. In the present invention, the oligonucleotide is abbreviated as "methylation-specific oligonucleotide ".

As the MR0s, a perfectly complementary sequence may be used in the sequence of the V region, but a substantially complementary sequence may be used to the extent that it does not interfere with the specific hybridization. Preferably, the MROs comprise a sequence that can hybridize to a sequence comprising 30 to 80 contiguous nucleotide residues comprising the V region of the invention. More preferably, the 3'-end of the MROs has a base complementary to the base in the V region. In general, the stability of the duplex formed by hybridization tends to be determined by the match of the terminal sequence, so that in the MROs having a base complementary to the base of the V region at the 3'-end, If not, such a duplex can be dismantled under stringent conditions.

The general formula of TSO oligonucleotides is

 5'-Hα-Tβ-Pγ-3 '(II)

In the formula (II), H is a region in which the 3 'end of the MROs is complementarily bound to the specific gene, and the complementary binding is complete from the base (G) following the base (C) (T); And P is a region (P) in which the reverse primer of the signal primer pair completely complementarily combines. [Alpha], [beta] and [gamma] are integers of 1-40 in terms of the number of nucleotides,

In addition, TSO having the same orientation as the MROs is used, which is composed of a base sequence complementary to the GG base of CpG islands located in the base following the 3 'terminal base of the V base sequence. The cytosine in the base sequence to which TSO binds is designed to be changed to thyamine (T) -like uracil by sodium bisulfite, and is designed to have adenine (A) at the corresponding position in TSO. In the present invention, the oligonucleotide is referred to as a "common oligonucleotide ".

Further, in the primer of the present invention, the two kinds of oligonucleotides of MROs are designed so as to bind to the same base sequence and to have the same orientation depending on methylation, and TSO is designed to have the same directionality as the above oligonucleotides. For example, MROs are designed to have 5 '3' directionality (or sense) if they have 5 '3' directionality (or sense). In the present invention, it is preferable to design the MROs to have antisense and TSO to have antisense orientation.

In addition, the H region of the oligonucleotide of the present invention has a melting temperature (Tm) of 50 to 70, preferably 55 to 65, most preferably about 60; It is suitable to design the oligonucleotide to have a size of 10 to 50 bp, preferably 20 to 25 bp, including a GC ratio of about 35-55%, preferably about 40-50%.

The oligonucleotide used in the synthesis of the oligonucleotide of the present invention may be in the form of a polymer of deoxynucleotide complementary to a commonly used template nucleotide sequence, a polymer form of PNA (Peptide Nucleic Acid), or both Any polymer form that can be used as a primer in PCR, such as a polymer with a miss match form in between, can be used.

The oligonucleotides of the present invention can be used in any art known to be capable of synthesizing oligonucleotides in the art, for example, automated DNA synthesizers (such as those available as Biosearch, Applied Biosystems ^TM, etc.) .

Step 3: Hybridization of the sodium bisulfite-treated nucleic acid with the prepared MROs and TSO to form a partial double-stranded nucleic acid

The MROs and TSOs used in the present invention are hybridized or annealed at one site of the template to form a double-stranded structure. Nucleic acid hybridization conditions suitable for forming such a double-stranded structure can be found in Nucleic Acid Hybridization < RTI ID = 0.0 > (" , A Practical Approach, IRL Press, Washington, DC (1985).

In the present invention, annealing is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the oligonucleotide. The stringent conditions for annealing are sequence-dependent and vary with environmental variables. The amplified target nucleic acid is a target nucleic acid molecule containing multiple target positions on one molecule, and can be used to simultaneously analyze multiple target positions.

Step 4: In the partial double strand, the 3 'end of the MROs and the 5' end of the TSO undergo a ligation reaction to form a double stranded nucleic acid

The linking reaction refers to a reaction capable of catalyzing the linkage of a nucleotide sequence by a ligase. Two oligonucleotides of a specific length are allowed to hybridize side by side in the target sequence, and the nick regions of the double helix formed at this time are amplified by DNA ligase through a conventional linkage reaction based on the linkage principle of ordinary nucleic acids It is a reaction that connects two kinds of oligonucleotides in a single stranded state. Therefore, enzymes conventionally used in the art can be used without limitation as a ligase for inducing the linkage of nucleic acids.

The enzyme used in the coupling reaction may be selected from the group consisting of E. coli DNA ligase, Taq DNA ligase, T4 DNA ligase and Ampligase ligase, but not limited thereto, DNA binding activity Can be used.

In addition, the ligase reaction can be performed in a single reaction using a plurality of oligonucleotides recognizing a plurality of targets as well as a single target gene or mutation detection. In this case, a ligase oligonucleotide suitable for each mutation position may be selected so that an error of a melting temperature (Tm) value of a portion of each ligase oligonucleotide sequence hybridized with the target gene is within 5 .

Step 5: amplifying the double strand as a template with a signal primer pair to form an amplification product having a methylation-related base sequence with a labeling substance

In the above, the signal primers are represented by the following formulas III and IV:

Forward primer: 5'-X-P-3 '(III); Reverse primer: 5'-P-3 '(IV)

In the general formulas (III) and (IV), X is a detectable label and is used to identify whether methylation is to be made with a fluorescent substance such as a fluorescent reporter molecule or a reporter molecule having a physical characteristic at the 5 'terminal end of the primer, Preferably, fluorescence assays can be labeled with Cy3 for unmethylated and Cy5 for methylated. P consists of a nucleotide sequence completely complementary to the nucleotide sequence of the region in which the signal primers of MROs and TSOs are completely complementary to each other.

The forward primer (P1 or P2) in the signal primer pair is composed of an open reading sequence completely complementary to the base sequence of the region to which the signal primer binds in the structure of the MROs, and is preferably a universal PCR primer ) Or a labeling substance (X) such as a fluorescent reporter molecule or a reporter molecule having a physical characteristic is selected at the 5 'end of the signal primer according to whether the gene is methylated. When the hybridization reaction is terminated and the methylation is determined, Lt; / RTI > is used.

For fluorescence analysis, Cy5 and Cy3 are used as the labeling substance (X).

The reverse primer (P3) refers to a base sequence which perfectly complementarily binds to the base sequence of the region to which the primer binds in the structure of TSO, and may be preferably a universal PCR primer.

In the assay method of the present invention, all PCR (Polymerase Chain Reaction) methods known in the art can be used.

PCR is described, for example, in U.S. Patent Nos. 4,683,195; U.S. Patent No. 4,683,194; Saiki et al. Science, 1985, vol. 230, pp. 1350-1354; Scharf et al. Science, 1986, vol.324, pp.163-166; Kogan et al. New Engl. J. Med., Vol. 317, pp. 986-990.

PCR typically involves (1) denaturation of DNA; (2) annealing of the primer; (3) the step of polymerization or elongation of DNA. Modification of DAN in the present invention can be accomplished by heating at about 80 ° C to 96 ° C as is known in the art, and the higher temperatures can facilitate the separation (denaturation) into single stranded DNA, but if the temperature is too high, The temperature should be set appropriately as it may affect the activity. Binding of the primer to the single strand DNA thus separated (i.e., template) typically proceeds from 37 to 65, but the temperature may vary depending on various factors such as the GC content and size of the primer. When the primer is bound to the template, nucleotides complementary to the template are sequentially bound from the terminal of the primer to synthesize DNA. The DNA synthesis is usually carried out at 60 to 75 ° C. In the present invention, the steps of denaturation of DNA, annealing, and synthesis of DNA are preferably performed at 30 DEG C to 40 times, preferably 35 times.

In the present invention, PCR is preferably carried out under conditions suitable for the synthesis of DNA. Generally, PCR is carried out in a buffer solution at a pH of about 7 to 9, preferably at about pH 8. [ In the present invention, a buffer solution containing HEPES or glycine-NaOH, a phosphate buffer solution or the like may be used, and it is particularly preferable to use a buffer solution containing Tris-HCl at a concentration of 10 to 100 mM. In the present invention, the buffer solution may contain a monovalent salt at a concentration of about 10 mM to 60 mM. Commonly used monovalent salts include KCl. NaCl and (NH4) 2SO4, and the like.

