KR20150019119A - Cyclized poly Fas Targeting Peptides and Uses Thereof - Google Patents

Abstract

The present invention relates to: cyclized poly fas targeting peptide (FTP) in which a monomeric FTP is cyclized; and use thereof. The cyclized poly FTP has substantially excellent binding affinity with respect to Fas or FasL compared to a monomer FTP. Moreover, the cyclized poly FTP inhibits Fas-induced apoptosis generated in fat tissue or adipose tissue macrophages (ATMs) and inhibits production of Fas-induced pro-inflammatory cytokine and chemokine. Therefore, a pharmaceutical composition containing the cyclized poly FTP as an active ingredient can be very effectively applied for alleviating or treating diseases, disorders, or conditions related to Fas.

Description

≪ Desc / Clms Page number 1 > Cyclic Poly Fas Targeting Peptides and Uses Thereof &

The present invention relates to a circular poly FTP with at least three monomeric FTP cyclisations and uses thereof.

Obesity and related morbidities

Over the past several decades, the incidence of human obesity has reached epidemic levels at an alarming rate both in developing countries and globally (1, 2). According to recent reports from the World Health Organization (WHO), this figure is expected to increase significantly in the years to come, unless billions of adults are overweight and 300 million are obese and are not controlled by intervention (3, 4).

Obesity is the result of increased body mass index (> 30 kg / m ² ) with increased energy consumption over energy expenditure. Obesity-related pathological conditions include type II diabetes (T2D), hepatic steatosis, dyslipidemia, hypertension, neurodegeneration, and certain types of cancer (5-8). And has a profound effect on shortening the life span. Obesity-related mortality and co-morbidities are higher than deaths associated with underweight and associated comorbidities (3). Type 2 diabetes is the fifth leading cause of death worldwide (9). It is known that about 75% of obese patients suffer from fatty liver, which is a liver disease that has fatty liver and more than 20% of them are exacerbated (10). These facts imply the importance of obesity complications in the drug development process and the necessity of medical management and related treatment methods to deal with obesity problems.

Obesity and inflammation

Obesity is associated with a low level of chronic inflammation induced by metabolism in the natural state of high fat diets (HFD). In response to the surplus metabolic signal, metabolic cells such as adipocytes endure damage and activate the inflammatory program. With this onset, if it continues over time, a complete platform for inflammation will be established, ultimately destroying metabolic homeostasis (4, 11-12).

Adipose tissue, a metabolic reaction organ, increases production of a variety of pro-inflammatory cytokines and chemokines in response to an increased metabolic signal from high fat dieting, leading to the origin of major inflammation do. Originally, adipose tissue produces cytokines such as IL-1β and TNF-α and chemokines such as CCL2 (MCP-1), CCL3, CCL4, CCL5 and CCL8 at moderately low levels (13-16). The endothelial cells respond to the increased expression of the adhesion molecules and the increased vascular permeability to release cytokines and chemoattractants induce immune cells to the adipose tissue (Fig. 1, 15). Invaded immune cells such as T-cells, mast cells and macrophages regulate low-level, appropriate inflammatory conditions into a persistent chronic inflammatory state. As a result of the inflammatory reaction, the infiltrated macrophages in the adipose tissue are called ATMs (adipose tissue macrophages).

In both humans and rodents, ATMs in adipose tissue increase the severity and weight of obesity. Although the CCL2-CCR2 axis is considered to be the central chemotactic signal involved in the ATM recruitment process to inflamed adipose tissue, recent studies have shown that different CCL3 / CCL4 / CCL5 / CCL8-CCR5 interactions And that the action contributes to the ATM regression (15, 16, 17). When ATMs enter fat tissue, most are activated to produce proinflammatory cytokines. In nature, tissue macrophages are classified as "M1 or traditionally activated" pro-inflammatory macrophages or "M2 or selectively activated" non-inflammatory macrophages because they exhibit phenotypic heterogeneity . M1 is a deleterious macrophage activated by interferon gamma (IFN-y) and TNF-a, producing a pro-inflammatory cytokine associated with insulin resistance and is mainly associated with obesity fat tissue. On the other hand, M2 macrophages are activated by IL-4, IL-10 and IL-13 and are generally associated with dry fat tissue. Overall, M1 macrophages tend to trigger chronic inflammation and tissue damage, whereas M2 macrophages tend to resolve tissue inflammation and increase wound healing (18-20). In addition, obesity factors associated with sustained nutrient stress increase the shift to M2's M1 polarization. As a result of the polarization shifts, TNF-α, IL-6, iNOS, MCP-1 and IL-1β together with a decrease in M2 factors such as IL-10, arginase- Expression of M1 ATM-associated pro-inflammatory molecules is markedly increased. The above-mentioned M1 cytokines lead to more harmful cycles that do not end up leading more immune cells to adipose tissue and regressing (Fig. 1). In both humans and rodents, the number of ATMs increases in proportion to body weight and the excreted inflammatory cytokines also increase to contribute positively to insulin resistance. Knock-out studies targeting CCR2, CCL2 and CCR5 associated with regression of macrophages to adipose tissue have reported that impaired macrophage infiltration into adipose tissue mitigates insulin resistance and fatty liver [15,16] , 17).

IL-8 (KC; mouse analogue of IL-8), MCP-1 and IL-8, even though the relative amounts of cytokines produced by adipocytes are unclear compared to ATMs Inflammatory cytokines such as IL-1β (20). Cross-talk between adipocytes and ATMs increases the inflammatory environment by synergizing with each other and directly affects insulin signaling in adipocytes through autocrine / paracrine signaling And provides a link between inflammation and insulin resistance by inducing systemic insulin resistance through endocrine signaling (15-16).

Mechanisms of Obesity-Associated Inflammation and Insulin Resistance

In obese adipose tissue, inflammation triggers insulin resistance by triggering NF-κB and JNK (c-Jun N-terminal kinase) pathways. The pathways described above are activated by proinflammatory stimuli, including TNF-a which is the result of the activation as well as activating NF-kB. Separately, the two pathways described above are activated by TLRs (toll-like receptors) as well as by free fatty acids (FFAs) that are increased in obese conditions (21, 22). FFAs released from adipose tissue are induced in adipocytes by TNF-α and are caused by increased lipolysis (23).

Overall, the obesity-induced activation effects of NF-κB are similar to those of IL-6, IL-10, TNF-α, IL-1β, MCP-1, IL- ), PAI-1, and the like, primarily through the synthesis of NF-κB gene products, which function and mediate primarily at the transcriptional level, either directly or indirectly through autophosphorylation and downstream signaling of the insulin receptor resulting in insulin resistance Indirect suppression is induced (11,13,20). In contrast, the JNK activation effect is mediated through serine / threonine kinases that result in the phosphorylation of IRS (insulin receptor substrates) to specific serine residues. Phosphorylation in certain serine residues of IRS reduces tyrosine phosphorylation of IRS by reducing affinity for insulin receptor kinase, thereby reducing insulin signal transduction (24, 25).

Link between fatty tissue inflammation and liver insulin resistance / steatosis

Fat tissue is a large endocrine organ that secretes a variety of factors that can affect other tissues and organs in the body. The organs involved in the glucose homeostatic process, such as liver and muscle, always cross-tag (9). Over-secretion of inflammatory cytokines and FAAs from obese adipose tissue is a major cause of liver and muscle metabolic imbalance.

Adipose tissue inflammation is associated with hepatic insulin resistance and fatty liver and, when left untreated, progresses to a worsening inflammatory condition, often known as hepatitis (26, 27). Increased regression of ATMs in obese adipose tissue results in the production of several pro-inflammatory cytokines. Among these, IL-6 is considered a possible candidate to provide a link between adipose tissue inflammation and hepatic insulin resistance and hepatitis. Previously reported in vitro studies have clearly shown that treatment of IL-6 with hepatocytes induces insulin resistance. In in vivo , IL-6 phosphorylates the 307th serine residue of IRS-1 in C57BL / 6J mice and activates the negative insulin signaling regulator SOCS-3 (28-32).

In addition to the IL-6 signaling effect, the fat-dissolution rate increases as a result of insulin resistance in adipocytes, leading to an increased transport of FAAs to the liver, thereby increasing liver triglyceride content, which contributes to hepatic insulin resistance / 27).

Role of Fas (CD95) in obesity-associated inflammation

Fas (CD95) -mediated apoptosis signaling

Fas (CD95), known as a cell death receptor, is a member of the TNF (tumor necrosis factor) receptor superfamily and is activated with FasL (CD178) to induce apoptosis in several cell types (33). Fas activation-mediated PCD (programmed cell death) is dependent on adapter molecules called Fas-associated proteins with death domain (FADD). Through trimerization, the Fas receptor regresses FADD to initiate proteolytic cleavage of caspase-8 (FLICE) and ultimately to activate caspase-3, an effector caspase Resulting in poptosis (34). The execution of the Fas-mediated apoptotic signal can be inhibited by a FILCE inhibitory protein (FLIP) with affinity for FADD, and Fas binds to FLICE and FADD. Thus, the end result of apoptosis is determined by whether FLICE interacts with FADD (35).

Fas-mediated non-apoptotic inflammatory signaling

Unlike TNF-α, whose function in apoptosis is well established, Fas as a member of the TNF superfamily is known to induce non-apoptotic signaling in certain types of cells (FIG. 2; 36, 37). Fas activation is induced by several cytokines such as IL-6, IL-8 (KC), IL-1α, IL-1β, MCP-1 and TNF-α in many different types of cells such as macrophages, mature adipocytes, (38-44). In addition, the Apart from inducing apoptosis, Fas activation has also been found to be involved in chemokine and cytokine expression and neutrophil regression.

Although little is known about the exact mechanism involved in Fas-mediated non-apoptotic signaling, FLIP appears to function as a switch between apoptotic signaling and non-apoptotic signaling (45, 46). Depending on the strength of the Fas signal, FLIP avoids the apoptotic signal and directs it to the non-popped tocic path. A stronger Fas signal prevents the FLIP from pointing to the evasive pathway and activates the apoptotic pathway leading to apoptosis (47).

Other factors that can distinguish between the two effects of Fas lead to effective downstream signaling through internalization of Fas receptors through ligation with FasL. Perhaps, receptor-mediated endocytosis will be required for effective activation of caspase cascades leading to apoptosis (not required for the non-apoptotic pathway; 48).

Fas signaling in adipocytes

Fas receptors are highly expressed in 3T3-L1 preadipocytes and decrease during maturation. However, it is still expressed at a meaningful level in mature adipocytes (49).

Fas activation in mature adipocytes using recombinant membrane-bound FasL induces non-apoptotic signaling. By the treatment of FasL, mature adipocytes produce several pro-inflammatory cytokines such as IL-6, IL-8 and MCP-1. Fas activation reduced insulin - stimulated glucose uptake, which was associated with decreased protein and mRNA expression of Akt. Both total Akt and phosphorylated forms were down-regulated, which means that Fas activation in mature adipocytes destroys insulin sensitivity by reducing the amount of Akt in the cells. In addition to the effects described above, Fas-FasL interaction in adipocytes leads to total body insulin resistance by inducing lipolysis and resulting in increased FFAs in the circulatory system under in vivo conditions (49-51) .

In general, Fas signaling by FasL can activate NF-kB, JNK and ERK pathways. Triggering Fas signaling in adipocytes failed to activate NF-κB or JNK pathways, but was shown to activate the ERK pathway. The mechanism for the cytokines released via Fas ligation in mature adipocytes is unclear and is being established. Non-apoptotic Fas signaling may activate the three pathways described above that are known to impair insulin function in other cells and tissues (52, 53).

Interestingly, the decrease in Akt associated with impaired insulin signaling by Fas activation in adipocytes was independent of activation of the three pathways described above (ERK, JNK or NF-κB), but PPARγ (Peroxisome proliferator-activated receptor gamma) And was associated with down-regulation of protein levels. Certainly, the PPARγ protein binds to the promoter region of Akt, which indirectly accounts for the loss of Akt content in cells and the associated impairment of insulin signaling (51). And lipolysis by Fas ligation in mature adipocytes was found to be the result of activation of the ERK signaling pathway (49).

Fas-FasL signaling in obese adipose tissue

Fas expression was significantly increased in perigonadal fat pads of db / db mice, ob / ob mice, and high fat-fed wild type mice. Similarly, the expression was found to be higher in obese patients and further increased in patients with type 2 diabetes. Interestingly, FasL expression levels were also higher in fat tissue in obese mice (50).

Mature adipocytes Fas-FasL interaction is pro-reducing amount of Akt in the cell in vitro to generate the inflammatory cytokine-inducing lipolysis and impair insulin signaling. To identify the role of increased Fas expression in obese adipose tissue, Wueest et al. (50) used adipocyte-specific Fas knock-out mice (AFasKO). In the HFD-fed AFasKO mice for 4 weeks, various obesity-related parameters were significantly reduced compared to wild-type mice. The weight gain between the wild type mice and the AFasKO mice differed only in the weight of the mesenteric fat pad, but not different. However, metabolic parameters such as fasting glucose levels decreased, but insulin levels, FFAs, triglyceride and glycerol levels were similar in both groups. AFasKO mice exhibited higher glucose uptake, decreased fat degradation, better glucose levels and insulin resistance tests confirming in vitro results, which implies that Fas activation is involved in insulin resistance.

Furthermore, the inflammatory profile of AFasKO mice under HFD was lower than in wild type mice. IL-6, MCP-1, CD11b and resistin mRNA levels in adipose tissue were decreased, while mRNA levels of arginase-1 and IL-10 were increased. In addition, systemic IL-6 levels were reduced in AFasKO mice compared to wild-type mice. Since IL-6 is associated with hepatic insulin resistance and lipolysis with FFAs release, reduction of IL-6 in AFasKO mice resulted in improved hepatic insulin sensitivity with protection against fatty liver. The above results strongly suggest that the Fas-FasL system is a driver of obesity-induced inflammation, fat and liver insulin resistance, systemic insulin resistance and fatty liver.

Cross-talk between ATMs and adipocytes during obesity

After establishing that the Fas-FasL system is involved in inducing obesity-related complications, it is very important to clarify the players contributing to the system. Adipocytes as well as infiltrated ATMs express both Fas and FasL on their surface. Thus, both Fas and FasL contribute to the pool of inflammatory receptors and are responsible for increased Fas and FasL expression observed in obese adipose tissue (54). Several cytokines associated with fatty liver inflammation leading to systemic insulin resistance, liver insulin resistance and fatty liver as well as local insulin resistance are shown to be expressed or produced by Fas activation on adipocytes (FIG. 3). In addition, infiltrated ATMs expressing Fas receptors produce increased amounts of TNF-α, IL-1β and KC (IL-8) upon activation, which synergistically contribute to adipose tissue inflammation. FasL expressed on ATMs also stimulates adipocytes to express pro-inflammatory cytokines and vice versa. To further aggravate the problem (inflammation), secreted products such as TNF-a and IL-l [beta] up-regulate the expression of Fas on adipocytes to activate the feed forward loop of the Fas-FasL system By returning more ATMs to this location, they ultimately translate the low level of mild inflammatory sites to chronic inflammatory sites. TNF-α is known to increase lipolysis in adipocytes, resulting in excessive circulation of FFAs in the circulation system and in the liver, leading to problems associated with it (50).

