KR20150016006A - Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof - Google Patents

Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof Download PDF

Info

Publication number
KR20150016006A
KR20150016006A KR1020130092180A KR20130092180A KR20150016006A KR 20150016006 A KR20150016006 A KR 20150016006A KR 1020130092180 A KR1020130092180 A KR 1020130092180A KR 20130092180 A KR20130092180 A KR 20130092180A KR 20150016006 A KR20150016006 A KR 20150016006A
Authority
KR
South Korea
Prior art keywords
galactose
gene
recombinant microorganism
leu
ala
Prior art date
Application number
KR1020130092180A
Other languages
Korean (ko)
Other versions
KR101543845B1 (en
Inventor
이선복
이신엽
장혜란
Original Assignee
주식회사 포스코
포항공과대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 포스코, 포항공과대학교 산학협력단 filed Critical 주식회사 포스코
Priority to KR1020130092180A priority Critical patent/KR101543845B1/en
Publication of KR20150016006A publication Critical patent/KR20150016006A/en
Application granted granted Critical
Publication of KR101543845B1 publication Critical patent/KR101543845B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06—Ethanol, i.e. non-beverage
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01001—Alcohol dehydrogenase (1.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01316—L-Galactose 1-dehydrogenase (1.1.1.316)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Abstract

The present invention relates to a recombinant microorganism having ability to metabolize L-galactose and a method for manufacturing bioethanol from biomass including L-galactose by using the same. More specifically, in the present invention, provided are a recombinant microorganism, which includes an L-galactose transporter gene to a host microorganism, an L-galactose dehydrogenase gene and an L-galactonolactonase gene, and a manufacturing method of bioethanol using the recombinant microorganism, which uses biomass including the L- galactose as a substrate by using the recombinant microorganism.

Description

L-갈락토스 대사능을 가지는 재조합 미생물 및 이를 이용하여 L-갈락토스를 함유하는 바이오매스로부터 바이오에탄올을 제조하는 방법{Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof}[0001] The present invention relates to a recombinant microorganism having L-galactose metabolism and a method for producing bioethanol from L-galactose-containing biomass using the recombinant microorganism and a method for producing bioethanol from L-galactose-containing biomass using thereof}

본 발명은 L-갈락토스 대사능을 가지는 재조합 미생물 및 이를 이용하여 L-갈락토스를 함유하는 바이오매스로부터 바이오에탄올을 제조하는 방법에 관한 것으로, 보다 구체적으로는 L-갈락토스의 신규 대사 경로 유전자와 L-갈락토스 운반체 유전자를 숙주 미생물에 도입하여, L-갈락토스 대사능을 가지는 재조합 미생물을 제조하고, 이러한 미생물을 이용하여 L-갈락토스를 함유하는 바이오매스, 특히 홍조류로부터 바이오에탄올을 제조하는 방법에 관한 것이다.
The present invention relates to a recombinant microorganism having L-galactose metabolism ability and a method for producing bioethanol from biomass containing L-galactose using the recombinant microorganism. More particularly, the present invention relates to a novel metabolic pathway gene of L- The present invention relates to a method for producing a recombinant microorganism having L-galactose metabolism ability by introducing a galactose carrier gene into a host microorganism, and a method for producing bio-ethanol from biomass containing L-galactose, in particular, algae using the microorganism.

신 재생 에너지 중 수송용 연료로서 가장 많은 연구가 되고 있는 물질 중 하나인 바이오에탄올의 경우 현재 이미 미국, 유럽, 브라질 등 세계 각지에서 상용화를 이루고 있는 대체 에너지로서 다른 경쟁 기술들에 비해 현재까지 실용성 및 시장성이 높은 기술로 평가되고 있다.
Bioethanol, which is one of the most studied materials for transportation of renewable energy, is already being commercialized in the USA, Europe, Brazil and other countries. Compared to other competitive technologies, It is evaluated as highly marketable technology.

현재 바이오 연료는 가솔린, 휘발유 등 기존의 연료와 혼합한 형태로 사용되고 있으며, 기존 석유 연료에 비하여 연소 시 발생하는 이산화탄소 배출이 저감되고 SOx, NOx 등의 기타 유해한 물질을 배출하지 않는 등의 청정 연료로서의 장점을 가지고 있다 (J. Hill, et al. (2006) Proc . Natl . Acad . Sci ., USA 103: 11206-11210).
Currently, biofuels are used in mixed form with existing fuels such as gasoline and gasoline. They are used as clean fuels in that they reduce carbon dioxide emissions during combustion and do not emit other harmful substances such as SOx and NOx. (J. Hill, et al. (2006) Proc . Natl . Acad . Sci ., USA 103: 11206-11210).

한편, 바이오에탄올 생산에 있어서 가장 중요한 고려 요인 중 하나는 원료인 바이오매스로서, 산업적으로 활용 가능한 바이오매스를 다양화함으로써 공급을 안정화하는 것과 생산 및 활용 과정에서 경제성이 높은 바이오매스를 선별하는 것이 산업적 측면에서 중요한 요소이다.
On the other hand, one of the most important factors in bioethanol production is biomass, which is raw material. It is important to stabilize supply by diversifying biomass that can be used industrially and to select biomass with high economic efficiency during production and utilization. It is an important factor in terms of.

바이오매스를 이용하는 기술은 크게 1세대 기술인 전분계 바이오매스 이용 기술, 2세대 기술인 목질계 바이오매스 이용 기술, 3세대로 평가받고 있는 해조류 바이오매스 이용 기술로 나누어 볼 수 있다.
Biomass technology can be classified into first-generation technologies such as starch biomass utilization technology, second-generation technologies such as woody biomass technology, and third generation biomass technology.

1세대 전분계 바이오매스 이용 기술은 가장 오랜 기간 동안 연구가 진행된 것으로, 전분의 비결정형 구조로 가수분해가 용이하여, 당화 공정의 단가를 낮출 수 있을 뿐만 아니라, 미생물 발효에 용이한 D-글루코스를 주로 활용 하기 때문에 바이오에탄올 생산 시 단가를 낮출 수 있어 유리하다. 그러나 1세대 바이오매스 이용 기술은 옥수수, 사탕수수 등의 식량 자원을 주 원료로 사용하기 때문에 대량 생산을 위해서는 막대한 양의 식량 자원 소모가 불가피하고, 곡물 값 상승 등의 문제를 야기하고 있으므로 장기적인 관점에서 대체 바이오매스 이용 기술의 개발이 요구되어 왔다(R. P. John et al. (2011) Bioresource Technology 102: 186-193).
The first-generation starch biomass technology has been studied for a long time, and it is easy to hydrolyze with the amorphous structure of starch, so that the cost of the saccharification process can be lowered and D-glucose, which is easy to ferment the microorganism, It is advantageous to lower the unit cost of bioethanol production. However, since first-generation biomass technologies use food resources such as corn and sugar cane as their main raw materials, massive amounts of food resources are inevitably consumed, and grain prices are rising. Development of alternative biomass utilization technologies has been required (RP John et al. (2011) Bioresource Technology 102: 186-193).

2세대 목질계 바이오매스 이용 기술은 목질계 원료나 곡물을 수확하고 남은 대, 잎, 껍질 등의 경작 부산물 등을 사용하여 바이오에탄올을 생산하는 기술이다. 이들은 리그노셀룰로오스계 바이오매스로서 원료 가격이 저렴하고, 비식용 자원을 이용한다는 점에서 장점이 있지만, 원료의 주요 구성 성분인 셀룰로오스 및 리그닌의 견고한 화학적 구조로 인해 전처리 및 당화공정에 많은 에너지와 비용이 소모되며 공정 수율도 높지 않아서 상용화에 요구되는 경제성에는 미치지 못하는 문제점이 있다. 또한, 바이오매스의 공급을 위해 대규모의 삼림 파괴의 우려가 있어서 환경적인 문제를 야기할 가능성이 크다(C. S. Goh, et al. (2010) Renewable and Sustainable Energy Reviews 14: 842-848).
The second-generation woody biomass technology is a technology for harvesting wood-based raw materials or grains and producing bio-ethanol by using cultivation by-products such as leaves, leaves, and shells. These are lignocellulosic biomass, which is advantageous in that it is low in raw material cost and utilizes non-edible resources. However, due to the solid chemical structure of cellulose and lignin, which are the main constituents of raw materials, And the yield of the process is not high, so that the economical efficiency required for commercialization is insufficient. In addition, there is a high possibility that the supply of biomass will cause environmental problems because of the concern of large-scale forest destruction (CS Goh, et al. (2010) Renewable and Sustainable Energy Reviews 14: 842-848).

이러한 문제들을 극복할 수 있는 대안으로 3세대 해조류 바이오매스 이용 기술이 주목받고 있다. 해조류 바이오매스는 리그닌 함량이 낮고, 치밀하지 않은 조직을 가지기 때문에 2세대 바이오매스에 비해 당화가 용이하며, 육상 생물과 비교하여 생산성도 높은 편이다(M. G. Borines, et al. (2011) Renewable and Sustainable Energy Reviews 15: 4432-4435). 또한 해양에서 바이오매스를 생산하며 수분 공급의 문제에서 자유롭기 때문에, 육상의 면적이 넓지 않은 국가에서 개발하기가 적합한 바이오매스에 해당한다. 더욱이, 김(Porphyra)의 경우 홍조류에 속하는 해조류로서, 한국, 일본 및 중국에서 주로 생산되고 있고, 우리나라의 연안에서도 20종류 이상 서식하고 있으며, 지금까지 동아시아를 중심으로 꾸준히 재배되어 왔기 때문에 산업 원료로 활용할 때, 원료 생산에 용이하다는 장점을 가진다.
As an alternative to overcome these problems, technology for utilizing third-generation seaweed biomass is attracting attention. Seaweed biomass is easier to saccharify than second-generation biomass because it has a low lignin content and less dense tissue, and is more productive than terrestrial biomass (MG Borines, et al. (2011) Renewable and Sustainable Energy Reviews 15: 4432-4435). It is also biomass suitable for development in countries where the land area is not wide, because it produces biomass in the ocean and is free from the problem of moisture supply. In addition, Porphyra is a seaweed belonging to red algae. It is mainly produced in Korea, Japan and China. It also has more than 20 species in coastal areas of Korea. Since it has been cultivated steadily in East Asia, When used, it has an advantage that it is easy to produce raw materials.

그러나 해조류 바이오매스의 경우 기존의 육상계 바이오매스와는 구성 당의 성분이 상당 부분 다르기 때문에 이를 효율적으로 활용하기 위해서는 특이한 구성 당 성분을 활용할 수 있는 능력에 대한 연구가 요구되고 있다. 특히, 해조류는 상당량의 비발효성 당을 함유하고 있는데, 이러한 비발효성 당은 현재 기술로는 바이오에탄올 생산에 활용이 불가능한 상태이기 때문에 비발효성 당의 활용 기술은 해조류 바이오에탄올 생산 수율을 높이는 핵심적인 기술이 된다.
However, in the case of seaweed biomass, the composition of the constituent sugar is different from that of the conventional terrestrial biomass. Therefore, research on the ability to utilize a specific constituent sugar component is required to utilize it efficiently. In particular, seaweeds contain a large amount of non-bioactive sugars, which are currently inapplicable to bioethanol production. Therefore, the technology of non-bioactive sugars is a key technology for increasing the bio-ethanol production yield of seaweed. do.

대표적인 연구로 갈조류의 다당류 알긴산(alginic acid)을 구성하는 비발효성 당인 4-데옥시-L-에리트로-5-헥소세울로스 우론산(4-deoxy-L-erythro-5-hexoseulose uronic acid)을 활용하여 바이오연료를 생산하는 기술이 개발된 바 있다(US patent 8211689; A. J. Wargacki, et al. (2012) Science 335: 308-313). 홍조류의 경우 원초로부터 발효성 당을 추출하여 바이오에탄올을 생산하는 기술이 있으나(대한민국특허 10-1010183; 대한민국특허 10-1032997), 이는 구성 성분 중 일부인 포도당, D-갈락토스와 같은 발효성 당만을 활용 가능한 기술로, 홍조류의 비발효성 당 성분까지 모두 활용하여 바이오에탄올을 생산하는 기술은 개발된 바가 없다.
As a representative study, 4-deoxy-L-erythro-5-hexoseulose uronic acid, which is a non-combinatorial sugar constituting the polysaccharide alginic acid of brown algae (US Patent No. 8211689; AJ Wargacki, et al. (2012) Science 335: 308-313). In the case of red algae, there is a technology for producing bioethanol by extracting fermentable sugar from a plant (Korean Patent No. 10-1010183; Korean Patent No. 10-1032997). However, only fermentable sugars such as glucose and D-galactose No technology has been developed to produce bioethanol by utilizing all of the non-inactivating sugar components of red algae as a possible technology.

따라서, 바이오에탄올의 생산효율을 증가시키기 위하여, 비발효성 당인 L-갈락토스를 활용하는 기술에 대한 연구가 요구되고 있다. 이때, L-갈락토스의 경우, 특히 김과 같은 홍조류에 풍부하게 존재하며, 옥수수, 단풍나무, 아마 등의 육상식물의 섬유소나 달팽이, 성게 등의 분비물 등 다양한 생명체에 존재하는 단당류이다(R. M. Robert and E. Harrer (1973) Phytochemistry 12: 2679-2682).
Therefore, in order to increase the production efficiency of bioethanol, research on a technique utilizing L-galactose, which is a non-combinatorial sugar, is required. In this case, L-galactose is abundantly present in red algae such as Kim, and is a monosaccharide present in various living things such as fibrils, snails and sea urchins of terrestrial plants such as corn, maple and flax (RM Robert and E. Harrer (1973) Phytochemistry 12: 2679-2682).

따라서 L-갈락토스를 활용하는 기술의 개발은 홍조류뿐만 아니라 다양한 L-갈락토스 함유 바이오매스의 활용성을 높일 수 있다는 의의가 있다. L-갈락토스를 다량 함유하는 대표적인 다당류로는 포피란(porphyran)으로, 홍조류에 상당량 함유되어 있으며, D-갈락토스와 L-갈락토스-6-설페이트(L-galactose-6-sulfate), 3,6-안하이드로-L-갈락토스(3,6-anhydro-L-galactose)가 연결된 구조를 가지고 있다(Q. Zhang, et al. (2005) Carbohydrate Research 340: 2447-2450). 이 중 L-갈락토스-6-설페이트의 황산(sulfate)기는 가수분해 과정에서 제거될 수 있어, 홍조류의 당화 과정을 통하여 L-갈락토스-6-설페이트를 L-갈락토스로 전환할 수 있다.
Therefore, the development of the technology utilizing L-galactose has the significance that it can increase the utilization of various L-galactose-containing biomass as well as red algae. A representative polysaccharide containing a large amount of L-galactose is porphyran, which is contained in a considerable amount in red algae. D-galactose and L-galactose-6-sulfate, (3, 6-anhydro-L-galactose) is connected to each other (Q. Zhang, et al. (2005) Carbohydrate Research 340: 2447-2450). Among these, the sulfate group of L-galactose-6-sulfate can be removed during the hydrolysis process, and L-galactose-6-sulfate can be converted to L-galactose through glycation of red algae.

