KR20150019027A - Multiplex assay kit for analyzing personal genome SNP and method using the same - Google Patents

Abstract

The present invention relates to a technique for multiplex assay of personal genome single nucleotide polymorphism (SNP) and, more specifically, to a primer set and a probe set used for the assay, and to a kit comprising the same. In addition, the present invention relates to a method for easily analyzing predictions with respect to disease susceptibility, drug responsiveness, genetic disease, or physical characteristics according to the gene type, by utilizing a kit for personal genome SNP assay to analyze particular genes.

Description

TECHNICAL FIELD [0001] The present invention relates to a method and a kit for analyzing a genomic SNP,

TECHNICAL FIELD The present invention relates to a technique for multiple analysis of a single genome SNP (single nucleotide polymorphism), a primer set and a probe set used in the analysis, and a kit containing the same. The present invention also relates to a method for easily analyzing disease susceptibility, drug reactivity, genetic disease, or physical characteristics according to genotypes by analyzing specific genes using a kit for analyzing SNPs of individual genomes.

After all the human genome sequences have been decoded, research on single nucleotide polymorphism (SNP) has been actively conducted on differences in single base pairs based on individual and racial diversity in order to clarify the relationship with disease. 99.9% of the human genes are identical, but genetic characteristics such as constitution, appearance, and disease are shown by individual and ethnic genetic characteristics due to differences in SNP and copy number variation (CNV) of 0.1-0.5% It is known that drug efficacy, drug efficacy, and reaction are different due to differences in SNP and CNV.

Therefore, it is possible to apply the accumulated SNP study results to various fields such as differences in physical characteristics of individuals, historical differences such as differences in drug response, susceptibility to specific diseases, and migration routes of ethnic groups.

In addition, due to the breakthrough of genome analysis technology and the drop in analysis cost, the individual genome analysis industry has been extended beyond the research level to business areas for the general public. Already in developed countries, various companies such as 23andMe, Knome, deCODEme, Navigenics, Counsyl and Pathway Genomics provide personal genome analysis service, and commercialization and popularization as DCT (Direct to Consumer Genetic Test) is accelerating. With the advent of personalized products and services, it is possible not only to maximize the therapeutic effects, but also to directly enable healthcare activities that are subject to general consumers in terms of disease prediction and prevention.

However, the conventional personalized multimolecular diagnostic technology is mainly focused on development of platform technology, and development of contents linked with biomarker or platform technology corresponding to software is desperately required.

Under such circumstances, the present invention has been developed to provide a multi-diagnostic kit capable of simultaneous detection of individual genome SNPs by combining multiple PCR techniques, enabling industrialization for actual diagnostic purposes. More specifically, the present invention provides primer sets and probe sets used in multiple assays of individual genomic SNPs, and kits containing them, and provides a method for multiple SNP analysis methods that can be used in actual diagnostic sites.

One object of the present invention is to provide a set of primers for multiplex PCR for the analysis of individual genomic SNPs.

It is another object of the present invention to provide a set of probes for multiple analysis of a personal genomic SNP.

It is another object of the present invention to provide a kit for multiplex analysis of a personal genomic SNP comprising the primer set and the probe set.

It is another object of the present invention to provide a method for multiplex analysis of a multiple genomic PCR-based individual genome SNP using the primer set and the probe set.

The present invention relates to a technique for multiple analysis of individual genomic SNPs, a primer set and a probe set used in the analysis, and a kit comprising the same. The present invention also relates to a method for easily analyzing disease susceptibility, drug reactivity, genetic disease, or physical characteristics according to genotypes by analyzing specific genes using a kit for analyzing SNPs of individual genomes.

In the present invention, a total of 32 SNP markers, which are scientifically widely recognized as target SNP markers to be subjected to multiple analysis and capable of predicting disease susceptibility, drug reactivity, genetic diseases and physical characteristics, are selected and the simultaneous detection of these SNP markers A possible platform was constructed, and analysis conditions were established through optimization process. In addition, the contents were acquired to provide unique analysis results optimized for Koreans by matching predicted information on genotype, disease susceptibility, drug reactivity, genetic disease and physical characteristics obtained from the analysis results. The functional classification and characteristics of the 32 selected genes are shown in Table 1 of the examples.

In one embodiment, the present invention provides a set of primers for simultaneously amplifying the 32 genes.

Preferably, the primer set includes:

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set comprising a primer pair consisting of a nucleotide sequence of SEQ ID NO: 8, a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, and a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12;

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18, A pair of primers consisting of the base sequence of SEQ ID NO: 20, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 21 and SEQ ID NO: 22, and a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO:

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 25 and SEQ ID NO: 26, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 27 and SEQ ID NO: 28, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 29 and SEQ ID NO: A primer pair consisting of the nucleotide sequence of SEQ ID NO: 33 and SEQ ID NO: 34, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 35 and SEQ ID NO: 36, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: A primer set comprising a primer pair consisting of a sequence;

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 40, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 41 and SEQ ID NO: 42, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 43 and SEQ ID NO: A primer set comprising a primer pair consisting of a base sequence of SEQ ID NO: 46, a primer pair consisting of a base sequence of SEQ ID NO: 47 and SEQ ID NO: 48, and a pair of primers consisting of a base sequence of SEQ ID NO: 49 and SEQ ID NO: 50; And

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 51 and SEQ ID NO: 52, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 53 and SEQ ID NO: 54, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 55 and SEQ ID NO: 56, A primer pair consisting of the nucleotide sequence of SEQ ID NO: 59 and SEQ ID NO: 60, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 61 and SEQ ID NO: 62 and a pair of primers consisting of the nucleotide sequence of SEQ ID NO: And a primer set comprising a pair of primers consisting of a sequence selected from the group consisting of primers set for multiplex PCR.

In another aspect, the present invention provides a probe set for detecting SNPs on 32 kinds of genes.

Preferably, the probe set includes:

A probe set consisting of the nucleotide sequence of SEQ ID NO: 65 to SEQ ID NO: 78;

A probe set consisting of the nucleotide sequence of SEQ ID NO: 79 to SEQ ID NO: 92;

A probe set consisting of the nucleotide sequence of SEQ ID NO: 93 to SEQ ID NO: 106;

A probe set consisting of the nucleotide sequence of SEQ ID NO: 107 to SEQ ID NO: 120; And

A probe set consisting of a nucleotide sequence of SEQ ID NO: 121 to SEQ ID NO: 134,

Or may be a set of probes for multiple analysis of individual genomic SNPs.

In another aspect, the present invention provides a kit for multiplex analysis of a multi-PCR-based individual genomic SNP comprising the primer set and the probe set.

In another aspect,

(a) treating a nucleic acid extracted from an individual sample with the primer set of claim 1 to perform a multiple polymerase chain reaction,

(b) hybridizing the amplified product with the probe set of claim 2 as a result of the multiple polymerase chain reaction,

(c) reacting the reactant with the fluorescent material as a result of the hybridization reaction; And

(d) measuring the fluorescence value to identify the individual genomic SNP type.

Provides a method for multiple analysis of individual genomic SNPs.

In this method, preferably, a detectable label may be bonded to the end of either one of the primer pairs constituting the primer set.

Such detectable labels may be, but are not limited to, chemical labels, enzyme labels, radioactive labels, fluorescent labels, luminescent labels, chemiluminescent labels, FRET (fluorescence resonance energy transfer) labels or metal labels.

More specifically, the detectable label may include, but is not limited to, biotin, Cy3, Cy5, fluorescein, phycoerythrin, rhodamine, lisamine, TAMRA, HEX, TET, Dabsyl or FAM.

In the above method, preferably, the probe may be bonded to the bead.

At this time, it is preferable that the bead is a microbead to which a carboxyl group is bonded. In order for the probes to bind more easily to such carboxybids, the probes should be designed such that, for example, an amine group and a 12-poly-cytosine or a 12-poly-thymine are attached at the 5'- Can be modified.

In the above method, preferably, the fluorescent substance may be fluorescein, isothiocyanate, rhodamine, picoerythrine, picocyanin, allophycocyanin, o-phthaldehyde or fluorescamine. For example, the degree of hybridization between the probe and the amplified sample can be confirmed by fluorescence by treating the fluorescer combined with streptavidin. For example, streptavidin is specifically bound to biotin, so that the gene present in a sample can be measured by fluorescence.

The term " primer " of the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different nucleoside triphosphates (NTPs) at appropriate buffer solutions and temperatures.

The primer set of the present invention is characterized in that the size of the primer, the Tm value, the GC content of the primer, the formation of a dimer of the primer by a self-complementary sequence in the primer, Inhibition, etc., and are carefully designed to maximize the sensitivity and specificity of amplification of individual genomes and SNP detection.

In addition, the primer pair constituting the primer set of the present invention amplifies only a specific gene fragment, and amplification of each gene fragment is sufficient for the analysis of the next step. In the PCR reaction, Can be simultaneously amplified. In addition, SNPs of respective genes can be more easily confirmed by forming PCR amplification products having different sizes of the primer pairs.

The primers of the present invention may incorporate additional features that do not alter the basic properties. I.e. the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more nucleotides into nucleotides, and uncharged linkages such as phosphonates, phosphotriesters, phosphoramidates or carbamates, phosphorothioates or phosphorodithioates Or the like can be transformed into a charged nucleus. The primer nucleic acid sequence of the present invention can also be modified using a label that can directly or indirectly provide a detectable signal.