As anti-inflammatory factors PPARγ

PPARγ (Peroxisome proliferator-activated receptor gamma) is an important nuclear receptor for both adipocyte differentiation and maintenance of mature adipocytes (55-57). Although primarily expressed in adipose tissue, other glucose homeostatic organs such as liver and muscle also express PPARγ (56, 58). PPARγ activation in adipocytes induces insulin sensitization throughout the body and macrophage-specific loss of PPARγ leads to insulin resistance and glucose intolerance throughout the body (58-60). Fat tissue-specific mouse knockout of PPARy induces systemic insulin resistance according to the HFD diet (61, 62). In adipose tissue, the co-existence of adipocytes and macrophages, and the cross-talk between them, are critical to maintaining the balance existing between insulin resistance and insulin-sensitive states. In co-culture experiments, overexpression of PPARy in cultured mature adipocytes down-regulated the expression of pro-inflammatory cytokines such as MCP-I, IL-6 and TNF-alpha in LPS-treated Raw264.7 cells , Which means the anti-inflammatory function of PPARy (58). It has been reported that Fas activation in adipocyte-conditioned adipocytes down-regulates the expression of PPARγ and confirms the results described above, resulting in the reduction of PPARγ expression in obese mice under HFD dietary conditions (50). Activation or restoration of the PPARgamma levels in adipose tissue positively contributes to the recovery of inflammation and the improvement of insulin sensitivity.

PPARgamma activating factors such as Thiazolidinediones (TZDs) have been used as anti-inflammatory drugs in type 2 diabetes (63-66). Although the above-mentioned TZDs are not precisely defined to induce anti-inflammatory effects, the most plausible explanation is the trans-suppression of a series of NF-κB and JNK / activating protein-1 by TZD-binding PPARγ . Furthermore, it is still an inference that the exact location of the target organ where the TZD-conjugated PPARgamma has a beneficial effect is still understood, although it is not known whether the same mechanism occurs in vivo (65, 67). Thus, anti-inflammatory properties appear off-target and specific for the active primary mechanism, which means that a more direct approach would be desirable to prevent inflammation (13).

FasL-mediated neutrophil regression

In addition to the inclusion of the Fas-FasL system, FasL is also known to act as a neutrophil attractant. Although controversial, several studies have shown that sFasL itself can function as a chemoattractant factor and induce neutrophil infiltration into inflammatory sites (41, 68). Although not yet fully understood, several studies have suggested that FasL indirectly induces the production of IL-1β and functions as a neutrophil attractant (41). Collectively, the effect of FasL as an individual factor that attracts neutrophils is unclear, but blocking the function of FasL with Fas is an important factor in the production of inflammatory cytokines or the regulation of inflammatory cells It suppresses cross-talk to some extent.

The Role of Adipocyte Apoptosis in Obesity-Associated Compulsive Disease

The adipose tissue is remodeled continuously if it is HFD diet. With increased fat tissue beds, associated fat cell degeneration (especially apoptosis percentage) is increased. The frequency of fat cell death increases from baseline (0 weeks of 0 weeks HFD) of <0.1% in C57Bl / 6 mice to 16% after 12 weeks of high fat diet. The rate of increase is significantly increased by about 80% after the high fat diet for 16 weeks (69). Similarly, fat cell death in obese adipose tissue has also been reported in human patients (70). Interestingly, increased fat cell death occurs simultaneously with increased body weight, inflammation, infiltrated ATMs, and insulin resistance. And, adipocyte apoptosis is associated with the formation of crown like structures (CLS) that are formed around multiple ATMs near dead fat cells, and the CLS increases with severity of obesity. This phenomenon has been reported in both humans and rodents (69, 70).

In previous studies, it was unclear whether adipocyte apoptosis was the result of initiating a regression of ATMs or itself as a result of ATM infiltration. T-Bid (a key factor in pro-apoptotic linkage between the endogenous apoptotic pathway and the extrinsic apoptotic pathway) Recent studies using knock-out mice have shown that fat cell death is associated with adipose tissue Suggesting it is a major event leading to macrophage infiltration. The same group of researchers found that inhibition of ATM infiltration and inhibition of apoptosis in adipocytes by genetic inactivation of t-Bid also inhibited inflammation and improved insulin sensitivity, as well as protecting mice from hepatic steatosis (70).

Inflammatory conditions sensitize adipocytes to Fas-mediated apoptosis

Mature adipocytes have very high resistance to Fas-mediated apoptosis, instead of undergoing non-apoptotic signaling through Fas activation and producing pro-inflammatory cytokines (50). One of the reasons for this process is the lower expression of Fas in the differentiation of adipose precursor cells into adipocytes (71). However, the scenario varies according to inflammatory conditions. Reported that the control - such as Fischer-Posovszky 71 TNF-α and IFN-γ The treatment of inflammatory cytokines in vitro up to Fas expression in human fat cells four times in the same mature adipocytes. Moreover, TNF- [alpha] and IFN- [gamma] induce sensitization to apoptosis at various points in the cell through up-regulation of caspases. In addition, treatment of adipocytes with an APO-1 antibody (having a function similar to FasL) in combination with the above-described inflammatory cytokines induced strong apoptosis. Although the individual treatment of the cytokines described above with APO-1 is sufficient to induce apoptosis, the cytokines described above caused an increased apoptotic effect when treated in combination with APO-1.

As noted above, the apoptotic index (AI) of obese adipose tissue is very high and is associated with the etiologic cause of obesity-related comorbidities. In addition, it is unclear whether blockade of Fas activation in inflammation-induced obese adipose tissue expressing high amounts of TNF-α is capable of controlling the rate of apoptosis, It is also unclear whether it reduces infiltration and insulin resistance (adipose tissue, liver tissue and system) and inhibits hepatic steatosis. Thus, based on available information, the researchers can hypothesize that Fas will be involved in the apoptosis of inflammation-sensitized adipocytes, even if they preferentially induce inflammatory pathways in adipose tissue.

Is blocking Fas activation reversing obesity-related complications?

Given the previously published results, it is clear that Fas is the central molecule that contributes to the production of inflammatory molecules through both adipocytes and ATMs. Thus, although induced inflammation sensitizes adipocytes to induce Fas-mediated apoptosis, evidence for this or clear in vivo information is not yet available. Adipocyte inflammation and apoptosis, which stimulate and encourage a feed-forward loop, contribute synergistically to the overall obesity-associated comorbidities. For Fas, a common causative agent, it would be interesting to investigate whether blocking Fas activation shows therapeutic effects by reversing inflammation, insulin resistance (T2D) and fatty liver in obese mice.

Peptidomimetics to block Fas activity

Blocking Fas activity in adipose tissue under obese conditions appears to be beneficial in addressing obesity-related complications. In order to effectively inhibit Fas activity, it is important to develop potent inhibitors. There are macromolecules such as anti-Fas antibodies, soluble FasL, Fas receptors fused with immunoglobulin Fc receptors, etc., but have various limitations (72, 73): (a) large; (b) always induces an immune response when injected into a mouse; (c) low bioavailability; (d) low stability; (e) high cost; (f) Serious risks, including side effects (sometimes associated with life). On the other hand, small peptides developed from the secondary structure of the parent Fas-FasL protein can mimic the function of the protein and inhibit Fas signaling. Moreover, the peptides are easy to handle, modify and design as needed. A peptide mimic capable of blocking the Fas-FasL signal was developed by Hasegawa et al. (74), derived from the KP7 loop of FasL interacting with the Fas receptor. Of the various peptides derived from the KP7 loop, the sixth peptide sequence was identified as the best inhibitor and named KP7-6 peptide. The KP7-6 peptide has affinity for Fas as well as for Fas and, above all, is not only specific for inhibition of Fas-FasL activity, but also does not affect even the most intimate members of the TNF receptor superfamily. Accordingly, the present inventors have found that the peptide can be selected to inhibit Fas-FasL-mediated inflammatory pathways in adipocytes and to improve inflammatory conditions in obese mice to prove that they are therapeutic peptides for treating obesity-related complications .

Features of FTP (KP7-6 peptide)

In addition to important features that bind Fas as well as FasL, FTP (Fas targeting peptide) is a very unique peptide that selectively inhibits the Fas-FasL signal as a selective inhibitor. FTP is a selective blocking agent and not a perfect Fas inhibitor in that FTP suppresses the ERK signaling pathway but selectively triggers the NF-KB pathway and has no effect on the JNK pathway (Fig. 4). FTP is a peptide of about 1 kDa with a peptide sequence of "YCDEHFCY &quot;, and the internal cysteine residue enables the cyclization of the peptide through a disulfide bond (74).

Polymerization of peptides

One of the most important features of the peptide mimetic is that it is easy to modify and design according to the experimental content. Since the polymerization of the peptides allows to have a multivalency (multi-receptor-interacting epitope) that increases the binding affinity and increases the functional final activity, it is desirable that before the fusion receptor with the Fc fragment of the immunoglobulin is obtained It was attempted to have polyvalency (75-77). Although macromolecules have various disadvantages, small peptides also have several disadvantages in that they are easily excreted outside the body and have a short half-life. Thus, controlled polymerisation of peptides of optimal size will be beneficial.

According to previous studies, the researchers used dimethyl sulfide (DMSO) as a catalyzing agent to polymerize cysteine-bearing peptides (78-80). DMSO helps the oxidation of the free-SH group to generate disulfide bonds to produce polymers. Poly (TAT) and poly (oligo-arginine) polymers were prepared from the C-TAT-C and C-9R-C monomers, respectively, by reaction with 20-30% DMSO (78, 79). The size of the formed polymer is dependent on the solubility of the peptide, but also on the location of the cysteine used in the polymerization reaction and on the starting concentration of the monomer. In order to analyze the effect of increasing the efficiency in adipocytes and suppressing unknown Fas-FasL-induced inflammatory pathways, poly (FTP) was prepared by applying DMSO-based polymerization method to FTP.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors have sought to develop a substance having the same function as that of the conventional FTP (Fas targeting peptide) or having a more excellent function. As a result, the present inventors have found that a poly-FT (specifically, pentamer FTP) in which at least three monomeric FTPs are cyclized has a binding affinity for Fas or FasL remarkably And can be applied to the improvement or treatment of a Fas-related disease, disease or condition (e.g., obesity-induced disease or Fas-associated skin or hair disease).

It is an object of the present invention to provide a cyclized poly Fas targeting peptide (FTP).

It is another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of obesity-induced diseases, diseases or conditions.

It is another object of the present invention to provide a pharmaceutical composition for the prevention or treatment of Fas-related skin or hair diseases, diseases or conditions.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides a cyclized poly Fas targeting peptide (FTP) having a cyclic Fas targeting peptide sequence (SEQ ID NO: 1) acid synthase) or FasL (Fas ligand).

The present inventors have sought to develop a substance having the same function as that of the conventional FTP (Fas targeting peptide) or having a more excellent function. As a result, the present inventors have found that a poly-FT (specifically, pentamer FTP) in which at least three monomeric FTPs are cyclized has a binding affinity for Fas or FasL remarkably Can be applied to the prevention or treatment of a Fas-related disease, disease or condition (e.g., obesity-induced disease or Fas-associated skin or hair disease).

Fas (CD95 / Apo-1) and its specific ligand FasL (CD95L) are members of proteins belonging to the TNF receptor and the TNF ligand superfamily (TNFSF), respectively. The interaction between Fas and FasL triggers a cascade of intracellular events leading to apoptosis in Fas-expression targets (e.g., adipocytes). Fas is a 45 kDa type 1 membrane protein that is always expressed in various tissues such as the spleen, lymph nodes, liver, lung, kidney, and ovaries. FasL is a 40 kDa type 2 membrane protein that is mainly expressed in lymphoid organs and immune-related tissues. FasL can induce cytolysis of Fas-expressing cells in a membrane-bound form or a 17 kDa water-soluble form excreted through proteolysis, but the membrane-bound form is more potent than Fas-stimulated great. In addition, the Fas receptor and FasL are all involved in signaling for apoptosis and non-apoptosis (Wajant et al. , Cytokine & Growth Fac. Rev., 14: 53-66 (2003)).

The Fas-FasL system is involved in the immune response, inflammation, infection, neoplasia or the death of parenchymal cells in various organs. Damage to the Fas-FasL system inhibits lymphocyte apoptosis resulting in lymphocyte proliferation and autoimmune disease (Nagata et al. Supra; Biancone, L. et al. , J Exp Med 186: 147-152 (1997) ; Krammer, PH Adv Immunol 71: 163-210 (1999); Seino, K. et al. , J Immunol 161: 4484-4488 (1998); and Famularo, G., et al. , Med Hypotheses 53: 62 (1999)). Thus, Fas-mediated apoptosis is a key component in tissue-specific organ damage (e.g., liver damage).

Neutralization studies on FasL using antibodies have been conducted in various animal models for the modulation of the Fas-FasL system as a therapeutic target (Okuda, Y. et al. , Biochem Biophys Res Commun, 275: 164-168 (2000) ). However, methods using macromolecules such as antibodies have the following fatal disadvantages: (a) difficulty in mass production; (b) high production costs; (c) difficulty in application to a particular tissue (e.g., brain); And (d) the need for neutralizing antibodies. In order to overcome this, development of small molecule inhibitors is urgently required.

We have developed peptidomimetics (poly FTP) that not only has the Fas-FasL system inhibitory effect of macromolecules such as antibodies, but also has a high ligand binding affinity for the receptor.

As used herein, the term "peptide" refers to a linear molecule formed by peptide bonds and amino acid residues joined together. Peptides may be synthesized by methods known in the art such as solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85: 2149-54 (1963); Stewart, et al., Solid (Peptide Synthesis , 2nd ed., Pierce Chem. Co .: Rockford, 111 (1984)) or liquid phase synthesis technology (US Patent No. 5,516,891). The term "peptidomimetics &quot;, as used herein, refers to a molecule (e.g., a peptide) that mimics the activity of a peptide and includes modifications or peptoids of conventional peptides (nitrogen on the peptide backbone Or a similar system designed to mimic a peptide, such as a beta-peptide. Typically, peptide mimetics can be designed to increase stability or biological activity through a modified chemical structure.

According to the present invention, the peptidomimetics of the present invention are 'Fas mimetics'. The term " Fas mimetics " as used herein means peptides derived from Fas peptides and inhibits Fas activity (particularly Fas-mediated signaling).

According to certain embodiments of the invention, the peptide mimetics of the invention bind Fas or FasL and inhibit Fas-mediated signaling.