따라서, L-갈락토스를 원료로 사용하여 바이오에탄올을 생산할 수 있다면, 기존의 홍조류를 이용한 미생물 발효기술 대비 생산 수율을 상당히 향상시킬 수 있을 뿐만 아니라, 바이오매스의 활용도를 높일 수 있다. 그러나 현재는 L-갈락토스를 활용하여 바이오에탄올을 생산하는 미생물공정이 존재하지 않아, 활용이 불가능한 상태이므로, 이에 대한 지속적인 요구가 요구되고 있는 실정이다.
Therefore, if bioethanol can be produced using L-galactose as a raw material, the yield of biomass can be improved as well as the production yield of microbial fermentation technology using existing red algae can be improved. However, currently, there is no microbial process for producing bioethanol by utilizing L-galactose, and it is impossible to utilize it. Therefore, there is a constant demand for this.

특허문헌 1: US 8211689 (Yoshikuni et al.) 2012. 7. 3.Patent Document 1: US 8211689 (Yoshikuni et al.) 특허문헌 2: 대한민국특허 10-1010183(배현종 외) 2011. 1. 15.Patent Document 2: Korean Patent No. 10-1010183 (Bae Hyeonjong et al.) Jan. 15, 2011 특허문헌 3: 대한민국특허 10-1032997(유학철 외) 2011. 4. 27.Patent Document 3: Korean Patent 10-1032997 (Yu, Kee-Hyeon et al.) 2011. 4. 27.

비특허문헌 1: J. Hill, et al. (2006) Proc. Natl. Acad. Sci., USA 103: 11206-11210.Non-Patent Document 1: J. Hill, et al. (2006) Proc. Natl. Acad. Sci., USA 103: 11206-11210. 비특허문헌 2: R. P. John, et al. (2011) Bioresource Technology 102: 186-193.Non-Patent Document 2: R. P. John, et al. (2011) Bioresource Technology 102: 186-193. 비특허문헌 3: C. S. Goh, et al. (2010) Renewable and Sustainable Energy Reviews 14: 842-848.Non-Patent Document 3: C. S. Goh, et al. (2010) Renewable and Sustainable Energy Reviews 14: 842-848. 비특허문헌 4: M. G. Borines, et al. (2011) Renewable and Sustainable Energy Reviews 15: 4432-4435.Non-Patent Document 4: M. G. Borines, et al. (2011) Renewable and Sustainable Energy Reviews 15: 4432-4435. 비특허문헌 5: A. J. Wargacki, et al. (2012) Science 335: 308-313.Non-Patent Document 5: A. J. Wargacki, et al. (2012) Science 335: 308-313. 비특허문헌 6: R. M. Robert and E. Harrer (1973) Phytochemistry 12: 2679-2682.Non-Patent Document 6: R. M. Robert and E. Harrer (1973) Phytochemistry 12: 2679-2682. 비특허문헌 7: Q. Zhang, et al. (2005) Carbohydrate Research 340: 2447-2450.Non-Patent Document 7: Q. Zhang, et al. (2005) Carbohydrate Research 340: 2447-2450. 비특허문헌 8: I. A. Suvorova, et al. (2011) Journal of Bacteriology 193: 3956-3963.Non-Patent Document 8: I. A. Suvorova, et al. (2011) Journal of Bacteriology 193: 3956-3963.

본 발명은 상기의 문제점을 해결하기 위한 것으로, L-갈락토스의 신규 대사 경로 유전자와 L-갈락토스 운반체 유전자를 숙주 미생물에 도입하여, L-갈락토스 대사능을 가지는 재조합 미생물을 제조함으로써, 이러한 미생물을 이용하여 기존에 비활용성 당으로 분류되었던 L-갈락토스로부터 바이오에탄올을 생산할 수 있어, 바이오매스의 활용도 및 바이오에탄올 생산 효율을 현저히 향상시킬 수 있도록 한다.
In order to solve the above problems, the present invention provides a recombinant microorganism having L-galactose metabolism ability by introducing a novel metabolic pathway gene of L-galactose and an L-galactose carrier gene into a host microorganism, Galactose, which has been previously classified as an unavailable sugar, can be used to significantly improve biomass utilization and bio-ethanol production efficiency.

본 발명의 일 구현 예에 따르면, L-갈락토스 대사능이 없는 미생물에 L-갈락토스 운반체(L-galactose transporter) 유전자, L-갈락토스 탈수소효소(L-galactose dehydrogenase) 유전자 및 L-갈락토노락토네이즈(L-galactonolactonase) 유전자를 도입한 재조합 미생물을 제공한다.According to one embodiment of the present invention, an L-galactose transporter gene, an L-galactose dehydrogenase gene, and L-galactonolactonase (hereinafter referred to as " L- L-galactonolactonase) gene is introduced into the recombinant microorganism.

상기 L-갈락토스 대사능이 없는 미생물은 아그로박터리엄(Agrobacterium), 아조스피릴엄(Azospirillum) 바실러스(Bacillus), 버크홀데리아(Burkholderia), 클로스트리디엄(Clostridium), 엔테로박터(Enterobacter), 엔트로코커스(Enterococcus), 에스케리키아(Escherichia), 플라보박터리엄(Flavobacterium), 클렙시엘라(Klebsiella), 락토바실러스(Lactobacillus), 로도박터(Rhodobacter) 및 살모넬라(Salmonella)로 이루어진 그룹으로부터 선택된 1종의 속에 속하는 것일 수 있다. Microorganism-free L- galactose metabolism is the ability bakteo William Agrobacterium (Agrobacterium), azo RY rileom (Azospirillum) Bacillus (Bacillus), Burke holde Liao (Burkholderia), Claus tree dieom (Clostridium), Enterobacter bakteo (Enterobacter), in Lactococcus ent (Enterococcus), Escherichia (Escherichia), Plastic beam bakteo William (Flavobacterium), Keulrep when Ella (Klebsiella), Lactobacillus , Rhodobacter , and Salmonella. ≪ Desc / Clms Page number 7 >

상기 L-갈락토스 운반체 유전자, L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자는 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)로부터 유래된 것일 수 있다.The L-galactosyltransferase gene, L-galactosse dehydrogenase gene and L-galactonolactonase gene can be obtained from Pseudoalteromonas atlantica . < / RTI >

상기 L-갈락토스 운반체 유전자는 서열번호 1로 표시되는 염기 서열을 갖고, 상기 L-갈락토스 탈수소효소 유전자는 서열번호 3으로 표시되는 염기 서열을 가지며, 상기 L-갈락토노락토네이즈 유전자는 서열번호 5로 표시되는 염기서열을 가질 수 있다.The L-galactosyltransferase gene has a nucleotide sequence of SEQ ID NO: 1, the L-galactosse dehydrogenase gene has a nucleotide sequence of SEQ ID NO: 3, and the L-galactonolactonase gene has a nucleotide sequence of SEQ ID NO: And the like.

상기 L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자는 단일 벡터에 의해 도입될 수 있다.The L-galactosse dehydrogenase gene and L-galactonolactonase gene can be introduced by a single vector.

상기 벡터는 ColE1 origin을 갖는 플라스미드일 수 있다.The vector may be a plasmid with a ColEl origin.

상기 벡터에 의해 L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자가 순차로 배열되며, 상기 L-갈락토노락토네이즈 유전자의 전단부에 리보좀 결합부위(RBS, ribosome binding site)가 도입될 수 있다.The L-galactosyltransferase gene and the L-galactonolactonase gene are sequentially arranged by the vector, and a ribosome binding site (RBS) is introduced into the front end of the L-galactonolactonase gene .

상기 L-갈락토스 운반체 유전자는 p15A origin을 갖는 플라스미드에 의해 도입될 수 있다.The L-galactose carrier gene may be introduced by a plasmid having a p15A origin.

상기 재조합 미생물은 피루브산 탈탄산효소(pyruvate decarboxylase) 유전자 및 알코올 산화환원효소(alcohol dehydrogenase) 유전자가 추가로 도입될 수 있다.
The recombinant microorganism may further include a pyruvate decarboxylase gene and an alcohol dehydrogenase gene.

본 발명의 다른 구현 예에 따르면, L-갈락토스를 포함하는 바이오매스를 기질로 하여 상기 재조합 미생물을 이용해 바이오에탄올을 제조하는 재조합 미생물을 이용한 바이오에탄올 제조방법을 제공한다.According to another embodiment of the present invention, there is provided a method for producing bioethanol using a recombinant microorganism which produces bioethanol using the recombinant microorganism using biomass containing L-galactose as a substrate.

상기 바이오매스는 홍조류일 수 있다.The biomass may be red algae.

상기 홍조류는 김 속(Porphyra) 홍조류, 돌가사리 목(Gigartinales) 홍조류, 폴리시포니아 속(Polysiphonia) 홍조류 및 포피리디움 속(Porphyridium) 홍조류로 이루어진 그룹으로부터 선택된 1종 이상일 수 있다.The red algae may be at least one selected from the group consisting of Porphyra red alga, Gigartinales red alga, Polysiphonia algae and Porphyridium algae.

상기 바이오매스는 홍조류를 직접 가수분해하거나 홍조류에 함유된 다당류를 추출한 뒤 가수분해한 것일 수 있다.The biomass may be obtained by directly hydrolyzing red algae or extracting polysaccharides contained in red algae and then hydrolyzing the same.

상기 가수분해는 황산, 염산, 질산, 아세트산, 개미산, 트리플루오로아세트산(trifluoroacetic acid), 테트라부틸암모늄 중황산(tetrabutyl ammonium bisulfate), 1-부틸-3-메틸이미다졸륨 황산수소(1-butyl-3-methylimidazolium hydrogen sulfate), 1-메틸-이미다졸륨 황산수소(1-methylimidazolium hydrogen sulfate)으로 이루어진 그룹으로부터 선택된 1종 이상의 산을 사용하여 수행하는 산 촉매 가수분해 일 수 있다.
The hydrolysis may be carried out in the presence of a reducing agent such as sulfuric acid, hydrochloric acid, nitric acid, acetic acid, formic acid, trifluoroacetic acid, tetrabutyl ammonium bisulfate, 1-butyl-3-methylimidazolium hydrogen sulfate -3-methylimidazolium hydrogen sulfate, and 1-methylimidazolium hydrogen sulfate. The acid-catalyzed hydrolysis may be carried out using at least one acid selected from the group consisting of 1-methylimidazolium hydrogen sulfate and 1-methylimidazolium hydrogen sulfate.

본 발명은 L-갈락토스 대사능을 가지는 재조합 미생물을 제조함으로써, 기존에는 비활용성 당으로 분류되었던 L-갈락토스를 이용해 바이오에탄올을 생산할 수 있도록 하여, L-갈락토스를 다량 함유하고 있는 홍조류의 바이오매스로부터 유래한 다당류의 활용도를 높이고, 바이오에탄올의 생산 효율을 현저히 향상시킬 수 있도록 한다.
The present invention provides a recombinant microorganism having L-galactose metabolism ability, which can produce bioethanol using L-galactose, which has been conventionally classified as a non-utilizable sugar, and can produce biomass of red algae containing a large amount of L- And the production efficiency of bioethanol can be remarkably improved.

또한, 바이오에탄올 생산 공정 중 중간 물질로 발생하는 피루브산을 다양한 바이오화학제품의 생산에 응용하여, 경제성을 더욱 향상시킬 수 있도록 한다.
In addition, pyruvic acid, which is an intermediate product in the bioethanol production process, can be applied to the production of various biochemical products to further improve the economical efficiency.

도 1의 A는 해양 미생물인 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)가 가지는 L-갈락토스의 대사경로를 개략적으로 도시한 것이다.
도 1의 B는 해양 미생물인 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)의 L-갈락토스 대사관련 유전자 클러스터를 개략적으로 도시한 것이다.
도 2는 본 발명의 L-갈락토스 대사능을 가지는 재조합미생물에 의해 L-갈락토스로부터 바이오에탄올을 포함한 바이오화학물질이 생성되는 과정을 개략적으로 도시한 것이다.
도 3은 L-갈락토스 대사 관련 유전자가 도입된 플라스미드의 유전자 지도로서, 도 3의 A는 L-갈락토스 운반체 유전자(LgaP)가 도입된 pLGA1의 유전자 지도이고, B는 L-갈락토스 탈수소효소 유전자(LgaA)와 L-갈락토노락토네이즈 유전자(LgaB)가 도입된 pLGA2의 유전자 지도를 도시한 것이다.
도 4는 L-갈락토스 운반체 유전자의 발현 및 효소 활성을 확인한 결과로서, 도 4의 A는 비교예 1에서 L-갈락토스 운반체 유전자가 삽입되지 않은 대조군의 배양 시간에 따른 L-갈락토스 소모 양상을 그래프로 도시한 것이고, B는 실시예 3에서 L-갈락토스 운반체 유전자가 삽입된 재조합 대장균의 배양 시간에 따른 L-갈락토스 소모 양상을 그래프로 도시한 것이다.
도 5는 실시예 5 및 비교예 2에서 기질에 따른 L-갈락토스 탈수소효소의 활성을 UV 분광광도계의 흡광도 변화의 그래프로 도시한 것이다.
도 6은 L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈의 L-갈락토스 및 L-갈락토노-1,4-락톤 각각에 대한 효소 활성을 확인한 결과로서, 도 6의 A는 실시예 6에서 L-갈락토스 탈수소효소 첨가 전 샘플을, B는 L-갈락토스 탈수소효소 첨가 후 샘플을, C는 L-갈락토노락토네이즈 첨가 후 샘플을 HLPC로 분석한 결과를 그래프로 도시한 것이다.FIG. 1 (A) schematically shows the metabolic pathway of L-galactose of the marine microorganism Pseudoalteromonas atlantica .
Fig. 1B schematically shows the L-galactose metabolism related gene cluster of the marine microorganism, Pseudoalteromonas atlantica .
FIG. 2 is a schematic view showing a process of producing biochemicals containing bioethanol from L-galactose by a recombinant microorganism having L-galactose metabolism ability according to the present invention.
3 is a gene map of a plasmid into which an L-galactose metabolism-related gene has been introduced. In FIG. 3, A is a gene map of pLGA1 into which an L-galactose carrier gene (LgaP) has been introduced, and B is a gene map of L-galactose dehydrogenase gene ) And the L-galactonolactonase gene (LgaB).
FIG. 4 is a graph showing the expression of L-galactose transporter gene and enzyme activity. FIG. 4A is a graph showing the L-galactose consumption pattern of the control group in which the L-galactose transporter gene was not inserted in Comparative Example 1 And B is a graph showing the L-galactose consumption pattern of the recombinant Escherichia coli having the L-galactose carrier gene inserted therein according to the incubation time in Example 3. Fig.
FIG. 5 shows the activity of L-galactose dehydrogenase according to the substrate in Example 5 and Comparative Example 2 as a graph of the change in absorbance of a UV spectrophotometer.
FIG. 6 shows the results of confirming the enzyme activities of L-galactose dehydrogenase and L-galactonolactonase, respectively, of L-galactose and L-galactono-1,4-lactone, Galactose dehydrogenase, B shows a sample after addition of L-galactose dehydrogenase, and C shows the result of analyzing a sample with HLPC after addition of L-galactonolactonase.

이하, 첨부된 도면을 참조하여 본 발명의 바람직한 실시 형태를 설명한다. 그러나, 본 발명의 실시 형태는 여러 가지 다른 형태로 변형될 수 있으며, 본 발명의 범위가 이하 설명하는 실시 형태로 한정되는 것은 아니다.
Hereinafter, preferred embodiments of the present invention will be described with reference to the accompanying drawings. However, the embodiments of the present invention can be modified into various other forms, and the scope of the present invention is not limited to the embodiments described below.