The term " probe " of the present invention means a nucleic acid molecule corresponding to several to several tens bases, which is a short nucleic acid sequence capable of specifically detecting each SNP marker

The probe provided in the present invention is preferably provided in the form of a bead array bonded to beads. The kind of the beads to be combined with the probe is not particularly limited, and the manufacture of the bead array is according to a general method known in the art.

Preferably, the probe may have an amine group capable of covalently bonding to the carboxyl group of the bead at the 5 'terminus for binding to xMAP microspheres attached with a carboxyl group. Amine groups are connected through a preferably (CH ₂₎ n chain. In this case, n is 5 to 10, more preferably 5 to 7. In addition, the probe may further comprise 5-20 cytosine or thymine sequences (e. G., A C12 spacer arm) to facilitate binding to the PCR product. In the present invention, for detection of polymorphism, the genotype of one gene was detected by two probes which are different only in the polymorphic position of the base and the rest are all the same. Sixty - four probes were designed for all 32 genes, and their lengths varied from 18 to 24 bp depending on the conditions.

The term " kit for multiplex analysis of individual genomic SNPs " of the present invention includes the primer set and the probe set, and simultaneously detects SNP markers on a specific gene through multiplex PCR to detect disease susceptibility, drug reactivity, A kit that can be used to easily analyze a disease or a prediction of body characteristics.

The kit of the present invention may further include substances necessary for PCR reaction and base sequence analysis in addition to the primer and the probe set. Thermostable DNA polymerase obtained from DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), dNTP (dATP, dCTP, dGTP, dTTP), a reaction buffer, distilled water, and the like, and may further include an agarose and an electrophoresis buffer to confirm the detection of the PCR product. In addition, the kit of the present invention can be made from a number of separate packaging or compartments containing the reagent components described above.

The 'individual sample' that can be analyzed in the present invention is any bio-derived sample capable of gene analysis including nuclear and / or mitochondria derived from each individual, and may be a sample of cells, tissues, organs, body fluids, blood, etc. . In addition, the nucleic acid extracted from the individual sample may be DNA or RNA, which contains all or part of the target gene in which the SNP marker to be detected exists.

In the present invention, multiplex PCR refers to a process of amplifying a target nucleic acid by repeating the steps of denaturation, annealing, and synthesis using the nucleic acid extracted from the above as a template and using the primer set of the present invention. Preferably, the multiplex PCR can be performed by treating the PCR reaction mixture composed of the primer set of the present invention, DNA polymerase, dNTP, reaction buffer, distilled water and the like using the nucleic acid extracted from the individual sample as a template. The primer pairs constituting the primer set of the present invention have common PCR conditions and can be simultaneously applied to one PCR reaction.

The present invention can easily analyze disease susceptibility, drug reactivity, genetic disease or body characteristics according to genotype by multiplex analysis of individual nucleotide polymorphism (SNP) in one kit.

Figure 1 shows primer validation results by single PCR and multiplex PCR.
Figure 2 shows the results of multiple PCR quantitation and qualitative analysis using a Bioanalyzer 2100 instrument.
Fig. 3 shows the result of genotype analysis by standard nucleotide sequence analysis and MassARRAY.
Figure 4 shows a single PCR result (2% agarose gel) by genotype.
Figure 5 shows the Net MFI for a single PCR result using Luminex (Net MFI = MFI - Background).
6 shows allelic ratios for single PCR results using Luminex (allelic ratio = MFIa1 (MFIa1 + MFIa2 ... + MFIan), Homozygote≈1.0, Heterozygote≈0.5)
Figures 7 and 8 show direct hybridization results for primer set 1 (allelic ratio).
Figures 9 and 10 show direct hybridization results for primer set 2 (allelic ratio).
Figures 11 and 12 show direct hybridization results for primer set 3 (allelic ratio).
Figures 13 and 14 show direct hybridization results for primer set 4 (allelic ratio).
Figures 15 and 16 show direct hybridization results for primer set 5 (allelic ratio).

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example  1. Target Marker  selection

Using the GWAS database (A Catalog of Published Genome-Wide Association Studies) of the US National Institutes of Health, which collected large-scale studies on various diseases for screening content for individual genome analysis related to diseases or personal characteristics Respectively. As of June 2013, there are a total of 1,640 studies in the GWAS database, with 10,876 SNP markers reported to be associated with specific phenotypes.

Among these SNP markers, genes that can be predicted for scientifically recognized disease susceptibility, drug reactivity, genetic diseases, and body characteristics were selected. At this time, 32 cases of genes were selected for contents including the results of research on Asians, while avoiding the case of Westerners only. Functional classification and characteristics of the final screened genes are shown in the following table.

No. Related genes SNP (rs #) Content context M ajor M inor references One MCM8 rs236114 Womb G A Stolk L et al . (2009) 2 ZFP36L2 , LOC100129726 , THADA rs13429458 Womb A C Chen ZJ et al . (2011) 3 SLK , OBFC1 rs7913069 Womb G A Cha PC et al . (2011) 4 CDKN2BAS rs10965235 Womb C A Uno S et al . (2010) 5 Intergenic rs3847153 Womb A G Qin Y et al . (2012) 6 MIPEP , C1QTNF9B - AS1 , C1QTNF9B rs9318086 nearsighted G A Shi Y et al . (2011) 7 FRAP1 rs17036350 nearsighted C T Han S et al . (2011) 8 PDGFRA rs7677751 astigmatism C T Fan Q et al . (2011) 9 GATA2 rs4328821 Immunity A G Okada Y et al . (2011) 10 ITGA4 rs12988934 Immunity C T Okada Y et al . (2011) 11 FUT2 rs1047781 anemia A T Lin X et al . (2012) 12 TMPRSS6 rs855791 anemia G A Chambers JC et al. (2009) 13 LRRK2 rs34778348 Parkinson's disease G A Lill CM et al . (2012) 14 FAM3C rs7776725 Bone density T C Cho YS et al . (2009) 15 LBX1 rs11190870 spine T C Takahashi Y et al . (2011) 16 BTNL2 , HLA - DQA2 , HLA - DQB1 rs10947262 joint C T Nakajima M et al . (2010) 17 NFKBIE rs2233434 arthritis A G Okada Y et al . (2012) 18 NKAPL rs1635 Mental illness G T Yue WH et al . (2011) 19 SP8 rs2709736 Mental illness G A Lee MT et al . (2011) 20 INMT , FAM188B , AQP1 rs1000597 kidney A G Urabe Y et al . (2012) 21 MHC rs2273017 thyroid A G Nakabayashi K et al . (2011) 22 VKORC1 rs9923231 Warfarin A / C / G T Cha PC et al . (2010) 23 CTNNA3 rs10762058 asthma G C Kim SH et al . (2009) 24 WSB1 , FAM27L rs4795519 leukemia A C Kim DH et al . (2011) 25 Intergenic rs987525 Cleft palate C A Beaty TH et al . (2010) 26 BRAP , ALDH2 rs671 Adenosine G A Cui R et al . (2009) 27 DCC rs7504990 Gallbladder cancer G A Cha PC et al . (2012) 28 TERT rs2736100 Lung disease A C Mushiroda T et al . (2008) 29 MHC rs9271366 Inflammatory bowel disease T C Okada Y et al . (2011) 30 FAM167A , BLK rs2254546 Kawasaki disease G A Onouchi Y et al . (2012) 31 Intergenic rs873549 Keloid T C Nakashima M et al . (2010) 32 RNF213 rs6565681 Moyamoya disease G A Kamada et F al . (2011)

Example  2. For gene amplification for individual genome analysis primer  And Of the probe  Produce

PrimerPlex 2.60 of Premiere Biosoft was purchased and used to design primers and probes capable of amplifying and detecting the selection genes listed in Table 1 above. The parameters for designing the primer are shown in the following table.

Parameter Value Tm 58 ± 8 ° C Length 20 to 24 bp Amplicon Length 100 to 300 bp Mg ++ Ion Conc. 3.0mM

Biotin was attached to the 5 'region of the sense strand primer for reaction with Streptavidin-Phycoerythrin (SA-PE). The Tm value of the probe is the same as that of the primer, and its length is designed within a range of 18 to 24 bp. Designed primers and probes were subjected to single PCR and multiplex PCR, followed by luminex single and multiple tests for specific probe verification, and then finalized by modifying and complementing the design. The probe included a 5'-amino modifier to bind to the xMAP microsphere with a carboxyl group attached, and a C12 spacer arm was added to facilitate coupling with the PCR product. For detection of polymorphism, the genotype of one gene was detected with two probes which differ only in the base at the polymorphic position and all in the other. Sixty - four probes were designed for all 32 genes, and their lengths varied from 18 to 24 bp depending on the conditions.

Tables 3 to 7 below show primer sets for simultaneous amplification of multiple markers.