 The deoxynucleotide triphosphate dATP, dCTP, dGTP and dTTP as one component of the PCR reaction must be added to the PCR reaction in an amount sufficient to amplify the sequence of the desired specific gene to the desired amount. The dNTPs may be added to the PCR reaction at a concentration of preferably about 0.75 to 4.0 mM, more preferably about 2.0 to 3.0 mM.

The PCR reaction should include a DNA polymerase that catalyzes the sequential coupling of complementary nucleotides to the base sequence of the template DNA from the terminal of the primer. In the present invention, all DNA polymerase enzymes known in the art can be used, and examples thereof include E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase, T4 DNA polymerase and the like. However, since PCR is usually carried out at a high temperature, the DNA polymerase used in the present invention preferably has stable properties at high temperatures. In the PCR according to the present invention, all thermostable DNA polymerase enzymes known in the art can be used, and it is particularly preferable to use Taq polymerase such as Amplitaq-gold enzyme.

According to the PCR of the present invention, as shown in FIG. 1, various amplification products can be generated depending on whether or not a specific gene is methylated. If a particular gene is completely unmethylated, a non-methylation-specific primer will bind to a particular gene, resulting in a PCR product (also referred to as an "unmethylated amplification product"). When a specific gene is completely methylated, a methylation-specific primer binds to a specific gene and a resulting PCR product (also referred to as a 'methylated amplification product') will be generated. If methylation and unmethylation are mixed in a particular gene, both an unmethylated amplification product and a methylated amplification product will be produced. In addition, when the specific gene is mainly methylated, the methylation-specific promoter binds to the specific gene at a higher probability than the non-methylation-specific promoter, resulting in the methylation amplification product being predominantly produced, whereas when the specific gene is mainly methylated , A non-methylation-specific promoter will bind to the specific gene at a higher probability than the methylation-specific promoter, resulting in the production of an unmethylated amplification product.

Step 6: The hybridization reaction of the amplification product and the capture probe is performed to analyze a signal generated in the capture probe that has completely complementary to base sequences of the single-stranded nucleic acids having the methylation-related base sequence with the labeling substance step;

The present invention relates to an oligonucleotide having a methylation-related base sequence, characterized by a capture probe complementarily binding to a region (T) to which a capture probe in a single-stranded nucleic acid with a labeling substance binds in the double- And methylation of a specific gene using a capture probe and a method for analyzing the ratio.

The capture probes are used to detect the binding of the target nucleic acid to the capture probe binding region (T) in an amplification product prepared by amplifying the target nucleic acid as a template with a signal primer, Strand nucleic acid, oligonucleotide, and PNA (peptide nucleic acid) having a base sequence complementary to a single-stranded nucleic acid having a labeling substance based on the nucleotide sequence shown in SEQ ID NO.

The present invention provides a method for determining methylation of a specific gene using an oligonucleotide having a methylation-related base sequence and a capture probe, and a method for analyzing the ratio, characterized in that various kinds of the above-mentioned capture probes are fixed to a support.

In order to confirm whether or not the methylation of a gene of a nucleic acid-containing biological sample containing a specific gene having a methylation-related base sequence is methylated and whether the methylation of the gene is methylated, An acquisition probe capable of identifying whether or not methylation is caused by analyzing a signal generated by completely complementary binding with strand nucleic acids, and an array characterized by comprising one or more of the acquisition probes.

Preferably, the capture probe can be attached to a glass slide or a sensing surface of a biosensor, etc., which can be modified to enable binding, and this modification can be combined with a C1 to C20 alkyl group at the 5 ' end of the oligonucleotide , Materials such as thiols may be added to facilitate bonding with the glass slide or sensing surface. However, such a modification can be appropriately changed depending on the purpose.

The support on which the acquisition probe is fixed is a kind of array, which may be a biosensor sensing surface, and is capable of detecting a target substance by measuring a change caused by binding of the target substance. In particular, fluorescence changes can be measured by analyzing the fluorescent material of the labeling substance bound to the capture probe. What is useful herein is a glass slide that is a conventional solid support.

In the above, the hybridization (annealing) temperature in the hybridization reaction is 40 to 70, more preferably 45 to 68, even more preferably 50 to 65, and most preferably 60 to 65. Hybridization conditions are described in the following publications: Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press , Washington, DC (1985). The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. These stringent conditions can be determined differently depending on the sequence to be hybridized. For example, high stringency conditions were hybridized under conditions of 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS) and 1 mM EDTA at 65, followed by hybridization in 0.1 x SSC (standard saline citrate) /0.1% SDS under 68 conditions ≪ / RTI > Alternatively, high stringency conditions means washing in 6 x SSC / 0.05% sodium pyrophosphate at 48 conditions. Low stringency conditions mean, for example, washing in 0.2 x SSC / 0.1% SDS at 42 conditions.

In the array, the acquisition probe is used as a hybridizable array element and is immobilized on a substrate. Preferred gases include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports. The above-described acquisition probes are arranged and immobilized on the above-mentioned substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the capture probe may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element may be coupled to the gas through a linker (e.g., ethylene glycol oligomer and diamine).

In the above, an instrument for measuring a signal generated from a single-stranded nucleic acid having a methylation-related base sequence and a labeling substance of an amplification product bound to the acquisition probe is determined according to the type of signal, and after the hybridization reaction, Hybridization signal is detected. The hybridization signal can be performed in various ways depending on, for example, the type of label attached to the capture probe.

The present invention also provides a method of detecting the methylation of various kinds of nucleic acids by using an array made of trapping probes, And methylation of a specific gene using an oligonucleotide having a methylation-related base sequence and a capture probe.

On the other hand, the sample DNA to be applied to the array of the present invention can be labeled and hybridized with an acquisition probe on the array. Hybridization conditions can be varied. The detection and analysis of the hybridization degree can be variously carried out according to the labeling substance.

The labeling substance bound to the capture probe can provide a signal to detect hybridization, which can be linked to an oligonucleotide. Suitable labels include fluorescent moieties (e.g., fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), chromophores, chemiluminescent moieties, magnetic particles, (Such as P32 and S35), mass labels, electron dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), joins, substrates for enzymes, heavy metals such as gold and antibodies, streptavidin, biotin , Hapten having specific binding partners such as digoxigenin and chelating groups. Markers may be obtained using a variety of methods routinely practiced in the art such as the nick translation method, the Multiprime DNA labeling systems booklet ("Amersham" (1989)) and the kaination method (Maxam & Gilbert, 1989 , ≪ / RTI > Methods in Enzymology, 65: 499). The label provides signals that can be detected by fluorescence, radioactivity, color measurement, weighing, X-ray diffraction or absorption, magnetism, enzymatic activity, mass analysis, binding affinity, hybridization high frequency, and nanocrystals.

In the above, the method of making the array is synthesized and manufactured by any suitable method known in the art. Array fabrication equipment is also readily available through commercial sources. A variety of known methods (M. schena, 1999, DNA microarray; a practical approach, Oxford) can capture nucleic acid chips regularly with single stranded nucleic acids.

In addition, the present invention provides information on the methylation-related base sequence of the identified gene as a result of analyzing a signal generated from a labeling substance in a single strand of the amplification product bound to the acquisition probe, .

Genes on the genome are methylated or unmethylated and vary depending on the physiological and pathological conditions of the biological sample.

Preferably, when the specific gene is unmethylated, fluorescence analysis can be performed by labeling the labeling substance Cy3 at the 5 'end of the MROs and labeling the labeling substance Cy5 in the other case of methylation. That is, the MROs and TSPs are ligated with a specific gene as a template, amplified by a signal primer, and the obtained amplification product is hybridized with a macroarray having the capture probe to form a labeling substance in a single strand bound to the capture probe of the array If the spot is blue, if the marker is Cy3 / Cy3, all of the specific genes are unmethylated. If the spot is red, the markers are all methylated with Cy5 / Cy5. If the spot is yellow, It means that unmethylated and methylated genes coexist in Cy3 / Cy5. In general, the frequency of methylation of a biological sample varies from 0 to 100%. If the spot has a blue to red color spectrum, the labeling substance can detect the ratio of Cy3 / Cy5, so that the ratio of unmethylated and methylated And the ratio of methylation in the biological sample can be determined from these.