기존에는 해조류, 특히 홍조류를 바이오매스로 이용하는 미생물 발효기술에서, 바이오에탄올 생성 균주는 홍조류의 구성당 중 포도당 및 D-갈락토스만 바이오에탄올을 생성하는 데에 활용될 수 있었고, L-갈락토스는 탄소원으로 활용하지 못하여 바이오매스 활용도 및 바이오에탄올 생산 수율이 다소 떨어졌었다.
Conventionally, in the microbial fermentation technology using seaweeds, especially red algae as a biomass, the bioethanol-producing strains could be used to produce only glucose and D-galactose in the constituent sugar of red algae, and L-galactose was used as a carbon source The utilization of biomass and the yield of bioethanol production were somewhat lower.

따라서, 홍조류 유래의 L-갈락토스를 바이오에탄올 원료로 사용하기 위해서는 L-갈락토스를 활용하는 대사 경로를 외부로부터 도입하여 기존 미생물이 활용하는 대사 경로와 연결시켜주는 과정이 필요하다.
Therefore, in order to use L-galactose derived from red algae as a raw material for bioethanol, it is necessary to introduce a metabolic pathway utilizing L-galactose from the outside and link it to a metabolic pathway utilized by existing microorganisms.

본 발명의 일 구현 예에 따르면, L-갈락토스 대사능을 가지는 재조합미생물을 제공하는 것을 목적으로 하며, 구체적으로는 L-갈락토스 대사능이 없는 숙주 미생물에 L-갈락토스 운반체(L-galactose transporter) 유전자, L-갈락토스 탈수소효소(L-galactose dehydrogenase) 유전자 및 L-갈락토노락토네이즈(L-galactonolactonase) 유전자를 도입한 재조합 미생물을 제공한다.
According to one embodiment of the present invention, there is provided a recombinant microorganism having L-galactose metabolism ability. Specifically, a recombinant microorganism having L-galactose transporter gene, L-galactose transporter gene, There is provided a recombinant microorganism into which an L-galactose dehydrogenase gene and an L-galactonolactonase gene are introduced.

본 발명자는 해양 미생물인 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)가 L-갈락토스를 2-케토-3-디옥시-D-글루코네이트(2-keto-3-deoxy-D-gluconate)로 전환할 수 있음을 발견하였는 바, 본 발명에서 상기 숙주 미생물에 도입하는 L-갈락토스 운반체(L-galactose transporter) 유전자, L-갈락토스 탈수소효소(L-galactose dehydrogenase) 유전자 및 L-갈락토노락토네이즈(L-galactonolactonase) 유전자는 L-갈락토스 대사능을 가지는 해양 미생물인 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)가 가지는 유전자로부터 유래한 것일 수 있다.
The present inventors have found that the marine microorganism Pseudoalteromonas atlantica can convert L-galactose to 2-keto-3-deoxy-D-gluconate L-galactose transporter gene, L-galactose dehydrogenase gene and L-galactosyltransferase gene introduced into the host microorganism in the present invention, galactonolactonase) gene as Altman also marine microorganisms having L- galactose metabolism Monastir Atlantica (Pseudoalteromonas atlantica ) may be derived from the gene.

도 1의 A 및 B는 상기 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)가 가지는 L-갈락토스의 대사 경로 및 상기 L-갈락토스 대사 관련 유전자 클러스터를 개략적으로 도시한 것이다. 보다 구체적으로는, (a) L-갈락토스 운반체(Patl_0801)를 이용하여 L-갈락토스를 미생물 내로 운반하는 과정, (b) L-갈락토스 탈수소효소(L-galactose dehydrogenase, Patl_0799)를 이용하여 운반된 L-갈락토스(L-galactose)를 L-갈락토노-1,4-락톤(L-galactono-1,4-lactone)으로 전환하는 과정, (c) L-갈락토노락토네이즈(L-galactonolactonase, Patl_0798)를 이용하여 L-갈락토노-1,4-락톤을 L-갈락토네이트(L-galactonate)로 전환하는 과정, (d) L-갈락토네이트 5-탈수소효소(L-galactonate 5-dehydrogenase, Patl_0797)를 이용하여 L-갈락토네이트(L-galactonate)를 D-타가투로네이트(D-tagaturonate)로 전환하는 과정, (e) D-타가투로네이트 환원효소(D-tagaturonate reductase, Patl_0834)를 이용하여 D-타가투로네이트를 D-알트로네이트(D-altronate)로 전환하는 과정, (f) D-알트로네이트 탈수효소(D-altronate dehydratase, Patl_0800)를 이용하여 D-알트로네이트를 2-케토-3-디옥시-D-글루코네이트(2-keto-3-deoxy-D-gluconate)로 전환하는 과정을 포함한다.
Figures 1 A and B schematically illustrate the metabolic pathway of L-galactose and the L-galactose metabolism related gene cluster of Pseudoalteromonas atlantica . More specifically, the present invention provides a method for producing L-galactose by carrying out the steps of (a) carrying L-galactose into a microorganism using L-galactose carrier (Patl_0801), (b) - converting L-galactose into L-galactono-1,4-lactone, (c) converting L-galactonolactonase into L- Galactonate 5-dehydrogenase (L-galactonate 5-dehydrogenase) by converting L-galactono-1,4-lactone into L-galactonate by using L- galactonate to D-tagaturonate by using a D-tagatronate reductase (D-tagase), (d) a step of converting L- , D-altronate (D-altronate dehydratase, Patl_0800) was used to convert D-tagatouronate to D-altronate by using D-altroate dehydratase - Alt (2-keto-3-deoxy-D-gluconate).

이때, 상기 Patl_0801, Patl_0799, Patl_0798, Patl_0797, Patl_0834 및 Patl_0800은 상기 (a) 내지 (f)의 각 과정을 수행할 수 있는 폴리펩타이드를 코딩하는 유전자를 의미하는 것으로, 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)의 L-갈락토스 대사관련 유전자는 L-갈락토스 운반체 유전자인 Pat1_0801 1종과, L-갈락토스 대사관련 유전자인 Patl_0799, Patl_0798, Patl_0797, Patl_0834 및 Patl_0800의 5종으로 구성된다.
Herein, Patl_0801, Patl_0799, Patl_0798, Patl_0797, Patl_0834, and Patl_0800 are genes encoding polypeptides capable of performing the respective steps of (a) through (f), including Pseudoalteromonas atlantica ) Of L-galactose metabolism is composed of five species of L-galactose carrier gene Pat1_0801 and L-galactose metabolism genes Patl_0799, Patl_0798, Patl_0797, Patl_0834 and Patl_0800.

그러나, 대장균 등 엔테로박터(Enterobactor) 등에 속하는 일반적인 미생물은 상기 도 1의 B에 사선으로 표시한 바와 같이, 상기 대사경로 중 L-갈락토네이트를 2-케토-3-디옥시-D-글루코네이트로 전환하는 3종의 효소 유전자를 포함하고 있기 때문에(I. A. Suvorova, et al. (2011) Journal of Bacteriology 193: 3956-3963), 본 발명은 숙주 미생물에 L-갈락토스 운반체 유전자 1종과 L-갈락토스를 L-갈락토네이트로 전환하는 효소 유전자 2종을 숙주 미생물에 도입하여 재조합 미생물을 제조함으로써, 신규 대사 경로를 통하여 L-갈락토스로 부터 바이오에탄올을 제조할 수 있다.
However, typical microorganisms belonging to Escherichia coli, Enterobactor and the like are, as indicated by the shaded line in FIG. 1B, the L-galactonate in the metabolic pathway is 2-keto-3-deoxy-D-gluconate (Ia Suvorova, et al. (2011) Journal of Bacteriology 193: 3956-3963). According to the present invention, recombinant microorganisms are prepared by introducing one L-galactose carrier gene and two enzyme genes for converting L-galactose into L-galactonate into a host microorganism, Bioethanol can be prepared from L-galactose through a novel metabolic pathway.

한편, 상기 L-갈락토스 운반체 유전자는 서열번호 1로 표시되는 염기 서열을 갖고, 상기 L-갈락토스 탈수소효소 유전자는 서열번호 3으로 표시되는 염기 서열을 가지며, 상기 L-갈락토노락토네이즈 유전자는 서열번호 5로 표시되는 염기서열을 가질 수 있다.
The L-galactosyltransferase gene has the nucleotide sequence shown in SEQ ID NO: 1, the L-galactosse dehydrogenase gene has the nucleotide sequence shown in SEQ ID NO: 3, and the L- 5 < / RTI >

도 2는 본 발명의 L-갈락토스 대사능을 가지는 재조합미생물에 의해 L-갈락토스로부터 바이오에탄올을 포함한 바이오화학물질이 생성되는 과정을 개략적으로 도시한 것으로, L-갈락토스 운반체 유전자 1종과 L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자를 대장균(E. coli)에 도입하여 얻어진 재조합 미생물은 상기 3종의 유전자로 인하여 발현되는 효소를 이용해 L-갈락토스로부터 L-갈락토네이트를 생성한다. 그 후, 대장균이 가지고 있는 헥스유론산 대사경로(hexuronate metabolic pathway)를 이용하여 순서대로 D-타가투로네이트, D-알트로네이트, 2-케토-3-디옥시-D-글루코네이트, 2-케토-3-디옥시-D-글루코네이트-6-인산(2-keto-3-deoxy-D-gluconate-6-phosphate)를 거쳐 피루브산(pyruvate)과 D-글리세르알데히드-3-인산(D-glyceraldehyde-3-phosphate)가 생성된다.
FIG. 2 is a schematic view showing a process of producing biochemicals containing bioethanol from L-galactose by a recombinant microorganism having L-galactose metabolism ability according to the present invention, wherein one kind of L-galactose carrier gene and L- The recombinant microorganism obtained by introducing the dehydrogenase gene and L-galactonolactonase gene into E. coli produces L-galactonate from L-galactose using an enzyme expressed by the above three genes . D-tagatouronate, D-altroate, 2-keto-3-deoxy-D-gluconate, 2-keto-3-deoxy-D-gluconate were then sequenced using the hexuronate metabolic pathway of Escherichia coli (2-keto-3-deoxy-D-gluconate-6-phosphate) via pyruvate and D-glyceraldehyde-3-phosphate D-glyceraldehyde-3-phosphate.

본 발명의 재조합 미생물은 숙주 미생물이 피루브산 탈탄산효소(pyruvate decarboxylase) 유전자 및 알코올 산화환원효소(alcohol dehydrogenase) 유전자를 포함하지 않는 경우, 바이오에탄올 생산을 위하여 상기의 두 유전자를 추가로 도입할 수 있다.
The recombinant microorganism of the present invention can further introduce the above two genes for the production of bioethanol when the host microorganism does not contain a pyruvate decarboxylase gene and an alcohol dehydrogenase gene .

따라서, 상기 피루브산(pyruvate)과 D-글리세르알데히드-3-인산(D-glyceraldehyde-3-phosphate)은 피루브산 탈탄산효소(pyruvate decarboxylase)와 알코올 산화환원효소(alcohol dehydrogenase)에 의하여 최종적으로 바이오에탄올로 전환이 가능하며, 바이오에탄올 외에도 부탄올(butanol), 젖산(lactic acid), 아세트산(acetic acid), 숙신산(succinic acid)등 산업적으로 유용한 여러 바이오화학물질의 생산에 활용할 수 있다.
Therefore, pyruvate and D-glyceraldehyde-3-phosphate are pyruvate decarboxylase and alcohol dehydrogenase, and finally, bioethanol And it can be used for the production of many industrially useful biochemicals such as butanol, lactic acid, acetic acid and succinic acid in addition to bioethanol.

단, 본 발명에서 재조합 미생물의 제조에 이용되는 L-갈락토스 대사능이 없는 미생물은 그 종류를 특별히 한정하지는 않으나, 아그로박터리엄(Agrobacterium), 아조스피릴엄(Azospirillum) 바실러스(Bacillus), 버크홀데리아(Burkholderia), 클로스트리디엄(Clostridium), 엔테로박터(Enterobacter), 엔트로코커스(Enterococcus), 에스케리키아(Escherichia), 플라보박터리엄(Flavobacterium), 클렙시엘라(Klebsiella), 락토바실러스(Lactobacillus), 로도박터(Rhodobacter) 및 살모넬라(Salmonella)로 이루어진 그룹으로부터 선택된 1종의 속에 속하는 것일 수 있으며, 특히, 재조합에 가장 일반적으로 사용되는 엔테로박터(Enterobacter)에 속하는 대장균(E. coli)이 가장 바람직하다.
However, the microorganism no ability L- galactose metabolism to be used in manufacture, but is not limited to that particular type, Agrobacterium bakteo Burke William (Agrobacterium), azo RY rileom (Azospirillum) Bacillus (Bacillus), Liao holde the recombinant microorganism in the present invention ( Burkholderia ), Claus tree dieom (Clostridium), Enterobacter bakteo (Enterobacter), in Lactococcus ent (Enterococcus), Escherichia (Escherichia), Plastic beam bakteo William (Flavobacterium), Keulrep when Ella (Klebsiella), Lactobacillus , Also it may be one belonging to the genus of one member selected from the group consisting of bakteo (Rhodobacter) and Salmonella (Salmonella), in particular Escherichia coli (E. coli) belonging to the Enterobacter bakteo (Enterobacter) most commonly used in recombinant is most preferred .

또한, 본 발명에서 상기 3종의 유전자를 숙주 유전자에 도입하는 방법으로는 특별히 한정하지는 않으나, 벡터에 상기 유전자를 삽입하여 열 충격 방법(heat shock transformation method) 등을 사용해 재조합 미생물 내에 도입함으로써, 재조합 미생물 내에서 함께 발현될 수 있도록 하는 것이 바람직하다.
In the present invention, the method for introducing the above-mentioned three genes into the host gene is not particularly limited. However, by introducing the gene into a vector and introducing it into the recombinant microorganism using a heat shock transformation method or the like, So that they can be expressed together in microorganisms.

이때 사용하는 벡터는 종류를 특별히 한정하지 않으며, 단백질의 발현 정도, 공정 조건 및 경제적인 조건 등을 고려하여 선택할 수 있다. 단, L-갈락토스 운반체 유전자의 경우 과발현되면 효소 활성 및 세포 성장에 악영향을 줄 수 있어, 낮은 복제 개수(copy number)를 가지는 p15A origin을 갖는 플라스미드로, 예를 들어, pHR-Tc에 클로닝하는 것이 바람직하며, L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자의 경우 과발현되어 세포 내로 유입되는 L-갈락토스를 빠르게 이용할 수 있어야 하므로, 높은 복제 개수를 가지는 ColE1 origin을 갖는 플라스미드로, 예를 들어, pQE8OL에 클로닝하는 것이 바람직하다.
The type of the vector used herein is not particularly limited, and can be selected in consideration of the degree of protein expression, processing conditions, and economic conditions. However, in the case of the L-galactose transporter gene, cloning into a plasmid having a p15A origin having a low copy number, for example, pHR-Tc can overcome the enzyme activity and cell growth when overexpressed Galactose dehydrogenase gene and L-galactonolactonase gene, it is necessary to be able to rapidly utilize L-galactose introduced into cells to overexpress. Therefore, a plasmid having a ColE1 origin having a high copy number, For example, cloning into pQE8OL is preferred.