Primer Set  One SEQ ID NO: Name (S / AS ) Sense  Primer (5'- biotin )
Anti - Sense Primer Length Product
Length One rs10965235-S 5'-Biotin-GTTGCCCCTTCTGTCTTTTCCT 22 230 2 rs10965235-AS TCAGCCTAACTTTAAGCCACCAA 23 3 rs13429458-S 5'-Biotin-AGCGGTATGATTTCGTAGTGGTTA 24 289 4 rs13429458-AS TTAGTGGCAGGGTATAGGTGTATG 24 5 rs236114-S 5'-Biotin-GCAGGTAAGTGGCAGAACTGA 21 133 6 rs236114-AS GGTAAGATTCCTCTACAGCAAAGC 23 7 rs3847153-S 5'-Biotin-CCAAGAAGAGGACCACACCTT 21 125 8 rs3847153-AS AATCTGCCTAGAAGACACTCACAT 24 9 rs7913069-S 5'-Biotin-GACCAGAACCTCTCCTGATTACTA 24 208 10 rs7913069-AS TCTCCCCTAACCGATGTCTAAATT 24 11 rs9318086-S 5'-Biotin-CTGTAGGGAGAGAAGGGCATAC 22 146 12 rs9318086-AS GTCAACACATTATTGGTCCATCTG 24

Primer Set  2 order
number Name (S / AS ) Sense  Primer (5'- biotin )
Anti - Sense Primer Length Product
Length 13 rs1047781-S 5'-Biotin-GATGTGGACGATCAATGCAATAGG 24 297 14 rs1047781-AS CGGAGGTGGTGGTAGAAGGT 20 15 rs12988934-S 5'-Biotin-CCCATATCCCGTCGTTTAACCTAA 24 298 16 rs12988934-AS ATTCCTTCCTCTTTCCCCACTTG 23 17 rs17036350-S 5'-Biotin-GAGACCAGCCACCAGTATAAGC 22 272 18 rs17036350-AS CGAACTCCTGACCTCAAGTGAT 22 19 rs4328821-S 5'-Biotin-ACCGAGTTGGGACTGAGGAG 20 280 20 rs4328821-AS CAGCAGGGTGATGTTGTCTTCT 22 21 rs7677751-S 5'-Biotin-TCACTTTCTCTATTGCTCCTCCTT 24 250 22 rs7677751-AS AGTTGCTTGGGTTGGGGTAAA 21 23 rs855791-S 5'-Biotin-GCAGAGCAGGAGAGAAGTAGG 21 237 24 rs855791-AS TTCTTGCCCTTGCGGTAGC 19

Primer Set  3 order
number Name (S / AS ) Sense  Primer (5'- biotin )
Anti - Sense Primer Length Product
Length 25 rs10947262-S 5'-Biotin-AGGCAACTAGAAGAGGGAGAGAT 23 256 26 rs10947262-AS AACAACCCAGGTATGCTGGTATTA 24 27 RS11190870-S 5'-Biotin-GCAAACACTCCTTCACACCTTT 22 209 28 rs11190870-AS TTTACGGGCGATTGAACTAAGC 22 29 rs1635-S 5'-Biotin-GTTGGAATCTGAACTGCTGCTTT 23 191 30 rs1635-AS CGGAAGACTACGAGAAGGAAGAG 23 31 rs2233434-S 5'-Biotin-GAGGAGAGCCAGTACGACTC 20 208 32 rs2233434-AS TGTAGGTGAGCGAGGAGGAG 20 33 rs2709736-S 5'-Biotin-TCAGTTAGTCATCCATGAATGC 22 271 34 rs2709736-AS GCTTTACATCTACACAGGCTACT 23 35 rs34778348-S 5'-Biotin-ACATCATAACAGTGGTGGTAGACA 24 223 36 rs34778348-AS TCTATTCAGAGGCAGAAAGGAAGA 24 37 rs7776725-S 5'-Biotin-GGCAGAAAGCAGATCAGTGGTT 22 149 38 rs7776725-AS AGTGTGGCATTTAGCACGTTCAT 23

Primer Set  4 order
number Name (S / AS ) Sense  Primer (5'- biotin )
Anti - Sense Primer Length Product
Length 39 rs1000597-S 5'-Biotin-CTCTGCTTATCTGGAATGCTCTC) 23 299 40 rs1000597-AS CTGACCCTGAGGAGTGCTATTAA 23 41 rs10762058-S 5'-Biotin-GCAGCTCAGACTTGTCCATAGA 22 276 42 rs10762058-AS 5'-C12-ACATTATTGGTTCTCCTGGGTTCT 24 43 rs2273017-S 5'-Biotin-TCTGGTGGATAGTAAGAGGTGATC 24 272 44 rs2273017-AS 5'-C12-GCTGTTTGATGAGTGAGATGAACT 24 45 rs4795519-S 5'-Biotin-GAGGAGGGTGCTGTAAAGAGTC 22 244 46 rs4795519-AS 5'-C12-AGAGCGTGGGTTAGATAACAAGG 23 47 rs987525-S 5'-Biotin-AGCCAATTTACCACCCTGTACTAC 24 234 48 rs987525-AS 5'-C12-ACAAACAGAGGTTGGATGACCATT 24 49 rs9923231-S 5'-Biotin-AAGTGGTTCTCGTGCCTCAG 20 244 50 rs9923231-AS 5'-C12-CCTCTGGGAAGTCAAGCAAGA 21

Primer Set  5 order
number Name (S / AS ) Sense  Primer (5'- biotin )
Anti - Sense Primer Length Product
Length 51 rs2254546-S 5'-Biotin-CAGAGGACAGCCACGGAGAA 20 191 52 rs2254546-AS GCAGCAAGCAACAGCAGTAAG 21 53 rs2736100-S 5'-Biotin-AGTTCTATCTCAGGCATCTTGACA 24 293 54 rs2736100-AS TCCTCGTGAGTCTCCACATCT 21 55 rs6565681-S 5'-Biotin-TAAGACTGCTCTGAAGGTAGGATG 24 201 56 rs6565681-AS CCACTGGTTCACGCACACTA 20 57 rs671-S 5'-Biotin-TTGGAGCCCAGTCACCCTTT 20 297 58 rs671-AS CGCCCAGCAGACCCTAAATC 20 59 rs7504990-S 5'-Biotin-TCATGCAATTGGTCTACCTAGTCT 24 272 60 rs7504990-AS CCACTTAGAGAGAAAGCCAGAATG 24 61 rs873549-S 5'-Biotin-GGACAGATGACAGATGGCAAGT 22 240 62 rs873549-AS ATTCAGAGGACATCACAAGGAGAC 24 63 rs9271366-S 5'-Biotin-CCTCGCCCATTTGTCTATAAGC 20 142 64 rs9271366-AS ACATCCAGGATACAGCAGAGTAA 22

Tables 8 to 12 below show probe sets for simultaneous detection of multiple markers.

Probe Set  One order
number name Probe  Sequence (5'- C12 spacer ) Length 65 rs10965235-WA 5'-C12-GCTGTAGAG A TATGTCAG 18 66 rs10965235-MC 5'-C12-GCTGTAGAG C TATGTCAG 18 67 rs13429458-WA 5'-C12-AGATGAAAC A AAACTGAT 18 68 rs13429458-MC 5'-C12-AGATGAAAC C AAACTGAT 18 69 rs236114-WA 5'-C12-CCTCGAATAC A TTGGTAAGA 20 70 rs236114-MG 5'-C12-CCTCGAATAC G TTGGTAAGA 20 71 rs2477686-WC 5'-C12-GGCACAGAAT C TAGGTCAGG 20 72 rs2477686-MG 5'-C12-GGCACAGAAT G TAGGTCAGG 20 73 rs3847153-WT 5'-C12-GACACTCGA T AAACGTCT 18 74 rs3847153-MA 5'-C12-AGACACTCGA C AAACGTCTG 20 75 rs7913069-WT 5'-C12-ATTAGCTTG T CATTTTCA 18 76 rs7913069-MC 5'-C12-ATTAGCTTG C CATTTTCA 18 77 rs9318086-WA 5'-C12-ACTTCTGTCA A CTTAAGT 18 78 rs9318086-MG 5'-C12-ACTTCTGTCA G CTTAAGT 18

Probe Set  2 order
number name Probe  Sequence (5'- C12 spacer ) Length 79 rs1047781-WT 5'-C12-CCGGGA T GTGGCGGTATT 18 80 rs1047781-MA 5'-C12-CCGGGA A GTGGCGGTATT 18 81 rs12988934-WC 5'-C12-TCTCAATGTCT C AGATTTGTGAC 18 82 rs12988934-MT 5'-C12-TCTCAATGTCT T AGATTTGTGAC 18 83 rs17036350-WT 5'-C12-ATCAGATTCCA T CCATCCAATAA 20 84 rs17036350-MC 5'-C12-ATCAGATTCCA C CCATCCAATAA 20 85 rs4328821-WA 5'-C12-TGCACCCA A TTTTAGAGAT 20 86 rs4328821-MG 5'-C12-TGCACCCA G TTTTAGAGAT 20 87 rs4794822-WT 5'-C12-CCTTTGAAGG T AGAGAGAGGTG 18 88 rs4794822-MC 5'-C12-CCTTTGAAGG C AGAGAGAGGTG 20 89 rs7677751-WT 5'-C12-TAAATGACA T ACATTGTTG 18 90 rs7677751-MC 5'-C12-TAAATGACA C ACATTGTTG 18 91 rs855791-WC 5'-C12-TGCAGCGAGG C CTATCGCTA 18 92 rs855791-MT 5'-C12-TGCAGCGAGG T CTATCGCTA 18