The present invention provides a kit characterized in that the methylation of the gene and the ratio thereof are analyzed through the methylation of a specific gene using the oligonucleotide having the methylation-related base sequence and the capture probe and the ratio analysis method.

 The assay method and kit of the present invention can be used for diagnosis of cancer as an embodiment. That is, the presence or absence of methylation of a specific gene in normal cells and the ratio of methylation of the gene in cancer cells are compared to diagnose cancer. In general, the promoter of cancer suppressor genes (eg, RASSF1A, p161INK4A) is known to be unmethylated in normal cells and methylated in cancer cells. Therefore, when a specific gene is a promoter of a cancer-suppressing gene, Can be diagnosed. In general, the promoter of a carcinogenesis gene (eg, k-ras) is known to be methylated in normal cells and unmethylated in normal cells. Therefore, when a specific gene is a promoter of a carcinogenesis gene, . Examples related thereto will be described in detail for the practice of the invention.

By using the method of simultaneously analyzing the methylation of one or more genes using an oligonucleotide having a methylation-related base sequence and a detection probe and analyzing the methylation status and the ratio of various specific genes of the present invention, It is possible to quickly detect the presence or the ratio of the gene methylation. Due to the rapid methylation of specific genes and the ratio analysis, the present invention can be very usefully used for the diagnosis and treatment of diseases.

Brief Description of the Drawings Fig. 1 is a diagram showing a series of processes of an oligonucleotide having a methylation-related base sequence and a method of performing methylation analysis using a capture probe,
2 shows the result of analysis of 35 methylation-related nucleotide sequences of 23 genes used in the experiment of the present invention in an array manner. On the right side, 35 methionine-related base sequences were arranged, and on the left, Fig.

Hereinafter, specific methods of the present invention will be described in detail by way of examples, but the scope of the present invention is not limited to these examples.

As another example, in the present invention, by detecting the methylation state of one or more of the following nucleic acids using a kit or a nucleic acid chip, it is possible to diagnose a cell growth abnormality (dysplasia) of the stomach tissue present in the specimen.

Any nucleic acid in purified or untreated form in the present invention may be used, and any nucleic acid containing or suspected of containing a nucleic acid sequence containing a target site (for example, a CpG-containing nucleic acid) may be used . The nucleic acid region that can be differentially methylated is a CpG island, which is a nucleic acid sequence having a high CpG density compared to other dinucleotide CpG nucleic acid sites. The doublet CpG, when predicted by the ratio of G * C base pairs, has a probability of only 20% in vertebrate DNA. At certain sites, the density of double CpG is ten times higher than in other parts of the genome. CpG islands have an average G * C ratio of about 60%, and the average G * C ratio of DNA represents an average of 40%. CpG islands typically have a length of about 1-2 kb, and the human genome has about 45,000 CpG islands.

In several genes, the CpG islands start from the upstream of the promoter and extend to the downstream transcription site. In the promoter, methylation of CpG islands usually suppresses gene expression. The CpG island may also surround the 5 'region of the gene coding region, as well as the 3' region of the gene coding region. Thus, CpG islands are found at several sites including the coding sequence upstream of the regulatory region comprising the promoter region, the coding region (e.g., the exon base sequence), downstream of the coding region, for example, the enhancer region and the intron do.

Typically, the CpG-containing nucleic acid is DNA. However, the method of the present invention can be applied, for example, to a sample containing DNA or RNA containing DNA and mRNA, wherein the DNA or RNA may be single-stranded or double-stranded, or a DNA-RNA hybrid And the like.

A nucleic acid mixture can also be used. The specific nucleic acid sequence to be detected may be a fraction of a large molecule and the unique sequence from the beginning may exist in the form of a separate molecule constituting the entire nucleic acid sequence. The nucleic acid sequence need not be a nucleic acid present in a pure form, and the nucleic acid may be a small fraction in a complex mixture such as a whole human DNA. Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N.Y., 1989) used to measure the degree of methylation of the nucleic acid contained in the sample, or the nucleic acid contained in the sample used to detect the methylated CpG island, And the like.

The nucleic acid may comprise a regulatory region that is a DNA region that codes for information or regulates transcription of the nucleic acid. The regulatory region comprises at least one promoter. A "promoter" is the minimum sequence required to direct transcription, and can regulate cell type-specific, tissue-specific or external signal or inducibility by the agent in the promoter-dependent gene. The promoter is located in the 5 'or 3' region of the gene. The number of nucleic acids in whole or part of the promoter region can be applied to measure the methylation of the CpG island region. The methylation of the target gene promoter proceeds from the outside to inside.

Therefore, the initial stage of cell turnover can be detected by analyzing the methylation at the outside of the promoter region.

The nucleic acid isolated from the sample is obtained by the biological sample of the specimen. If you want to diagnose the progression of gastric cancer or stomach cancer, you should isolate the nucleic acid from the stomach tissue by scrap or biopsy. Such samples can be obtained by various medical procedures known in the art.

In one embodiment of the present invention, the degree of methylation of the nucleic acid of the sample obtained from the sample is measured relative to the same nucleic acid portion of the sample without cell growth abnormality of the stomach tissue. Hypermethylation refers to the presence of a methylated allele in one or more nucleic acids. Specimens without cell growth abnormality in the stomach tissue do not show methylated alleles when examined for the same nucleic acid.

≪ Example 1 > Separation of genomic DNA and bisulfite treatment

 Using the kit, genomic DNA was extracted from the lung cancer cell lines Calu6 and H358 and sputum of the patient and the concentration was measured using Nano Drop. About 1 ~ 2 ㎍ of the extracted DNA was mixed with 0.5 N sodium hydroxide to make 16 ㎕, and the reaction was performed at 37 캜 for 15 minutes to transform the DNA into a single stranded form. Then, 3.5 M sodium bisulfite and 0.01 M sodium hydrogulphate reagent were added and reacted at 56 ° C for 16 hours. Then, the precipitated reaction with ethanol was carried out to concentrate only the transformed DNA, followed by pure separation, followed by dissolving in 50 μl of tertiary distilled water. Sodium hydroxide was added to a concentration of 0.1 M and the reaction was allowed to proceed at room temperature for 15 minutes. , Concentrated once again by ethanol precipitation reaction, finally dissolved in 30 의 of tertiary distilled water and stored at -20.

Example 2 Production of MROs and TSO

The following MROs and TSOs are required to form an amplification product containing a single-stranded nucleic acid having information on the presence or absence of methylation using the presence or absence of methylation in a specific gene from the nucleic acid containing the specific gene.

The MROs are composed of an oligonucleotide enabling ligation when a specific gene is methylated and an oligonucleotide enabling linkage when the gene is unmethylated. The TSO is complementary to the 3 'end of the MROs Is an oligonucleotide that is completely complementary to the nucleotide sequence immediately following the base to which it is attached.

Wherein the MROs comprise a region (P) in which the forward primer of the signal primer pair, which amplifies the specific gene having the methylation-related base sequence, is completely complementary to the base sequence, A methylation-related adjacent specific region (H) for complementary binding, and a region (V) for completely complementary binding with a part of the methylation-related base sequence.

The TSO comprises a region (H) in which the base sequence of a specific gene including a part of the methylation-related base sequence is completely complementary to the base sequence, a region (T) in which the detection probe completely complementarily binds to the base sequence, And a region (P) completely complementary to the reverse primer of the signal primer pair amplifying the specific gene.