According to some embodiments of the present invention, the peptide mimetic of the present invention is an annular poly FT consisting of at least three monomeric Fas targeting peptides (FTP) linked by cyclization, more specifically, 3-10 Monomeric FTP is an annular poly-FTP linked by cyclization, more specifically, an annular poly-FTP in which 3-7 monomeric FTP's are linked through cyclization, and most specifically, five monomeric FTP's are cyclic, It is a poly FTP. The term "cyclized poly Fas targeting peptide" as used herein refers to a cyclic poly Fas targeting peptide comprising an amino acid sequence selected from the group consisting of a cyclic poly (FT) peptide having a cysteine residue in a monomeric FTP of Sequence Listing 1 sequence linked to a cysteine residue of another monomeric FTP via a disulfide bridge but are not limited to, circularized peptides, for example, cyclic poly-FTP consisting of trimmer-FTP and circular-poly-FTP consisting of pentamer-FTP. Methods for the preparation of cyclic peptides include solid phase synthesis and other methods (Burgess, et al. (1996) in Solid phase syntheses of peptidomimetics (American Chemical Society, Washington DC) pp. ORGN-157; Goodman & Shao, Pure Appl. . 68: 1303-1308 (1996); Hanessian, et al, Tetrahedron 53:... 12789-12854 (1997); Koskinen & Hassila, Acta Chem Scand 50: 323-327 (1996); Kuhn, et al,. 3, 580-584 (1993)), which is available from Tetrahedron 53: 12497-12504 (1997); Waid, et al. , Tetrahedron Lett. 37: 4091-4094 (1996) and Zuckermann, Curr. Opin. And can be easily carried out in the art. Also, locating aromatic residues at the ends of cyclically constrained small peptides is advantageous for increasing the activity of the mimetic (Takasaki, et al. , Nat. Bio technol. 15 : 1266-1270 (1997); Zhang, et al. , Nature Biotech no . 14, 472-475 (1996)).

According to some embodiments of the present invention, the cyclization to form the annular poly FTP of the present invention is such that the cysteine residue in one FTP is linked to the cysteine residue in another FTP via a disulfide bond, More specifically, it is formed through cyclization between three to seven FTPs, and more specifically, through cyclization between five FTPs (see FIG. 5A).

The circular poly FTP of the present invention exhibited a high binding constant and dissociation constant and a very high binding affinity as compared to the monomer FTP since it has multivalency (see FIGS. 6A and 6B).

According to some embodiments of the present invention, the association constant (K _a ) for Fas or FasL of the circular poly FTP of the present invention is at least two times higher than the binding constant for Fas or FasL of the monomeric FTP.

According to some embodiments of the present invention, the dissociation constant (K _d ) for Fas or FasL of the annular poly FTP of the present invention is at least 1.5 times higher than the binding constant for Fas or FasL of the monomeric FTP.

According to some embodiments of the present invention, the binding affinity (K _D ) of Fas or FasL of the circular poly FTP of the present invention is at least 10 times higher than the binding affinity of Fas or FasL of the monomeric FTP.

As noted above, receptors belonging to the TNF receptor family are associated with apoptosis as well as inflammatory signaling. Fas-mediated apoptosis not only causes autoimmunity by killing self-reactive lymphocytes, but Fas signaling can also be used to detect immune surveillance to remove transformed and virus-infected cells It is important for immune surveillance. Binding of oligomerized FasL to Fas activates signaling adapters (e.g., FAF, FADD, DAX, etc.) that bind to the cytoplasmic domain of Fas (known as the death domain) Activate apoptotic signaling by activating cascade. First, caspase-8 and caspase-10 are activated to cleave downscream caspases (e.g., caspase-3, caspase-7, etc.), resulting in cell death. The caspases not only break down the nuclear structure of the nuclear lamina but also break down the chromosome through another substrate, DNA fragmentation factor (DFF). Other caspase substrates are also involved in the cytoskeleton structure, cell cycle regulation, and several signaling pathways.

According to some embodiments of the present invention, the annular poly FTP of the present invention inhibits Fas-induced apoptosis that occurs in adipose tissue macrophages (ATMs) of adipocytes or adipose tissue.

According to some embodiments of the present invention, the annular poly FTP of the present invention reduces the level of truncated caspase-3 increased in response to inflammatory conditions.

According to some embodiments of the present invention, the annular poly FTP of the present invention inhibits the phosphorylation of extracellular signal-regulated kinase (ERK), thereby blocking the ERK signaling pathway.

In addition, the inflammatory signaling is closely related to obesity. Excessive nutritional load leads to low levels of chronic inflammation, but, if prolonged, destroys metabotropic homeostasis and triggers a variety of intracellular inflammatory-related responses (eg, the NF-κB and JNK signaling pathways). As a result, cross-talk between ATMs in adipose and adipose tissues exacerbates the inflammatory state through synergistic effects, which directly affects insulin signaling in adipocytes and leads to signaling through systemic ) Causing insulin resistance.

According to some embodiments of the present invention, the annular poly FTP of the present invention inhibits the production of Fas-induced pro-inflammatory cytokines and chemokines.

According to some embodiments of the present invention, the Fas-induced pro-inflammatory cytokines and chemokines are selected from the group consisting of TNF (tumor necrosis factor) -α, iNOS (inducible NO synthase), IL (interleukin) But are not limited to, IL-6, IL-8, MCP (monocyte chemotactic protein) -1, CCL (chemokine ligand) 3, CCL5, CCL5 and CCL8.

According to some embodiments of the present invention, the annular poly FTP of the invention reduces M1 type macrophages and increases M2 type macrophages.

According to some embodiments of the present invention, the annular poly FTP of the present invention inhibits Fas-triggered insulin resistance.

According to another aspect of the present invention, the present invention provides a method for the treatment of cancer, comprising: (a) a therapeutically effective amount of the cyclized poly Fas targeting peptide described above; And (b) a pharmaceutically acceptable carrier. The present invention provides a pharmaceutical composition for preventing or treating obesity-induced diseases, diseases or conditions.

Since the composition of the present invention includes the annular poly FTP of the present invention described above as an active ingredient, the description common to both is omitted in order to avoid the excessive complexity of the present specification.

According to certain embodiments of the present invention, the pharmaceutical composition of the present invention inhibits phosphorylation of JNK (Jun-NH ₂ terminal kinase), p38 MAPK (mitogen activated protein kinase) and NF-κB (p65 nuclear factor-κB) As well as the expression of CD11c, CCR5 or CD11b.

According to some embodiments of the present invention, the pharmaceutical composition of the present invention not only increases the expression of arginase-1 or IL-10, but also increases the expression of PPARy (Peroxisome proliferator-activated receptor gamma) or phospho-Akt lt; RTI ID = 0.0 &gt; (phospho-Akt). &lt; / RTI &gt;

According to some embodiments of the present invention, the pharmaceutical composition of the present invention inhibits the formation of a crown-like structure (CLS) in adipocytes.

According to certain embodiments of the invention, the pharmaceutical compositions of the present invention reduce serum free fatty acids (FFA), lipid accumulation and triglyceride content.

As used herein, the term " obesity-associated diseases, disorders or conditions "refers to co-morbidities associated with obesity, including pathological conditions caused by increased Fas signaling conditions, including, for example, pathological conditions associated with lymphocyte apoptosis leading to abnormal lymphocyte proliferation and autoimmunity, aging and cell death in skin and other organs, and the like. Because the pathological condition caused by an increase in Fas signaling, the obesity-inducing disease, disease or condition can be improved or treated by lowering Fas activity by binding to both Fas or FasL, or both.

According to certain embodiments of the invention, an obesity-inducing disease, condition or condition that can be ameliorated or treated by the composition of the invention is selected from the group consisting of inflammation, insulin resistance, glucose sensitivity, type 2 diabetes, fatty liver, hepatitis, dyslipidemia , Hypertension, rheumatoid arthritis, Sjogren's syndrome, multiple sclerosis, ocular disorders, renal injury or trauma, HIV (human immunodeficiency virus) infection, aging, cancer, Rejection, and autoimmune diseases. &Lt; RTI ID = 0.0 &gt;

The term "pharmaceutically effective amount " as used herein means an amount sufficient to achieve the efficacy or activity of the cyclic poly-ft described above for the amelioration or treatment of the obesity-induced disease, disease or condition. As used herein, the term " treatment "means lowering the severity or the likelihood of recurrence of the disease, disorder or condition caused by administration of the active substance, and the term" Means reducing the likelihood of disease, disease or condition.

The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally. In the case of parenteral administration, administration is by transmucosal administration, intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, topical administration, transdermal administration or the like .

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a physician skilled in the art will be able to easily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to some embodiments of the present invention, the daily dosage of the pharmaceutical composition of the present invention is about 25-1,000 / body weight (50 kg), more specifically about 100-750 mg / body weight (50 kg) More specifically about 250-500 mg / body weight (50 kg), but is not limited thereto.

In addition, the pharmaceutical composition of the present invention may be formulated into a unit dosage form by using a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by a person having ordinary skill in the art to which the present invention belongs. Or may be manufactured by penetration into a multi-dose container. Here, the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets, capsules or gels (e.g., hydrogels) have.

According to a further aspect of the present invention, the present invention provides a method for the treatment of cancer, comprising: (a) a therapeutically effective amount of the cyclized poly Fas targeting peptide described above; And (b) a pharmaceutically acceptable carrier, for the prophylaxis or treatment of a Fas-associated skin or hair disease, disease or condition.

Since the composition of the present invention includes the annular poly FTP of the present invention described above as an active ingredient, the description common to both is omitted in order to avoid the excessive complexity of the present specification.

Fas receptor complex is known to induce apoptosis in keratinocytes (Sayama, et al. , J. Invest. Dermatol. , 103: 330-334 (1994); and Trautmann et al. , JCI 2000)). Induction of apoptotic cells through activation of the Fas receptor system destroys epidermal barriers, resulting in infiltration of T lymphocytes, leading to direct keratinocyte death. In addition, it is known that Fas-mediated keratinocyte death is involved in another skin disease, TEN (toxic epidermal necrolysis) (Viard, I., et al. , Science , 282: 490-493 (1998)). Thus, Fas inhibition can block keratinocytes and hair follicles apoptosis and treat skin conditions including inflammation such as eczema.

Fas is up-regulated in HF (hair follicle) keratinocytes (Sharov et al. , Cancer Res. , 64: 6266-6270 (2004)). Sharov et al. (2004) reported that Fas up-regulation in HF keratinocytes induced by cyclophosphamide treatment was partially inhibited by their inhibitors (e.g., FasL-neutralizing antibodies). Thus, the composition of the present invention (ability to modulate or inhibit the Fas-FasL system) can be applied to the prevention or treatment of Fas-associated skin or hair diseases, diseases or conditions.

According to certain embodiments of the present invention, a Fas-associated skin or hair disease, disease or condition that can be prevented or treated by the composition of the present invention is selected from the group consisting of vitiligo, psoriasis, toxic epidermal necrolysis (RIE) , Eczematous dermatitis, macropapular rashes, rosacea, hair cell-associated diseases and drug-induced skin diseases.

According to certain embodiments of the present invention, the hair cell-associated disease of the present invention is selected from the group consisting of alopecia areata, alopecia totalis, alopecia universalis, ophiasis, androgenic alopecia , Telogen effluvium, lichen planopilaris, chemotherapy-induced hair loss, and radiation therapy-induced hair loss.

According to certain embodiments of the present invention, the chemotherapeutic-induced hair loss of the present invention may be administered in combination with at least one selected from the group consisting of cyclophosphamide, clomethine, mestin, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, is induced by treatment with vp16, iopospermide, irinotecan, mitoxantrone, mitoxantrone, paclitaxel, topotecan, vinblastine, vincristine, gemcitabine and carboperactin.

The term "pharmaceutically effective amount" as used herein in the pharmaceutical composition for the prophylaxis or treatment of Fas-associated skin or hair disease, disease or condition refers to the amount of the Fas-associated skin or hair disease, Quot; means an amount sufficient to achieve the efficacy or activity of the annular poly-FTP described above. As used herein, the term " treatment " means lowering the severity or the likelihood of recurrence of the disease, disorder or condition caused by administration of the active substance, and the term " Means reducing the likelihood of disease or condition.

The pharmaceutically acceptable carriers to be contained in the pharmaceutical composition of the present invention are those conventionally used in the present invention and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia rubber, calcium phosphate, alginate, gelatin, But are not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. It is not. The pharmaceutical composition of the present invention may further contain a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, etc. in addition to the above components. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, and in the case of parenteral administration, it can be administered by local administration, transdermal administration, subcutaneous injection, or the like.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a physician skilled in the art will be able to easily determine and prescribe dosages effective for the desired treatment or prophylaxis. According to some embodiments of the present invention, the daily dosage of the pharmaceutical composition of the present invention is about 0.0005-1000 mg / kg.

In addition, the pharmaceutical composition of the present invention can be prepared into any of the formulations conventionally produced in the art, and can be, for example, a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, , An emulsion foundation, a wax foundation, and a spray, but is not limited thereto. More specifically, it can be manufactured in the form of a soft lotion, a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a pack, a spray or a powder.

When the formulation of the present invention is a paste, cream or gel, an animal oil, vegetable oil, wax, paraffin, starch, tracant, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component .

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In the case of a spray, in particular, / Propane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

In the case where the formulation of the present invention is a suspension, a carrier such as water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, Cellulose, aluminum metahydroxide, bentonite, agar or tracant, etc. may be used.

The components included in the composition of the present invention include, in addition to peptides and carrier components as an active ingredient, components commonly used in cosmetic compositions, and include conventional components such as antioxidants, stabilizers, solubilizers, vitamins, May include adjuvants.

The features and advantages of the present invention are summarized as follows:

(a) The present invention relates to cyclic poly-FTP in which monomeric FTP is cyclized and uses thereof.

(b) The circular poly FTP of the present invention is significantly superior in binding affinity to Fas or FasL as compared to monomer FTP.

(c) In addition, the annular poly FTP of the present invention not only inhibits Fas-induced apoptosis occurring in adipose tissue macrophages (ATMs) of adipocytes or adipose tissues, but also inhibits Fas-induced Inhibit the production of pro-inflammatory cytokines and chemokines.

(d) Thus, the pharmaceutical composition comprising the annular poly-FTP of the present invention as an active ingredient can be used to treat a Fas-related disease, a disease or condition (e.g., an obesity-induced disease or a Fas- Can be applied very effectively for improvement or treatment.