Probe Set  3 order
number name Probe  Sequence (5'- C12 spacer ) Length 93 rs10947262-WT 5'-C12-CTATGTGATT T GGTGGCAAA 20 94 rs10947262-MC 5'-C12-CTATGTGATT C GGTGGCAAA 20 95 rs11190870-WT 5'-C12-TTGATTAATA T GCAAATCGC 20 96 rs11190870-MC 5'-C12-TTGATTAATA C GCAAATCGC 20 97 rs1635-WG 5'-C12-CTCAACTGGG G TATGTTCGT 20 98 rs1635-MT 5'-C12-CTCAACTGGG T TATGTTCGT 20 99 rs2233434-WC 5'-C12-CCGGGACCCG C CAAGGAACC 20 100 rs2233434-MT 5'-C12-CCGGGACCCG T CAAGGAACC 20 101 rs2709736-WA 5'-C12-GTAAGTTGAC A GAGTGAAAT 20 102 rs2709736-MG 5'-C12-GTAAGTTGAC G GAGTGAAAT 20 103 rs34778348-WG 5'-C12-AAAACTCTGT G GACTAATAG 20 104 rs34778348-MA 5'-C12-AAAACTCTGT A GACTAATAG 20 105 rs7776725-WT 5'-C12-AATGAACAAC T GCTTAATGA 20 106 rs7776725-MC 5'-C12-AATGAACAAC C GCTTAATGA 20

Probe Set  4 order
number name Probe  Sequence (5'- C12 spacer ) Length 107 rs10947262-WT 5'-C12-TCCTGATTAC G AAACTGTCC 20 108 rs10947262-MC 5'-C12-TCCTGATTAC A AAACTGTCC 20 109 rs11190870-WT 5'-C12-TAAATCTGGT G GTATAATTT 20 110 rs11190870-MC 5'-C12-TAAATCTGGT C GTATAATTT 20 111 rs1635-WG 5'-C12-TTAACAGTTCA C ATCTGAAGTCA 23 112 rs1635-MT 5'-C12-TTAACAGTTCA T ATCTGAAGTCA 23 113 rs2233434-WC 5'-C12-GTGAAAACCA C GGAGGGAGG 20 114 rs2233434-MT 5'-C12-GTGAAAACCA T GGAGGGAGG 20 115 rs2709736-WA 5'-C12-TGGGGATAAT C AACATGGTC 20 116 rs2709736-MG 5'-C12-TGGGGATAAT A AACATGGTC 20 117 rs34778348-WG 5'-C12-ATTTTAGTCT A AAAGTGTGA 20 118 rs34778348-MA 5'-C12-ATTTTAGTCT C AAAGTGTGA 20 119 rs7776725-WT 5'-C12-CCACCGCACC C GGCCAATGG 20 120 rs7776725-MC 5'-C12-CCACCGCACC T GGCCAATGG 20

Probe Set  5 order
number name Probe  Sequence (5'- C12 spacer ) Length 121 rs2254546-WG 5'-C12-CTTCCTCCAAT G GGAAAAAAGG 22 122 rs2254546-MA 5'-C12-CTTCCTCCAAT A GGAAAAAAGG 22 123 rs2736100-WT 5'-C12-GAGTGTTTCT T TAGCTTTGC 20 124 rs2736100-MG 5'-C12-GAGTGTTTCT G TAGCTTTGC 20 125 rs372883-WA 5'-C12-TAAAATAGTGA A CAATGATC 20 126 rs372883-MG 5'-C12-TAAAATAGTGA G CAATGATC 20 127 rs6565681-WG 5'-C12-CCACTGATGC G GCCCATCAC 20 128 rs6565681-MT 5'-C12-CCACTGATGC A GCCCATCAC 20 129 rs671-WG 5'-C12-AGGCATACACT G AAGTGAAAAC 22 130 rs671-MA 5'-C12-AGGCATACACT A AAGTGAAAAC 22 131 rs7504990-WC 5'-C12-ATTGGCAGAT C GAAGGGCGT 20 132 rs7504990-MT 5'-C12-ATTGGCAGAT T GAAGGGCGT 20 133 rs9271366-WA 5'-C12-TGGCTCTTTC A GTACAAACT 20 134 rs9271366-MA 5'-C12-TGGCTCTTTC G GTACAAACT 20

Example  3. Multiple Marker  For simultaneous detection PCR Establishment of optimum condition of

To verify the performance of the designed primers, single PCR and multiplex PCR using Qiagen multiplex PCR kit were performed, and PCR amplification products were confirmed by agarose gel electrophoresis. The PCR devices were performed on S1000 (48 blocks), MJ mini (48 blocks), and GeneAmp PCR System 9700 (96-well aluminum block) from Bio-Rad. Quantitative and qualitative analysis was performed using Agilent's Bioanalyzer 2100 instrument and DNA 1000 kit to confirm the exact amplification size and amplification amount, and the optimal PCR conditions and reagent composition were established (Fig. 2 ).

Table 13 shows the Qiagen PCR master mix composition, and Table 14 shows single and multiplex PCR amplification conditions.

Item Volume / Reaction Final concentration 2X Qiagen Multiplex PCR master mix 25.0 1X Primer mix (2 uM / each) 5.0 0.2 uM RNase Free Water 15.0 Template (10 ng / ul) 5.0 50ng Total 50

Step Temperature Time Cycle Initial activation 95 ℃ 15 min One Denaturation 94 ° C 30 sec 35 cycles Annealing 58 ℃ 90 sec Extension 72 ℃ 30 sec Final Extension 72 ℃ 10 min One

Example  4. Standard techniques ( Direct Sequencing , Sequenom MassARRAY )

In order to confirm whether the products generated by multiplex PCR correctly displayed correct genotypes, direct sequence sequencing method and Sequenom's MassARRAY analysis method were secured and used as data for accuracy comparison (Fig. 3).

Example  5. Probe and Bead  Combination

The amplified products were amplified by PCR using multiple markers and hybridized with a probe attached to a magnetic xMAP microsphere (bead). The relative amplification was determined by the intensity of fluorescence through a Luminex analyzer.

The probe-coupled xMAP microsphere is a magnetic material, and each bead is stained differently with 100 unique fluorescences, and a specific probe is attached to each bead, and the result of the reaction with the sample is measured at the same time. The bead with the carboxyl group was used for the reaction by forming a covalent bond with the amino group of the specific probe using 1-Ethyl-3- [3-dimethylaminopropyl] carbodiimide hydrochloride (EDC or EDAC). The coupling of the probe and the beads was carried out by mixing 0.2 nmole (200 pmol) and 50 μl of 1 × 10 ⁶ beads diluted in 0.1 M 2- [N-morpholino] ethanesulfonic acid (MES, pH 4.5) ml) was added and reacted at a dark room temperature for 30 minutes. 2.5 μl of EDC (10 mg / ml) was added again and reacted again in the dark at room temperature for 30 minutes. After completion of the reaction, the cells were washed with 500 μl of 0.02% Tween-20 and 0.1% Sodium Dodecyl Sulfate (SDS), and the supernatant was carefully drained and diluted in 25 μl of TE buffer (pH 8.0)

The probe-bound beads were diluted 100 times with TE buffer (pH 8.0) and counted with a microscope using a hemocytometer. Based on the counted number, it was diluted to a final concentration of 2,000 beads / ul and used in the experiment.

Example  6. Multiple PCR  Amplification products Of the probe Hybridization

The multiplex PCR products amplified with 5'-biotin labeled primers were hybridized with the probe sets-coupled bead sets after denaturation. A set of probe-bead synthesis mixtures was made using 1.5 x TMAC (Tetramethyl Ammonium Chloride) buffer to a final 2,000 beads / ul. 33ul of this mixture was divided into a 96-well plate and divided into blank one and negative one. Blank wells were filled with 17 μl of TE buffer (pH 8.0), and the remaining wells were filled with 12 to 15 μl of TE buffer (pH 8.0) except for the amount (2 to 5 μl) containing the multiple PCR products. Pipette or PCR plate vortexer . Denatured at 95 ° C for 5 minutes using a PCR instrument, followed by hybridization at 51 ° C for 20 minutes. After hybridization, the 96-well PCR plate was left in a magnetic separator block for 30 seconds to 1 minute, and then the reaction solution in the well was removed. Fresh streptavidin-R-phycoerythrin was diluted with 1 x TMAC hybridization solution to 2 to 4 ug / ml. The reaction was carried out at 51 ° C for 5 minutes in a PCR instrument, and the degree of reaction was monitored using a Luminex analyzer. The instructions for using the Luminex analyzer were in accordance with the manufacturer's instructions.

Example  7. Data Analysis

The Luminex analyzer analyzed samples hybridized with bead types using two types of laser with different wavelengths. First, the kind of beads was identified with a red wavelength of 635 nm, and nucleic acid reacted with a probe attached to the bead with a green wavelength of 532 nm was measured.

Experiment result

1. Single PCR  Product direct hybridization  result

We tested the performance of primers and probes using multiple positive controls that already knew the genotype. As a result of the single PCR, it was confirmed that the PCR product of the correct size was amplified for each genotype (FIG. 4)

Net MFI (Median Fluorescent Intensity) showed a minimum average of 105.5 and a maximum MFI of 1643.8 for each marker. Similar results were obtained in two repeated experiments, but the marker with a difficult allelic discrimination due to the difference in relative values (Fig. 5).

Therefore, homozygote / heterozygote discrimination was facilitated by the allelic ratio value when the MFI value of the marker was low or relatively different from that of other markers. The basic background values were generated according to the markers, and sufficient clinical samples were tested to establish marker-specific criteria to prevent genotype discrimination problems (FIG. 6).