A base sequence of a signal primer pair that completely complementarily binds to the primer binding site (P) of the MRO and TSO primer The base sequence (5 '- > 3') Remarks P1 gatcaggcgtctgtcgtgctc Forward primer P2 gattgagctgctgcttttctctcctt Forward primer P3 ccctgcctcacacctgatagcac Reverse primer

The T region of the TSO and the base sequence of the capture probe The nucleotide sequence (5 '- >3') of the T region of TSO The base sequence of the capture probe (5 'to 3') 1_1 GATTTGTATTGATTGAGATTAAAG CTTTAATCTCAATCAATACAAATC 1-2 TGATTGTAGTATGTATTGATAAAG CTTTATCAATACATACTACAATCA 2_1 GATTGTAAGATTTGATAAAGTGTA TACACTTTATCAAATCTTACAATC 2_2 GATTTGAAGATTATTGGTAATGTA TACATTACCAATAATCTTCAAATC 2_3 GATTGATTATTGTGATTTGAATTG CAATTCAAATCACAATAATCAATC 3_1 GATTTGATTGTAAAAGATTGTTGA TCAACAATCTTTTACAATCAAATC 3_2 ATTGGTAAATTGGTAAATGAATTG CAATTCATTTACCAATTTACCAAT 3_3 GTAAGTAATGAATGTAAAAGGATT AATCCTTTACATTCATTACTTAC 4_1 GTAAGATGTTGATATAGAAGATTA TAATCTTCTATATCAACATCTTAC 5_1 TGTAGATTTGTATGTATGTATGAT ATCATACATACATACAAATCTACA 6_1 GATTAAAGTGATTGATGATTTGTA TACAAATCATCATCACTTTTAATC 7_1 AAAGAAAGAAAGAAAGAAAGTGTA TACACTTTCTTTCTTTCTTTCTTT 8_1 TTAGTGAAGAAGTATAGTTTATTG CAATAAACTATACTTCTTCACTAA 9_1 AAAGTAAGTTAAGATGTATAGTAG CTACTATACATCTTACTATACTTT 10_1 TGAATTGATGAATGAATGAAGTAT ATACTTCATTCATTCATCAATTCA 11_1 TGATGATTTGAATGAAGATTGATT AATCAATCTTCATTCAAATCATCA 11_2 TGATAAAGTGATAAAGGATTAAAG CTTTAATCCTTTATCACTTTATCA 12_1 TGATTTGAGTATTTGAGATTTTGA TCAAAATCTCAAATACTCAAATCA 12_2 GTATTTGAGTAAGTAATTGATTGA TCAATCAATTACTTACTCAAATAG 13_1 GATTGTATTGAAGTATTGTAAAAG CTTTTACAATACTTCAATACAATC 13_2 TGATTTGAGATTAAAGAAAGGATT AATCCTTTCTTTAATCTCAAATCA 14_1 TGATTGAATTGAGTAAAAAGGATT AATCCTTTTTACTCAATTCAATCA 14_2 AAAGTTGAGATTTGAATGATTGAA TTCAATCATTCAAATCTCAACTTT 14_3 GTATTGTATTGAAAAGGTAATTGA TCAATTACCTTTTCAATACAATAC 15_1 TGAAGATTTGAAGTAATTGAAAAG CTTTTCAATTACTTCAAATCTTCA 16_1 TGAAAAAGTGTAGATTTTGAGTAA TTACTCAAAATCTACACTTTTTCA 17_1 AAAGTTGAGTATTGATTTGAAAAG CTTTTCAAATCAATACTCAACTTT 18_1 TTGATAATGTTTGTTTGTTTGTAG CTACAAACAAACAAACATTATCAA 19_1 AAAGAAAGGATTTGTAGTAAGATT AATCTTACTACAAATCCTTTCTTT 19_2 GTAAAAAGAAAGGTATAAAGGTAA TTACCTTTATACCTTTTCTTTTTAC 20_1 GATTAAAGTTGATTGAAAAGTGAA TTCACTTTTCAATCAACTTTAATC 21_1 GTAGATTAGTTTGAAGTGAATAAT ATTATTCACTTCAAACTAATCTAC 21_2 AAAGGATTAAAGTGAAGTAATTGA TCAATTACTTCACTTTAATCCTTT 22_1 ATGAATTGGTATGTATATGAATGA TCATTCATATACATACCAATTCAT 23_1 TGAAATGAATGAATGATGAAATTG CAATTTCATCATTCATTCATTTCA

In order to analyze the specific gene characterized by the 5'-CCGG-3 'nucleotide sequence in which the methylation-related nucleotide sequence appears at a high frequency in a CpG island, the 3-terminus of the MROs is the nucleotide sequence of the methylation- Depending on the methylation of a portion of the CC base, a base that is complementary to the base is determined, and the 5-terminal of the TSO is composed of a base complementary to the GG base, which is a part of the methylation-related base sequence.

The region (H) that is complementary to the specific gene of MROs and TSOs identifies the methylation status of a specific gene and produces an oligonucleotide having an optimal length for annealing at a specific temperature. MROs and TSOs are methylated Base sequences and 5'-flanking sequences. All oligonucleotides were approximately 20 to 30 nt (nucleotides) and Tm values were around 60 ° C.

Using the MethPrimer (http://itsa.ucsf.edu/~urolab/methprimer/index1.html), the following 23 genes, which were confirmed to have CpG islands and were methylated in the vicinity of the tumor (Korean Patent No. 10- 0892588) were examined for the methylation ratio of the 35 methylation-related base sequences.

Any nucleic acid that can detect the presence of differently methylated CpG islands can be used. The CpG island is a CpG-rich region in the nucleic acid sequence. The nucleic acid includes, for example, a sequence encoding the following genes (GenBank Accession Number is indicated);

1. MTCBP-1 (NT022270); Membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1

cagg acagggtctg ggcttgaatg cctttgcttc cgaaaacagc ggagccgtgg ggcctccccc gcg ccc ccgg tgcctccaac cagccgccca atc ctc ccgg ccatgcgcgt ccacgcctcc ctataagaca aagcgcggcc gacgggctcc gagcgcggcc cctgggttcg aacacggcac ccgcactgcg cgtcatggtg caggcctggt atatggacga cgccccg (SEQ ID NO: 1)

1_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: ttttatca cctaaacacc ccaaaaaaaaa cacgg

Unmethylated specific oligonucleotides: ttttatca cctaaacacc ccaaaaaaaa cacaa

Common oligonucleotides: ccaaa acaaaaatta atcaacaaaa taa

1_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: ccaaa acaaaaatta atcaacaaaa taagg

Unmethylated specific oligonucleotides: ccaaa acaaaaatta atcaacaaaa taaaa

Common oligonucleotides: ccaaa aatacacaca cctacaaaaa aatattc

2. MTPN (NT_007933); Myotrophin

tggtggtgca gaagcgtcct aatcccatcg aaagtactct cactcttcct ccattcgctg tcttgacctccc ccgg cct ccttcattct gcctcccagt cccgcccact tgtcg ccgg c cctaccctc cactctagcc ttc cag ccgg cctgtacatt gcgcatgcgc actagtggcg ttcgcgccgc ggacccagag agaggcgttc cgcggaggag aagaggaaga ggaagttggg ggagggtcc (SEQ ID NO: 4)

2_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaaaaaaa aataaacaac aaaactaaaa aagg

Unmethylated specific oligonucleotides: aaaaaaaa aataaacaac aaaactaaaa aaaa

Common oligonucleotides: cccaaa aaaaataaaa caaaaaatca aaac

2_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aataaaa caaaaaatca aaacaaataa acaacgg

Unmethylated specific oligonucleotides: aataaaa caaaaaatca aaacaaataa acaacaa

Common oligonucleotides: gga aaaataaaaa ataaaatcaa aaaaa ccatc

2_3. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: caacaa gga aaaataaaaa ataaaatcaa aaagg

Unmethylated specific oligonucleotides: caacaa gga aaaataaaaa ataaaatcaa aaaaa

Common oligonucleotide: ccatc aaacatataa cacatacaca taatcacc

3. MTSS1 (NT_008046); Metastasis suppressor 1

ta caagcgggct ctgggctagg cgcgccaccc gtgcaagtcc ccgg ggagcg gcggtgcacc ctccgtcccg cgcgctcgca gccattgtag gggtgggcgc tcgccaggca gggtgccgac acgccctctc cgcgctgcga cgggcggccg ggggaggaga gggtgcgctg tgcgca ccgg agggagaggc t ccgg cccag cgccgcctgc ccgccagcag accagcaggc tcct (SEQ ID NO: 7)

3_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cccaatcc acacaataaa cacattcaaa gg