1 is a diagram showing the characteristics of inflammation in obese adipose tissue. HFD (high fat diet) induces the activation of macrophages (M2) in adipocytes and adipose tissue to produce a series of IL-1β, TNF-α, and CCR2 ⁺ and CCR5 ⁺ macrophages It causes the production of chemokines. Invaded macrophages are shifted to M1 polarization in M2 by production of inflammatory cytokines, which not only increases the M1 to M2 ratio in adipose tissue but also sets the dialyzed inflammatory milieu. Macrophages infiltrated with cytokines attract more macrophages from the circulatory system by stimulating adipocytes to provide Fas and FasL molecules that induce an increase in MCP-1 levels. Along with this persistent vicious cycle, chronic inflammatory conditions result in increased CLS, increased fat degradation, and insulin resistance through stimulated JNK and NF-κB pathways.
2 is a diagram showing Fas signaling. Fas induces the production of cytokines such as IL-8, IL-6, MCP-1, IL-1β, TNF-α, etc. through the interaction of traditional apoptotic signaling with FasL through caspase activation. It is known to induce both traditional inflammatory signaling.
Figure 3 is a diagram showing cross-talk between adipose tissue and liver. Nutrient stress caused by HFD causes fatty tissue remodeling with increased expression of increased M1 macrophages, Fas and FasL and increased production of inflammatory cytokines such as IL-6, IL-1b, and TNF-a. Increased production of TNF-α by macrophages induces fat degradation in adipocytes, leading to excessive release of FFA (free fatty acids). Thus, the produced FFA, TNF-a and IL-6 are released into the portal vein, resulting in hepatic insulin resistance and fatty liver.
FIG. 4 is a diagram showing the anti-apoptotic mechanism by Fas targeting peptide (Hasegawa et al., 1994, PNAS). Fas activation in Jurkat cells induces apoptosis by triggering the ERK pathway, but there is no change in JNK or NF-κB signaling. Fas activation by FasL inhibits ERK signaling in the presence of FTP, but activates the NF-κB pathway (increased expression of anti-apoptotic genes). Thus, FTP is a peptidomimetics that is an optional blocker / activator as the only pathway to activate anti-apoptotic function.
5 is a diagram showing the synthesis and cyclization of pFTP (poly FTP). Figure 5a is a diagrammatic representation of the polymerization of poly FTP (pFTP) using cysteine of a monomeric FTP peptide in the presence of DMSO. 5B is MALDI-TOF data of the polymers of FTP synthesized through DMSO-mediated oxidative polymerization. The top panel shows all multimers synthesized through polymerization and the bottom panel shows purified pFTP peptides after dialysis and removal of low molecular weight peptides. Figure 5C shows the percentage of free thiol groups determined by DTNB reaction at different incubation times to confirm the cyclization of the peptides. Dialysis data is the result of dialysis to remove the smaller peptides by taking the sample on the 10th day. The data mean the mean ± standard deviation obtained from three independent experiments.
FIG. 6 shows results of SPR (spin plasmon resonance) analysis of the interaction between Fas and FasL and pFTP. Figures 6a and 6b are representative sensograms showing the interaction between the FasL and Fas receptors attached to the sensor chip (left panel) and pFTPs of different concentrations, respectively. The right panel means a representative senogram comparing the interaction of mFTP or pFTP with immobilized FasL (6a) or Fas receptor (6b). pFTP is a poly FTP, mFTP is a monomer FTP, and all peptides are cyclized in nature.
Figure 7 shows the cytotoxic and anti-apoptotic activity of pFTP in Jurkat cells. FIG. 7A shows the results of measuring and comparing cell viability after treating various concentrations of FTP and pFTP on jurkat cells. The data mean the mean ± standard deviation obtained from three independent experiments. FIG. 7B shows the results of analysis of apoptosis in jurkat cells using Annexin V staining. As a result, it was found that the membrane-bound FasL (1.5 ng / ml) of 500 μM peptide (FTP or pFTP) Are presented as histograms showing the percentage of apoptosis according to treatment. FIG. 7C is a graph comparing percent inhibition of apoptosis between FTP, pFTP, and scrambled peptide (scrFTP) analyzed via Annexin V staining of jurkat cells according to FasL treatment (1.5 ng / ml). The graph is presented as mean ± standard deviation from three independent experiments (* p <0.05).
FIG. 8 is a view showing the regulation mechanism of apoptosis by pFTP. Phosphorylation of IκB-α (8a) and ERK (8b) induced in jurkat cells following treatment of membrane-bound FasL (1.5 ng / ml) for various times with or without treatment of pFTP (1000 μM) As a result of Western blotting. Figure 8c is a schematic diagram showing the expected mechanism of apoptosis inhibition by pFTP. FasL ligands bound to Fas receptors induce apoptotic regulatory elements such as JNK, ERK, and NF-κB (left pathway), bind to FasL or Fas receptors when pFTP is treated, or bind to all, Block poptosis (right path). Activation of ERK by membrane-bound FasL is inhibited by pFTP in jurkat cells and activation of the NF-κB pathway by FasL treatment does not occur in the presence or absence of pFTP.
Figure 9a shows the inhibition of FasL-induced pro-inflammatory cytokine production by peptameric and trimeric FTP in mature 3T3-L1 adipocytes. The left panel is a plot showing ELISA results (red box) of membrane-bound FasL (2.0 ng / ml) inducing increased production of IL-6, IL-8 (KC) and MCP- Is a graph showing inhibition of cytokines by pFTP (500 [mu] M). The graph shows the percent inhibition of FasL-induced cytokine production by FTP, pFTP, and scrambled peptides (scrFTP) at various treatment concentrations. The data in the figures are presented as means ± standard deviation from at least four independent experiments. * P < 0.05 compared to control group; # * P < 0.05 compared to FasL treatment; And p <0.01 compared to # ** FasL treatment. 9b is the result of measuring the effect of Trimer FTP (tFTP) on inhibition of cytokine production in adipocytes activated by FasL treatment. Data are presented as mean ± standard deviation from three independent experiments. * P <0.05 compared to FasL treatment; # * p <0.05 compared to tFTP treatment; 0.0 &gt;#< / RTI &gt; tFTP treatment.
Figure 10 shows the recovery of PPARy and Akt levels by pFTP in FasL-triggered mature 3T3-L1 mature adipocytes. FIG. 10A is a Western blotting result showing inhibition of PPARγ expression activated in 3T3-L1 mature adipocytes by FasL (2 ng / ml) treatment and inhibition of FasL activity by 500 μM pFTP or scrambled peptide (scrFTP). Experiments were performed at least three times. Figure 10B is a bar graph showing quantitative real-time PCR results measuring Akt expression upon treatment or no treatment of pFTP with membrane-bound FasL. The bar graph is presented as mean ± standard error from three independent experiments. * P < 0.05 compared to control group; # * P < 0.05 compared to FasL treatment; And p <0.01 compared to # ** FasL treatment.
11 is a graph showing the inhibitory effect of pFTP on FasL-induced proinflammatory cytokine production in intraperitoneal macrophages derived from obese mice. The left panels are ELISA results showing increased production of membrane-bound FasL (10 ng / ml) -stimulated TNF- ?, IL-8 (KC) and IL-1 ?, and the graph on the right panel shows the pFTP This is a result showing the inhibitory effect of cytokines by scrambled peptides (scrFTP). The plots on the right panel are percent inhibition of FasL-induced cytokine production with varying concentrations of pFTP. Data are means ± standard deviation from at least 4 independent experiments. * P < 0.05 compared to control group; # * P < 0.05 compared to FasL treatment; And p <0.01 compared to # ** FasL treatment.
Figure 12 is the result of observing the bio-distribution of Alexa-488-labeled pFTP in obese mice. Figure 12a after a single intraperitoneal injection in obese mice examined the location of the Alexa labeled -488 pFTP (500 μg) X-VIVO (ex-vivo) the result is. Major organs were isolated from the mice and fluorescence of Alexa-488-labeled pFTP was measured 24 hours post-injection. Figure 12B shows the results of confirming the presence of Alexa-488 labeled pFTP (green fluorescence) in tissue sections of adipose tissue. Figure 12c shows the result of observing the interaction between Alexa-488-labeled pFTP (green fluorescence) and CD11b-PE antibody-stained adipose tissue macrophages (red fluorescence) in adipose tissue sections.
13 is a schematic diagram showing a pFTP processing plan. After adapting 4-week-old male C57B1 / 6 mice to in-house conditions with a nornal chow diet (NCD) for 2 weeks, the mice were treated with 60% HFD (high fat diet) for 8 weeks. Mice were also divided into three groups according to body weight (control, scrFTP and pFTP treatment groups). Scrambled peptides and pFTP peptides (350 μg / mouse) were intraperitoneally injected into each group of mice daily for 4-5 weeks. Afterwards, various therapeutic variables were analyzed.
Figure 14 shows the results of investigating the effect of pFTP treatment on inflammatory components in adipose tissue. 14A is a graph showing the reduction of inflammatory signaling pathways in adipose tissue of pFTP-treated obese mice compared to control or scrambled peptide-treated groups. The upper left panel is the result of Western blotting of (p) -JNK, p-p38 MAPK, p-NF-kappa B p65 and their total proteins phosphorylated in adipose tissue of obese mice after pFTP or scrambled peptide treatment. The graphs in Figures 14a and 14b show that inflammatory cytokines (14a right panel and lower panel), inflammatory immune cell markers (Figure 14b upper panel), and anti-inflammatory cytokines and M2 macrophage markers (14b lower panel) Quantitative real-time PCR results. mRNA levels were normalized using beta-actin levels. Data are means ± standard error obtained from 6-8 mice per group: * p <0.05; And ** p < 0.01. The middle panel in Figure 14b shows a decrease in macrophage infiltration in pFTP-treated mice (left) as a result of adipose tissue section staining with Mac-3 antibody. The right graph shows the total number of Mac-3 positive cells per 10 microscopic fields: ** p < 0.01.
Figure 15 shows the results of increased insulin signaling in adipose tissue of pFTP-treated obese mice. 15A is immunoblot results of PPARy expression in adipose tissue of scrambled or pFTP peptide-treated obese mice. The right panel is a density-gauge readout graph of PPARγ levels standardized with beta-actin: p <0.05 compared to the control. Fig. 15B is the immunoblot results of phosphorylation of Akt, total Akt and beta-actin expression in adipose tissue of scrambled peptide or pFTP peptide treated obese mice. The right panel is the densitometric reading graph of the pAkt level normalized to the total Akt level: p <0.05 compared to the control.
Figure 16 shows the effect of inhibiting pFTP on inflammation sensitizing Fas-mediated apoptosis in 3T3-L1 mature adipocytes. Figures 16a and 16b show the effect of Fas activation on the 3T3-L1 mature adipocyte truncated caspase in the presence of 20% LPS-treated Raw-conditioned medium without or with pFTP (500 [mu] M) 3 shows the immunoblot (16a) showing its level and its cell viability (16b). Raw-CM was prepared by treating LW264.7 cells with LPS (200 ng / ml) for 20 hours. Complete media (CM) consists of 10% FBS and 1% antibiotic. The data are means ± standard error from three independent experiments: p <0.05 compared to the control group; P < 0.05 compared to # FasL + 20% LPS-treated Raw-CM + pFTP-treated samples; And p <0.01 compared to # ** FasL + 20% LPS-treated Raw-CM + pFTP-treated samples. Figure 16c shows the results of Annexin V staining for the percentage of apoptosis in 3T3-L1 adipocytes following FasL treatment in the presence of 20% FasL-treated Mac-CM medium (Macrophage conditioned medium) &Lt; / RTI &gt; And p <0.01 compared to # * FasL + 20% FasL-treated Mac-CM + pFTP-treated samples.
Figure 17 shows the reduced apoptotic levels in adipose tissue of pFTP-treated obese mice. Figure 17a is a quantitative time-of-day PCR showing an increase in IFN-y and TNF-alpha levels in adipose tissue of HFD-fed obese mice compared to NCD-fed control mice. Data are mean ± standard error from 4-6 mice: p <0.05 compared to NCD-control group; And < RTI ID = 0.0 &gt;#< / RTI &gt; * HFD-control. Figure 17B shows the TUNEL staining results for adipose tissue of HFD-induced obese mice treated with scrambled peptides or pFTP peptides. The right panel shows the total number of TUNEL positive cells per 10 microscope fields: p <0.01 compared to the control. FIG. 17C shows immunoblot results of detection of caspase-3 levels cleaved in adipose tissue of control mice, obesity mice treated with pFTP peptide or scrambled peptide. The right panel is a cut-off, caspase-3 level density readout graph normalized to beta-actin: p < 0.05 compared to control. Figure 17d shows the results of the formation of CLS (crown like structure) around dead fat cells in the obese adipose tissue evaluated by F4 / 80 immunostaining. The right panel shows the total number of CLSs per 10 microscope fields: p <0.05 compared to the control.
Figure 18 shows the reduction of serum inflammatory cytokines (IL-6, MCP-1 and IL-8 (KC)) in pFTP-treated obese mice as a result of investigating the effect of pFTP treatment on systemic inflammation levels in obese mice Show. Data are mean ± standard deviation from 6 mice: p <0.01 compared to control.
FIG. 19 shows the effect of pFTP treatment on circulating metabolic parameters in obese mice. FIG. 19A is a result of intra-peritoneal glucose tolerance test (ipGTT) in a control, scrFTP and pFTP-treated obese mice. The mean GT curves obtained from the control, scrFTP and pFTP groups were plotted on the left panel. The area of the GT curve is calculated from each mouse and the average value is shown on the right panel. Results are mean ± standard error based on data from 6 mice: p <0.05 compared to control group; And ** p &lt; 0.01 compared to control. Figure 19b shows fasting plasma insulin levels according to treatment groups. Figures 19c and 19d show FFA levels and serum triglyceride levels, respectively. Results are mean ± standard error based on data from 6 mice: p <0.05 compared to control group; And ** p &lt; 0.01 compared to control.
20 shows the results of observing the effect of pFTP treatment on fatty liver in obese mice. Figure 20a is a representative micrograph of H & E (hematoxylin and eosin) -stained liver sections to identify fatty liver. FIG. 20B shows the results of measurement of liver triglyceride levels in the control, scrFTP peptide and pFTP peptide-treated obese mice. Data are presented as mean ± standard deviation from 6 mice per group: p &lt; 0.05 compared to control.
Figure 21 shows the results of measuring the effect of pFTP treatment on body weight and food intake in obese mice. Body weights 21a and 21b and food intake 21c were measured in obese mice after 4-5 weeks of treatment with pFTP peptide or scrambled peptide.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example

Materials and Experiments

Experimental material

Fas-targeting peptide (FTP; YCDEHFCY) was synthesized from Peptron (Daejeon, Korea). Alpha-Cyano-4-hydroxycinnamic acid matrix, trifluroacetic acid for MALDI-TOF analysis and DTNB were purchased from Sigma (St. Louis, Mo.) . Membrane-bound FasL was purchased from Upstate and DMEM, RPMI, FBS, FCS, penicillin-streptomycin antibiotic and alexa-488 fluorescent die were purchased from Invitrogen. Antibodies for wavelenght blotting were purchased from cell signaling technologies unless specifically stated otherwise. Antibodies for immunohistochemistry were purchased from Abcam. The TUNEL assay kit was purchased from Roche (Germany).

Synthesis of Poly Fas Targeting Peptide (pFTP)

Synthesis of pFTP was carried out by oxidative polymerization of a conventional DMSO-mediated Fas targeting peptide (YCDEHFCY). Condensation was carried out in PBS (phosphate buffered saline, pH 7.4) containing 30% DMSO using 125 mM FTP for 10 days with constant agitation. During this reaction, 5 μl of sample was taken at intervals of 24 hours, and the reaction was stopped by addition of HEPES buffer and analyzed using MALDI-TOF (matrix-assisted laser desorption / ionization-time of flight). After confirming the formation of different sizes of polymer by MALDI-TOFF, the smaller molecular peptides were removed by dialysis (PBS, pH 7.4) using a dialysis membrane with a molecular weight cut-off of 3.5 kDa (MwCo). Purified peptides were collected and lyophilized using a vacuum-freeze dryer (Freezone 4.5, Labconco corporation, Kansas City, Mo.).