2. Multiple Marker  For detection Kit  Clinical test results

Using 5 primers and 40 primers for product development, the primer sets and probe sets of the present invention were used for the control 5 samples that already know the genotype by standard sequence analysis and MassARRAY, and the individual genome SNPs Respectively. PCR was performed for simultaneous detection of multiple markers using 32 individual genomic analysis contents, and then analyzed with a Luminex analyzer. Allelic ratios were determined for homozygotes and heterozygotes for genotyping. FIGS. 7 to 16 are graphs showing allelic ratios according to respective content sets, and Tables 15 to 19 are raw data for MFIs per set.

Set  One Sample 2_ WA 2_ MC 3_ WA 3_ MG 4_ WT 4_ MC 5_ WA 5_ MG 6_ WT 6_ MC 7_ WA 7_ MC Con1 41 187 14 317 21 505 23 360 320 144.5 506 481 Con2 24.5 123 13 541 39.5 462 32 401 1660 185 285 13 Con3 231.5 97 142 179 268 250 15 265 351 22.5 1273.5 46 Con4 33 147 107 155.5 47.5 652 23.5 370.5 148 62 1498 1138.5 Con5 369 17 10 387 350 455 25 443 468.5 32 2241 123.5 A003 55 331 167 262.5 393 387 11.5 384 353.5 21.5 493.5 0 A008 53 264 188 20.5 58 736.5 22 328 403.5 32.5 689 14 A009 58 321 141 142.5 54 648 7 284 21 121 464.5 26 A010 45 319 140 164.5 52.5 822.5 27 489 280.5 146 390 429 A011 604.5 280.5 492.5 12 60 910 25.5 457.5 237 129 559 6.5 A012 67 483.5 338 489 64 872 28 406.5 292 137 266.5 294 A013 339.5 138 16 476 54 619.5 10 345 31 175 206 248 A014 37.5 208 162 159 30 532 14.5 247.5 206.5 107 222 248.5 A015 50 434 136.5 160 54 958 15 437 269 110.5 833 18 A016 57 390.5 238 304 37.5 628.5 12 265 29 410 309 16 A017 412 210.5 18 337 39.5 851.5 14 389 185 101.5 651 10.5 A022 61 477.5 388 505 457 535.5 8 463 2016.5 1180 95.5 135 A028 30 250.5 689 23 20 394 25 341 586 234 74 128.5 A032 360 97.5 174 222.5 238.5 303 18.5 436.5 452 25 370 24.5 A033 65.5 403.5 12 476 67 1034 27 547 535 29 486 478 A035 342 140 131 7.5 366 425 17.5 335.5 12 182 677 23 A037 53 301 73 67 426 429 12.5 334.5 192.5 100 960.5 13 A039 47.5 271 177 190.5 45 532 16 170.5 334 13.5 173 19 A040 317 121 919 25 24 633.5 5 304 1528.5 946 188 16.5 A041 13 76.5 100 105.5 85 1094.5 22 246 2121 1578 169 14 A045 79 146 69 93 116 186 14 125.5 473 154.5 257 39.5 A048 54 189 160 168 27 468 19 302 437 28 382 19 A050 72 480 373.5 364 24 499 17 488 1884.5 143 137 174.5 A057 289 120.5 4 353 17 303 31 337 1645.5 1318 97 115 A061 791 24.5 9.5 433 39 849 25 474 26 312 366 348.5 A074 52 405.5 20 508.5 262 364 5.5 412 390.5 23 481 2 A076 40.5 145 51 61 24 459.5 14.5 166 196 21 294 257 A078 43 252.5 435 538 35 742 24.5 316.5 605 315 131.5 128 A080 28 241.5 135 156 21.5 616 21 194 121 78 144 164.5 A081 61.5 364.5 18 574 13.5 459 14.5 443 1346 1038 319 23.5 A082 26 217.5 688.5 23 33 673 24 476.5 1528 829 228 14 A085 51 470 221 214 35 758 2 579 495 273 525 23.5 A087 52.5 412 239.5 298 27 657 17 456 191 138 477 9 A089 66 408 213 204.5 32 657 26 518 427 19.5 567 18.5 A094 43 358 13 490.5 31 629 23 395 20 204 513 19 A095 346 159 264 311 28 611 17 291 697 430 312.5 9 A097 77 416 18 502 55 852 10 691 60 272 421 376 A100 86 587 621.5 15 56 926 22 443 526 31 463 15 B004 651 233.5 178 246 53 982.5 14 473.5 240 111 685 12 B011 76.5 308 259 356 49 597.5 22 716 530 264.5 429.5 21.5

Set  2 Sample 2_ WC 2_ MT 3_ WT 3_ MC 4_ WT 4_ MC 5_ WA 5_ MG 6_ WC 6_ MT 7_ WA 7_ MT Con1 170 172 73.5 199 368 721 1533 97.5 26 356 496 566.5 Con2 169 165.5 105 207 111 1066.5 1052 921 137 186 482.5 552.5 Con3 188.5 190 170 209 111.5 1148 1517 102 166 184 539 606 Con4 199 185 211.5 252 651 81 1007 1018.5 213 191 570.5 644.5 Con5 269 104 151 287 85 1241 41 1400 381 34 565 666.5 A003 90 32.5 108 213 89 1093 112.5 1332 352.5 41 440 545 A008 86 113.5 89.5 183.5 88 1126 1524 91 15 434 409.5 464.5 A009 84 92 76 162 85.5 1145 1023.5 905 19 215 384 448 A010 127 43.5 81 146 91 1142 1506 84 197 156 184 499 A011 94 116 85 148 83 1073 1082.5 1040 102 159 353 396 A012 81 114 132.5 161 109 1308 1160 43.5 12 204 211 570 A013 115 57.5 124.5 208 139 1351 795 526 251 49.5 459 561 A014 86 142 98 197 96.5 1360 883 755 187.5 155 408.5 463 A015 119 45 96.5 159.5 78 1080 1092 1023 182 145 555 315.5 A016 92.5 113 139 151 418 810 945 867 12 205 413 458 A017 130 51 87 178 95 1184 1457 73.5 175.5 128 389 428.5 A022 92 116 100.5 177 109.5 1354 792 705 113 94 188 551 A028 102 111 93 150 85 1213 1501 77.5 175.5 127.5 392 430 A032 41 176 70.5 149 117 1174 327 296 91.5 80 562 263 A033 104 115 75 160 85 1232.5 1054 988 378 36 181.5 496 A035 73.5 88 76 140.5 65 1032 1155 1062.5 217 156.5 349 379 A037 85 101 76 170 72 1008 1611 100 15 270 524 284.5 A039 132.5 133 83.5 143 73 1050 1673 97.5 112 354 306.5 353 A040 97 163 79 143 65.5 1039.5 1575.5 90 188.5 134 343 371.5 A041 35.5 246.5 73 156 333.5 713.5 1038.5 951.5 14 198 173.5 509.5 A045 51 63 48.5 104.5 145 671.5 627.5 12 21.5 116.5 209 243 A048 113 40.5 63 147.5 102 1022.5 153.5 193 14 120 175.5 535 A050 81 92.5 62 140 329 716.5 70 1461 182 140 137 391.5 A057 102 37 82 145 74 1101 1423 75 255 28 475 234.5 A061 87 37.5 67.5 119 64 1114 1491 58.5 75 105 482 260.5 A074 80 117 106.5 170.5 140 1360 1019 51 15 181 494 243.5 A076 37 222 92 163.5 77 1168 947.5 864 158 123.5 168 523.5 A078 31 240.5 84 141 70 1087.5 59.5 1393 168.5 124 336 355 A080 77 87 76 131.5 64 1058 1518 80 172.5 137 283 318 A081 79 105.5 73 153.5 150 1120 669 521.5 16 105.5 155 488 A082 34.5 236 89 112 70 1123 1010 974 161 115 311 346.5 A085 80.5 97 72 131 60.5 1049 1054.5 976 19 253 128.5 366 A087 122 46 106.5 183 108 1361 733 611.5 246.5 44.5 355.5 409 A089 111 44 93 163 119 1338.5 755 612.5 306 67 370 449 A094 106 39 115 155.5 392.5 806 1329 53 255.5 35 172 525 A095 106 44 70 149.5 533 57 56.5 1365 17 205 330 369.5 A097 98 110.5 109 124.5 82 1196 1315 54.5 121.5 95 559 272 A100 98 37.5 73 146 68 1162 37.5 1167 173 285 153 440 B004 103 36 94.5 119 87 1219 903 826 31 241 510 239 B011 75 40 104.5 186 163 1069 474 286 133 81.5 341 401