Unmethylated specific oligonucleotides: cccaatcc acacaataaa cacattcaaa aa

Common oligonucleotide: cccctcac caccacataa aaaacaaaac acac

3_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aac cccctcctct cccacacaac acacatgg

Unmethylated specific oligonucleotides: aac cccctcctct cccacacaac acacataa

Common oligonucleotide: cc tccctctcca aaaccaaatc acaacaaac

3_3. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cccacacaac acacataa cc tccctctcca agg

Unmethylated specific oligonucleotides: cccacacaac acacataa cc tccctctcca aaa

Common oligonucleotides: ccaaatc acaacaaaca aacaatcatc taatc

4. PELI2 (NT_026437); Pellino homologue 2 (Drosophila)

gcgccttcg aaacgtcctc tacgccagca ccaactggca aaaccttcta attttctaga cgcctttctg cttggttttg gaaggggagg cacccaagtg ggtgtgtgcg acacctctag ttgtaag ccg g gacacagtg acgtcgagag agcgctattc tactcggaga ggaagttaat cccatcgaac tccagccagg aaaacgtggg cttggga (SEQ ID NO: 10)

4_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: ccacacacac tataaaaatc aacattcaa

Unmethylated specific oligonucleotides: ccacacacac tataaaaatc aacattcaa

Common oligonucleotide: c cctatatcac tacaactctc tcacaataaa

5. PLEKHF2 (NT_008046); Pleckstrin homology domain containing, family F (with FYVE domain) member 2

aaggg ctggtcggag tcaggaaagt caggtaaggc gcctcacgtg cacctcaacg cgtcgcggga gcgcgtcccg acctcacaca tggacaagct ccgcccgcgg ccgg cctgag tgggtgtggc ctccgccaaa ggccccgccc ctagagcgcg tcgcgagggg cgcgaggggc ggggcgaggg aactggcaag aaagggcg (SEQ ID NO: 13)

5_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide taaaatatat acctattcaa aacaaacacc gg

Unmethylated specific oligonucleotides taaaatatat acctattcaa aacaaacacc aa

Common oligonucleotide ccactc acccacacca aaaacaattt ccaaaac

6. RERG (NT_009714); RAS-like, estrogen-regulated, growth inhibitor

gg agcctggagg cttggaaata accagtgaaa aagggaagcc cgtcttgggt gcagcacgtt aaagacccaa gctcgcaagc ctgggaggca gcgcggcggg aggagcctgc ccctgccccc agtagggggc gccgaagcgc cgcactgcag catcctggcc gctgagcgca gcggccttgg ccgg gctcag ctcgcgtcct gccgcagtcc ctccgccgct agtc (SEQ ID NO: 16)

6_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide ataaaaccaa caactcacat caccaaaacc gg

Unmethylated specific oligonucleotide ataaaaccaa caactcacat caccaaaacc aa

Common oligonucleotide cccaaatc aaacacaaaa caacatcaaa aaaac

7. THBD (NT_011387); Thrombomodulin

cgccag ggcagggttt actcatcccg gcgaggtgat cccatgcgcg agggcgggcg caagggcggc cagagaaccc agcaatccga gtatgcggca tcagcccttc ccaccaggca cttccttcct tttcccgaac gtccagggag ggaggg ccgg gcacttataa actcgagccc tggccg

aaaaaactta caaatccctc cctcccaa cc cataaatatt taaactcaaa accaac

 (SEQ ID NO: 19)

7_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaaaaactta caaatccctc cctcccgg

Unmethylated specific oligonucleotides: aaaaaactta caaatccctc cctcccaa

Common oligonucleotide: cc cataaatatt taaactcaaa accaac

8. TP53INP1 (NT_008046); Tumor protein p53 inducible nuclear protein 1

ctccca gcaccctggc tacacgtcta accctaggct gaccaggtgg ggctctcgga ggcgttagcc ccagccctcc caggagtctt aatgttcctc tcacaggaaa aaacgttctg cgccctttgt gccccaaacc ctcgaccctt cactcggcga gaggggtcgc tgagggagag atccacctct gcccttcccg ttgcccg ccg g ttcttcctc gcccgcctct tac (SEQ ID NO: 22)

8_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: taaataaaaa caaaaaaaac aacaaacgg

Unmethylated specific oligonucleotides: taaataaaaa caaaaaaaac aacaaacaa

Common oligonucleotide: c caaaaaaaaa caaacaaaaa ata

9. MGC11324 (NT_016354); Hypothetical protein MGC11324

ggtggcttc agcccagacc tgggcagcca gcggagaaag agttaactgg caggggcgag gaggagccca gggaggaagg aaggatattg ccgtaattct gaaagttttt ttccttcctc tcttcccttc gcagaggtga gtg gct ccgg cggcgctctg ctcctggagc tcccgcggga ctgcctgggg acagggactg ctgtggcgct cggccctcca ctgcggacct ctcctga (SEQ ID NO: 25)

9_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaaaaaaaaa aaaaaaaaaa catctccact cacgg

Unmethylated specific oligonucleotides: aaaaaaaaaa aaaaaaaaaa catctccact cacaa

Common oligonucleotides: cccaa accacaaaac aaaaacctc aaaac

10. ZFHX1B (NT_005058); Zinc finger homeobox 1b

(SEQ ID NO: 28) cctgcctccc gacactcttg gcgaggtttt tgtacagttt gct ccgg gag ctgtttcttc gcttccacct ttttctcccc cacacttcgc ggcttcttca tgctttttct tctcaccatt tctggccaaa actacaaaca agacttcgca ggtaggtttt ttttcctccc cttttctctc tttttatccc tttttggtgt gctcgtcctc catcc

10_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaac cactccaaaa acatatcaaa caagg

Unmethylated specific oligonucleotides: aaac cactccaaaa acatatcaaa caaaa

Common oligonucleotides: ccctc aacaaaaaaa caaaaataaa aaaaaaaaaa

11. ADRB2 (NT_029289); Adrenergic, beta-2-, receptor, surface

gagctgggag ggtgtgtctc agtgtctatg gctgtggttc ggtataagtc tgagcatgtc tgccagggtg tatttgtgcc tgtatgtgcg tgcctcggtg ggcactctcg tttccttccg aatgtggggc agtg ccgg tg tgctgccctc tgccttgaga cctcaagccg cgcaggcgcc cagggcaggc aggtagcggc cacagaagag ccaaaagctc ccgg gttggc tggtaaggac accacctcca gctttagccc tatatcttctc aattttcaaa aa cccaacca accattccta taataaaaat caaaatc

(SEQ ID NO: 31)

11_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaac aaaaaaaaac ttacacccca tcacgg

Unmethylated specific oligonucleotides: aaac aaaaaaaaac ttacacccca tcacaa

Common oligonucleotide: ccac acaacaaaaa acaaaactct aaaattc

11_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cca tccatcacca atatcttctc aattttcaaa gg

Unmethylated specific oligonucleotides: cca tccatcacca atatcttctc aattttcaaa aa

Common oligonucleotide: cccaacca accattccta taataaaaat caaaatc

12. AR (NT_011669); Androgen receptor (dihydrotestosterone receptor; testicular feminization; spinal and bulbar muscular atrophy; Kennedy disease)

ggacccga ctcgcaaact gttgcatttg ctctccacct cccagcgccc cctccgagat c ccgg ggagc cagcttgctg ggagagcggg acggt ccgg a gcaagcccac aggcagagga ggcgacagag ggaaaaaggg ccgagctagc cgctccagtg ctgtacagga gccgaaggga cgcaccacgc cag (SEQ ID NO: 34)

12_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide aataaa aaatcacaaa aaaaactcta aaa

Unmethylated specific oligonucleotide aataaa aaatcacaaa aaaaactcta aaa

Common oligonucleotide cccctca atcaaacaac cctctcaccc taccaaa c

12_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotide cccctca atcaaacaac cctctcaccc taccagg