또한, L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자의 경우 단일 벡터에 의해 숙주 미생물 내로 도입되는 것이 바람직하며, 상기 두 유전자는 벡터 내에 순차로 배열되어 두 유전자가 동시 발현 시, 단백질 번역에 문제가 없도록 두 번째 유전자인 L-갈락토노락토네이즈 유전자의 앞부분에 리보좀 결합부위(RBS, ribosome binding site)가 추가적으로 도입되는 것이 바람직하다.
In addition, in the case of the L-galactosse dehydrogenase gene and L-galactonolactonase gene, it is preferable that the gene is introduced into the host microorganism by a single vector. The two genes are sequentially arranged in the vector, It is preferable that a ribosome binding site (RBS) is additionally introduced to the front of the second L-galactonolactonase gene so that there is no problem in translation.

또한, 본 발명의 재조합 미생물에 있어서, 다중 서열을 정렬해주는 ClustalW 방법에 따를 때, 상기 L-갈락토스 운반체 유전자에 의해 발현되는 아미노산 서열은 서열번호 2의 아미노산 서열과 80% 이상의 유사성을 가지는 것이 바람직하며, 상기 L-갈락토스 탈수소효소 유전자에 의해 발현되는 아미노산 서열은 서열번호 4의 아미노산 서열과 80% 이상의 유사성을 가지는 것이 바람직하고, 상기 L-갈락토노락토네이즈 유전자에 의해 발현되는 아미노산 서열은 서열번호 6의 아미노산 서열과 80% 이상의 유사성을 가지는 것이 재조합 미생물에 포함된 유전자 각각이 L-갈락토스 운반체 유전자, L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자와 동일한 기능을 하는 유전자일 가능성이 높아 바람직하다.
In the recombinant microorganism of the present invention, according to the ClustalW method for aligning multiple sequences, the amino acid sequence expressed by the L-galactose carrier gene preferably has 80% or more similarity with the amino acid sequence of SEQ ID NO: 2 , The amino acid sequence expressed by the L-galactosyl dehydrogenase gene preferably has 80% or more similarity with the amino acid sequence of SEQ ID NO: 4, and the amino acid sequence expressed by the L-galactonolactonase gene is preferably SEQ ID NO: 6, it is possible that each of the genes contained in the recombinant microorganism has the same function as the L-galactose carrier gene, L-galactosse dehydrogenase gene and L-galactonolactonase gene High.

본 발명의 다른 구현 예에 따르면, L-갈락토스를 포함하는 바이오매스를 기질로 하여 상기 재조합 미생물을 이용해 바이오에탄올을 제조하는 재조합 미생물을 이용한 바이오에탄올의 제조방법을 제공한다.
According to another embodiment of the present invention, there is provided a method for producing bioethanol using a recombinant microorganism which produces bioethanol using the recombinant microorganism using biomass containing L-galactose as a substrate.

상기 L-갈락토스를 포함하는 바이오매스의 종류는 특별히 한정하지는 않으나, 홍조류가 L-갈락토스를 다량으로 함유하는 대표적인 다당류인 포피란(porphyran)을 상당량 포함하고 있어 가장 바람직하다. 단, 본 발명의 제조방법은 상기 기재한 바와 같이 바이오매스를 홍조류에 한정하여 수행되는 것은 아니며, 그 외에 L-갈락토스를 포함하는 옥수수, 단풍나무, 아마 등의 육상식물의 섬유소나, 달팽이, 성게 등의 분비물 등을 바이오매스로 사용할 수 있다.
The type of the biomass including L-galactose is not particularly limited, and it is most preferable that the red algae contains a substantial amount of porphyran, which is a typical polysaccharide containing a large amount of L-galactose. However, the production method of the present invention is not limited to the above-described biomass as limited to red algae. In addition, the production method of the present invention is not limited to biomass, And the like can be used as biomass.

따라서, 본 발명의 바이오에탄올 제조방법은 L-갈락토스를 활용하는 기술을 개발하는 것으로, 홍조류뿐만 아니라 다양한 L-갈락토스 함유 바이오매스의 활용성을 높일 수 있다는 의의가 있다.
Therefore, the bioethanol production method of the present invention is to develop a technique utilizing L-galactose, meaning that it is possible to enhance the utility of various L-galactose-containing biomass as well as red algae.

다만, 홍조류를 바이오매스로 사용하는 경우, 상기 홍조류는 김 속(Porphyra) 홍조류, 돌가사리 목(Gigartinales) 홍조류, 폴리시포니아 속(Polysiphonia) 홍조류 및 포피리디움 속(Porphyridium) 홍조류로 이루어진 그룹으로부터 선택된 1종 이상일 수 있으나, 그 중에서도 김 속(Porphyra) 홍조류에 L-갈락토스가 다량 함유되어 있어, 가장 바람직하다.
However, when red algae are used as biomass, the red algae are selected from the group consisting of Porphyra red algae, Gigartinales red algae, Polysiphonia algae and Porphyridium algae It may be at least one species, and it is most preferable that Porphyra red algae contains a large amount of L-galactose.

상기 바이오매스에 포함된 L-갈락토스가 바이오에탄올로 전환되는 과정은 상기 재조합 미생물의 신규 대사 경로를 기재한 바와 동일하며, 간략히는 L-갈락토스는 재조합 미생물에 도입된 유전자가 발현됨에 따라 얻어지는 L-갈락토스 운반체에 의해 재조합 미생물 세포 내로 이동한 뒤, 역시 유전자 도입으로 얻어지는 L-갈락토스 탈수소효소(L-galactose dehydrogenase) 및 L-갈락토노락토네이즈에 의해 L-갈락토노-1,4-락톤을 거쳐 L-갈락토네이트로 전환되고, 그 후, 숙주 미생물에 포함된 효소에 의하여 2-케토-3-디옥시-D-글루코네이트를 거쳐, 피루브산과 D-글리세르알데히드-3-인산으로 전환될 수 있다.
The process of converting the L-galactose contained in the biomass into bioethanol is the same as that described in the novel metabolic pathway of the recombinant microorganism. In brief, L-galactose is converted into L-galactose, which is obtained by expressing the gene introduced into the recombinant microorganism, Galactose dehydrogenase (L-galactose dehydrogenase) obtained by gene transfer and L-galactono-1,4-lactone by L-galactonolactonase were introduced into the recombinant microorganism cells by the galactose carrier Galactonate, and then converted to pyruvic acid and D-glyceraldehyde-3-phosphate through 2-keto-3-deoxy-D-gluconate by an enzyme contained in the host microorganism .

상기 피루브산과 D-글리세르알데히드-3-인산은 숙주 미생물에 피루브산 탈탄산효소(pyruvate decarboxylase) 및 알코올 산화환원효소(alcohol dehydrogenase)를 발현하는 유전자가 포함되어 있거나 상기 효소를 코딩하는 유전자를 재조합 시 도입한 경우에는 최종적으로 바이오에탄올로 전환이 가능하며, 상기의 유전자가 포함되어 있지 않다고 하더라도, 상기 효소를 따로 첨가해 줌으로써 바이오에탄올로 전환이 가능하다.
The pyruvic acid and the D-glyceraldehyde-3-phosphate may contain a gene expressing pyruvate decarboxylase and alcohol dehydrogenase in the host microorganism, or may be obtained by recombining a gene encoding the enzyme If it is introduced, it can be finally converted to bioethanol. Even if the above gene is not contained, it can be converted into bioethanol by separately adding the enzyme.

단, 본 발명은 바이오에탄올의 제조방법으로 기재하고 있으나, 바이오에탄올 제조에 한정하지 않으며, 상기한 바와 같이 피루브산과 D-글리세르알데히드-3-인산으로부터 부탄올, 젖산, 아세트산, 숙신산 등 산업적으로 유용한 여러 바이오화학물질의 생산에 활용할 수 있다.
However, the present invention is not limited to the preparation of bioethanol. However, the present invention is not limited to the production of bioethanol. As described above, industrially useful pyruvic acid and D-glyceraldehyde-3-phosphate can be obtained from butanol, lactic acid, acetic acid, It can be used for the production of various biochemicals.

또한, 본 발명의 바이오에탄올의 제조방법에서 사용되는 바이오매스는 홍조류를 직접 가수분해하거나 홍조류에 함유된 다당류를 추출한 뒤 가수분해하는 당화의 전처리 공정이 수행될 수 있다.
In addition, the biomass used in the method for producing bioethanol of the present invention may be subjected to a pretreatment step of hydrolyzing red algae directly or by extracting polysaccharides contained in red algae and hydrolyzing the saccharide.

즉, 바이오에탄올을 제조하기 위해서는 L-갈락토스를 함유하는 홍조류를 재조합 미생물에 가하기에 앞서 홍조류로부터 당 성분을 추출하는, 당화 과정을 거치는 것이 바람직하며, 방법으로는 홍조류, 특히 김 속 홍조류의 경우 두께가 얇고 건조 시 잘 파쇄되는 특성으로 인하여, 일반적으로 사용되는 산 촉매 가수분해 조건 만으로도 충분히 당화할 수 있다. 구체적으로는, 당 성분 추출을 위하여는 상기 홍조류를 직접 산 촉매 가수분해하거나, 열수 처리 등의 방법으로 홍조류로부터 다당류를 추출한 이후에 다당류를 산 촉매 가수분해할 수 있다.
That is, in order to produce bioethanol, it is preferable to carry out a saccharification process in which the sugar component is extracted from red algae before adding the red algae containing L-galactose to the recombinant microorganism. In the case of red algae, Can be saccharified sufficiently even under the generally used acid catalytic hydrolysis conditions because of its thinness and good shatterability at the time of drying. Specifically, in order to extract the sugar component, the polysaccharides can be subjected to acid catalytic hydrolysis after the polysaccharides are extracted from red algae by a method such as direct acid catalytic hydrolysis of the red algae, hydrothermal treatment or the like.

상기 가수분해에 의하여 홍조류를 구성하는 L-갈락토스-6-설페이트는 L-갈락토스로 전환될 수 있다. L-갈락토스-6-설페이트는 L-갈락토스의 6번 탄소와 황산기가 에스터(ester) 결합을 하는 물질로, 일반적인 산 촉매 가수분해 조건 하에서 쉽게 황산기가 제거되므로, 상기 가수분해 과정으로 인하여 L-갈락토스-6-설페이트로부터 L-갈락토스의 생성과 홍조류의 당화가 동시에 진행될 수 있다.
The L-galactose-6-sulfate constituting the algae by the hydrolysis can be converted into L-galactose. Since L-galactose-6-sulfate is a substance that makes an ester bond with the carbon atom of L-galactose and the sulfate group, the sulfate group is easily removed under general acid catalyzed hydrolysis conditions, The production of L-galactose and the saccharification of red algae can proceed simultaneously.

상기 산 촉매 가수분해에 이용되는 산은 그 종류를 특별히 한정하지는 않으나, 황산(sulfuric acid), 염산(hydrochloric acid), 질산(nitric acid), 아세트산(acetic acid), 개미산(formic acid), 트리플루오로아세트산(trifluoroacetic acid), 테트라부틸암모늄 중황산(tetrabutyl ammonium bisulfate), 1-부틸-3-메틸이미다졸륨 황산수소(1-butyl-3-methylimidazolium hydrogen sulfate), 1-메틸-이미다졸륨 황산수소(1-methylimidazolium hydrogen sulfate)으로 이루어진 그룹으로부터 선택된 1종을 사용하거나, 혹은 2종 이상을 적절한 비율로 혼합하여 사용할 수 있다.
The acid used for the acid catalytic hydrolysis is not particularly limited, but may be selected from the group consisting of sulfuric acid, hydrochloric acid, nitric acid, acetic acid, formic acid, (1-butyl-3-methylimidazolium hydrogen sulfate), 1-methyl-imidazolium hydrogen sulfate (hereinafter referred to as " hydrogen peroxide "), tetrabutylammonium bisulfate (1-methylimidazolium hydrogen sulfate), or a mixture of two or more of them in an appropriate ratio.

실시예Example

이하, 구체적인 실시예를 통해 본 발명을 보다 구체적으로 설명한다. 하기 실시예는 본 발명의 이해를 돕기 위한 예시에 불과하며, 본 발명의 범위가 이에 한정되는 것은 아니다.
Hereinafter, the present invention will be described more specifically by way of specific examples. The following examples are provided to aid understanding of the present invention, and the scope of the present invention is not limited thereto.

[실시예 1] 재조합 미생물의 제조[Example 1] Preparation of recombinant microorganism

(1) 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)로부터 L-갈락토스 운반체 유전자는 상기 해양 미생물의 게놈 DNA를 참고하여 제한효소 KpnI과 PstI 인식부위를 포함하는, 하기와 같은 염기 서열을 가진 프라이머를 이용하여 PCR을 수행하고, p15A origin을 갖는 pHR-Tc 플라스미드 벡터에 유전자를 삽입하여 최종 pLGA1의 형태로 만들었으며, 상기 pLGA1의 형태의 플라스미드 유전자 지도는 도 3의 A에 나타내었다.
(1) The capital, Pseudoalteromonas L- galactose transporter gene from atlantica) is carried out a PCR using primers having the base sequence as described below, including a restriction enzyme Kpn I and Pst I recognition site with reference to the genomic DNA of marine bacteria, and the p15A origin The plasmid gene map in the form of pLGA1 was shown in Fig. 3 (A). The pLGA1 plasmid was inserted into the pHR-Tc plasmid vector.

프라이머 정방향: 5`- GGGGTACCATGTCAAGCGGGA -3`Primer Forward: 5`- GG GGTACC ATGTCAAGCGGGA -3`

역방향: 5`- AACTGCAGTTATCGACCATACTTATAGT -3`
Reverse direction: 5`- AA CTGCAG TTATCGACCATACTTATAGT -3`

(2) L-갈락토스를 기질로 이용하는 L-갈락토스 탈수소효소의 유전자를 클로닝하기 위해 상기 수도알트로모나스 아틀란티카의 게놈 DNA를 참고하여 정방향 프라이머의 5'에는 제한효소 BamHI을 사용하고 역방향 프라이머의 3'에는 제한효소 PstI을 사용하여 프라이머를 제작하였다.(2) In order to clone the gene of L-galactose dehydrogenase using L-galactose as a substrate, the restriction enzyme Bam HI was used for 5 'of the forward primer and the 3' of the reverse primer ', A primer was prepared using restriction enzyme Pst I.

프라이머 정방향: 5`- CGGGATCCATGAATTATAGGCAATTAG -3`Forward primer: 5`- CG GGATCC ATGAATTATAGGCAATTAG -3`

역방향: 5`- AACTGCAGTTACTATTTGTCTTGATTTTGCT -3`
Reverse direction: 5`- AA CTGCAG TTACTATTTGTCTTGATTTTGCT -3`

(3) L-갈락토노락토네이즈 유전자는 리보좀 결합부위(RBS, ribosome binding site)를 포함하였으며, 상기 수도알트로모나스 아틀란티카의 게놈 DNA를 참고하여 정방향 프라이머의 5'에는 제한효소 PstI을 사용하고, 역방향 프라이머의 3'에는 제한효소 HindIII 인식부위가 포함되도록 프라이머를 제작하였다.
(3) The L-galactonolactonase gene contained a ribosome binding site (RBS), and the restriction enzyme Pst I was used at the 5 'end of the forward primer in reference to the genomic DNA of the above-mentioned alteurononas atlantica And 3 'of the reverse primer contained a restriction enzyme Hin dIII recognition site.