Set  3 Sample One_ WG One_ MT 2_ WA 2_ MG 3_ WG 3_ MA 4_ WC 4_ MT 5_ WT 5_ MC 6_ WT 6_ MC 7_ WT 7_ MC Con1 50 20.5 132 161 31 20 57 199 159 97 7 53.5 57 40.5 Con2 279 278.5 413.5 646.5 129 26 51 766 1494 433 27 158.5 175 400.5 Con3 358 359 160.5 1122 124 23 48 812 1521 445 16 314 150 345 Con4 210 199 534.5 798.5 161.5 19 170 1108.5 736 724.5 30 17 230.5 37 Con5 441 28 159.5 1252 160 20 1126.5 556.5 1325 365 20 317 213 33 A003 511 25 416 661 185 31.5 81 1116 1792 570 21.5 119 254.5 45.5 A008 143 693 467.5 749 214 31 1965 163 1854.5 617.5 16 270.5 160.5 356 A009 474 504 512 802 208.5 29.5 82 1159 1939 670 18 292.5 195.5 420 A010 142 708.5 407 659 180 22 1160 712 1889.5 634 26 129 255 46 A011 546 38 427 826.5 210 17 75 1023 1827.5 581 26 264 67 631.5 A012 383 467 397 706 191 15.5 81.5 992.5 1778.5 557 25 113 152 372 A013 683 24.5 398.5 576 163 24.5 1350 706 1525 428 16 218.5 142 354.5 A014 495 522 417 802 208 21.5 88 1169 1803 580 39 15 168 372 A015 532 31 96 1009 210 8 78.5 1108 1702 477 20 245 48.5 651 A016 671 36 194.5 1261 204 22 1465 833 1929 612 18 328 266 31 A017 667.5 27.5 487 801 115 20 1361.5 777 1907 592 17 276 211 13 A022 614 716.5 120 1028 194 16 1138 687 2139 698 33.5 132.5 50 583.5 A028 752 47 593.5 838 206.5 30 1355 752 2141 661 21.5 307.5 185.5 406 A032 730 35.5 102 832.5 167 23 64 1036 1996 656 29 109 207.5 30.5 A033 553 27 375.5 852.5 187 25 72 1060 1880 576 24.5 143 58 657 A035 383 415 138 1265 215 9.5 1238.5 731 2045 606 21 362 76 760 A037 404 413 179 1243 223 20.5 2046 177 2000 615.5 29 218 301.5 49 A039 121 632.5 146 1235 196 31.5 1844 156 1986 599 33.5 188 258.5 33 A040 133 748.5 783 171.5 208 25 66 1019 1981 621 40.5 20 265 39 A041 754.5 37 394 799 170 18 68.5 985 1552 1400 29 140 228 43 A045 140 380.5 82 223.5 86.5 12.5 567 356 1300.5 259 15 83 186.5 18 A048 632 16 86 919 155 13 934 560 1426 1432.5 25 125 166.5 357.5 A050 399 458 495 593 185 27 967 563 1799 1532 27.5 385.5 230.5 513 A057 740.5 50 612 693 201 30 1134 616 2080 723 32 304 332.5 46 A061 631.5 41.5 117 1072 213 22 64 1016.5 2142 586.5 23.5 141 309 47 A074 117 864 115 1231 149.5 19.5 58.5 1019 2230.5 601.5 23 97 120.5 311.5 A076 103 731.5 311.5 663 183 24.5 72 1059.5 1858 539.5 27 112.5 249.5 35 A078 93 656 93 960 182 25 55 979 1860 530 27 134 181 446.5 A080 394 436 146 1154.5 173 33 1675.5 119.5 2009.5 743 26.5 295 297.5 46 A081 285 683 387 678 190.5 27 1118 677 2156 654 27 160 222 275 A082 410.5 482 102 960 171 21 1235 622.5 1912 597 30 263.5 181 412 A085 360 399.5 392 701 190 19.5 1683 105 1950 637 19 143 59.5 678.5 A087 415.5 451 379 709.5 181 29 1181 617 1741 517 30.5 255 230.5 34 A089 82 652 396 722 196.5 27 73 1074 1714.5 461 44 129.5 150 352 A094 430 445 466.5 737 216 21 76.5 1195 1961 612 45 29 60.5 747 A095 604.5 47.5 445.5 744 200 32.5 63.5 1021.5 1449.5 1355.5 41.5 24 321 29.5 A097 355 389.5 713 149 154 25 59.5 1001.5 1463 1355 45 25 173 401 A100 393.5 415 104 979.5 176 25 69.5 939.5 1975 543.5 18 263 281 34 B004 616 47 433.5 754 202 21 1201.5 656 2097 617 24.5 313.5 72.5 770.5 B011 475 469.5 98 951 154 21 920 590.5 1842 547 38 162 192 23

Set  4 Sample 2_ WC 2_ MT 3_ WG 3_ MC 4_ WA 4_ MC 5_ WC 5_ MA 6_ WC 6_ MT 7_ WG 7_ MA Con1 70 843 33 723 29.5 493 30.5 356 787 1113.5 744 786 Con2 35 631.5 202 290.5 16 301 21 351 652 813.5 247 835.5 Con3 891 115 363.5 24 24.5 365 7 430.5 783.5 976.5 521.5 579.5 Con4 648 625 527 18 20 479 10 445.5 820 1028 431 1169 Con5 635 653 557 19 23.5 435.5 22.5 446 915 853.5 392 1155.5 A003 724 685 225.5 374 28 518 26 456.5 1318 1534 410.5 1144.5 A008 585 566 155 288 218 312 215.5 254.5 1521 1391 496 1207.5 A009 677 651 352 21 27 530 230 218.5 1367 1701 733 814.5 A010 627 633 269 22 22 527 25 410 1368 1706.5 468 1151.5 A011 491.5 461.5 275 17 25.5 544.5 393 35 1316 1585.5 454 1150 A012 120 1202 355 118 31.5 464 153 229 1380 1654 594 601 A013 816 974.5 318.5 402.5 28.5 409 209 211 1168 1321 312.5 833 A014 71 1110.5 352 27 17 477 240 264 1277 1140 604 737.5 A015 548.5 542 292 21 14.5 526 210 250 1505 1318 453 1166 A016 646.5 608 299 13 20 487.5 329 27 1296 1581 401 1039 A017 118 1306 345.5 501 22 583 316 34 1419 1685 524 1413 A022 824 1026.5 260 412 18 565.5 148 194.5 1390 1860.5 359 976.5 A028 708 636.5 250 334 28 577 28 408 1380.5 1808.5 427 1183 A032 705 570 178 284 186 223 174 245 1257 1458 99 484.5 A033 518.5 502 258 14 19 495 203 245 1277.5 1556 449 1264 A035 439 390 147 207 7.5 480 461 27 1285 1509 451.5 1166 A037 424 409 159.5 245 31 501 274 267.5 1186 1454 846.5 876.5 A039 807 86 225.5 28 22 458.5 276 238 1151 1487 439 1168 A040 573.5 568.5 28.5 507.5 24 579 21 436 1340.5 1685.5 533 1249 A041 703 729.5 155 280 19.5 626 268 28 1585 1491 483.5 1274.5 A045 186 587 21 313.5 20 226 54.5 119 435 498 116.5 21.5 A048 616.5 669.5 298 90 38 417 307 35 1112 1354 190 502.5 A050 775 75 236 23 31 486.5 20 373 1419 1346 797.5 789 A057 762.5 724 384.5 80 29 623 300.5 29 1332 1752 419 1206.5 A061 924.5 88.5 234 28 17 493.5 181.5 204 1273 1587 342 1072 A074 1080.5 391 214 404 27 570.5 329 31 1272.5 1668.5 308 863.5 A076 47 834 293.5 30 23 585 23 465 1253.5 1590 387 1182 A078 24 660.5 136 227.5 23 483 217 225 1257 1598 448 1152 A080 756 84.5 246 26 42.5 502 201.5 208 1274 1602 468 1181 A081 626 1029 148 170 24 547 15 231 1323 1679 325 707 A082 464 481 221 26 34 462 172 210 1174.5 1602 381 1134 A085 33.5 694.5 234 33 32.5 449 196 201 1237.5 1627 689 824 A087 644.5 687 220 320.5 36 499 223 200 1094 1456 316.5 917 A089 64.5 1086 252.5 369.5 19 458.5 362 30 1091 1454 340 991 A094 759 678 336 55 24 541.5 206 232 1151 1498 357.5 1070 A095 31 739.5 149 266 24 473 227 252 1152 1503.5 414 1171.5 A097 104 1253 308 447.5 214 373.5 165 171 1386 1830 366.5 1145.5 A100 519 544 150.5 244 27 484 186 207 1275.5 1643 421 1197.5 B004 67 1059 193.5 358 26 523.5 178 206 1317.5 1728 473.5 1273 B011 508 689 267 122 27 333 168.5 174 976 1321 123.5 542.5