Unmethylated specific oligonucleotide cccctca atcaaacaac cctctcaccc taccaaa

Common oligonucleotide cct cattcaaata tccatctcct ccactatctc

13. BLVRB (NT_011109); Biliverdin reductase B (flavin reductase (NADPH)

tttctcccct tgctggttct gggaggccct ggggcttaga gtgcgcccca gatccgctcc aggct ccgg g agagggggcg tgagctacga gaggccgtgg gtgaggctcg cctggccccgc ccctct ccgg gaggtggagc gcggaggcag ggcgctgagt gacaagttat ctcggctccg tccactctat ttgttgctat gtggaggcgt ggccttctgt ggccccgcct tccagtctaa gtggcgcgca gagag (SEQ ID NO: 37)

13_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: ct cacacaaaat ctaaacaaaa tccaagg

Unmethylated specific oligonucleotides: ct cacacaaaat ctaaacaaaa tccaaaa

Common oligonucleotide: ccc tctcccccac actcaatact ctccaacacc

13_2. Methylation-related oligonucleotides

Methylation specific oligonucleotide: ccaacacc cactccaaac aaaccaaaaca aaaaaagg

Unmethylated specific oligonucleotides: cacc cactccaaac aaaccaaaaca aaaaaaaa

Common oligonucleotides: ccc tccacctca cacctccatc ccacaactc

14. CALCR (NT_007933); Calcitonin receptor

cct gtgtttacgc ggcgctttag tctc ccgg ac tcgcagggtg agccccagcc ctgactggag cgagacagca gccgcgagcg cagccccact cgcggg ccgg ggcgactggg gctggcgcga ggctcacgga gctcaccagc tcgcccctcc ctctcctggg acaggagggg gctgactggg gtggcggggt ccgg gaaggg gggctggctc tcatcaattc tgctgc (SEQ ID NO: 40)

14_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaa cacaaataca ccacaaaatc aaaagg

Unmethylated specific oligonucleotides: aaa cacaaataca ccacaaaatc aaaaaa

Common oligonucleotides: ccta aacatcccac tcaaaatcaa aac

14_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: caacactcac atcaaaataa acacccgg

Unmethylated specific oligonucleotides: caacactcac atcaaaataa acacccaa

Common oligonucleotide: cc ccactaaccc caaccacact ccaaatacc

14_3. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cctcccc caactaaccc caccacccca gg

Unmethylated specific oligonucleotides: cctcccc caactaaccc caccacccca aa

Common oligonucleotide: cccttccc cccaaccaaa aataattaaa ac

15. CDH2 (NT_010966); Cadherin 2, type 1, N-cadherin (neuronal)

tct aaactcccag ggggacaaaa aaaacaaaac agaacacaaa acttgggctg tccagtacat ctcaagggtg gagctgaag tgcgagctcc gagaggagcc cggcctccg cctcccccgc cgcaggtggc tc ccgg cgag gcctcagaca caatagctag atgagcttgg ctgcgtcct agttt

(SEQ ID NO: 43)

15_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: ccaaaaac aaaaaaaca acatccacca aagg

Unmethylated specific oligonucleotides: ccaaaaac aaaaaaaca acatccacca aaaa

Common oligonucleotide: ccactc caaaatctat attatcaatc tactcaaacc

16. CKAP4 (NT_019546); Cytoskeleton-associated protein 4

ggctggattt tggacagcct tttttgtctc cgccttcaaa cccaaggcaa aggacaaggc ccaaccccat ggcgggctggg agagtgaaag cagggggagt cccccaattc ccagcggaaa ggaagggcgat ctgttcccac ccgctgactc ccactc ccgg g gccagggctc cttgggcgcc ccccttcatt tctctcctct ccgcacaggt c (SEQ ID NO: 46)

16_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cta aacaaaaata aacaactaaa aaaaagg

Unmethylated specific oligonucleotides: cta aacaaaaata aacaactaaa aaaaaaa

Common oligonucleotides: ccc caatcccaaa aaacccacaa aaaaaaataa

17. CYBRD1 (NT_005403); Cytochrome b reductase 1

ggagacagcc ccaagaagtc gacgcc ccgg tcccgccgcc cggccactac ccagagggctc ctctatcaa aattcttcaa ctacaaaa cc aaaacaacaa accaataata aatctccc gccgccgcct ctccaagttc ttgtggcccc cgcggtgcgg agtatggggc gctgatggcc atggagggct actggcgctt cctggcgctg ctggggtcgg cactgctcgt cggcttcctg tcggtgatct tcgccctcgt ctgggtcctc cactaccgag a (SEQ ID NO: 49)

17_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cctctatcaa aattcttcaa ctacaagg

Unmethylated specific oligonucleotides: cctctatcaa aattcttcaa ctacaaaa

Common oligonucleotides: cc aaaacaacaa accaataata aatctccc

18. GFPT1 (NT_022184); Glutamine-fructose-6-phosphate transaminase 1

tcctcctctt tcctcgcttcg tgcagtgctgg cgcctggggc ctggggctgc acggggcacg cac gct ccgg attgctttgc taacaattcc atccttctct ttccgtcatt ccctgccagg tgctgagttt ctccctccct ctcggctcgg tccctcccgc ggctcgcccc ggggcgggcg tctccaggaa ctccaggc (SEQ ID NO: 52)

18_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cccca aaccccaaca taccccatac atagg

Unmethylated specific oligonucleotides: cccca aaccccaaca taccccatac ataaa

Common oligonucleotides: cccaa taacaaaaca attattaaaa taaaaaaaaa

19. GOLPH2 (NT_023935); Golgi phosphoprotein 2

acggcctcat agggcttctc aaacatcagtg cgcctgagcg tcatctgagg cgctgtttca

aatgcagctg c ccgg gcta taagatcaca cccgaaggcg t ccgg gaatc ttcacttttt

ccgttgctag cagtggaagg gtcacagacc aaacactaag gcctgagcgg tgacaaccga

ggcgagatga tggtcaacag ggaatgcc (SEQ ID NO: 55)

19_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aatagactcc acaacaaaat ttacatcaac agg

Unmethylated specific oligonucleotides: aatagactcc acaacaaaat ttacatcaac aaa

Common oligonucleotide: cccaat attctaatat aaacttccac a

19_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: cccaat attctaatat aaacttccac agg

Unmethylated specific oligonucleotides: cccaat attctaatat aaacttccac aaa

Common oligonucleotides: cccttaa aaataaaaaa aacaacaatc atcaccttcc

20. HHEX (NT_030059); Hematopoietically expressed homeobox

gcagggaagt ctttccattt ccatgattaa tggaggacct tagcagaaac ggctcaccgc gaggtgtgac gaccgcagga gggcgtcaat caagaaaatg cccccttgcc ccgg aggcga

gtggagccgc acagagccga ggccatacgg gccagcagta cggactgctt caatagaaaa

cacgtgcaaa accagagagc cagactgcg (SEQ ID NO: 58)

20_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: acaatta attcttttac aaaaaaacaa gg

Unmethylated specific oligonucleotides: acaatta attcttttac aaaaaaacaa aa

Common oligonucleotide: cctccact cacctcaaca tatctcaact ccaatatacc

21. LAMA2 (NT_025741); laminin, alpha 2 (merosin, congenital muscular dystrophy)

cctagctgt ttgcatttcc cagaaataat gttttccatg tgtagggatt ttacagattt caaagtgctt tcatgtcaat tactttcttt aatttaaaag aagttcagat accaggtcaa gctaggaatg at ccgg tctc

agagggaagg agcgctctag gaaaggagga tcctttaata gagggccgtc ctggggccgc

(SEQ ID NO: 61) gggcatgg aaggcgagag tggaggagtg tcctctttct cccccaccct caggcggcgg ccgg ccaaa gccagagggg gctgtctcct cctcttcccc agcagctgct gctcgctcag ctcacaagcc aaggccaggg gacagggcgg cagcgactcc tctggctccc gagaagtgg

21_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: caaatcta taatccaatt caatccttac tagg

Unmethylated specific oligonucleotides: caaatcta taatccaatt caatccttac taaa

Common oligonucleotide: ccaaaa tctcccttcc tcacaaaatc cttt

21_2. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaaaaa aaaaataaa atccaccacc agg