프라이머 정방향: 5`- AACTGCAGTAAAAAGAGGAGAAATTAACTATGA -3`Primer Forward: 5`- AA CTGCAG TAAAAAGAGGAGAAATTAACTATGA -3`

역방향: 5`- CCCAAGCTTCTACAATCGGTAGAATC -3`
Reverse direction: 5`- CCC AAGCTT CTACAATCGGTAGAATC -3`

상기 (2) 및 (3)에서 제작한 프라이머는 PCR을 수행한 뒤, ColE1 origin을 갖는 pQE8OL 플라스미드 벡터에 유전자를 삽입하여 최종 pLGA2의 형태로 만들었으며, 상기 pLGA2의 형태의 플라스미드 유전자 지도는 도 3의 B에 나타내었다.
The primers prepared in the above (2) and (3) were subjected to PCR and inserted into a pQE8OL plasmid vector having a ColE1 origin to make a final pLGA2 form. The plasmid gene map in the form of pLGA2 is shown in FIG. 3 B of Fig.

L-갈락토스 대사관련 유전자를 포함한 두 벡터(pLGA1, pLGA2)는 에탄올 생산 대장균인 KO11에 열충격 도입방법(heat shock transformation method)을 이용하여 삽입하였다. 벡터를 도입한 재조합 대장균(SB-G1)은 앰피실린(ampicillin), 테트라사이클린(tetracycline), 클로람페니콜(chloramphenicol) 항생제가 포함된 LB배지에서 최종 선별하였다.
Two vectors (pLGA1, pLGA2) containing the L-galactose metabolism-related gene were inserted into KO11, an ethanol producing Escherichia coli, using heat shock transformation method. The recombinant Escherichia coli (SB-G1) introduced with the vector was finally selected in LB medium containing ampicillin, tetracycline, and chloramphenicol antibiotics.

[실시예 2] 홍조류의 당화과정 [Example 2] Saccharification process of red algae

(1)홍조류의 직접적 가수분해 과정(1) Direct hydrolysis process of red algae

홍조류인 참김을 60~80℃에서 1시간 동안 건조한 뒤 분쇄기로 파쇄하여 생성한 원초 분말 10g을 200 ml 증류수에 넣어 5%(w/v) 용액으로 만든 후, 0.5 M 황산을 첨가한 후 121℃ 1시간 동안 산으로 가수분해를 하고 탄산칼슘을 이용하여 중화하였다.
Red algae were dried at 60 ~ 80 ℃ for 1 hour 10 g of the ground powder obtained by crushing with a pulverizer was added to 200 ml of distilled water to make a 5% (w / v) solution. Then, 0.5 M sulfuric acid was added and the mixture was hydrolyzed with acid for 1 hour at 121 ° C., Neutralized.

(2)홍조류로부터 다당류 추출 후 가수분해 과정(2) Hydrolysis process after extracting polysaccharide from red algae

상기 원초 분말 10g을 증류수 1 L와 혼합하여 100℃에서 3시간 동안 열수 처리하였다. 열수 처리 산물이 식은 후 체와 원심분리를 이용하여 참김 잔여물을 제거하고 추출액은 동결건조를 이용하여 8배 농축하였다. 농축한 추출액에 상기 추출액의 3배 부피에 해당하는 94% 에탄올을 첨가하여 4℃에서 12시간 저어주며 포피란 성분을 침전시켰다. 이때 얻어진 침전물은 원심분리를 이용하여 회수하고 증류수에 녹여 3%(w/v) 용액으로 만든 후 0.1 M 황산을 첨가한 후 120℃ 1시간 동안 산으로 가수분해를 하고 탄산칼슘을 이용하여 중화하였다.
10 g of the ground powder was mixed with 1 L of distilled water and hydrothermally treated at 100 캜 for 3 hours. After hydrothermal treatment, the product was removed by centrifugation, and the extract was concentrated 8 times by freeze drying. To the concentrated extract, 94% ethanol corresponding to 3 times the volume of the above extract was added, and the mixture was stirred at 4 캜 for 12 hours to precipitate the forpiran component. The resulting precipitate was recovered by centrifugation, dissolved in distilled water to make 3% (w / v) solution, 0.1 M sulfuric acid was added, and hydrolyzed with acid at 120 ° C for 1 hour and neutralized with calcium carbonate .

[실시예 3] L-갈락토스 운반체 유전자 발현 및 효소 활성 확인[Example 3] Expression of L-galactose transporter gene and confirmation of enzyme activity

상기 실시예 1에서 제조한 재조합 대장균(SB-G1)을 LB 배지에 2% 접종한 후, 30℃, 150rpm에서 약 4시간 배양하고, 배양액을 600nm 파장에서 흡광도를 측정하여 O.D(Optical Density)값이 0.4 ~ 0.6이 되었을 때, 균주의 배양액을 5 g/L L-갈락토스를 포함한 LB배지로 교체하였다. 그 후, L-갈락토스 운반체 유전자와 L-갈락토스 탈수소효소, L-갈락토노락토네이즈의 발현을 유도하기 위하여, 배지에 이소프로필-β-D-티오갈락토피라노시드(Isopropyl-β-D-thiogalactopyranoside, IPTG)를 최종 농도 1mM로 첨가한 뒤, 재조합 대장균을 48시간 동안 배양하였다.
The recombinant Escherichia coli (SB-G1) prepared in Example 1 was inoculated at 2% in LB medium and cultured at 30 DEG C and 150 rpm for about 4 hours. The absorbance of the culture was measured at a wavelength of 600 nm to determine an optical density Was 0.4 to 0.6, the culture broth of the strain was replaced with LB medium containing 5 g / L of L-galactose. Then, in order to induce the expression of the L-galactose carrier gene, L-galactosse dehydrogenase and L-galactonolactonase, isopropyl-β-D-thiogalactopyranoside (Isopropyl-β-D -thiogalactopyranoside, IPTG) was added to a final concentration of 1 mM, and the recombinant E. coli was cultured for 48 hours.

단, L-갈락토스 운반체 유전자 발현 및 효소 활성을 확인하고자, IPTG 첨가 전과 첨가한 뒤 48시간 배양 후 샘플을 HPLC(High Performance Liquid Chromatography)로 분석하여 L-갈락토스 소모 양상을 그래프로 도 4에 나타내었다.
In order to confirm gene expression and enzyme activity of L-galactose transporter, the sample was analyzed by HPLC (High Performance Liquid Chromatography) before and after the addition of IPTG and the L-galactose consumption pattern is shown in FIG. 4 as a graph .

[비교예 1] 대조군의 L-갈락토스 운반체 유전자 발현 및 효소 활성 확인[Comparative Example 1] Expression of L-galactose carrier gene and activity of enzyme in the control group

상기 실시예 1과 동일한 과정으로 재조합 대장균을 제조하되, L-갈락토스 운반체 유전자를 삽입하지 않은 p15A origin을 갖는 pHR-Tc벡터와 L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈 유전자를 삽입한 pLGA2 벡터를 대장균 KO11에 열충격 방법으로 도입하여, 앰피실린, 테트라사이클린, 클로람페니콜 항생제가 포함된 LB배지에서 최종 선별하였다.
Recombinant E. coli was prepared by the same procedure as in Example 1 except that a pHR-Tc vector having a p15A origin without the L-galactosyltransfer gene inserted therein and a pLGA2 with L-galactosyl dehydrogenase and L-galactonolactonase gene inserted The vector was introduced into Escherichia coli KO11 by thermal shock method and finally selected in LB medium containing ampicillin, tetracycline and chloramphenicol antibiotics.

이 후, 제조한 재조합 대장균을 상기 실시예 3과 동일한 방법으로, LB 배지에 2% 접종한 후, 30℃, 150rpm에서 약 4시간 배양하고, 배양액을 600nm 파장에서 흡광도를 측정하여 O.D값이 0.4 ~ 0.6이 되었을 때, 균주의 배양액을 5 g/L L-갈락토스를 포함한 LB배지로 교체하였다. 그 후, L-갈락토스 탈수소효소와 L-갈락토노락토네이즈의 발현을 유도하기 위하여, 배지에 이소프로필-β-D-티오갈락토피라노시드(IPTG) 최종 농도 1 mM로 첨가한 뒤, 재조합 대장균을 48시간 동안 배양하였다.
Thereafter, the prepared recombinant E. coli was inoculated 2% in LB medium in the same manner as in Example 3, and cultured at 30 DEG C and 150 rpm for about 4 hours. The absorbance of the culture was measured at a wavelength of 600 nm, To 0.6, the culture broth of the strain was replaced with LB medium containing 5 g / L of L-galactose. Then, to induce the expression of L-galactose dehydrogenase and L-galactonolactonase, isopropyl-beta-D-thiogalactopyranoside (IPTG) was added to the medium at a final concentration of 1 mM, The recombinant E. coli was cultured for 48 hours.

단, L-갈락토스 운반체 유전자 발현 및 효소 활성을 확인하고자, IPTG 첨가 전과 첨가한 뒤 48시간 배양 후 샘플을 HPLC로 분석하여 L-갈락토스 소모 양상을 그래프로 도 4에 나타내었다.
In order to confirm the gene expression and enzyme activity of L-galactose transporter, samples were analyzed before and after the addition of IPTG for 48 hours, and L-galactose consumption patterns are shown in FIG. 4 as a graph.

도 4는 L-갈락토스 운반체의 활성을 확인한 결과로써, 도 4의 A는 비교예 1에서 L-갈락토스 운반체 유전자가 삽입되지 않은 대조군의 배양 시간에 따른 L-갈락토스 소모 양상을 그래프로 도시한 것이고, B는 실시예 3에서 L-갈락토스 운반체 유전자가 삽입된 재조합미생물의 배양시간에 따른 L-갈락토스 소모양상을 그래프로 도시한 것이다. 도 4의 B에 따르면, 실시예 3의 재조합 대장균의 경우, 초기 5 g/L의 L-갈락토스가 모두 소모한 것을 알 수 있으나, 도 4의 A에 따르면 비교예 1의 대조군은 초기 5g/L의 L-갈락토스 중 0.56g/L의 L-갈락토스만을 소모하고 4.44 g/L의 기질이 그대로 남아있는 것을 볼 수 있었다.
FIG. 4 is a graph showing the activity of L-galactose transporter. FIG. 4A is a graph showing the L-galactose consumption pattern of the control group in which the L-galactose transporter gene was not inserted in Comparative Example 1, B is a graph showing the L-galactose consumption pattern of the recombinant microorganism into which L-galactose transporter gene is inserted according to the culturing time in Example 3. Fig. 4B, it can be seen that the initial 5 g / L of L-galactose was consumed in the case of the recombinant E. coli of Example 3. However, according to A of FIG. 4, the control of Comparative Example 1 contained an initial 5 g / L Of L-galactose consumed only 0.56 g / L of L-galactose and the substrate of 4.44 g / L remained intact.

이러한 결과를 통하여 실시예 1의 재조합 대장균에 도입된 L-갈락토스 운반체 유전자가 활성을 가지며, 그에 따라 발현된 L-갈락토스 운반체가 활성을 나타내어, 상기 재조합 대장균이 배지 내 포함된 L-갈락토스를 모두 사용할 수 있는 것을 알 수 있었다. 그러나, 비교예 1의 대조군의 경우, L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈 유전자는 도입되었으나, L-갈락토스 운반체 유전자가 도입되지 않아, L-갈락토스 운반체가 발현되지 않았으며, 따라서 배지 내에 포함된 L-갈락토스를 거의 이용하지 못한 것을 알 수 있다.
From these results, it can be seen that the L-galactose carrier gene introduced into the recombinant E. coli of Example 1 is active, and thus the expressed L-galactose carrier is active, and the recombinant Escherichia coli can utilize all of the L- I could see that I could. However, in the control group of Comparative Example 1, the L-galactosse dehydrogenase and the L-galactonolactonase gene were introduced, but the L-galactose carrier gene was not introduced and the L-galactose carrier was not expressed. Galactose < / RTI > contained in the < RTI ID = 0.0 >

[실시예 4] L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈 유전자 발현 확인[Example 4] Confirmation of L-galactosse dehydrogenase and L-galactonolactonase gene expression

상기 실시예 1에서 제조한 재조합 대장균을 앰피실린(100μg/ml)이 첨가된 10ml의 LB배지에 2% 접종한 뒤, 하룻밤 동안 액체 배양하였고, 이 배양물을 1 L의 LB배지에 2% 접종하여, 1L 규모에서 배양을 수행하였다. 그 후, O.D600 값이 0.4 ~ 0.6 사이가 될 때까지 재조합 대장균을 배양한 후, IPTG를 최종 농도가 0.5 mM이 되도록 첨가하고, 25℃에서 8시간 동안 배양한 후 5000rpm의 원심 분리를 20분 동안 수행하여 대장균을 수확하였다.
The recombinant E. coli prepared in Example 1 was inoculated 2% in 10 ml of LB medium supplemented with ampicillin (100 μg / ml), then cultured overnight, and the culture was inoculated 2% in 1 L of LB medium And cultured at a 1-L scale. Thereafter, OD 600 After culturing the recombinant E. coli until the value became between 0.4 and 0.6, IPTG was added to a final concentration of 0.5 mM, cultured at 25 ° C. for 8 hours, and centrifuged at 5000 rpm for 20 minutes to obtain E. coli And harvested.

수확한 대장균은 30ml의 완충용액에 넣어 10분씩 2회 초음파처리를 하여 세포를 파쇄하였고, 세포 파쇄물을 4℃의 온도 조건에서 1시간 동안 13,000rpm으로 원심 분리하였다. 원심 분리 후 얻은 상등액을 Ni-NTA 컬럼을 이용해 이미다졸의 농도를 높여 His-tag이 달린 효소를 용출시켜 정제하였다. 이 후, 정제된 효소는 황산도데실나트륨 폴리아크릴아미드 겔 전기영동법 (sodium dodecyl sulfate polyacrylamide gel electrophoresis)를 수행한 결과, 예상된 분자량의 L-갈락토스 탈수소효소(34 kDa) 및 L-갈락토노락토네이즈(32 kDa)가 생성됨을 확인할 수 있었다.
The harvested Escherichia coli was inoculated into 30 ml of buffer solution and sonicated twice for 10 minutes to disrupt the cells. Cell lysates were centrifuged at 13,000 rpm for 1 hour at 4 ° C. The supernatant obtained after centrifugation was purified by eluting the His-tagged enzyme by increasing the concentration of imidazole using a Ni-NTA column. Then, the purified enzyme was subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis. As a result, the expected molecular weight of L-galactose dehydrogenase (34 kDa) and L-galactonolactose It was confirmed that Nath (32 kDa) was generated.

[실시예 5] L-갈락토스 탈수소효소의 기질에 따른 효소 활성 확인[Example 5] Determination of enzyme activity of L-galactose dehydrogenase by substrate

반응 조건으로 25℃, pH 8.0에서, 상기 실시예 2에서 참김을 당화시켜 얻은 L-갈락토스 0.2mM과 NAD(P)+ 조효소 0.2mM을 혼합한 용액에 상기 실시예 4에서 얻어진 L-갈락토스 탈수소효소를 100?/ml의 농도로 첨가하였고, L-갈락토스 탈수소효소의 활성을 확인하기 위하여, 상기 효소를 첨가하기 전과 후의 O.D(Optical Density)값을 340nm에서 UV 분광광도계(UV spectrophotometer)를 이용하여 측정하여 그 결과를 도 5에 그래프로 나타내었다.
Galactose dehydrogenase (L-galactose dehydrogenase) obtained in Example 4 was added to a solution obtained by mixing 0.2 mM of L-galactose and 0.2 mM of NAD (P) + coenzyme obtained by saccharifying the seedlings in Example 2 at 25 DEG C and pH 8.0 Was added at a concentration of 100? / Ml. In order to confirm the activity of L-galactose dehydrogenase, OD (Optical Density) value before and after the addition of the enzyme was measured using a UV spectrophotometer at 340 nm And the results are shown graphically in Fig.