Set  5 Sample One_ WG One_ MA 2_ WA 2_ MG 3_ WT 3_ MG 4_ WG 4_ MA 5_ WG 5_ MA 7_ WA 7_ MG 8_ WC 8_ MT Con1 468 90 544.5 20 110.5 144 107 89.5 23 735.5 237 19 1012 242.5 Con2 294 243 344 42 32 252 157.5 50 18 738 18 335 928 203 Con3 426 86 340 42 211 54 176 54.5 59 482.5 33 374.5 1093.5 298.5 Con4 527.5 108 397 44 93 128 200 72.5 25 801 242 304 1256 363.5 Con5 523 102 634 19.5 87.5 119 168 55 59 502 260.5 317 925 1177.5 A003 166 117.5 51 27 336 72 79 162.5 29 293.5 73.5 138 986 261 A008 206.5 29 202.5 16.5 171 233 231 67 58 5 19.5 154 1016 229 A009 244.5 34 207 27 172 214 146.5 127 29 422 93 110.5 682.5 914.5 A010 167 26 108.5 15 270 57 202 60 48.5 23.5 76.5 92 669 125 A011 212 27 374 14 384 80 170 147 45 502 77 89 965 212 A012 373.5 264.5 357 8 308.5 344 229 67 46 30.5 88.5 161 1069 238 A013 480 92 49.5 28.5 103.5 120 95 72.5 16 289 109 8.5 1039.5 249.5 A014 259 191 221 30.5 32 348.5 190.5 56 56 21.5 81.5 113 1088 256 A015 226 28 214.5 23 213 265 177 136 37 461.5 77.5 100 1084.5 259 A016 162.5 124 349 14 257 38 234 62 43 434.5 22 155 1034 229 A017 648 90 14 17 72 103.5 398 340 22 188 23 12 21 22 A022 275 221.5 128 14 199.5 19.5 196 85 22.5 345 14.5 229 1288 314 A028 162.5 122 205 32 386 61 260 67 63.5 25 79 115.5 792 1033 A032 1320 323 74 12 59.5 79 211.5 61 7.5 189 56.5 113 76 16 A033 98 102 185.5 17 424 79 262 76.5 31.5 504 78 105.5 1046 207.5 A035 85.5 75 27 31.5 645 157 234.5 194 83 14 77 92 942 194 A037 100 20.5 112 23 662 192 320 108 49 597.5 51 72 783 1085 A039 114 5 249.5 15 310.5 441 300 93.5 41 501 119.5 13.5 684 941 A040 54 55 35 16 243 48 292 79 43 528.5 25 246.5 200 346 A041 98 70.5 175 16 134.5 189.5 90 223 55 542 67 21.5 912 1271 A045 559.5 252 238 30.5 211 47 128 45 7 189 113 19.5 570 106 A048 654 83 40 43 273.5 109 195 55.5 36 53.5 48 90 1407 419 A050 56.5 61.5 57 25 229 45.5 339.5 258 53 409 45 21 940.5 1238 A057 133 10 70.5 19 17.5 18.5 214 176 27.5 962 63 14 219 41 A061 136 14 23 15 100.5 151 235 61 58 525 411 25 830 205 A074 291 200 18 28 92 132 140 90 33.5 379 59.5 96 1106 1431 A076 221 29 159 34 294 67 234.5 69 65.5 575 50 63 1334.5 599 A078 88 15 88 24.5 494 120 257 62 69 690.5 48.5 67 1242 469 A080 73 61 107.5 32 384 397 332.5 100 104.5 30 50.5 61 1341 515 A081 376 310.5 132 27 184 38 174 45 66 16 52 80 1485 573 A082 128.5 15 68.5 22 160 19 252 58 63 504.5 43 60 807 205 A085 211.5 18 134.5 31 377 482 319 98 99 743 64.5 79 1527 656.5 A087 274 43 233.5 20 190.5 283 69 170 53 472.5 57 92.5 223 1698.5 A089 282.5 44 151 34 168 214 168 124 70 533 65 101 276.5 1860.5 A094 233.5 32 276.5 18 203.5 257 234 56.5 56.5 551 87.5 112 1219 392 A095 *** *** *** *** *** *** *** *** *** *** *** *** *** *** A097 153 22 31 39 284 354.5 251.5 69 106.5 37 56.5 109 264.5 1711 A100 86 84 90 29 444 84.5 209 167 81 832 58.5 71 899 1155.5 B004 86 94.5 128 40 178 219 301 81 156.5 42 65.5 80 850.5 1205 B011 623.5 78 139 44 44 334.5 175.5 64.5 21 552.5 26.5 136 268 1662

&Lt; 110 > D & P Biotech Ltd. <120> Multiplex assay kit for analyzing personal genome SNP and method          using the same <160> 134 <170> Kopatentin 1.71 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs10965235-S primer <400> 1 gttgcccctt ctgtcttttc ct 22 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs10965235-AS primer <400> 2 tcagcctaac tttaagccac caa 23 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs13429458-S primer <400> 3 agcggtatga tttcgtagtg gtta 24 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs13429458-AS primer <400> 4 ttagtggcag ggtataggtg tatg 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs236114-S primer <400> 5 gcaggtaagt ggcagaactg a 21 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs236114-AS primer <400> 6 ggtaagattc ctctacagca aagc 24 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs3847153-S primer <400> 7 ccaagaagag gaccacacct t 21 <210> 8 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs3847153-AS primer <400> 8 aatctgccta gaagacactc acat 24 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs7913069-S primer <400> 9 gaccagaacc tctcctgatt acta 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs7913069-AS primer <400> 10 tctcccctaa ccgatgtcta aatt 24 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs9318086-S primer <400> 11 ctgtagggag agaagggcat ac 22 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs9318086-AS primer <400> 12 gtcaacacat tattggtcca tctg 24 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs1047781-S primer <400> 13 gatgtggacg atcaatgcaa tagg 24 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs1047781-AS primer <400> 14 cggaggtggt ggtagaaggt 20 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs12988934-S primer <400> 15 cccatatccc gtcgtttaac ctaa 24 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs12988934-AS primer <400> 16 attccttcct ctttccccac ttg 23 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs17036350-S primer <400> 17 gagaccagcc accagtataa gc 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs17036350-AS primer <400> 18 cgaactcctg acctcaagtg at 22 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs4328821-S primer <400> 19 accgagttgg gactgaggag 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4328821-AS primer <400> 20 cagcagggtg atgttgtctt ct 22 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs7677751-S primer <400> 21 tcactttctc tattgctcct cctt 24 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs7677751-AS primer <400> 22 agttgcttgg gttggggtaa a 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs855791-S primer <400> 23 gcagagcagg agagaagtag g 21 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs855791-AS primer <400> 24 ttcttgccct tgcggtagc 19 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-S primer <400> 25 aggcaactag aagagggaga gat 23 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-AS primer <400> 26 aacaacccag gtatgctggt atta 24 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-S primer <400> 27 gcaaacactc cttcacacct tt 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-AS primer <400> 28 tttacgggcg attgaactaa gc 22 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1635-S primer <400> 29 gttggaatct gaactgctgc ttt 23 <210> 30 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1635-AS primer <400> 30 cggaagacta cgagaaggaa gag 23 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-S primer <400> 31 gaggagagcc agtacgactc 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-AS primer <400> 32 tgtaggtgag cgaggaggag 20 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-S primer <400> 33 tcagttagtc atccatgaat gc 22 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-AS primer <400> 34 gctttacatc tacacaggct act 23 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-S primer <400> 35 acatcataac agtggtggta gaca 24 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-AS primer <400> 36 tctattcaga ggcagaaagg aaga 24 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-S primer <400> 37 ggcagaaagc agatcagtgg tt 22 <210> 38 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-AS primer <400> 38 agtgtggcat ttagcacgtt cat 23 <210> 39 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1000597-S primer <400> 39 ctctgcttat ctggaatgct ctc 23 <210> 40 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1000597-AS primer <400> 40 ctgaccctga ggagtgctat taa 23 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs10762058-S primer <400> 41 gcagctcaga cttgtccata ga 22 <210> 42 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs10762058-AS primer <400> 42 acattattgg ttctcctggg ttct 24 <210> 43 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs2273017-S primer <400> 43 tctggtggat agtaagaggt gatc 24 <210> 44 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs2273017-AS primer <400> 44 gctgtttgat gagtgagatg aact 24 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4795519-S primer <400> 45 gaggagggtg ctgtaaagag tc 22 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs4795519-AS primer <400> 46 agagcgtggg ttagataaca agg 23 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs987525-S primer <400> 47 agccaattta ccaccctgta ctac 24 <210> 48 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs987525-AS primer <400> 48 acaaacagag gttggatgac catt 24 <210> 49 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs9923231-S primer <400> 49 aagtggttct cgtgcctcag 20 <210> 50 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs9923231-AS primer <400> 50 cctctgggaa gtcaagcaag a 21 <210> 51 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2254546-S primer <400> 51 cagaggacag ccacggagaa 20 <210> 52 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs2254546-AS primer <400> 52 gcagcaagca acagcagtaa g 21 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs2736100-S primer <400> 53 agttctatct caggcatctt gaca 24 <210> 54 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> rs2736100-AS primer <400> 54 tcctcgtgag tctccacatc t 21 <210> 55 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs6565681-S primer <400> 55 taagactgct ctgaaggtag gatg 24 <210> 56 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs6565681-AS primer <400> 56 ccactggttc acgcacacta 20 <210> 57 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs671-S primer <400> 57 ttggagccca gtcacccttt 20 <210> 58 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs671-AS primer <400> 58 cgcccagcag accctaaatc 20 <210> 59 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs7504990-S primer <400> 59 tcatgcaatt ggtctaccta gtct 24 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs7504990-AS primer <400> 60 ccacttagag agaaagccag aatg 24 <210> 61 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs873549-S primer <400> 61 ggacagatga cagatggcaa gt 22 <210> 62 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> rs873549-AS primer <400> 62 attcagagga catcacaagg agac 24 <210> 63 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs9271366-S primer <400> 63 cctcgcccat ttgtctataa gc 22 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs9271366-AS primer <400> 64 acatccagga tacagcagag taa 23 <210> 65 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs10965235-WA probe <400> 65 gctgtagaga tatgtcag 18 <210> 66 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs10965235-MC probe <400> 66 gctgtagagc tatgtcag 18 <210> 67 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs13429458-WA probe <400> 67 agatgaaaca aaactgat 18 <210> 68 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs13429458-MC probe <400> 68 agatgaaacc aaactgat 18 <210> 69 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs236114-WA probe <400> 69 cctcgaatac attggtaaga 20 <210> 70 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs236114-MG probe <400> 70 cctcgaatac gttggtaaga 20 <210> 71 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2477686-WC probe <400> 71 ggcacagaat ctaggtcagg 20 <210> 72 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2477686-MG probe <400> 72 ggcacagaat gtaggtcagg 20 <210> 73 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs3847153-WT probe <400> 73 gacactcgat aaacgtct 18 <210> 74 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs3847153-MA probe <400> 74 agacactcga caaacgtctg 20 <210> 75 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7913069-WT probe <400> 75 attagcttgt cattttca 18 <210> 76 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs7913069-MC probe <400> 76 attagcttgc cattttca 18 <210> 77 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs9318086-WA probe <400> 77 acttctgtca acttaagt 18 <210> 78 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs9318086-MG probe <400> 78 acttctgtca gcttaagt 18 <210> 79 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1047781-WT probe <400> 79 ccgggatgtg gcggtatt 18 <210> 80 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> rs1047781-MA probe <400> 80 ccgggaagtg gcggtatt 18 <210> 81 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs12988934-WC probe <400> 81 tctcaatgtc tcagatttgt gac 23 <210> 82 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs12988934-MT probe <400> 82 tctcaatgtc ttagatttgt gac 23 <210> 83 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs17036350-WT probe <400> 83 atcagattcc atccatccaa taa 23 <210> 84 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs17036350-MC probe <400> 84 atcagattcc acccatccaa taa 23 <210> 85 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs4328821-WA probe <400> 85 tgcacccaat tttagagat 19 <210> 86 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs4328821-MG probe <400> 86 tgcacccagt tttagagat 19 <210> 87 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4794822-WT probe <400> 87 cctttgaagg tagagagagg tg 22 <210> 88 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs4794822-MC probe <400> 88 cctttgaagg cagagagagg tg 22 <210> 89 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs7677751-WT probe <400> 89 taaatgacat acattgttg 19 <210> 90 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> rs7677751-MC probe <400> 90 taaatgacac acattgttg 19 <210> 91 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs855791-WC probe <400> 91 tgcagcgagg cctatcgcta 20 <210> 92 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs855791-MT probe <400> 92 tgcagcgagg tctatcgcta 20 <210> 93 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-WT probe <400> 93 ctatgtgatt tggtggcaaa 20 <210> 94 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-MC probe <400> 94 ctatgtgatt cggtggcaaa 20 <210> 95 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-WT probe <400> 95 ttgattaata tgcaaatcgc 20 <210> 96 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-MC probe <400> 96 ttgattaata cgcaaatcgc 20 <210> 97 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs1635-WG probe <400> 97 ctcaactggg gtatgttcgt 20 <210> 98 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs1635-MT probe <400> 98 ctcaactggg ttatgttcgt 20 <210> 99 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-WC probe <400> 99 ccgggacccg ccaaggaacc 20 <210> 100 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-MT probe <400> 100 ccgggacccg tcaaggaacc 20 <210> 101 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-WA probe <400> 101 gtaagttgac agagtgaaat 20 <210> 102 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-MG probe <400> 102 gtaagttgac ggagtgaaat 20 <210> 103 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-WG probe <400> 103 aaaactctgt ggactaatag 20 <210> 104 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-MA probe <400> 104 aaaactctgt agactaatag 20 <210> 105 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-WT probe <400> 105 aatgaacaac tgcttaatga 20 <210> 106 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-MC probe <400> 106 aatgaacaac cgcttaatga 20 <210> 107 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-WT probe <400> 107 tcctgattac gaaactgtcc 20 <210> 108 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs10947262-MC probe <400> 108 tcctgattac aaaactgtcc 20 <210> 109 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-WT probe <400> 109 taaatctggt ggtataattt 20 <210> 110 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs11190870-MC probe <400> 110 taaatctggt cgtataattt 20 <210> 111 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1635-WG probe <400> 111 ttaacagttc acatctgaag tca 23 <210> 112 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> rs1635-MT probe <400> 112 ttaacagttc atatctgaag tca 23 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-WC probe <400> 113 gtgaaaacca cggagggagg 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2233434-MT probe <400> 114 gtgaaaacca tggagggagg 20 <210> 115 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-WA probe <400> 115 tggggataat caacatggtc 20 <210> 116 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2709736-MG probe <400> 116 tggggataat aaacatggtc 20 <210> 117 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-WG probe <400> 117 attttagtct aaaagtgtga 20 <210> 118 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs34778348-MA probe <400> 118 attttagtct caaagtgtga 20 <210> 119 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-WT probe <400> 119 ccaccgcacc cggccaatgg 20 <210> 120 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7776725-MC probe <400> 120 ccaccgcacc tggccaatgg 20 <210> 121 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs2254546-WG probe <400> 121 cttcctccaa tgggaaaaaa gg 22 <210> 122 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs2254546-MA probe <400> 122 cttcctccaa taggaaaaaa gg 22 <210> 123 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2736100-WT probe <400> 123 gagtgtttct ttagctttgc 20 <210> 124 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs2736100-MG probe <400> 124 gagtgtttct gtagctttgc 20 <210> 125 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs372883-WA probe <400> 125 taaaatagtg aacaatgatc 20 <210> 126 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs372883-MG probe <400> 126 taaaatagtg agcaatgatc 20 <210> 127 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs6565681-WG probe <400> 127 ccactgatgc ggcccatcac 20 <210> 128 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs6565681-MT probe <400> 128 ccactgatgc agcccatcac 20 <210> 129 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs671-WG probe <400> 129 aggcatacac tgaagtgaaa ac 22 <210> 130 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> rs671-MA probe <400> 130 aggcatacac taaagtgaaa ac 22 <210> 131 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7504990-WC probe <400> 131 attggcagat cgaagggcgt 20 <210> 132 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs7504990-MT probe <400> 132 attggcagat tgaagggcgt 20 <210> 133 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs9271366-WA probe <400> 133 tggctctttc agtacaaact 20 <210> 134 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> rs9271366-MA probe <400> 134 tggctctttc ggtacaaact 20