Unmethylated specific oligonucleotides: aaaaaa aaaaataaa atccaccacc aaa

Common oligonucleotides: ccaatt caatctcccc caacaaaaaa

22. CPEB3 (NT_030059); cytoplasmic polyadenylation element binding protein 3

taagggggtc attcccctga aagataac cc gg ttcttgcc agtgacatcg ctgacaaaca cttcacaagt tggggagggg gaagggggag gggaagaggg taaggaaaac taattttgtg gattaacagg agtccctctc aggtcaaaac ggggttccaa ggaaaccaga cgccactcct tagctaagtt tcacccaaag tctacgaccc aggccg (SEQ ID NO: 64)

22_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotide: attcccccaa taaaaaaact ttctattaagg

Unmethylated specific oligonucleotides: attcccccaa taaaaaaact ttctattaaaa

Common oligonucleotides: ccaaaaacaa tcactataac aactatttat

23. HTR1B (NT_007299); 5-hyroxytryptamine (serotonin) receptor 1B gene

gggagcttcc ttggccagga aaggaacagg gcggggggaa aagagggagg gagagagaaa aagggaaggt gatggggagc gggcgtccgc acccgccgcg ccgcacgagt tgcactgctc tggcggaccg gacctggact ctatataaag agcccatctg ctccgtagct cgcacgcttc tc ccgg gctg gtgcagcgccg cgtccctcca gctcccccag acacctgccc cttcccagtg tgccgcgcca ggtcctccag acccgcgcac ccagtggcat ggctccgagt ggctcccgtg ggaccagggt ggcggtggcg gcggcgcggc ccgagcagcc gcaactccag cccccgtgtc ccccctttta tggctccgtc tccgcggggc agctcgtccg agtggccaga gagtgaaaag agagggaggg cagag (SEQ ID NO: 67)

23_1. Methylation-related oligonucleotides

Methylation-specific oligonucleotides: aaaacatcaa acatacaaag aagg

Unmethylated specific oligonucleotides: aaaacatcaa acatacaaag aaaa

Common oligonucleotide: 5-cccaac cacatcacaac acaaaaaaat

In the above, "CCGG" in the form of bold indicates a methylated site and is also a site recognized by the methylation-sensitive restriction enzyme HpaII.

Example 3 Hybridization and Coupling of Nucleic Acids, MROs and TSOs Containing Target Nucleic Acids

The hybridization and ligation reactions were performed at 95 ° C for 1 min, 70 ° C for 1 min, 68 ° C for 1 min, 66 ° C for 1 min, and 64 Lt; 0 > C for 3 minutes. The 10-ml reaction solution contained 20 mM TrisHCl (pH 7.6), 25 mM sodium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, 1 mM NAD ⁺ , 0.1% Triton X-100, MRO and TSO (500 pM each) prepared in Example 1, unit Taq DNA ligase (New England Biolabs, MA, USA) and 100 DNA prepared above.

Example 4: Amplification reaction

The amplification reaction was carried out in a reaction solution below at 95 ° C for 3 minutes using a PCR instrument, followed by 42 cycles consisting of 95 ° C for 10 seconds, 56 ° C for 10 seconds and 72 ° C for 20 seconds. The 25-ml reaction solution contained 10 mM Tris HCl (pH 8.6), 50 mM KCl, 2.5 mM MgCl 2, 5% (v / v) glycerin, 1 U Taq DNA polymerase, 1 pmol forward signal primers (P1 and P2) Primer (P3) and 2 ml of the reaction solution of Example 2. The signal primer is a signal primer that has a completely complementary bond to a single-stranded nucleic acid having a nucleotide sequence corresponding to an unmethylated specific oligonucleotide. The signal primer includes a forward primer labeled with a Cy3 labeling substance and a single strand with a base sequence corresponding to a methylated specific oligonucleotide A forward primer labeled with a Cy5 labeling substance as a signal primer that is completely complementary to the nucleic acid, and a reverse primer that is a signal primer that makes a completely complementary binding to a single-stranded nucleic acid having a base sequence corresponding to the TSO Which was prepared by organic synthesis (Bioneer).

Example 5: Capture probe and array fabrication

In order to identify genes having various methylation-related nucleotide sequences, the above-mentioned trapping probes are used as capture probes having a base sequence that perfectly complementary to the T region of TSO corresponding to a gene having a methylation-related base sequence 2) were organically synthesized (Bioneer) and the acquisition probes were fixed to the array.

A nucleic acid chip in which the capture single stranded nucleic acid was stuck to a certain rule was prepared using UltraGAPSTM Coated Slide (Corning), a glass slide coated with GAPS (Gamma Amino Propyl Silane). A pin-type microarrayer system (GenPak) was used to produce the nucleic acid chip, and the spot spacing was set to be 150 탆 center-to-center. Each of the captured single stranded nucleic acids was dissolved in a standard solution to adjust the concentration. At this time, the humidity in the air layer was maintained at 70% to perform spotting. The spotted slides were left in a humidified chamber for 24 to 48 hours and baking was performed in an UV crosslinker. After the capture single stranded nucleic acids were immobilized on a glass slide in a well known manner, the slides were immediately centrifuged and dried, and then stored in a light-blocked state. The substrate in the method of manufacturing the array is a glass slide glass. At this time, the substrate coated with an amine group, an aldehyde group or the like may be used. For example, the captured single-stranded nucleic acids are arrayed and fixed by using UltraGAPSTM Coated Slide (Corning), which is a glass slide coated with GAPS (Gamma Amino Propyl Silane).

The preparation of the array according to the above can use a microarrayer system and the concentration of each single stranded nucleic acid is dissolved in a buffer to keep the humidity in the layer at 70 to 80% and spotting is performed. The spotted slides are left in a humidified chamber and then baked in a UV crosslinker.

As such, the array according to the present invention can be obtained by immobilizing captured single-stranded nucleic acids on a glass slide in a manner well-known in the related art, immediately after centrifuging the slides, and storing them in a state of being shielded from light until use .

Example 6 Array Hybridization and Analysis

The amplification product having the methylation-related base sequence in Example 3 was treated with the capture probe of the array of the present invention, hybridized at 60 ° C for 4 to 12 hours, and washed with 0.1 x SSC solution at 42 ° C. Wherein the hybridization solution comprises 1 M sodium chloride, 0.3 M sodium citrate, 0.5% SDS or 100 / Salmonella DNA, 0.2% bovine serum albumin or single stranded nucleic acid. After performing hybridization, the array was washed with wash solution. The composition of the washing solution is, for example, 1X SSC + 0.2% SDS, 1X SSC + 0.2% SDS, 0.5X SSC + 0.2% SDS and 0.01X SSC + 0.2% SDS. Minute.

≪ Example 7 > Spot search and analysis of arrays

After the washing of Example 4 was completed, the glass slide was dried by centrifugation, and then a laser scanner (GenePix4000, manufactured by Nippon Kayaku Co., Ltd.) having a laser (Cy5, 635 nm) having an appropriate wavelength for exciting the used fluorescent dye, Axon). The fluorescent images were stored in a multi-image-tagged image file (TIFF) format and analyzed with appropriate image analysis software (GenePix Pro 3.0, Axon).

The signal intensity per spot is obtained by subtracting the fundamental signal of the surrounding background, where the background signal is a local background consisting of the surrounding signals of the four spots around a particular spot ). If more than 90% of the pixels in the spot have a signal intensity that exceeds the background signal + 2 standard deviation (SD), they are included in the data analysis. If the above condition is not satisfied, they are not included in the data It is generally classified as a bad spot and not included in the analysis.

The variation according to labeling efficiency is normalized (eg, Normalized Intensity = Probe Intensity / IS intensity) by using an internal standard (IS) signal, and in the case of monolabeling The result is recorded with the signal intensity of the Cy5 channel, and the mean value is used when the spotting becomes twice or more. The signal intensity (S) of the target single-stranded nucleic acid determines the signal intensity for each pixel of the spot and then uses the median value of the pixel-by-pixel ). The signal strength (S) normalizes the deviation according to the labeling efficiency using the internal standard (IS).

 S '(normalized value) = S (Cy5-reference) x (Cy5-IS).

In this way, the relationship between the pixel density analysis result and the actual sample amount can be identified and the correlation can be confirmed.