To determine the molecular weight of the peptides polymerized by MALDI-TOF, we used alpha-cyano-4-hydroxy cinnamic acid (CHCA; molecular weight, 189.04 Da). The matrix was prepared in a matrix solution consisting of 50:50 water / acetonitrile containing 0.1% TFA (trifluroacetic acid). 10 mg of CHCA matrix was added to the mattress solution (1 ml), vortexed for 1 minute, and the undissolved matrix was removed by high-speed centrifugation for 30 seconds to obtain a dissolved matrix supernatant. Peptide samples (5 μl) were mixed with the same amount of matrix and analyzed by MALDI-TOF.

Determination of free thiol (-SH) group in peptide using DTNB method

Free-SH groups were determined to analyze whether the formed pFTP was in the ring form in its natural state, and the cyclic pFTP does not have a free-SH group. (5 μg; molar equivalent of pFTP) with purified pFTP peptide (25 g) or free-SH group and 9 R (5 μg; molar equivalent of pFTP) with no free-SH group were added to 2 μl of DTNB [ (5, 5'-dithiobis- (2-nitrobenzoic acid); 100 mM)] in 190 μl of PBS (pH 7.4) and mixed well. . Absorbance was measured at 412 nm and the percentage of free-SH groups was calculated for the FTP peptides. Smaller amounts of free-SH groups represent cyclization of more peptides. Similarly, all of the peptides (monomeric FTP, pFTP and scrambled FTP (scrFTP; polymer form)) were ring-shaped in nature and only the cyclized peptides were used in all in vitro and in vivo experiments.

Biosensor Analysis

The direct coupling of FTP or pFTP to the target was evaluated using a dual channel SPR device (Reichert, Depew, NY). Fas receptor or Fas ligand protein (Millipore) was loaded with a mixture of 0.1 M EDAC [1-ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride] and 0.05 M NHS (N-hydroxysuccinimide) M The remaining activated carboxyl groups are immobilized on the surface of the sensor chip by sequencing with ethanolamine (pH 8.5). Secondary reference cells were similarly treated, but the target protein was excluded. All working peptide dilutions were prepared in an electrophoresis buffer containing 0.5% DMSO, injected for 3 minutes (association time) at a flow rate of 30 μl / min, Dependent on the dissociation phase. Non-specific background combinations were subtracted from each sensogram using the SPR_V4017 Data Acquisition and Alignment Program (Reichert, Depew, NY). Binding rates and constants were independent of a wide range of flow rates. The most appropriate kinetic parameters were obtained by global fitting analysis using Scrubber2 (Biologic Software, Australia).

Cytotoxic assay

The toxic effects of peptide polymerization were investigated using the CCK-8 assay. Briefly, 5 x 10 ⁴ jurkat cells were dispensed into 96-well plates 24 hours before peptide treatment. The next day, different concentrations of FTP and pFTP were treated in triplicate to the cultured cells in DMEM containing 10% FBS and 1% antibiotic and incubated for 12 hours. Then, 10 μl of CCK-8 reagent was added to each well and reacted at room temperature for 2 hours. Absorbance was measured at 450 nm. The absorbance for the mock treatment was considered 100% cell viability and the survival rates in the other treatment groups were calculated relative to the neck treatment group.

Apoptosis

Apoptotic cells were detected via annexin V-PE binding to phosphatidylserine expressed on the cell membrane early in apoptosis using commercially available kits from BD Biosciences. Briefly, 1 × 10 ⁵ jurkat cells were incubated with membrane-bound FasL (1.5 ng / ml) for 4 hours in the presence or absence of peptide samples. The cells were then washed and resuspended in buffer containing calcium, PE-conjugated Annexin V and PI (propidium iodide) for 10 minutes. Cells were analyzed using FACS (Becton Dickinson). Early apoptotic cells were expressed as percentage of annexin V-positive versus PI-negative cells.

Determination of Signaling Mechanism

Downstream molecules involved in Fas signaling during apoptosis were examined using Western blot in the presence or absence of pFTP. Jurkat cells (1 × 10 ⁶ / well) are then incubated for 12 hours in six-well plates and peptide for 2 hours to pFTP of or be processed or 1,000 μM, treated with FasL of 1.5 ng / ml for a specified period of time . The cells were then washed with cold PBS and treated with RIPA lysis buffer. Cell lysates (15-30 μg) were electrophoresed on 12% SDS / PAGE and transferred to a nitrocellulose membrane and incubated with anti-phospho-IκBα, anti-IκBα, anti-phospho-ERK 1/2, ERK2 and anti-beta-actin antibody (Cell Signaling Technology, Beverly, Mass.).

Isolation of intraperitoneal macrophages

Peritoneal macrophages were isolated from 60% HFD-fed obese mice for 8-10 weeks. Following abdominal sterilization, 7.5 ml of cold PBS (pH 7.4) containing 5% FBS was injected intraperitoneally into obese mice and the mice were euthanized. Peritoneal fluid was obtained in a cold sterile 50 ml polypropylene tube. The same procedure was repeated for a total of 5 times to maximize the yield. The macrophages were concentrated by centrifugation at 3,000 rpm for 10 minutes at 4 ° C. The cells were washed once with DMEM complete medium and plated at a concentration of 2 x 10 ⁶ cells / ml. After 2 hours of plating, unbound cells were removed and washed extensively to remove them completely. Peritoneal macrophages were cultured in DMEM complete medium and used for other types of experiments 12 hours after adherence.

Adipocyte culture

3T3-L1 adipocytes were cultured in DMEM (Invitrogen) containing 25 mM glucose (high glucose) supplemented with 10% FCS and antibiotics (Invitrogen). To reach cell confluence 48 h (day 0, D0), cells were injected with 500 μM methylisobutylxanthine, 1 μM dexamethasone, 1.7 μM insulin and 10 μM A mixture of troglitazone (all Sigma) was treated. Two days later (D2), the medium was replaced with a high-glucose culture medium containing insulin (0.5 μM). After an additional two-day incubation (D4), the medium was replaced by a culture medium without insulin. The culture medium was replaced once a day and after 4 days (D8) was replaced by a culture medium containing 5.5 mM glucose (low concentration-glucose). Prior to conducting the experiments, the cells were maintained in low glucose-containing medium for at least 2 days. A membrane-bound Fas ligand (Lake Placid, NY) was added to the low-glucose serum-deficient medium at a concentration of 2 ng / ml and further reacted for 12 hours with or without the addition of peptide. In FasL-triggered adipocyte apoptosis experiments, 3T3-L1 cells were differentiated into mature adipocytes by the general method using complete medium (DMEM containing 10% FCS and 1% antibiotic) under the same concentration of the supplements described above . FasL was also treated for 12 hours under complete medium containing DMEM containing 10% FCS and 1% antibiotic. The above procedure was carried out to avoid apoptosis due to serum deficiency or false apoptotic markers because 3T3-L1 is slightly sensitive to serum deficiency.

Raw264.7 or macrophage condition medium

For from Raw264.7 macrophage cell line producing the inflammatory condition medium (inflamed condition media), 1.5 × 10 5 cells are dispensed in a 12-well plate for 20 hours in 12 hours, 200 ng / ml LPS is DMEM complete medium . The supernatants were collected and freshly used as Raw-conditioned medium (Raw-CM).

Intraperitoneal macrophage conditioned medium was prepared using intraperitoneal macrophages isolated from 60% HFD-fed obese mice for 8-10 weeks. To produce inflammatory conditioned media for apoptotic experiments, 10 ⁶ cells were plated in 48-well plates and treated with 10 ng / ml of membrane-bound FasL after 24 hours. After 18 hours, the supernatant was collected, cell debris was removed by high-speed centrifugation, and the supernatant was again collected and used as a macrophage-conditioned medium (Mac-CM).

Animal experiment

All courses were conducted in accordance with guidelines and protocols approved by the Hanyang University Animal Experimental Ethics Committee. Four-week-old male C57BL / 6 mice (body weight of 20-22 g) were purchased from Orient Bio (Korea). For 2 weeks after purchase, the mice were adapted to the conditions and were arbitrarily eaten according to a normal chow diet (NCD) for up to 6 weeks. Thereafter, mice were switched to a 60% HFD-diet for 8 weeks to become obese mice with a body weight of 40-42 g. The mice were divided into three groups (control, pFTP and scrambled peptide treated groups) with similar body weight distribution Respectively. After 4 weeks of high fat feeding, the peptide treatment started at the same time as the 60% HFD diet. Figure 13 illustrates the time line and protocol for animal care, the therapeutic treatment and analysis of peptides.

Analysis of adipose tissue by immunohistochemistry

A small area around epididymal adipose tissue was collected from other treatment groups and fixed in formalin for 2 days. Two days later, the tissues were washed and paraffin-embedded blocks were prepared for sectioning. The sections were rehydrated by successive removal of paraffin in 100%, 90% and 80% ethanol and distilled water for two minutes in a xylenes bath. The sections were stained with the corresponding antibodies at 4 &lt; 0 &gt; C under the humidity condition. The following day, the tissue was washed and counter-stained with DAPI, and images thereof were obtained using a Nikon Eclipse TE 2000-E fluorescence microscope (Japan). Positive fluorescent cells were counted in 10 consecutive visual fields at the same magnification.

TUNEL Assay

A TUNEL (terminal DNA transferase-mediated dUTP nick end labeling) assay for detecting apoptotic DNA breaks was performed using an apoptosis detection kit (Roche Applied Sciences, Germany). Peripheral parts of epididymal adipose tissue were collected from other treatment groups and fixed in formalin for 2 days. Two days later, the tissues were washed and paraffin-embedded blocks were prepared for sectioning. The sections were rehydrated by successive removal of paraffin in 100%, 90% and 80% ethanol and distilled water for two minutes in a xylenes bath. The sections were reacted in PBS treated with Proteinase K (40 [mu] g / ml) for 30 min at 37 [deg.] C for 30 min and then re-reacted for 5 min in PBS twice. The TUNEL reaction was performed by reacting the fragment with a TUNEL reaction mixture containing TdT (terminal deoxynucleotidyl transferase) and FITC-labeled nucleotides at 37 ° C for 1 hour according to the manufacturer's instructions. The tissue was washed and counter-stained with DAPI, and images thereof were obtained using a Nikon Eclipse TE 2000-E fluorescence microscope (Japan). TUNEL-positive cells were counted in 10 consecutive visual fields at the same magnification.

Real-time PCR

Total RNA was obtained from adipose tissue using the RNAiso kit (Takara). Total RNA (1 g) was reverse transcribed into cDNA using the iScript TM cDNA Synthesis Kit (Bio-rad). Real-time PCR was performed with 500 ng of synthesized cDNA using SYBR premix Ex Taq perfect real time (Takara) using gene-specific primers (Table 1). RT-PCR was performed using the 7500 Real-Time PCR system (Applied Biosystems) as follows: (a) denaturation step, 95 ° C for 10 min; (b) amplification step (40 cycles), 15 seconds at 95 ° C for 30 seconds, 30 seconds at 60 ° C and 30 seconds at 72 ° C per cycle, 1 minute at 95 ° C, 30 seconds at 55 ° C and 30 seconds at 95 ° C . Multiple changes to the control sample (fold change) was calculated by using the CT, and ΔCT ΔΔCT value. GAPDH RNA was used as an internal control.

Primer sequence. gene GenBank access number Sequences (5 '-> 3') Tm (占 폚) Akt-2 NM_001110208 FP- ACGTGGTGAATACATCAAGACC
RP- GGGCCTCTCCTTATACCCAAT 60 IL-6 NM_031168 FP- TCTATACCACTTCACAAGTCGGA
RP- GAATTGCCATTGCACAACTCTTT 60 IL-8
(KC) NM_011339.2 FP- TGTTGAGCATGAAAAGCCTCTAT
RP- AGGTCTCCCGAATTGGAAAGG 60 IL-10 NM_010548.2 FP- GCTGGACAACATACTGCTAACC
RP- ATTTCCGATAAGGCTTGGCAA 60 IL-1? NM_008361.3 FP- TTCAGGCAGGCAGTATCACTC
RP- GAAGGTCCACGGGAAAGACAC 60 TNF-a NM_013693.2 FP- CAGGCGGTGCCTATGTCTC
RP- CGATCACCCCGAAGTTCAGTAG 60 MCP-1 NM_011333.3 FP- TAAAAACCTGGATCGGAACCAAA
RP- GCATTAGCTTCAGATTTACGGGT 60 CD11b NM_001082960.1 FP- GGGAGGACAAAAACTGCCTCA
RP- ACAACTAGGATCTTCGCAGCAT 60 CD11c NM_021334.2 FP- GTGCTGAGTTCGGACACAGT
RP- AGAGGCCACCTATTTGGTTAGTb 60 CCR5 NM_009917.5 FP- ATGGATTTTCAAGGGTCAGTTCC
RP- CTGAGCCGCAATTTGTTTCAC 60 Arginine-1 NM_007482.3 FP- TTGGGTGGATGCTCACACTG
RP- GTACACGATGTCTTTGGCAGA 60 IFN-y NM_008337.3 FP- ACAGCAAGGCGAAAAAGGATG
RP- TGGTGGACCACTCGGATGA 60

Abbreviation: FP, forward primer; RP, reverse primer; And Tm, melting point.

Metabolic Studies

For ipGTT (intraperitoneal glucose tolerance test), mice were fasted overnight and then 2 mg glucose per body weight (g) was intraperitoneally injected. Blood was obtained from the tail vein of the perceptional mice at 0-, 15-, 45-, and 120-min. Glucose was measured using the Accu-Check active blood glucose monitoring system (Roche).

Protein and lipid analysis

(IL-6, IL-8, TNF-a and MCP-I), serum IL-6, IL-8 and MCP-I after 6 h fasting Metabolic mediators and serum assays of inflammatory mediators These are commercially available mouse insulin (Crystal Chem Inc, Downers Grove, Ill.), IL-1β, IL-6, IL-8 (Invitrogen), TNF- (eBioscience) ELISA kits. Liver and serum triglyceride and FFA levels were measured using commercially available assays: Triglyceride-SL assay (Diagnostic Chemicals Ltd) and NEFA C (Wako Chemicals).

Statistical analysis

Data are presented as mean ± standard error (SEM) or standard deviation (SD) as indicated. The mean difference between the two groups was assessed in a double-tailed Student's test. The mean difference between two or more groups was determined by ANOVA. P <0.05 was considered statistically significant.