Claims (11)

A primer pair consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, A primer set comprising a primer pair consisting of a nucleotide sequence of SEQ ID NO: 8, a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, and a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12;
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18, A pair of primers consisting of the base sequence of SEQ ID NO: 20, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 21 and SEQ ID NO: 22, and a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO:
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 25 and SEQ ID NO: 26, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 27 and SEQ ID NO: 28, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 29 and SEQ ID NO: A primer pair consisting of the nucleotide sequence of SEQ ID NO: 33 and SEQ ID NO: 34, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 35 and SEQ ID NO: 36, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: A primer set comprising a primer pair consisting of a sequence;
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 39 and SEQ ID NO: 40, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 41 and SEQ ID NO: 42, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 43 and SEQ ID NO: A primer set comprising a primer pair consisting of a base sequence of SEQ ID NO: 46, a primer pair consisting of a base sequence of SEQ ID NO: 47 and SEQ ID NO: 48, and a pair of primers consisting of a base sequence of SEQ ID NO: 49 and SEQ ID NO: 50; And
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 51 and SEQ ID NO: 52, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 53 and SEQ ID NO: 54, a primer pair consisting of the nucleotide sequence of SEQ ID NO: 55 and SEQ ID NO: 56, A primer pair consisting of the nucleotide sequence of SEQ ID NO: 59 and SEQ ID NO: 60, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 61 and SEQ ID NO: 62 and a pair of primers consisting of the nucleotide sequence of SEQ ID NO: And a primer set comprising a pair of primers consisting of a sequence.
A set of primers for multiplex polymerase chain reaction (PCR) for the analysis of individual genomic SNPs (single nucleotide polymorphism).
A probe set consisting of the nucleotide sequence of SEQ ID NO: 65 to SEQ ID NO: 78;
A probe set consisting of the nucleotide sequence of SEQ ID NO: 79 to SEQ ID NO: 92;
A probe set consisting of the nucleotide sequence of SEQ ID NO: 93 to SEQ ID NO: 106;
A probe set consisting of the nucleotide sequence of SEQ ID NO: 107 to SEQ ID NO: 120; And
A probe set consisting of a nucleotide sequence of SEQ ID NO: 121 to SEQ ID NO: 134,
A set of probes for multiple analysis of individual genomic SNPs.
11. A method of detecting a cancer, comprising the primer set of claim 1 and the probe set of claim 2,
Multiple analysis kits for individual genomic SNPs.
(a) treating a nucleic acid extracted from an individual sample with the primer set of claim 1 to perform a multiple polymerase chain reaction,
(b) hybridizing the amplified product with the probe set of claim 2 as a result of the multiple polymerase chain reaction,
(c) reacting the reactant with the fluorescent material as a result of the hybridization reaction; And
(d) measuring the fluorescence value to identify the individual genomic SNP type.
Multiple analysis of individual genomic SNPs.
5. The method according to claim 4, wherein a detectable label is bound to the end of either one of the primer pairs constituting the primer set.
6. The method of claim 5, wherein the detectable label is a chemical label, an enzyme label, a radioactive label, a fluorescent label, a luminescent label, a chemiluminescent label, a fluorescence resonance energy transfer (FRET) label or a metal label.
7. The method of claim 6, wherein said detectable label is biotin, Cy3, Cy5, fluorescein, picoeritrin, rhodamine, lysamine, TAMRA, HEX, TET, Dabsyl or FAM.
5. The method of claim 4, wherein the probe is bonded to the bead.
9. The method of claim 8, wherein the bead is a microbead having a carboxyl group attached thereto.
9. The method according to claim 8, wherein the probe has an amine group at the 5'-end and a poly-cytosine or a 12-poly-thymine.
The method according to claim 4, wherein the fluorescent substance is fluorescein, isothiocyanate, rhodamine, picoerythrine, picocyanin, allophycocyanin, o-phthaldehyde or fluorescamine.

Images