The degree of fluorescence of the spot varies depending on the nature of the double strand formed by the single-stranded nucleic acid with the capture probe and the labeling substance of the amplification product, and the signal of the single-stranded nucleic acid with the labeling substance of the amplification product in the spot composed of the single- .

The base sequence of the single-stranded nucleic acid and the array capture probe having the methylation-related base sequence and the labeling substance originating from the amplification product is determined by the double-stranded stability of the single-stranded nucleic acid-capturing probe and the labeling substance in the spot of the array and the methylation- The amount of single stranded nucleic acid affects the degree of fluorescence.

That is, the degree of fluorescence represents the amount of the single-stranded nucleic acid having the labeling substance and the methylation-related base sequence, and the amount of the single-stranded nucleic acid having the labeling substance and the methylation-related base sequence indicates the amount of the specific gene in the biological sample.

From the color spectrum of the spot, the methylation rate of a specific gene for methylation-related nucleotide sequence can be confirmed in a biological sample containing a specific gene corresponding to a spot. Finally, by analyzing the color spectrum of the spot formed and confirming the degree of all the spots in the array, it is possible to confirm the distribution pattern of methylation status and ratio in the biological sample.

In other words, the color spectrum of blue-yellow-red spots formed shows that the ratio of Cy-3-labeled single-stranded nucleic acid bound to capture single-stranded nucleic acid to Cy-5-labeled single- And the degree of the color spectrum of a particular spot represents the amount of a particular nucleotide variation so that the image showing the color spectrum of all spots on the nucleic acid chip corresponds to the nucleotide variation distribution in a particular biological sample.

That is, in the methylation determination method and ratio analysis method of the present invention, the single strand nucleic acid labeled with Cy-3 and the single-stranded nucleic acid labeled with Cy-5 which form double strands by binding to the capture probe at a specific spot are composed of Unmethylated nucleotide sequence, the latter being in proportion to the methylation-related nucleotide sequence. Thus, a particular spot is blue if it is relatively small, yellow if it is similar, and red if it is present in excess.

On the array, the spot has a different degree of fluorescence depending on the number of single-stranded nucleic acids with double-stranded labeling material, which correlates with the presence or absence of specific methylation. Thus, the image reflecting the color spectrum of all the spots constituting the array of the present invention exhibits the methylation distribution of a biological sample containing various specific genes.

The result of the above test is as shown in FIG. 2. As shown in FIG. 2, in a glass slide with a capture probe attached thereto, a spot on which a capture probe based on a single-stranded nucleic acid having a labeling substance and a methylation-related base sequence is attached has various degrees of fluorescence, - yellow-red color spectrum.

According to the present invention, it is possible to analyze the methylation status and the ratio of a specific gene in a biological sample containing a specific gene, and simultaneously analyze the methylation-related base sequence of one or more genes to determine methylation status and ratio of the genes of the biological sample And an image composed of spots of low-ray can be used to know the distribution of methylation of a biological sample.

Claims (14)

Treating the sample DNA containing the specific gene to be analyzed with sodium bisulfite;
Methylation related oligonucleotides (MROs) composed of an oligonucleotide enabling ligation when the specific gene is methylated and an oligonucleotide enabling the linkage when the specific gene is unmethylated, And preparing a target specific oligonucleotide (TSO) completely complementary to the base sequence complementary to the base sequence complementary to the 3 'end of the MROs;
Hybridizing the sodium bisulfite-treated nucleic acid with the prepared MROs and TSO to form a partial double-stranded nucleic acid;
Linking the 3 'end of the MROs and the 5' end of the TSO in the partial double strand to form a double stranded nucleic acid;
Amplifying the double strand as a template with a signal primer pair to form an amplification product having a methylation-related base sequence with a labeling substance; And
Analyzing a signal generated in the acquisition probe which has completely complementary to base sequences of single-stranded nucleic acids having a methylation-related base sequence by hybridizing the amplification product and a capture probe;
Methylation of a gene using an oligonucleotide having a methylation-related base sequence and a capture probe, and a method for analyzing the ratio The method according to claim 1,
A region (P) in which the forward primer of the pair of signal primers that amplify the specific gene having the methylation-related base sequence completely complementarily binds, a region complementary to the base sequence adjacent to the methylation-related base sequence of the specific gene A methylation-related nucleotide sequence complementary to the methylation-related nucleotide sequence, and a region (V) that completely complementarily binds to a part of the methylation-related nucleotide sequence, and the like, and an oligonucleotide having a methylation-related base sequence And methylation of the gene using the capture probe The method according to claim 1,
A region (H) completely complementary to a base sequence of a specific gene including a part of the methylation-related base sequence, a region (T) completely complementary to the acquisition probe and a specific gene having the methylation- And a region (P) completely complementary to the reverse primer of the pair of signal primers amplifying the methylation of the gene using the oligonucleotide having the methylation-related base sequence and the capture probe. Ratio analysis method 3. The method according to claim 1, wherein, in order to analyze the specific gene characterized by 5'-CCGG-3 ', wherein the methylation-related base sequence is a nucleotide sequence having a high frequency in a CpG island, Wherein a base for complementary binding is determined according to whether methylation of a CC base which is a part of the methylation-related base sequence is determined, and wherein the 5-terminal of the TSO is composed of a base complementary to a GG base which is a part of the methylation-related base sequence , Methylation of genes using oligonucleotide with methylation-related base sequence and capture probe and analysis of ratio Claim 1
An oligonucleotide having a methylation-related base sequence, which is characterized by a capture probe capable of perfectly complementary binding with single-stranded nucleic acids having a methylation-related base sequence of the amplification product and capable of identifying a specific methylation-related single- And methylation of the gene using the capture probe The method of claim 5, wherein
An oligonucleotide having a methylation-related base sequence and a DNA-binding base sequence having a methylation-related base sequence, characterized by a capture probe that completely complementarily binds to a marker substance of the amplification product and a region corresponding to the T region of TSO in a single-stranded nucleic acid having a methylation- METHODS FOR DETERMINATION OF METHYLATION AND RATIO OF GENE BY USING A SEQUENCE The method according to claim 1,
A method for determining methylation of a gene using methylation-related oligonucleotides and a capture probe, characterized in that one or more of the above-mentioned capture probes are immobilized on a support 8. The method of claim 7, wherein the support on which the acquisition probes are fixed comprises a glass slide, a sensing surface of the biosensor, beads, nanoparticles, etc. The oligonucleotide having the methylation- Of methylation and ratio analysis The method according to claim 1,
Wherein the linking reaction proceeds to a Taq DNA ligase that readily identifies the complementary binding state of MROs and the methylation-related base sequence with the single-stranded nucleic acid of the specific gene in the partial double strand. METHODS FOR DETERMINATION AND METHOD OF Methylation of Gene Using Oligonucleotides and Capture Probes The method according to claim 1,
Wherein the signal primer is composed of a forward signal primer consisting of a labeling substance and a base sequence determined according to the methylation status and a reverse signal primer composed of a base sequence irrespective of the methylation or not, pair In order to analyze whether or not the methylation of a gene of a nucleic acid-containing biological sample containing a specific gene having a methylation-related base sequence is methylated, single-stranded nucleic acids having a labeling substance of an amplification product made according to whether the specific gene is methylated or not An acquisition probe for identifying the presence or absence of methylation by analyzing a signal generated in an acquisition probe that makes complementary binding to the detection probe, and an array comprising one or more of the acquisition probes The method according to claim 1,
Methylation of a gene using an oligonucleotide having a methylation-related base sequence and a capture probe, characterized in that the presence or absence of methylation is identified by a signal generated from a labeling substance of an amplification product bound to the capture probe The method according to claim 1,
Methylation of a gene using an oligonucleotide having a methylation-related base sequence and a capture probe, characterized in that the methylation ratio is analyzed as a result of analyzing a signal generated from the labeling substance of the amplification product combined with the capture probe The method according to claim 1,
Methylation of a gene using an oligonucleotide having a methylation-related base sequence and a capture probe, characterized in that the methylation ratio is analyzed as a result of analyzing a signal generated from the labeling substance of the amplification product combined with the capture probe

Images