Experiment result

Synthesis and cyclization of pFTP

Multivalency is an important feature that increases overall activity and confer additional binding affinity in the ligand to the receptor. In order to increase the valency and binding affinity of FTP, the present inventors have polymerized the peptides. The presence of cysteine residues in the FTP peptides provided an opportunity to facilitate the polymerization of DMSO-based FTP (Fig. 5A). The molecular weight of the synthesized peptides was determined using MALDI-TOF (Fig. 5B). Results from peptide polymerizations performed in the presence of 30% DMSO resulted in different sizes of polypeptides ranging from monomers (single FTP peptides, about 1.07 kDa) to pentamers (five FTP peptides, about 5.2 kDa). The synthesized peptides were significantly larger in size, confirming the polymerization of the peptides and indirectly showing that they have higher binding values compared to the original FTP. In order to retain polypeptides with more binding, we also removed smaller monomers, dimers and most of the trimeric peptides through dialysis using a dialysis bag with a 3.5 kDa molecular weight cut-off. The final peptides were analyzed again with MALDI-TOF to confirm the presence of large amounts of pentameric peptides with smaller amounts of trimeric peptides (Fig. 5B). The dialyzed poly-FTP (pFTP) was used in all experiments in this study.

Cyclization of the peptides obtained through oxidative DMSO-mediated polymerization was tested using DTNB (Ellman's reagent). The DTNB reaction showed the presence of about 15-20% free thiol groups, which means that the remaining 80-85% of the peptides are ring-shaped (Figure 5c). Thus, the above results clearly show that FTP peptides are successfully dialed into poly-FTP (pFTP) and are present in a ring form in the native state.

FTP and pFTP binding affinity comparison

PFTP with a 5-fold higher binding (Fas or FasL binding epitope) than FTP was predicted to have increased affinity for both Fas and FasL molecules due to avidity. To confirm this, the present inventors conducted surface plasmon resonance (SPR) analysis to investigate the binding kinetics of FTP and pFTP to Fas and FasL. FasL was immobilized on the sensor chip and different concentrations of FTP or pFTP were treated on the surface to investigate the binding kinetics. The association constants (K _a ) and dissociation constants (K _d ) of pFTP were 2.1849 × 10 ³ M ^-1 S ^-1 and 4.7 × 10 ^-3 S ^-1 , respectively, and the K _a and K _d were calculated to be 1.2440 × 10 ³ M ^-1 S ^-1 and 3.1 × 10 ^-3 S ^-1 , respectively. Finally, the binding affinity (K _D ; K _d / K _a ) of pFTP and FTP was 2.1 ± 8 μM and 25.2 ± 4 μM, respectively (FIG. 6A).

We tested the affinity for Fas receptors by immobilizing the Fas receptor on the sensor chip and by treating the concentrations with pFTP and FTP to investigate kinetics. The K _a and K _d of pFTP were 260 × 10 ³ M ^-1 S ^-1 and 1.5 × 10 ^-3 S ^-1 , respectively, and the K _a and K _d of FTP were 27 × 10 ³ M ^-1 S ^-1 and 1.6 × 10 ^-3 S ^-1 . The final binding affinities (K _D ) of pFTP and FTP were 5.9 ± 10 μM and 55 ± 4 μM, respectively (Figure 6b).

The dissociation constant as well as the binding affinity of pFTP were better than those of FTP in the binding experiment (Fas or FasL) described above.

Feature Comparison of pFTP and FTP

The polymerization reaction significantly increases the size and molecular weight of pFTP. To investigate whether pFTP itself induces cytotoxicity, we performed a CCK-8 assay in jurkat cells treated with different amounts (100-1000 μM) of FTP or pFTP. FTP or pFTP showed no cytotoxicity in the jurkat cells as well as no significant difference between the two (Fig. 7a).

To confirm whether the synthesized pFTP had apoptotic suppression, which is a basic feature of FTP, we investigated the inhibitory effect on FasL-induced apoptosis in jurkat cells. Annexin V staining results showed that pFTP can inhibit up to 70% of membrane-bound FasL-induced apoptosis and that the effect is concentration-dependent (FIGS. 7b and 7c). Apoptotic inhibition in pFTP-treated cells was significantly higher at 100, 250, and 500 μM concentrations compared to FTP (pTTP-750 and 1,000 μM), although pFTP exhibited better inhibitory activity at higher concentrations P <0.01). The difference was not statistically significant. Taken together, these results imply that polymerization does not affect, but rather increases, the apoptotic inhibitory activity of pFTP as compared to monomorphic FTP activity.

Apoptosis inhibition mechanism by pFTP

FTP is a highly specific peptide with a unique pathway that inhibits apoptosis, blocking the ERK signaling pathway associated with apoptosis (81) and at the same time being involved in the regulation of anti-apoptotic components Activates the NF-κB pathway (82-84). Thus, FTP is an optional blocker and activator of related pathways (74). In order to investigate the mechanism by which pFTP inhibits apoptosis and to test whether it possesses the unique characteristics of FTP, the present inventors have found that ERK (phosphorylation of ERK) and NF-κB (phosphorylation of IκB-α) The signaling path was investigated. Unlike FTP 74, which induced transient phosphorylation of IκB-α, pFTP did not induce phosphorylation of IκB-α at the time points tested (0-120 min after FasL treatment) in the presence of FasL (FIG. On the other hand, pFTP markedly blocked phosphorylation of ERK at all time points tested (0-120 min after FasL treatment) (Fig. 8B). Thus, the above results indicate that pFTP is a blocking agent when compared to the features of FTP and does not trigger the pathway associated with the Fas-FasL system, and is different from the FTP that regulates the NF-kappaB pathway (FIG. 8c).

Inhibition of FasL-induced pro-inflammatory cytokines in 3T3-L1 mature adipocytes

Pathways that trigger Fas-mediated pro-inflammatory cytokine production in 3T3-L1 mature adipocytes are still unclear. However, in other insulin-responsive tissues, non-apoptotic Fas signaling may activate ERK, JNK and NF-κB pathways. Accordingly, the present inventors have found that pFTP can block the production of pro-inflammatory cytokines such as IL-8 (KC; mouse analogue of IL-8), MCP-1 and IL-6 in FasL-induced 3T3-L1 mature adipocytes Were tested by ELISA. Treatment of 3T3-L1 mature adipocytes with membrane-bound FasL (2 ng / ml) for 12 hours significantly induced the production of pro-inflammatory cytokines. IL-6 production was increased approximately 3-fold (p <0.001) by FasL treatment but decreased significantly in pFTP-treated samples (p <0.01). Inhibition of cytokine production was pFTP concentration-dependent and up to 80% inhibition was observed in pFTP-treated samples (FIGS. 9A and 9D). FTP-treated samples, which were selective blockers, did not show inhibition of IL-6 production in FasL-treated adipocytes. Moreover, the production of other cytokines such as IL-8 (KC) and MCP-1 (approximately 1.8-fold and 3.5-fold increase, respectively) was also increased by Fas treatment, but significantly decreased in pFTP-treated samples And Fig. 9b). Up to 75% of IL-8 and MCP-1 inhibition was observed, and the inhibition was pFTP concentration-dependent. Scrambled peptides and FTP failed to inhibit the production of FasL-induced proinflammatory cytokines in adipocytes. While the above data show that pFTP as a complete blocking agent can inhibit pro-inflammatory cytokine production in FasL-treated mature adipocytes while FTP as an alternative blocking agent inhibits inflammatory cytokine production in FasL-treated mature adipocytes , It can not be used to inhibit Fas-induced inflammation in adipocytes. Based on this, we then used only pFTP to inhibit FasL-induced signals in 3T3-L1 mature adipocyte ( In vitro ) experiments and obesity mouse models.

Recovery of PPARγ and Akt Expression by pFTP in Fas-Activated Adipocytes

Fas activation in 3T3-L1 mature adipocytes distorts insulin sensitivity by down-regulating intracellular content of Akt through a decrease in PPARy. FasL treatment on mature adipocytes markedly down-regulated PPARgamma levels. That is, western blot analysis using a sample treated with pFTP (500 μM) showed a markedly higher level of PPARγ compared to FasL-treated samples. The above results clearly show that pFTP inhibits Fas activation and restores PPARgamma levels (Fig. 10a). PPAR gamma plays a crucial role in the expression of Akt, a key link in insulin-induced glucose uptake by adipocytes. FasL treatment significantly reduced Akt expression to about 63% in mature adipocytes, but pFTP treatment (500 μM) not only inhibited Fas activation by FasL, but also markedly restored Akt expression to about 75% (p <0.01; Fig. 10b). Thus, the data indicate that pFTP can inhibit components or molecules involved in Fas-induced insulin resistance in addition to inhibiting Fas-mediated inflammatory pathways in mature adipocytes. Thus, one of skill in the art will infer that fTTP can indirectly inhibit Fas-induced insulin resistance by restoring Akt levels in mature adipocytes because Akt is associated with insulin sensitivity and its down-regulation impairs insulin signaling .

Inhibition of FasL-triggered pro-inflammatory cytokine production in intraperitoneal macrophages derived from obese mice

The adipose tissue of obese mice functions as a niche of infiltrated macrophages with adipocytes and their number is significantly higher in obese mice compared to dry mice. Thus, macrophages and adipocytes coexist in obese adipose tissue. Thus, we investigated the FasL effect and inflammatory cytokine production by Fas activation in obese mouse-derived intraperitoneal macrophages. Similar to adipocytes, Fas activation did not induce apoptosis in macrophages but triggered inflammatory cytokine production. The present inventors have found that treatment of membrane-bound FasL (10 ng / ml) in intraperitoneal macrophages increases TNF-a, IL-l [beta] and MCP -1 expression was increased. TNF-α levels were significantly increased (250 ± 37 pg / ml; p <0.01) compared to control cells, but significantly decreased in pFTP-treated samples (FIG. 11). In addition, the production of IL-8 (KC) and IL-1 [beta] was significantly increased in FasL-treated samples and decreased by pFTP treatment (Figure 11). The inhibition of cytokine production was pFTP concentration-dependent. Up to 70-80% inhibition of FasL-induced cytokine production was observed by pFTP treatment and at the same time no inhibitory effect was observed with scrambled peptide (scrFTP) treatment. The above results indicate that pFTP as a complete blocking agent not only inhibits pro-inflammatory cytokine production in mature adipocytes but also effectively inhibits cytokine production in obese mouse-derived intraperitoneal macrophages.

The bio-distribution of Alexa-488-labeled pFTP in obese mice

After confirming that pFTP can inhibit Fas activation in mature adipocytes as well as macrophages, we tested the anti-Fas therapeutic efficacy of pFTP on obesity-associated co-morbidities in HFD-induced obese mice Respectively. As a preliminary step for this, we investigated pFTP localization in various organs of obese mice. Intravenous infusion of 500 μg Alexa-488 labeled pFTP in obese mice showed that pFTP accumulates much in adipose tissue and liver and a small amount is also observed in the lungs. Meanwhile, scrambled FTP (scrFTP) was deposited in very small amounts in adipose tissue (Fig. 12A). To confirm cell surface binding of pFTP and to determine the cell type with which pFTP interacts, even though the peptide is located in adipose tissue, we performed adipose tissue sectioning studies. Since Fas and FasL are expressed in both adipocytes and invasive adipose tissue macrophages (ATMs), which are extensively involved in inflammation and insulin resistance, the inventors have checked whether pFTP interacts with these cells. Fluorescence microscopy results indicated that pFTP bound distinctly to large ring-shaped (white) adipocytes, indicating the interaction of pFTP and Fas at the adipocyte surface (Figure 12b). In addition, when investigating the presence or binding of scrFTP in adipose tissue sections, the inventors failed to detect the presence of peptide bonds or interaction with cells. Second, the present inventors sought to determine whether pFTP interacts with Fas / FasL also in adipose tissue macrophages. We then stained adipose tissue macrophages with commercially available CD11b-PE antibodies and examined the presence of Alexa-488-labeled pFTP. Through fluorescence microscopy analysis, the inventors have confirmed that pFTP can also bind adipose tissue macrophages (FIG. 12C).

Based on the above results showing the interaction between pFTP and most important cells involved in the etiology of obesity-related complications, we found that inhibition of Fas activity in adipocytes and ATMs was associated with obesity-related inflammation, Hypothesis that it has therapeutic effect on fatty liver.

Inflammation profile in pFTP-treated obese mice

Considering that obesity is associated with increased inflammatory pathways and thus leads to increased inflammatory cytokine production, the inventors have shown that the effect of pFTP treatment on the production of obesity-related inflammatory pathways and the resulting cytokine (Fig. 13A). pFTP peptide treatment exhibited markedly attenuated inflammatory signaling in adipose tissue. Phosphorylation of JNK (Jun-NH ₂ terminal kinase), p38 MAPK (mitogen activated protein kinase) and NF-κB (p65 nuclear factor-κB) was reduced in pFTP-treated obese adipose tissue compared to control and scrambled peptide treatment (Fig. 14A). As expected, the gene expression of the relevant inflammatory cytokines, such as TNF- [alpha], IL-l [beta], IL-6, IL-8 (KC) and MCP-I, decreased significantly in the pFTP-treated group (Fig. 14A). In order to confirm the above data, the expression levels of infiltrated immune cell markers such as M1 type macrophages (CD11c), CCR5 ⁺ (CCR5) and Mac-3 ⁺ macrophages and normal white blood cells (CD11b) (Fig. 14B). Interestingly, M1-type macrophages associated with gene expression such as CD11c, TNF-a, IL-l [beta] and IL-6 in pFTP-treated groups were significantly reduced compared to control or scrambled peptide treatments and IL- M2 type macrophages associated with gene expression such as arginase-1 were increased (Figs. 14A and 14B).

Improved insulin signaling in pFTP-treated obese mice

The insulin signal is transmitted through phosphorylation of the downstream target, Akt. Based on in vitro results in 3T3-L1 adipocytes, Fas activation impairs insulin signaling by inducing a reduction in both intracellularly phosphorylated Akt and total Akt content through down-regulation of PPARy. In the same context as our in vitro results, the inventors have found that pFTP treatment improves PPARgamma levels in adipose tissue of obese mice (Fig. 15A). In addition to the PPARgamma levels, insulin-induced phosphorylation of Akt levels was significantly increased in the pFTP-treated group as compared to the control (Figure 15b).

pFTP inhibits inflammatory-sensitized 3T3-L1 mature adipocyte apoptosis by Fas activation

In bovine obesity, adipocytes and macrophages coexist in adipose tissue, and macrophages play an important role in the development of inflammatory conditions. In order to investigate the inflammatory effect on 3T3-L1 mature adipocytes, we prepared LPS-induced inflammatory cytokine conditioned medium from Raw264.7 cells (macrophage line; Raw-CM) to mimic the above conditions. The 20% Raw-CM alone treatment did not induce the truncated caspase-3 level significantly, but adding FasL to Raw-CM significantly increased the truncated caspase-3 level in 12 hours (Fig. 16a). In addition, treatment with Raw-CM and FasL reduced cell viability by about 25% after 12 hours (Fig. 16b). Taken together, the above data clearly demonstrate that inflammatory conditions in the 3T3-L1 mature adipocytes do not induce apoptosis, but that inflammatory conditions sensitize the cells and confront apoptosis following Fas activation.