[비교예 2] 대조군[Comparative Example 2]

상기 실시예 5와 동일한 방법으로 수행하되, 기질로 L-갈락토스가 아닌 D-갈락토스를 사용하여 L-갈락토스 탈수소효소의 활성을 확인하여 그 결과를 도 5에 그래프로 나타내었다.
The activity of L-galactose dehydrogenase was confirmed using D-galactose, which is not L-galactose as a substrate, in the same manner as in Example 5, and the results are shown graphically in FIG.

즉, 도 5는 실시예 4 및 비교예 2에서 기질에 따른 L-갈락토스 탈수소효소의 활성을 UV 분광광도계의 흡광도 변화로 그래프로 도시한 것으로, L-갈락토스 탈수소효소의 활성은 첨가되는 조효소인 NAD(P)+로부터 만들어지는 NAD(P)H가 빛을 흡수하는 원리를 이용하여 UV 분광광도계(UV spectrophotometer)를 이용하여 확인할 수 있었다. 도 5에 따르면, 기질로 L-갈락토스를 사용한 실시예 4의 경우, 효소를 첨가하기 전과 후의 O.D값의 차이는 0.396인 반면, 기질로 D-갈락토스를 사용한 비교예 2의 경우, 효소 첨가 유무와 관계 없이 O.D값의 변화가 없는 것을 알 수 있다. 따라서, L-갈락토스 탈수소효소는 L-갈락토스에만 효소 활성을 보이는 것을 알 수 있다.
That is, FIG. 5 is a graph showing the activity of L-galactose dehydrogenase according to the substrate in Example 4 and Comparative Example 2 as a change in absorbance of a UV spectrophotometer. The activity of L-galactose dehydrogenase, (P) H produced from (P) + could be confirmed by UV spectrophotometer using the principle of absorbing light. 5, in Example 4 using L-galactose as a substrate, the difference in OD value before and after the addition of the enzyme was 0.396, while in the case of Comparative Example 2 using D-galactose as the substrate, It can be seen that there is no change in the OD value regardless of the difference. Therefore, it can be seen that L-galactose dehydrogenase exhibits enzyme activity only in L-galactose.

[실시예 6] L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈 활성 확인[Example 6] Confirmation of L-galactose dehydrogenase and L-galactonolactonase activity

(1) L-갈락토스 탈수소효소 활성 확인(1) Identification of L-galactose dehydrogenase activity

반응 조건으로 25℃, pH 8.0에서, 상기 실시예 2에서 참김을 당화시켜 얻은 L-갈락토스 10mM과 NAD(P)+ 조효소 15mM을 혼합한 용액에 상기 실시예 4에서 얻어진 L-갈락토스 탈수소효소를 100?/ml의 농도로 첨가하였고, L-갈락토스 탈수소효소 반응 결과 기질의 감소 및 생생물의 증가를 확인하기 위하여 반응 전, 후의 샘플을 HPLC로 확인하여 그 결과를 도 6의 A 및 B에 그래프로 나타내었다.
The L-galactose dehydrogenase obtained in Example 4 was added to a solution of 10 mM of L-galactose obtained in Example 2 and 15 mM of NAD (P) + coenzyme at 25 ° C and pH 8.0 under the reaction conditions, / ml. To confirm the reduction of the substrate and the increase of the viable product as a result of the L-galactose dehydrogenase reaction, the samples before and after the reaction were confirmed by HPLC. The results are shown in the graphs of A and B of FIG. 6 .

(2) L-갈락토노락토네이즈 활성 확인(2) Confirming L-galactonolactonase activity

반응 조건으로 25℃, pH 8.0에서, 상기 실시예 6의 (1)에서 L-갈락토스 탈수소효소의 작용으로 얻어진 L-갈락토노-1,4-락톤 10mM를 함유한 용액에 상기 실시예 4에서 얻어진 L-갈락토노락토네이즈를 100?/ml의 농도로 첨가한 뒤, 첨가한 효소가 충분히 반응이 일어날 수 있도록 3시간 동안 방치한 뒤, L-갈락토노락토네이즈의 반응 결과 기질의 감소 및 생생물의 증가를 확인하기 위하여 반응 후의 샘플을 HPLC로 확인하여 그 결과를 도 6의 C에 그래프로 나타내었다.
As a reaction condition, a solution containing 10 mM of L-galacto-1,4-lactone obtained by the action of L-galactose dehydrogenase in (1) of Example 6 at 25 ° C, The resulting L-galactonolactonase was added at a concentration of 100 < [deg.] '≫ / ml, and the resulting enzyme was allowed to react for 3 hours so that the reaction could sufficiently take place. And the sample after the reaction was confirmed by HPLC to confirm the increase of the fresh water, and the result is shown graphically in Fig. 6C.

도 6은 L-갈락토스 탈수소효소 및 L-갈락토노락토네이즈의 L-갈락토스 및 L-갈락토노-1,4-락톤 각각에 대한 효소 활성을 확인한 결과로써, 도 6의 A는 L-갈락토스 탈수소효소 첨가 전 샘플을, B는 L-갈락토스 탈수소효소 첨가 후 샘플을, C는 L-갈락토노락토네이즈 첨가 후 샘플을 HLPC로 분석한 결과를 그래프로 도시한 것이고, a, b 및 c의 선은 각각 L-갈락토네이트, L-갈락토노-1,4-락톤, L-갈락토스를 나타내며 피크의 높이 변화는 각 성분의 농도 변화를 의미하는 것이다.
6 is a result of confirming the enzymatic activities of L-galactose dehydrogenase and L-galactonolactonase to L-galactose and L-galactono-1,4-lactone, respectively. Galactose dehydrogenase, C shows the result of analysis of the sample after L-galactonolactonase addition by HLPC, and a, b and c show the results Galactonate, L-galactono-1,4-lactone and L-galactose, respectively, and the peak height change means the concentration change of each component.

도 6에 따르면, L-갈락토스 탈수소효소를 첨가하기 전(A)과 후(B)를 비교해 볼 때, c축에 대응하는 y값이 A 보다 B에서 감소한 것을 볼 수 있고, b축에 대응하는 y값은 A 보다 B에서 증가한 것을 볼 수 있다. 따라서, L-갈락토스 탈수소효소를 첨가 시, L-갈락토스가 감소하고, L-갈락토노-1,4-락톤이 생성됨을 알 수 있어, L-갈락토스 탈수소효소의 활성을 확인할 수 있었다.
According to Fig. 6, when comparing (A) and (B) before adding L-galactose dehydrogenase, it can be seen that the y value corresponding to the c axis decreases from B to A, It can be seen that the y value increases from B to A. Therefore, when L-galactose dehydrogenase was added, it was found that L-galactose decreased and L-galactono-1,4-lactone was produced, thus confirming the activity of L-galactose dehydrogenase.

또한, L-갈락토노락토네이즈를 첨가하기 전(B)과 후(C)를 비교해 볼 때, b축에 대응하는 y값이 B 보다 C에서 감소한 것을 볼 수 있고, c축에 대응하는 y값은 B 보다 C에서 증가한 것을 볼 수 있다. 따라서, L-갈락토노락토네이즈를 첨가 시, L-갈락토노-1,4-락톤이 감소하고, L-갈락토네이트가 생성됨을 알 수 있어, L-갈락토노락토네이즈의 활성을 확인할 수 있었다.
Further, when comparing (B) and (C) before adding L-galactonolactonase, it can be seen that the y value corresponding to the b axis decreases from C to B, and y The value increases from C to B. Therefore, it was found that, when L-galactonolactonose was added, L-galactono-1,4-lactone decreased and L-galactonate was produced. Thus, the activity of L-galactonolactonase I could confirm.

[실시예 7] 재조합 미생물의 에탄올 생성능 확인[Example 7] Confirmation of ethanol production ability of recombinant microorganism

상기 실시예 1에서 제조한 재조합 대장균(SB-G1)을 LB 배지 10ml에 2% 접종한 후, 30℃, 150rpm에서 약 4시간 배양하고, 배양액을 600nm 파장에서 흡광도를 측정하여 0.4 ~ 0.6이 되었을 때, 균주의 배양액을 상기 실시예 2에서 참김으로부터 얻은 당화물(갈락토스 총량 8.1g/L, L-갈락토스 함량 45%)이 포함된 LB배지로 교체한 뒤, 0.5mM 이소프로필-β-D-티오갈락토피라노시드(IPTG)를 이용하여 L-갈락토스 대사관련 유전자의 발현을 유도하고, 30℃, 150rpm에서 약 3일 동안 배양하여 얻은 발효배양액의 L-갈락토스 농도 및 생성된 에탄올 농도 변화를 하기 표 1에 나타내었다.
The recombinant Escherichia coli (SB-G1) prepared in Example 1 was inoculated at 2% in 10 ml of LB medium, followed by incubation at 30 ° C and 150 rpm for about 4 hours. The absorbance of the culture was measured at a wavelength of 600 nm, when, replacing the culture medium of the strain in the second embodiment LB medium containing oxides (galactose total 8.1g / L, L- galactose content 45%) obtained from sugar pyropia tenera from behind, 0.5mM isopropyl -β-D- The expression of L-galactose metabolism-related gene was induced by thiogalactopyranoside (IPTG), and the L-galactose concentration and the ethanol concentration change of the fermentation broth obtained by culturing at 30 ° C. and 150 rpm for about 3 days The results are shown in Table 1 below.

[비교예 3] 대조군[Comparative Example 3]

상기 실시예 7에서 재조합 대장균 대신에 유전자 재조합을 수행하지 않은대장균 KO11을 이용하여 실시예 7과 동일한 방법으로 대장균의 에탄올 생성능을 확인하였고, 그 결과를 하기 표 1에 나타내었다.
The ethanol production ability of E. coli was confirmed in the same manner as in Example 7 by using E. coli KO11 which was not subjected to genetic recombination in place of the recombinant E. coli in Example 7, and the results are shown in Table 1 below.

비교예 3Comparative Example 3 실시예 7Example 7 초기 갈락토스 농도Initial galactose concentration 8.1g/L8.1 g / L 8.1g/L8.1 g / L 소모된 갈락토스 농도Consumed galactose concentration 4.8g/L4.8 g / L 7.6g/L7.6 g / L 생산된 에탄올 농도Produced ethanol concentration 1.5g/L1.5 g / L 3.0g/L3.0 g / L

상기 표 1에서 볼 수 있는 바와 같이, 3일 경과 시 실시예 7의 재조합 대장균은 D-갈락토스와 L-갈락토스를 모두 이용하여 초기 갈락토스 농도 대비를 94%인 7.6 g/L 소모하여 3.0 g/L 에탄올을 생산하였다. 반면, 비교예 3의 대조군은 D-갈락토스 만을 소모하고 L-갈락토스는 소모하지 못하여 4.8 g/L의 갈락토스만을 소모하였으며 이를 이용하여 1.5 g/L의 에탄올을 생산하였다. 따라서, 에탄올 생산능에 있어서, 본 발명의 L-갈락토스 대사능을 가진 재조합 미생물의 바이오 에탄올 생산량이 대조군 대비 2배 향상된 것을 확인할 수 있었다.
As can be seen from the above Table 1, the recombinant E. coli of Example 7 consumed 7.6 g / L of the initial galactose concentration of 94% and 3.0 g / L of the initial galactose concentration using both D-galactose and L- Ethanol. On the other hand, the control group of Comparative Example 3 consumed only 4.8 g / L of galactose, consuming only D-galactose but not consuming L-galactose, and using this, 1.5 g / L of ethanol was produced. Therefore, it was confirmed that the production of bio-ethanol of the recombinant microorganism having L-galactose metabolism ability of the present invention was 2-fold higher than that of the control group in ethanol production ability.

이상에서 본 발명의 실시예에 대하여 상세하게 설명하였지만 본 발명의 권리범위는 이에 한정되는 것은 아니고, 청구범위에 기재된 본 발명의 기술적 사상을 벗어나지 않는 범위 내에서 다양한 수정 및 변형이 가능하다는 것은 당 기술분야의 통상의 지식을 가진 자에게는 자명할 것이다.
While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, It will be obvious to those of ordinary skill in the art.

미생물자원센터(KCTC)Microbial Resource Center (KCTC) KCTC12460BPKCTC12460BP 2013073120130731

<110> POSCO POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof <130> DPP131107 <160> 6 <170> KopatentIn 2.0 <210> 1 <211> 1425 <212> DNA <213> Pseudoalteromonas atlantica <400> 1 atgtcaagcg ggatggagca gacagccgaa gcggtatcag tacagaaaaa ccaggggagc 60 aaaccccaaa tattagaagc aaaatatatt gtcccattcc tgttggttgc ctcgctattt 120 ccgttatggg gctttgcaaa tgacgtgact aacccattag taaaagcgtt caaagatatt 180 ttcatgattt ctaacgcgca aagtagtttg gtgcaatttg ccttctactt gggctacgga 240 gtgatggcaa tacctgcggc aatttttatt cgtcgattct catataaatc cggtattttg 300 ctcggcttag ggttatacgc cattggcgct agtctcttta tacccgcatc gatatacatg 360 gagttttctt actttttagc ggcattgtgg atcttaacat gcggtttggc gttactagaa 420 acaacggcca atccttacgt gttgtctatg ggacatcccg atacatcgac tcagcgtttg 480 aacttggctc aagcgtttaa tcctatcggc tcattaacag gtatgttcgt cgccagtagc 540 tatattctta gtgagctacg ggttgaagct tttagagagc aagaaaaagc cgctcaccca 600 gagtatgcgc aaatgttgcc atcagaggtc gacggcaagt taaccaatgc attatatgac 660 tttgcgcaaa acaatccggt agagcatcag gcgatgcaag cggctgatct cattactgtt 720 cgtgggccgt atgtggctat tgcagttgtg gttgcgattg tgttctttgt atttctacta 780 agtaaattgc ctaaaaccat ggcgcatgcg acgcccttaa ccacgtctga attaaagaac 840 acatttcagc gcttatttgc caacaaatgt tatttagagg gcgtgatcgc gcaagctttc 900 tatgttgggg cacaaatcat gtgctggacg ttcgttattc attacggcat gacatcagta 960 gggctaagtg cctctgaagc acaaagctat aacatggtgg ccatgggaat atttttggct 1020 agccgcttta tatgtacatt tttactcggt ttctttaggc ccgggcagct gttgatgttg 1080 cttgctttag gtgggtttgt tttgtcccta gggactatct tcgtcggagg gtacacaggg 1140 ttgtactgct taattgctac ctcagcgtgc atgtcgttaa tgttcccaac catttacggt 1200 attgcgctca aaggaatggg cgaagatgct agcctagcgt cggctggttt agtgatggca 1260 atagtcggtg gggcgcttat gcctcccatc caaggctcta tgattgatgg cgctgcgctt 1320 atcgacggca tcccgtcagt gcaaacgtca ttcgtgctgc cgctcatttg ctttgcaatg 1380 atatgcctgt acggatatcg cgctcactat aagtatggtc gataa 1425 <210> 2 <211> 474 <212> PRT <213> Pseudoalteromonas atlantica <400> 2 Met Ser Ser Gly Met Glu Gln Thr Ala Glu Ala Val Ser Val Gln Lys 1 5 10 15 Asn Gln Gly Ser Lys Pro Gln Ile Leu Glu Ala Lys Tyr Ile Val Pro 20 25 30 Phe Leu Leu Val Ala Ser Leu Phe Pro Leu Trp Gly Phe Ala Asn Asp 35 40 45 Val Thr Asn Pro Leu Val Lys Ala Phe Lys Asp Ile Phe Met Ile Ser 50 55 60 Asn Ala Gln Ser Ser Leu Val Gln Phe Ala Phe Tyr Leu Gly Tyr Gly 65 70 75 80 Val Met Ala Ile Pro Ala Ala Ile Phe Ile Arg Arg Phe Ser Tyr Lys 85 90 95 Ser Gly Ile Leu Leu Gly Leu Gly Leu Tyr Ala Ile Gly Ala Ser Leu 100 105 110 Phe Ile Pro Ala Ser Ile Tyr Met Glu Phe Ser Tyr Phe Leu Ala Ala 115 120 125 Leu Trp Ile Leu Thr Cys Gly Leu Ala Leu Leu Glu Thr Thr Ala Asn 130 135 140 Pro Tyr Val Leu Ser Met Gly His Pro Asp Thr Ser Thr Gln Arg Leu 145 150 155 160 Asn Leu Ala Gln Ala Phe Asn Pro Ile Gly Ser Leu Thr Gly Met Phe 165 170 175 Val Ala Ser Ser Tyr Ile Leu Ser Glu Leu Arg Val Glu Ala Phe Arg 180 185 190 Glu Gln Glu Lys Ala Ala His Pro Glu Tyr Ala Gln Met Leu Pro Ser 195 200 205 Glu Val Asp Gly Lys Leu Thr Asn Ala Leu Tyr Asp Phe Ala Gln Asn 210 215 220 Asn Pro Val Glu His Gln Ala Met Gln Ala Ala Asp Leu Ile Thr Val 225 230 235 240 Arg Gly Pro Tyr Val Ala Ile Ala Val Val Val Ala Ile Val Phe Phe 245 250 255 Val Phe Leu Leu Ser Lys Leu Pro Lys Thr Met Ala His Ala Thr Pro 260 265 270 Leu Thr Thr Ser Glu Leu Lys Asn Thr Phe Gln Arg Leu Phe Ala Asn 275 280 285 Lys Cys Tyr Leu Glu Gly Val Ile Ala Gln Ala Phe Tyr Val Gly Ala 290 295 300 Gln Ile Met Cys Trp Thr Phe Val Ile His Tyr Gly Met Thr Ser Val 305 310 315 320 Gly Leu Ser Ala Ser Glu Ala Gln Ser Tyr Asn Met Val Ala Met Gly 325 330 335 Ile Phe Leu Ala Ser Arg Phe Ile Cys Thr Phe Leu Leu Gly Phe Phe 340 345 350 Arg Pro Gly Gln Leu Leu Met Leu Leu Ala Leu Gly Gly Phe Val Leu 355 360 365 Ser Leu Gly Thr Ile Phe Val Gly Gly Tyr Thr Gly Leu Tyr Cys Leu 370 375 380 Ile Ala Thr Ser Ala Cys Met Ser Leu Met Phe Pro Thr Ile Tyr Gly 385 390 395 400 Ile Ala Leu Lys Gly Met Gly Glu Asp Ala Ser Leu Ala Ser Ala Gly 405 410 415 Leu Val Met Ala Ile Val Gly Gly Ala Leu Met Pro Pro Ile Gln Gly 420 425 430 Ser Met Ile Asp Gly Ala Ala Leu Ile Asp Gly Ile Pro Ser Val Gln 435 440 445 Thr Ser Phe Val Leu Pro Leu Ile Cys Phe Ala Met Ile Cys Leu Tyr 450 455 460 Gly Tyr Arg Ala His Tyr Lys Tyr Gly Arg 465 470 <210> 3 <211> 939 <212> DNA <213> Pseudoalteromonas atlantica <400> 3 atgaattata ggcaattagg caagacagat cttaagctat cacaagttag ttacggtgcg 60 tcaccgctag gcagtgtttt tagaaatatc agcgagcaag aaggcataaa gacagtccac 120 accgcgttag acttaggaat aaactacctt gatgtatcac cttattacgg tgacacagta 180 gcggaaacag tactgggtaa agcattaaaa ggcattcctc gagatcagta tattttgtcg 240 actaaagcag ggcgttacgg ggcggatttt gctgattttg atttttctgc gaagcgaatt 300 gaagcaagcc ttgatgaaag ctgttcccgc ttaggcgtta acgaagttga tatcttgttt 360 ttacatgata ttgagtttgc tgatatgcgc caagtgctgc aagagagtat tccttgtcta 420 ttagccctca agaaggcagg taaaatacgt tacgcagggg tgaccggata tccattaaag 480 gtattcagtg aggtcatcag ccaatatgag attgattgta ttttgaccta ctgtcgctat 540 gccttgtacg acaactcatt ggcagagatt atcccaacat tagatgaagc gtcggttggt 600 attatcaacg cctcacctac tggtatggga ttgctgaccg aacggggcgc gcctcagtgg 660 caccctggaa gtgagcagct caaacaagcg agtctaaaag cggtcagtct ttgtcagtct 720 aaaggaatag acattactgc cttggctttg caatttgcga ttgaccaccc atctattgcc 780 tccactttgg ttggcacagc gaaccccgca aatatcgtaa aaaatgtaga atgggcttca 840 gctcaacctg atgcatcttt ggtgagtgaa attcaacaga tttttgccaa tgttccatgt 900 acatggccat caggctacga gcaaaatcaa gacaaatag 939 <210> 4 <211> 312 <212> PRT <213> Pseudoalteromonas atlantica <400> 4 Met Asn Tyr Arg Gln Leu Gly Lys Thr Asp Leu Lys Leu Ser Gln Val 1 5 10 15 Ser Tyr Gly Ala Ser Pro Leu Gly Ser Val Phe Arg Asn Ile Ser Glu 20 25 30 Gln Glu Gly Ile Lys Thr Val His Thr Ala Leu Asp Leu Gly Ile Asn 35 40 45 Tyr Leu Asp Val Ser Pro Tyr Tyr Gly Asp Thr Val Ala Glu Thr Val 50 55 60 Leu Gly Lys Ala Leu Lys Gly Ile Pro Arg Asp Gln Tyr Ile Leu Ser 65 70 75 80 Thr Lys Ala Gly Arg Tyr Gly Ala Asp Phe Ala Asp Phe Asp Phe Ser 85 90 95 Ala Lys Arg Ile Glu Ala Ser Leu Asp Glu Ser Cys Ser Arg Leu Gly 100 105 110 Val Asn Glu Val Asp Ile Leu Phe Leu His Asp Ile Glu Phe Ala Asp 115 120 125 Met Arg Gln Val Leu Gln Glu Ser Ile Pro Cys Leu Leu Ala Leu Lys 130 135 140 Lys Ala Gly Lys Ile Arg Tyr Ala Gly Val Thr Gly Tyr Pro Leu Lys 145 150 155 160 Val Phe Ser Glu Val Ile Ser Gln Tyr Glu Ile Asp Cys Ile Leu Thr 165 170 175 Tyr Cys Arg Tyr Ala Leu Tyr Asp Asn Ser Leu Ala Glu Ile Ile Pro 180 185 190 Thr Leu Asp Glu Ala Ser Val Gly Ile Ile Asn Ala Ser Pro Thr Gly 195 200 205 Met Gly Leu Leu Thr Glu Arg Gly Ala Pro Gln Trp His Pro Gly Ser 210 215 220 Glu Gln Leu Lys Gln Ala Ser Leu Lys Ala Val Ser Leu Cys Gln Ser 225 230 235 240 Lys Gly Ile Asp Ile Thr Ala Leu Ala Leu Gln Phe Ala Ile Asp His 245 250 255 Pro Ser Ile Ala Ser Thr Leu Val Gly Thr Ala Asn Pro Ala Asn Ile 260 265 270 Val Lys Asn Val Glu Trp Ala Ser Ala Gln Pro Asp Ala Ser Leu Val 275 280 285 Ser Glu Ile Gln Gln Ile Phe Ala Asn Val Pro Cys Thr Trp Pro Ser 290 295 300 Gly Tyr Glu Gln Asn Gln Asp Lys 305 310 <210> 5 <211> 831 <212> DNA <213> Pseudoalteromonas atlantica <400> 5 atgagaattg atgcacacca acatttttgg gcgtacaacc ctgaagagtt tgattggata 60 ggcgaagatg agggtgtttt aaagcgcgat tattttcctc cggcactaga agcagaagct 120 ggggccaatg gggttgatgg cactgtggtt gttcaagccc gtcaatctat tgaggaaacg 180 cagtggttgc tgtctctcgc tcaacagttt ccactaatca agggcgttgt tggttgggtt 240 gacttaatga acccgagctt agagcaacag cttttaagct ggcaaaacga gcaggtcctg 300 aaggggtttc ggcatgtgct tcaaggtgag cccgatccga actttatgct acaacctcgc 360 tttgtcgaag gtttgaaatt gttgcatcaa tttgactata cctatgactt actgattttc 420 gccgctcagt taccccaagc gcgtcagctt ttagatacct taccccagca caggatcgtt 480 atcgatcaca ttgccaaacc tgatattgct tcaggtgaag gtttcgccca gtggaaagcg 540 cacatgcagg ccattgctga acaccaaaat gtgtattgta agatttccgg catggtcacc 600 gaggctagcc acaaagactg gcaagaagct gatttcatcc cctatatgga tgtggtgttt 660 tccgcctttg gccctgaaag agtcatgttc ggttcagact ggccagtgtg ccaactcgca 720 gcgacgtacc cagaagtaat acagatcgtt gaacgatatg tcacccgtct gtacccagaa 780 ttttcgcagc atgtatttgg cttaaatgcc gaacgattct accgattgta g 831 <210> 6 <211> 276 <212> PRT <213> Pseudoalteromonas atlantica <400> 6 Met Arg Ile Asp Ala His Gln His Phe Trp Ala Tyr Asn Pro Glu Glu 1 5 10 15 Phe Asp Trp Ile Gly Glu Asp Glu Gly Val Leu Lys Arg Asp Tyr Phe 20 25 30 Pro Pro Ala Leu Glu Ala Glu Ala Gly Ala Asn Gly Val Asp Gly Thr 35 40 45 Val Val Val Gln Ala Arg Gln Ser Ile Glu Glu Thr Gln Trp Leu Leu 50 55 60 Ser Leu Ala Gln Gln Phe Pro Leu Ile Lys Gly Val Val Gly Trp Val 65 70 75 80 Asp Leu Met Asn Pro Ser Leu Glu Gln Gln Leu Leu Ser Trp Gln Asn 85 90 95 Glu Gln Val Leu Lys Gly Phe Arg His Val Leu Gln Gly Glu Pro Asp 100 105 110 Pro Asn Phe Met Leu Gln Pro Arg Phe Val Glu Gly Leu Lys Leu Leu 115 120 125 His Gln Phe Asp Tyr Thr Tyr Asp Leu Leu Ile Phe Ala Ala Gln Leu 130 135 140 Pro Gln Ala Arg Gln Leu Leu Asp Thr Leu Pro Gln His Arg Ile Val 145 150 155 160 Ile Asp His Ile Ala Lys Pro Asp Ile Ala Ser Gly Glu Gly Phe Ala 165 170 175 Gln Trp Lys Ala His Met Gln Ala Ile Ala Glu His Gln Asn Val Tyr 180 185 190 Cys Lys Ile Ser Gly Met Val Thr Glu Ala Ser His Lys Asp Trp Gln 195 200 205 Glu Ala Asp Phe Ile Pro Tyr Met Asp Val Val Phe Ser Ala Phe Gly 210 215 220 Pro Glu Arg Val Met Phe Gly Ser Asp Trp Pro Val Cys Gln Leu Ala 225 230 235 240 Ala Thr Tyr Pro Glu Val Ile Gln Ile Val Glu Arg Tyr Val Thr Arg 245 250 255 Leu Tyr Pro Glu Phe Ser Gln His Val Phe Gly Leu Asn Ala Glu Arg 260 265 270 Phe Tyr Arg Leu 275 <110> POSCO          POSTECH ACADEMY-INDUSTRY FOUNDATION <120> Recombinant microorganism having ability to metabolize          L-galactose and the method for producing bioethanol from          L-galactose-containing biomass using it <130> DPP131107 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 1425 <212> DNA <213> Pseudoalteromonas atlantica <400> 1 atgtcaagcg ggatggagca gacagccgaa gcggtatcag tacagaaaaa ccaggggagc 60 aaaccccaaa tattagaagc aaaatatatt gtcccattcc tgttggttgc ctcgctattt 120 ccgttatggg gctttgcaaa tgacgtgact aacccattag taaaagcgtt caaagatatt 180 ttcatgattt ctaacgcgca aagtagtttg gtgcaatttg ccttctactt gggctacgga 240 gtgatggcaa tacctgcggc aatttttatt cgtcgattct catataaatc cggtattttg 300 ctcggcttag ggttatacgc cattggcgct agtctcttta tacccgcatc gatatacatg 360 gagttttctt actttttagc ggcattgtgg atcttaacat gcggtttggc gttactagaa 420 acaacggcca atccttacgt gttgtctatg ggacatcccg atacatcgac tcagcgtttg 480 aacttggctc aagcgtttaa tcctatcggc tcattaacag gtatgttcgt cgccagtagc 540 tatattctta gtgagctacg ggttgaagct tttagagagc aagaaaaagc cgctcaccca 600 gagtatgcgc aaatgttgcc atcagaggtc gacggcaagt taaccaatgc attatatgac 660 tttgcgcaaa acaatccggt agagcatcag gcgatgcaag cggctgatct cattactgtt 720 cgtgggccgt atgtggctat tgcagttgtg gttgcgattg tgttctttgt atttctacta 780 agtaaattgc ctaaaaccat ggcgcatgcg acgcccttaa ccacgtctga attaaagaac 840 acatttcagc gcttatttgc caacaaatgt tatttagagg gcgtgatcgc gcaagctttc 900 tatgttgggg cacaaatcat gtgctggacg ttcgttattc attacggcat gacatcagta 960 gggctaagtg cctctgaagc acaaagctat aacatggtgg ccatgggaat atttttggct 1020 agccgcttta tatgtacatt tttactcggt ttctttaggc ccgggcagct gttgatgttg 1080 cttgctttag gtgggtttgt tttgtcccta gggactatct tcgtcggagg gtacacaggg 1140 ttgtactgct taattgctac ctcagcgtgc atgtcgttaa tgttcccaac catttacggt 1200 attgcgctca aaggaatggg cgaagatgct agcctagcgt cggctggttt agtgatggca 1260 atagtcggtg gggcgcttat gcctcccatc caaggctcta tgattgatgg cgctgcgctt 1320 atcgacggca tcccgtcagt gcaaacgtca ttcgtgctgc cgctcatttg ctttgcaatg 1380 atatgcctgt acggatatcg cgctcactat aagtatggtc gataa 1425 <210> 2 <211> 474 <212> PRT <213> Pseudoalteromonas atlantica <400> 2 Met Ser Ser Gly Met Glu Gln Thr Ala Glu Ala Val Ser Val Gln Lys   1 5 10 15 Asn Gln Gly Ser Lys Pro Gln Ile Leu Glu Ala Lys Tyr Ile Val Pro              20 25 30 Phe Leu Leu Val Ala Ser Leu Phe Pro Leu Trp Gly Phe Ala Asn Asp          35 40 45 Val Thr Asn Pro Leu Val Lys Ala Phe Lys Asp Ile Phe Met Ile Ser      50 55 60 Asn Ala Gln Ser Ser Leu Val Gln Phe Ala Phe Tyr Leu Gly Tyr Gly  65 70 75 80 Val Met Ala Ile Pro Ala Ala Ile Phe Ile Arg Arg Phe Ser Tyr Lys                  85 90 95 Ser Gly Ile Leu Leu Gly Leu Gly Leu Tyr Ala Ile Gly Ala Ser Leu             100 105 110 Phe Ile Pro Ala Ser Ile Tyr Met Glu Phe Ser Tyr Phe Leu Ala Ala         115 120 125 Leu Trp Ile Leu Thr Cys Gly Leu Ala Leu Leu Glu Thr Thr Ala Asn     130 135 140 Pro Tyr Val Leu Ser Met Gly His Pro Asp Thr Ser Thr Gln Arg Leu 145 150 155 160 Asn Leu Ala Gln Ala Phe Asn Pro Ile Gly Ser Leu Thr Gly Met Phe                 165 170 175 Val Ala Ser Ser Tyr Ile Leu Ser Glu Leu Arg Val Glu Ala Phe Arg             180 185 190 Glu Gln Glu Lys Ala Ala His Pro Glu Tyr Ala Gln Met Leu Pro Ser         195 200 205 Glu Val Asp Gly Lys Leu Thr Asn Ala Leu Tyr Asp Phe Ala Gln Asn     210 215 220 Asn Pro Val Glu His Gln Ala Met Gln Ala Ala Asp Leu Ile Thr Val 225 230 235 240 Arg Gly Pro Tyr Val Ala Ile Ala Val Val Ala Ile Val Phe Phe                 245 250 255 Val Phe Leu Leu Ser Lys Leu Pro Lys Thr Met Ala His Ala Thr Pro             260 265 270 Leu Thr Thr Ser Glu Leu Lys Asn Thr Phe Gln Arg Leu Phe Ala Asn         275 280 285 Lys Cys Tyr Leu Glu Gly Gly Ala Gly Ala Phe Tyr Val Gly Ala     290 295 300 Gln Ile Met Cys Trp Thr Phe Val Ile His Tyr Gly Met Thr Ser Val 305 310 315 320 Gly Leu Ser Ala Ser Glu Ala Gln Ser Tyr Asn Met Val Ala Met Gly                 325 330 335 Ile Phe Leu Ala Ser Arg Phe Ile Cys Thr Phe Leu Leu Gly Phe Phe             340 345 350 Arg Pro Gly Gln Leu Leu Met Leu Leu Ala Leu Gly Gly Phe Val Leu         355 360 365 Ser Leu Gly Thr Ile Phe Val Gly Gly Tyr Thr Gly Leu Tyr Cys Leu     370 375 380 Ile Ala Thr Ser Ala Cys Met Ser Leu Met Phe Pro Thr Ile Tyr Gly 385 390 395 400 Ile Ala Leu Lys Gly Met Gly Glu Asp Ala Ser Leu Ala Ser Ala Gly                 405 410 415 Leu Val Met Ala Ile Val Gly Gly Ala Leu Met Pro Ile Gln Gly             420 425 430 Ser Met Ile Asp Gly Ala Ala Leu Ile Asp Gly Ile Pro Ser Val Gln         435 440 445 Thr Ser Phe Val Leu Pro Leu Ile Cys Phe Ala Met Ile Cys Leu Tyr     450 455 460 Gly Tyr Arg Ala His Tyr Lys Tyr Gly Arg 465 470 <210> 3 <211> 939 <212> DNA <213> Pseudoalteromonas atlantica <400> 3 atgaattata ggcaattagg caagacagat cttaagctat cacaagttag ttacggtgcg 60 tcaccgctag gcagtgtttt tagaaatatc agcgagcaag aaggcataaa gacagtccac 120 accgcgttag acttaggaat aaactacctt gatgtatcac cttattacgg tgacacagta 180 gcggaaacag tactgggtaa agcattaaaa ggcattcctc gagatcagta tattttgtcg 240 actaaagcag ggcgttacgg ggcggatttt gctgattttg atttttctgc gaagcgaatt 300 gaagcaagcc ttgatgaaag ctgttcccgc ttaggcgtta acgaagttga tatcttgttt 360 ttacatgata ttgagtttgc tgatatgcgc caagtgctgc aagagagtat tccttgtcta 420 ttagccctca agaaggcagg taaaatacgt tacgcagggg tgaccggata tccattaaag 480 gtattcagtg aggtcatcag ccaatatgag attgattgta ttttgaccta ctgtcgctat 540 gccttgtacg acaactcatt ggcagagatt atcccaacat tagatgaagc gtcggttggt 600 attatcaacg cctcacctac tggtatggga ttgctgaccg aacggggcgc gcctcagtgg 660 caccctggaa gtgagcagct caaacaagcg agtctaaaag cggtcagtct ttgtcagtct 720 aaaggaatag acattactgc cttggctttg caatttgcga ttgaccaccc atctattgcc 780 tccactttgg ttggcacagc gaaccccgca aatatcgtaa aaaatgtaga atgggcttca 840 gctcaacctg atgcatcttt ggtgagtgaa attcaacaga tttttgccaa tgttccatgt 900 acatggccat caggctacga gcaaaatcaa gacaaatag 939 <210> 4 <211> 312 <212> PRT <213> Pseudoalteromonas atlantica <400> 4 Met Asn Tyr Arg Gln Leu Gly Lys Thr Asp Leu Lys Leu Ser Gln Val   1 5 10 15 Ser Tyr Gly Ala Ser Pro Leu Gly Ser Val Phe Arg Asn Ile Ser Glu              20 25 30 Gln Glu Gly Ile Lys Thr Val His Thr Ala Leu Asp Leu Gly Ile Asn          35 40 45 Tyr Leu Asp Val Ser Pro Tyr Tyr Gly Asp Thr Val Ala Glu Thr Val      50 55 60 Leu Gly Lys Ala Leu Lys Gly Ile Pro Arg Asp Gln Tyr Ile Leu Ser  65 70 75 80 Thr Lys Ala Gly Arg Tyr Gly Ala Asp Phe Ala Asp Phe Asp Phe Ser                  85 90 95 Ala Lys Arg Ile Glu Ala Ser Leu Asp Glu Ser Cys Ser Arg Leu Gly             100 105 110 Val Asn Glu Val Asp Ile Leu Phe Leu His Asp Ile Glu Phe Ala Asp         115 120 125 Met Arg Gln Val Leu Gln Glu Ser Ile Pro Cys Leu Leu Ala Leu Lys     130 135 140 Lys Ala Gly Lys Ile Arg Tyr Ala Gly Val Thr Gly Tyr Pro Leu Lys 145 150 155 160 Val Phe Ser Glu Val Ile Ser Gln Tyr Glu Ile Asp Cys Ile Leu Thr                 165 170 175 Tyr Cys Arg Tyr Ala Leu Tyr Asp Asn Ser Leu Ala Glu Ile Ile Pro             180 185 190 Thr Leu Asp Glu Ala Ser Val Gly Ile Ile Asn Ala Ser Pro Thr Gly         195 200 205 Met Gly Leu Leu Thr Glu Arg Gly Ala Pro Gln Trp His Pro Gly Ser     210 215 220 Glu Gln Leu Lys Gln Ala Ser Leu Lys Ala Val Ser Leu Cys Gln Ser 225 230 235 240 Lys Gly Ile Asp Ile Thr Ala Leu Ala Leu Gln Phe Ala Ile Asp His                 245 250 255 Pro Ser Ile Ala Ser Thr Leu Val Gly Thr Ala Asn Pro Ala Asn Ile             260 265 270 Val Lys Asn Val Glu Trp Ala Ser Ala Gln Pro Asp Ala Ser Leu Val         275 280 285 Ser Glu Ile Gln Gln Ile Phe Ala Asn Val Pro Cys Thr Trp Pro Ser     290 295 300 Gly Tyr Glu Gln Asn Gln Asp Lys 305 310 <210> 5 <211> 831 <212> DNA <213> Pseudoalteromonas atlantica <400> 5 atgagaattg atgcacacca acatttttgg gcgtacaacc ctgaagagtt tgattggata 60 ggcgaagatg agggtgtttt aaagcgcgat tattttcctc cggcactaga agcagaagct 120 ggggccaatg gggttgatgg cactgtggtt gttcaagccc gtcaatctat tgaggaaacg 180 cagtggttgc tgtctctcgc tcaacagttt ccactaatca agggcgttgt tggttgggtt 240 gacttaatga acccgagctt agagcaacag cttttaagct ggcaaaacga gcaggtcctg 300 aaggggtttc ggcatgtgct tcaaggtgag cccgatccga actttatgct acaacctcgc 360 tttgtcgaag gtttgaaatt gttgcatcaa tttgactata cctatgactt actgattttc 420 gccgctcagt taccccaagc gcgtcagctt ttagatacct taccccagca caggatcgtt 480 atcgatcaca ttgccaaacc tgatattgct tcaggtgaag gtttcgccca gtggaaagcg 540 cacatgcagg ccattgctga acaccaaaat gtgtattgta agatttccgg catggtcacc 600 gaggctagcc acaaagactg gcaagaagct gatttcatcc cctatatgga tgtggtgttt 660 tccgcctttg gccctgaaag agtcatgttc ggttcagact ggccagtgtg ccaactcgca 720 gcgacgtacc cagaagtaat acagatcgtt gaacgatatg tcacccgtct gtacccagaa 780 ttttcgcagc atgtatttgg cttaaatgcc gaacgattct accgattgta g 831 <210> 6 <211> 276 <212> PRT <213> Pseudoalteromonas atlantica <400> 6 Met Arg Ile Asp Ala His Gln His Phe Trp Ala Tyr Asn Pro Glu Glu   1 5 10 15 Phe Asp Trp Ile Gly Glu Asp Glu Gly Val Leu Lys Arg Asp Tyr Phe              20 25 30 Pro Pro Ala Leu Glu Ala Glu Ala Gly Ala Asn Gly Val Asp Gly Thr          35 40 45 Val Val Val Gln Ala Arg Gln Ser Ile Glu Glu Thr Gln Trp Leu Leu      50 55 60 Ser Leu Ala Gln Gln Phe Pro Leu Ile Lys Gly Val Val Gly Trp Val  65 70 75 80 Asp Leu Met Asn Pro Ser Leu Glu Gln Gln Leu Leu Ser Trp Gln Asn                  85 90 95 Glu Gln Val Leu Lys Gly Phe Arg His Val Leu Gln Gly Glu Pro Asp             100 105 110 Pro Asn Phe Met Leu Gln Pro Arg Phe Val Glu Gly Leu Lys Leu Leu         115 120 125 His Gln Phe Asp Tyr Thr Tyr Asp Leu Leu Ile Phe Ala Ala Gln Leu     130 135 140 Pro Gln Ala Arg Gln Leu Leu Asp Thr Leu Pro Gln His Arg Ile Val 145 150 155 160 Ile Asp His Ile Ala Lys Pro Asp Ile Ala Ser Gly Glu Gly Phe Ala                 165 170 175 Gln Trp Lys Ala His Met Gln Ala Ile Ala Glu His Gln Asn Val Tyr             180 185 190 Cys Lys Ile Ser Gly Met Val Thr Glu Ala Ser His Lys Asp Trp Gln         195 200 205 Glu Ala Asp Phe Ile Pro Tyr Met Asp Val Val Phe Ser Ala Phe Gly     210 215 220 Pro Glu Arg Val Met Phe Gly Ser Asp Trp Pro Val Cys Gln Leu Ala 225 230 235 240 Ala Thr Tyr Pro Glu Val Ile Gln Ile Val Glu Arg Tyr Val Thr Arg                 245 250 255 Leu Tyr Pro Glu Phe Ser Gln His Val Phe Gly Leu Asn Ala Glu Arg             260 265 270 Phe Tyr Arg Leu         275