Second, we investigated whether pFTP could block FasL-induced apoptosis under inflammatory conditions. Co-treatment of FasL and pFTP (500 M) under inflammatory conditions (Raw-CM) inhibited truncated caspase-3 production and markedly improved cell viability. In order to more specifically determine the role of Fas activation and apoptosis, the present inventors used 20% conditioned medium prepared by stimulating peritoneal-derived macrophages with FasL (10 ng / ml) to induce inflammatory conditions Was used to test the effect of FasL (2 ng / ml) treated 3T3-L1 mature adipocyte apoptosis. Annexin V staining results showed approximately 3.5-fold increased apoptosis results, which was significantly inhibited when pFTP was treated (Fig. 16c).

Taken together, the above data clearly indicate that Fas activation utilizes conditions that induce apoptosis as well as involve the development of an inflammatory environment in adipocytes.

Inhibition of apoptosis in adipose tissue of pFTP-treated obese mice

Since apoptosis of adipocytes is a link between inflammation, insulin resistance and fatty liver, inhibition of apoptosis would be very beneficial. Regarding the Fas function involved in the apoptosis of inflammation-sensitized adipocytes, the present inventors have tested whether pFTP has an apoptotic inhibitory effect. In addition, TNF- [alpha] and IFN- [gamma] can sensitize adipocytes to Fas-mediated apoptosis, either individually or in combination. Quantitative real-time PCR results showed increased expression of TNF-a and IFN-y in adipose tissue of obese mouse group compared to the same week old dry mouse group (Fig. 17A). When TNF-a levels were measured in adipose tissue of pFTP-treated mice, mRNA levels were reduced by about 40% as compared to the control or scrambled peptide-treated groups. However, IFN-y levels were no different between the control, scrFTP-treated obesity mouse group or pFTP-treated obese mouse group (Fig. 17A). In order to identify and quantify the amount of apoptosis, we performed TUNEL assays on adipose tissue samples derived from other animal groups. Qualitative results (microscopic photographs of TUNEL-positive cells) and quantitative results (number of TUNEL-positive cells per 10 fields) showed a clear reduction (p < 0.05) of apoptosis in the pFTP-treated group . Quantitation of TUNEL-positive cells showed a 20 +/- 4.7% reduction in the pFTP-treated group compared to the control (Figure 17B). To further confirm the reduction of the apoptotic phase of the pFTP-treated sample, we examined the activation level of caspase-3, an important effector of the apoptotic signal. Consistent with the TUNEL assay results, the cleaved caspase-3 densitometric analysis via Western blot revealed significant inhibition of apoptosis in the pFTP-treated group (25 +/- 7.4% ) (Fig. 17C).

Adipocytes in adipocytes are associated with macrophage infiltration and crown like structurs (CLS) that form around dead fat cells. As the number of dead fat cells increases, the number of CLS also increases. Thus, we performed immunohistochemical analysis of CLS of adipose tissue specimens obtained from three groups using macrophage specific F4 / 80 antibody to determine the number of CLS. The number of F4 / 80-positive CLS in the pFTP-treated group was 21 ± 6.3% less than the control group (Figure 17d).

The blocking of Fas activation by pFTP in adipocytes interferes with inflammatory circuits to suppress systemic insulin resistance

Next, we evaluated the effects associated with systemic inflammation levels and metabolic parameters in adipose tissue as an inflammatory starting point identified with a decrease in inflammatory rods in adipose tissue. Significant reductions in cytokine production in adipose tissue were also reflected at the systemic level. After 5 weeks of pFTP treatment, we measured the circulatory levels of IL-6, IL-8 (KC) and MCP-1 at about 26 ± 4%, 30 ± 6%, and 34 ± 6 % (Fig. 18).

Metabolic parameters were also improved in the pFTP-treated group. It was also found that levels of systemic fasting insulin (28 ± 3%) and FFA (30 ± 7%) were also significantly decreased and triglyceride levels were reduced to some extent (FIGS. 19B, 19C and 19D, respectively) . Moreover, ipGTT results indicated that HFD-induced glucose hypersensitivity was attenuated by pFTP treatment (Fig. 19A). Thus, pFTP treatment resulted in reduced systemic inflammation and lipid profiles and improved insulin sensitivity and glucose sensitivity in HFD-induced obese mice.

Improvement of fatty liver in pFTP-treated obese mice

The major candidates for liver insulin resistance and fatty liver are IL-6 and FFA. Following reduction in IL-6 levels in systemic adipose tissue with systemic FFA content, we checked liver status in pFTP-treated mice. H & E staining micrographs of liver specimens showed a pronounced reduction in lipid accumulation (Figure 20a). In addition, the total triglyceride content of the liver was also markedly decreased (Fig. 20B).

Fas inhibitory effect on adipose tissue in weight and food intake

After HFD diets for 13 weeks, including 4-5 weeks of pFTP treatment, the mice were reduced in body weight by about 10% compared to the control or scrambled peptide treatment groups, with the reduction of inflammation due to pFTP-induced Fas inhibition And did not significantly change food intake (Figs. 21A to 21C).

conclusion

In conclusion, our experimental results strengthen the notion that Fas (CD95) plays a pivotal role in obesity-related inflammation by providing valuable data files. In addition, as a proof of the hypothesis that Fas is a very good therapeutic target, we show that inactivation of Fas signaling in adipocytes and adherent macrophages in adipose tissue improves obesity-related comorbidities. In this process, we developed a powerful Fas inhibitor, poly FTP, which weakens HFD-induced obesity-related complications such as inflammation, insulin resistance and fatty liver.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is obvious that the same is by way of illustration and example only and is not to be construed as limiting the scope of the invention. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

references

1. Hossain, P., Kawar, B., and El Nahas, M. 2007. Obesity and diabetes in the developing world - a growing challenge. N Engl J Med 356: 213-215.

2. Riley, W.T., Barenie, J.T., Mabe, P.A., and Myers, D.R. 1991. The role of race and ethnicity on the psychosocial correlates of smokeless tobacco use in adolescent males. J Adolesc Health 12: 15-21.

3. WHO. 2010. WHO Fact Files: Ten facts on obesity. Geneva: WHO. http://www.who.int/features/factles/obesity/en/index.html

4. Gregor, M. F., and Hotamisligil, G.S. 2011. Inflammatory mechanisms in obesity. Annu Rev Immunol 29: 415-445.

5. Staels, B. 2006. When the clock stops ticking, metabolic syndrome explodes. Nat Med 12: 54-55; discussion 55.

6. Weiss, R., Dziura, J., Burgert, TS, Tamborlane, WV, Taksali, SE, Yeckel, CW, Allen, K., Lopes, M., Savoye, M., Morrison, J., et al . 2004. Obesity and the metabolic syndrome in children and adolescents. N Engl J Med 350: 2362-2374.

7. Browning, J. D., and Horton, J. D. 2004. Molecular mediators of hepatic steatosis and liver injury. J Clin Invest 114: 147-152.

8. Pond, C. 1998. The Fats of life.

9. Scherer, P.E. 2006. Adipose tissue: from lipid storage compartment to endocrine organ. Diabetes 55: 1537-1545.

10. Farrell, G. C., and Larter, C.Z. 2006. Nonalcoholic fatty liver disease: from steatosis to cirrhosis. Hepatology 43: S99-S112.

11. Hotamisligil, G.S. 2006. Inflammation and metabolic disorders. Nature 444: 860-867.

12. Medzhitov, R. 2008. Origin and physiological roles of inflammation. Nature 454: 428-435.

13. Shoelson, S. E., Lee, J., and Goldfine, A.B. 2006. Inflammation and insulin resistance. J Clin Invest 116: 1793-1801.

14. Kitade, H., Sawamoto, K., Nagashimada, M., Inoue, H., Yamamoto, Y., Sai, Y., Takamura, T., Yamamoto, H., Miyamoto, K., Ginsberg, HN , et al. 2012. CCR5 plays a critical role in obesity-induced adipose tissue inflammation and insulin resistance by regulating both macrophage recruitment and M1 / M2 status. Diabetes 61: 1680-1690.

15. Weisberg, S. P., Hunter, D., Huber, R., Lemieux, J., Slaymaker, S., Vaddi, K., Charo, I., Leibel, R. L., and Ferrante, A. W., Jr. 2006. CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J Clin Invest 116: 115-124.

16. Kanda, H., Tateya, S., Tamori, Y., Kotani, K., Hiasa, K., Kitazawa, R., Kitazawa, S., Miyachi, H., Maeda, S., Egashira, K ., et al. 2006. MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity. J Clin Invest 116: 1494-1505.

17. Mantovani, A., Sica, A., Sozzani, S., Allavena, P., Vecchi, A., and Locati, M. 2004. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25: 677-686.

18. Lumeng, C. N., Bodzin, J. L., and Saltiel, A.R. 2007. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117: 175-184.

19. Odegaard, JI, Ricardo-Gonzalez, RR, Goforth, MH, Morel, CR, Subramanian, V., Mukundan, L., Red Eagle, A., Vats, D., Brombacher, F., Ferrante, AW, et al. 2007. Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature 447: 1116-1120.

20. Tilg, H., and Moschen, A.R. 2006. Adipocytokines: mediators linking adipose tissue, inflammation and immunity. Nat Rev Immunol 6: 772-783.

4. J Biol Chem 276 (1986). The effect of cyclooxygenase-2 mediated through Toll-like receptors on the induction of Toll-like receptors. J Lee, JH, Sohn, KH, Rhee, SH and Hwang, : 16683-16689.

22. Shi, H., Kokoeva, M. V., Inouye, K., Tzameli, I., Yin, H., and Flier, J.S. 2006. TLR4 links innate immunity and fatty acid-induced insulin resistance. J Clin Invest 116: 3015-3025.

23. Souza, S. C., Palmer, H. J., Kang, Y. H., Yamamoto, M.T., Muliro, K. V., Paulson, K. E., and Greenberg, A.S. 2003. TNF-alpha induction of lipolysis is mediated through activation of the extracellular signal-related kinase pathway in 3T3-L1 adipocytes. J Cell Biochem 89: 1077-1086.

24. Hirosumi, J., Tuncman, G., Chang, L., Gorgun, C.Z., Uysal, K. T., Maeda, K., Karin, M., and Hotamisligil, G.S. 2002. A central role for JNK in obesity and insulin resistance. Nature 420: 333-336.

25. Aguirre, V., Uchida, T., Yenush, L., Davis, R., and White, M.F. 2000. The c-Jun NH (2) -terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser (307). J Biol Chem 275: 9047-9054.

26. Parekh, S., and Anania, F.A. 2007. Abnormal lipid and glucose metabolism in obesity: implications for nonalcoholic fatty liver disease. Gastroenterology 132: 2191-2207.

27. Greco, D., Kotronen, A., Westerbacka, J., Puig, O., Arkkila, P., Kiviluoto, T., Laitinen, S., Kolak, M., Fisher, RM, Hamsten, A. , et al. 2008. Gene expression in human NAFLD. Am J Physiol Gastrointest Liver Physiol 294: G1281-1287.

28. Carter-Kent, C., Zein, N.N., and Feldstein, A.E. 2008. Cytokines in the pathogenesis of fatty liver and disease progression to steatohepatitis: implications for treatment. Am J Gastroenterol 103: 1036-1042.

29. Crespo, J., Cayon, A., Fernandez-Gil, P., Hernandez-Guerra, M., Mayorga, M., Dominguez-Diez, A., Fernandez-Escalante, JC, and Pons-Romero, F 2001. Gene expression of tumor necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic steatohepatitis patients. Hepatology 34: 1158-1163.

30. Wieckowska, A., Papouchado, B.G., Li, Z., Lopez, R., Zein, N.N., and Feldstein, A.E. 2008. Increased hepatic and circulating interleukin-6 levels in human nonalcoholic steatohepatitis. Am J Gastroenterol 103: 1372-1379.

31. Senn, J. J., Klover, P. J., Nowak, I. A., Zimmers, T. A., Koniaris, L. G., Furlanetto, R. W., and Mooney, R.A. 2003. Suppressor of cytokine signaling-3 (SOCS-3), a potential mediator of interleukin-6-dependent insulin resistance in hepatocytes. J Biol Chem 278: 13740-13746.

 32. Weigert, C., Hennige, A. M., Lehmann, R., Brodbeck, K., Baumgartner, F., Schauble, M., Haring, H. U., and Schleicher, E. D. 2006. Direct cross-talk of interleukin-6 and insulin signal transduction via insulin receptor substrate-1 in skeletal muscle cells. J Biol Chem 281: 7060-7067.

33. Nagata, S. 1997. Apoptosis by death factor. Cell 88: 355-365.

34. Chinnaiyan, A. M., O'Rourke, K., Tewari, M., and Dixit, V.M. 1995. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81: 505-512.

35. Curtin, J. F., and Cotter, T.G. 2003. Live and let die: Regulatory mechanisms in Fas-mediated apoptosis. Cell Signal 15: 983-992.

36. Petersen, K. F., and Shulman, G.I. 2006. Etiology of insulin resistance. Am J Med 119: S10-16.

37. Wajant, H., Pfizenmaier, K., and Scheurich, P. 2003. Non-apoptotic Fas signaling. Cytokine Growth Factor Rev 14: 53-66.

38. Faouzi, S., Burckhardt, B.E., Hanson, J. C., Campe, C. B., Schrum, L. W., Rippe, R.A., and Maher, J.J. 2001. Anti-Fas induces hepatic chemokines and promotes inflammation by an F-kappa B-independent, caspase-3-dependent pathway. J Biol Chem 276: 49077-49082.

39. Farley, S. M., Purdy, D. E., Ryabinina, O. P., Schneider, P., Magun, B. E., and Iordanov, M.S. 2008. Fas ligand-induced proinflammatory transcriptional responses in reconstructed human epidermis. Recruitment of epidermal growth factor receptor and activation of MAP kinases. J Biol Chem 283: 919-928.

40. Imamura, R., Konaka, K., Matsumoto, N., Hasegawa, M., Fukui, M., Mukaida, N., Kinoshita, T., and Suda, T. 2004. Fas ligand induces cell-autonomous NF-kappaB activation and interleukin-8 production by a mechanism distinct from that of tumor necrosis factor- alpha. J Biol Chem 279: 46415-46423.

41. Miwa, K., Asano, M., Horai, R., Iwakura, Y., Nagata, S. and Suda, T. 1998. Caspase 1 independent IL-1beta release and inflammation induced by the apoptosis inducer Morass ligand Nat Med 4: 1287-1292.

42. Schaub, F. J., Liles, W. C., Ferri, N., Sayson, K., Seifert, R.A., and Bowen-Pope, D.F. 2003. Fas and Fas-associated death domain protein regulate monocyte chemoattractant protein-1 expression by human smooth muscle cells through caspase- and calpain-dependent release of interleukin-1alpha. Circ Res 93: 515-522.

43. Wang, F., Lu, Z., Hawkes, M., Yang, H., Kain, K. C., and Liles, W.C. 2010. Fas (CD95) induces rapid, TLR4 / IRAK4-dependent release of pro-inflammatory HMGB1 from macrophages. J Inflamm (Lond) 7:30.

44. Park, D. R., Thomsen, A. R., Frevert, C. W., Pham, U., Skerrett, S. J., Kiener, P. A., and Liles, W.C. 2003. Fas (CD95) induces proinflammatory cytokine responses by human monocytes and monocyte-derived macrophages. J Immunol 170: 6209-6216.

45. Budd, R. C., Yeh, W. C., and Tschopp, J. 2006. cFLIP regulation of lymphocyte activation and development. Nat Rev Immunol 6: 196-204.

46. Maedler, K., Fontana, A., Ris, F., Sergeev, P., Toso, C., Oberholzer, J., Lehmann, R., Bachmann, F., Tasinato, A., Spinas, GA , et al. 2002. FLIP switches Fas-mediated glucose signaling in human pancreatic beta cells from apoptosis to cell replication. Proc Natl Acad Sci U SA 99: 8236-8241.

47. Lavrik, I. N., Golks, A., Riess, D., Bentele, M., Eils, R., and Krammer, P. H. 2007. Analysis of CD95 threshold signaling: triggering of CD95 (FAS / APO-1) at low concentrations. J Biol Chem 282: 13664-13671.

48. Lee, K. H., Feig, C., Tchikov, V., Schickel, R., Hallas, C., Schutze, S., Peter, M.E., and Chan, A.C. 2006. The role of receptor internalization in CD95 signaling. EMBO J 25: 1009-1023.

49. Rapold, R. A., Wueest, S., Knoepfel, A., Schoenle, E. J., and Konrad, D. 2013. Fas activates lipolysis in a Ca2 + -CaMKII-dependent manner in 3T3-L1 adipocytes. J Lipid Res 54: 63-70.

50. Wueest, S., Rapold, R. A., Schumann, D. M., Rytka, J. M., Schildknecht, A., Nov, O., Chervonsky, A. V., Rudich, A., Schoenle, E. J., Donath, M. Y., et al. 2010. Deletion of Fas in adipocytes relieves adipose tissue inflammation and hepatic manifestations of obesity in mice. J Clin Invest 120: 191-202.

51. Wueest, S., Rapold, R. A., Schoenle, E. J., and Konrad, D. 2010. Fas activation in adipocytes impairs insulin-stimulated glucose uptake by reducing Akt. FEBS Lett 584: 4187-4192.

52. Hotamisligil, G.S. 2003. Inflammatory pathways and insulin action. Int J Obes Relat Metab Disord 27 Suppl 3: S53-55.

53. Gao, Z., Hwang, D., Bataille, F., Lefevre, M., York, D., Quon, MJ, and Ye, J. 2002. Serine phosphorylation of insulin receptor substrate 1 by inhibitor kappa B kinase complex. J Biol Chem 277: 48115-48121.

 54. Hebbard, L., and George, J. 2010. The chicken or the egg: adipocytes and hepatic insulin resistance. Hepatology 51: 1076-1079.

55. Imai, T., Takakuwa, R., Marchand, S., Dentz, E., Bornert, JM, Messaddeq, N., Wendling, O., Mark, M., Desvergne, B., Wahli, W. , et al. 2004. Peroxisome proliferator-activated receptor gamma is required in mature white and brown adipocytes for their survival in the mouse. Proc Natl Acad Sci U SE 101: 4543-4547.

56. Tontonoz, P., and Spiegelman, B. M. 2008. Fat and beyond: the diverse biology of PPARgamma. Annu Rev Biochem 77: 289-312.

57. Tontonoz, P., Hu, E., Graves, R.A., Budavari, A.I., and Spiegelman, B.M. 1994. mPPAR gamma 2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8: 1224-1234.

58. Sugii, S., Olson, P., Sears, D. D., Saberi, M., Atkins, A. R., Barish, G. D., Hong, S. H., Castro, G. L., Yin, Y. Q., Nelson, M. C., et al. 2009. PPARgamma activation in adipocytes is sufficient for systemic insulin sensitization. Proc Natl Acad Sci U SA 106: 22504-22509.

59. Hevener, A. L., Olefsky, J. M., Reichart, D., Nguyen, M. T., Bandyopadyhay, G., Leung, H. Y., Watt, M. J., Benner, C., Febbraio, M. A., Nguyen, A. K., et al. 2007. Macrophage PPAR gamma is required for normal skeletal muscle and hepatic insulin sensitivity and full antidiabetic effects of thiazolidinediones. J Clin Invest 117: 1658-1669.

60. Odegaard, JI, Ricardo-Gonzalez, RR, Goforth, MH, Morel, CR, Subramanian, V., Mukundan, L., Red Eagle, A., Vats, D., Brombacher, F., Ferrante, AW, et al. 2007. Macrophage-specific PPARgamma controls alternative activation and improves insulin resistance. Nature 447: 1116-1120.

61. He, W., Barak, Y., Hevener, A., Olson, P., Liao, D., Le, J., Nelson, M., Ong, E., Olefsky, J. M., and Evans, R.M. 2003. Adipose-specific peroxisome proliferator-activated receptor gamma knockout causes insulin resistance in fat and liver but not in muscle. Proc Natl Acad Sci U SE 100: 15712-15717.

 62. Medina-Gomez, G., Gray, SL, Yetukuri, L., Shimomura, K., Virtue, S., Campbell, M., Curtis, RK, Jimenez-Linan, M., Blount, M., , GS, et al. 2007. PPAR gamma 2 inhibitory lipotoxicity by controlling adipose tissue expandability and peripheral lipid metabolism. PLoS Genet 3: e64.

 Dhindsa, S. and Dandona, P. 2004. Mohanty, P., Aljada, A., Ghanim, H., Hofmeyer, D., Tripathy, D., Syed, T., Al-Haddad, W., Evidence for a potent antiinflammatory effect of rosiglitazone. J Clin Endocrinol Metab 89: 2728-2735.

64. Jiang, C., Ting, A. T., and Seed, B. 1998. PPAR-gamma agonists inhibit the production of monocyte inflammatory cytokines. Nature 391: 82-86.

65. Ricote, M., Li, A. C., Willson, T. M., Kelly, C. J., and Glass, C. K. 1998. The peroxisome proliferator-activated receptor-gamma is a negative regulator of macrophage activation. Nature 391: 79-82.

The present invention relates to a method of inhibiting kappaB inhibitory-kappaB stimulatory effects, comprising the steps of: (a) of troglitazone in obese patients with type 2 diabetes: evidence of an antiinflammatory action? J Clin Endocrinol Metab 86: 3250-3256.

67. Pascual, G., Fong, A. L., Ogawa, S., Gamliel, A., Li, A. C., Perissi, V., Rose, D. W., Willson, T. M., Rosenfeld, M. G., and Glass, C. K. 2005. A SUMOylation-dependent pathway mediates transrepression of inflammatory response genes by PPAR-gamma. Nature 437: 759-763.

68. Seino, K., Iwabuchi, K., Kayagaki, N., Miyata, R., Nagaoka, I., Matsuzawa, A., Fukao, K., Yagita, H., and Okumura, K. 1998. Chemotactic activity of soluble Fas ligand against phagocytes. J Immunol 161: 4484-4488.

69. Strissel, K.J., Stancheva, Z., Miyoshi, H., Perfield, J.W., 2nd, DeFuria, J., Jick, Z., Greenberg, A.S., and Obin, M.S. 2007. Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes 56: 2910-2918.

70. Alkhouri, N., Gornicka, A., Berk, M.P., Thapaliya, S., Dixon, L. J., Kashyap, S., Schauer, P.R., and Feldstein, A.E. 2010. Adipocyte apoptosis, a link between obesity, insulin resistance, and hepatic steatosis. J Biol Chem 285: 3428-3438.

71. Fischer-Posovszky, P., Hebestreit, H., Hofmann, A. K., Strauss, G., Moller, P., Debatin, K. M., and Wabitsch, M. 2006. Role of CD95-mediated adipocyte loss in autoimmune lipodystrophy. J Clin Endocrinol Metab 91: 1129-1135.

72. Park, BW, Zhang, HT, Wu, C., Berezov, A., Zhang, X., Dua, R., Wang, Q., Kao, G., O'Rourke, DM, et al. 2000. Rationally designed anti-HER2 / neu peptide mimetic disables P185HER2 / neu tyrosine kinases in vitro and in vivo. Nat Biotechnol 18: 194-198.

73. Takasaki, W., Kajino, Y., Kajino, K., Murali, R., and Greene, M.I. 1997. Structure-based design and characterization of exocyclic peptidomimetics that inhibit TNF alpha binding to its receptor. Nat Biotechnol 15: 1266-1270.

74. Hasegawa, A., Cheng, X., Kajino, K., Berezov, A., Murata, K., Nakayama, T., Yagita, H., Murali, R., and Greene, M.I. 2004. Fas-disabling small exocyclic peptide mimetics limit apoptosis by an unexpected mechanism. Proc Natl Acad Sci U SA 101: 6599-6604.

75. Peppel, K., Crawford, D., and Beutler, B. 1991. A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity. J Exp Med 174: 1483-1489.

76. Scallon, B. J., Trinh, H., Nedelman, M., Brennan, F.M., Feldmann, M., and Ghrayeb, J. 1995. Functional comparisons of different tumor necrosis factor receptor / IgG fusion proteins. Cytokine 7: 759-770.

77. Williams, R. O., Ghrayeb, J., Feldmann, M., and Maini, R.N. 1995. Successful therapy of collagen-induced arthritis with TNF receptor-IgG fusion protein and combination with anti-CD4. Immunology 84: 433-439.

78. Won, Y. W., Kim, H. A., Lee, M., and Kim, Y.H. 2010. Reducible poly (oligo-D-arginine) for enhanced gene expression in mouse lung by intratracheal injection. Mol Ther. 18: 734-742.

79. Soundara Manickam, D., Bisht, HS, Wan, L., Mao, G., and Oupicky, D. 2005. Influence of TAT-peptide on properties and transfection activity of TAT / DNA polyplexes. J Control Release 102: 293-306.

<110> Industry-University Cooperation Foundation Hanyang University <120> Cyclized poly Fas Targeting Peptides and Uses Thereof <130> PN130332 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Morocco Targeting Peptide <400> 1 Tyr Cys Asp Glu His Phe Cys Tyr   1 5

Claims (26)

(Cyclic poly Fas targeting peptide) in which the Fas binding peptide (Fas targeting peptide) sequence (FTP) is cyclized, and the cyclic poly FT consists of a Fas (fatty acid synthase) or a FasL gt; FTP &lt; / RTI &gt;
2. The circular poly FTP according to claim 1, wherein the cyclization is formed by one cysteine residue in the FTP being linked to another cysteine residue in the FTP via a disulfide bond.
The circular poly FTP of claim 1, wherein the annular poly FTP consists of 3-7 FTP rings.
The method of claim 1, wherein the association constant (K _a) of the annular poly FTP to Fas or FasL is at least two times higher than the binding constant for Fas or FasL of a monomeric FTP. FTP.
The cyclic poly FTP according to claim 1, wherein the dissociation constant (K _d ) for Fas or FasL of the annular poly FTP is at least 1.5 times higher than the binding constant for Fas or FasL of monomer FTP.
The method of claim 1, wherein the binding affinity (K _D ) of the cyclic poly-FT to Fas or FasL is at least ten times higher than the binding affinity of monomer FT to Fas or FasL. .
The circular poly FTP according to claim 1, wherein the circular poly FTP has an activity of inhibiting Fas-induced apoptosis.
8. The circular poly FTP according to claim 7, wherein said Fas-induced apoptosis occurs in adipose tissue macrophages (ATMs) of adipose or adipose tissue.
2. The circular poly FTP of claim 1, wherein the annular poly FTP blocks an extracellular signal-regulated kinase (ERK) signaling path.
6. The circular poly FTP according to claim 1, wherein the annular polyPTF inhibits the production of Fas-induced pro-inflammatory cytokines and chemokines.
11. The method of claim 10, wherein said Fas-induced proinflammatory cytokine and chemokine is selected from the group consisting of TNF (tumor necrosis factor) -α, iNOS (inducible NO synthase), IL (interleukin) MCP (monocyte chemotactic protein) -1.
2. The circular poly FTP according to claim 1, wherein the annular poly FTP reduces M1 type macrophages and increases M2 type macrophages.
2. The circular poly FTP according to claim 1, wherein the annular poly FTP suppresses Fas-triggered insulin resistance.
(a) a therapeutically effective amount of the cyclized poly Fas targeting peptide of any one of claims 1 to 13; And (b) a pharmaceutically acceptable carrier. &Lt; Desc / Clms Page number 15 &gt;
The pharmaceutical composition according to claim 14, wherein the pharmaceutical composition inhibits phosphorylation of JNK (Jun-NH ₂ terminal kinase), p38 MAPK (mitogen activated protein kinase) or NF-κB (p65 nuclear factor-κB) Gt;
15. The pharmaceutical composition according to claim 14, wherein said pharmaceutical composition inhibits the expression of CD11c, CCR5 or CD11b.
15. The pharmaceutical composition of claim 14, wherein said pharmaceutical composition increases the expression of arginase-1 or IL-10.
15. The pharmaceutical composition according to claim 14, wherein the pharmaceutical composition increases intracellular levels of PPARy (Peroxisome proliferator-activated receptor gamma) or phospho-Akt.
15. The pharmaceutical composition of claim 14, wherein said pharmaceutical composition inhibits the formation of Fas-induced cleaved capase-3.
15. The pharmaceutical composition according to claim 14, wherein the pharmaceutical composition inhibits the formation of a crown-like structure (CLS).
15. The pharmaceutical composition of claim 14, wherein the pharmaceutical composition reduces serum free fatty acids (FFA), lipid accumulation, or triglyceride content.
15. The method of claim 14, wherein the obesity-induced disease, disease or condition is selected from the group consisting of inflammation, insulin resistance, glucose insufficiency, type 2 diabetes, fatty liver, hepatitis, dyslipidemia, hypertension, rheumatoid arthritis, Sjogren's syndrome, It is characterized by including multiple sclerosis, ocular disorders, renal injury or trauma, HIV (human immunodeficiency virus) infection, aging, cancer, graft rejection or autoimmune diseases &Lt; / RTI &gt;
(a) a therapeutically effective amount of the cyclized poly Fas targeting peptide of any one of claims 1 to 13; And (b) a pharmaceutically acceptable carrier. A pharmaceutical composition for inhibiting or treating a Fas-associated skin or hair disorder, disease or condition.
24. The method of claim 23, wherein the Fas-associated skin or hair disease, condition or condition is selected from the group consisting of vitiligo, psoriasis, TEN (toxic epidermal necrolysis, Rial syndrome), eczematous dermatitis, macropapular rashes, rosacea, hair cell-associated disease or drug-induced skin disease.
The method of claim 24, wherein the hair cell-associated disease is selected from the group consisting of alopecia areata, alopecia totalis, alopecia universalis, ophiasis, androgenic alopecia, telogen effluvium, lichen planopilaris, chemotherapy-induced hair loss or radiation therapy-induced hair loss.
26. The method of claim 25, wherein said chemotherapy-induced hair loss is selected from the group consisting of cyclophosphamide, clomethine, mestin, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, etoposide, vp16, , Irinotecan, mitogantrone, mitoxantrone, paclitaxel, topotecan, vinblastine, vincristine, gemcitabine or carboperactin treatment.

Images