Claims (14)

L-갈락토스 대사능이 없는 미생물에 L-갈락토스 운반체(L-galactose transporter) 유전자, L-갈락토스 탈수소효소(L-galactose dehydrogenase) 유전자 및 L-갈락토노락토네이즈(L-galactonolactonase) 유전자를 도입한 재조합 미생물.
A recombinant microorganism having an L-galactose transporter gene, an L-galactose dehydrogenase gene and an L-galactonolactonase gene introduced into a microorganism having no L-galactose metabolism ability microbe.
제1항에 있어서, 상기 L-갈락토스 대사능이 없는 미생물은 아그로박터리엄(Agrobacterium), 아조스피릴엄(Azospirillum) 바실러스(Bacillus), 버크홀데리아(Burkholderia), 클로스트리디엄(Clostridium), 엔테로박터(Enterobacter), 엔트로코커스(Enterococcus), 에스케리키아(Escherichia), 플라보박터리엄(Flavobacterium), 클렙시엘라(Klebsiella), 락토바실러스(Lactobacillus), 로도박터(Rhodobacter), 및 살모넬라(Salmonella)로 이루어진 그룹으로부터 선택된 1종의 속에 속하는 것인 재조합 미생물.
The method of claim 1, wherein the microorganism without the ability L- galactose metabolism is bakteo William Agrobacterium (Agrobacterium), azo RY rileom (Azospirillum) Bacillus (Bacillus), Burke holde Liao (Burkholderia), Claus tree dieom (Clostridium), Enterobacter bakteo (Enterobacter), in Lactococcus ent (Enterococcus), Escherichia (Escherichia), Plastic beam bakteo William (Flavobacterium), Keulrep when Ella (Klebsiella), Lactobacillus , Rhodobacter (Rhodobacter), and at least one recombinant microorganism belonging to the genus selected from the group consisting of Salmonella (Salmonella).
제1항에 있어서, 상기 L-갈락토스 운반체 유전자, L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자는 수도알트로모나스 아틀란티카(Pseudoalteromonas atlantica)로부터 유래된 것인 재조합 미생물.
The recombinant microorganism according to claim 1, wherein the L-galactosyltransferase gene, L-galactosse dehydrogenase gene and L-galactonolactonase gene are derived from Pseudoalteromonas atlantica .
제1항에 있어서, 상기 L-갈락토스 운반체 유전자는 서열번호 1로 표시되는 염기 서열을 갖고, 상기 L-갈락토스 탈수소효소 유전자는 서열번호 3으로 표시되는 염기 서열을 가지며, 상기 L-갈락토노락토네이즈 유전자는 서열번호 5로 표시되는 염기서열을 갖는 재조합 미생물.
The L-galactosyltransferase gene according to claim 1, wherein the L-galactosyltransferase gene has the nucleotide sequence of SEQ ID NO: 1, the L-galactosse dehydrogenase gene has the nucleotide sequence of SEQ ID NO: 3, The Natse gene is a recombinant microorganism having the nucleotide sequence shown in SEQ ID NO: 5.
제1항에 있어서, 상기 L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자는 단일 벡터에 의해 도입되는 재조합 미생물.
2. The recombinant microorganism according to claim 1, wherein the L-galactosse dehydrogenase gene and L-galactonolactonase gene are introduced by a single vector.
제5항에 있어서, 상기 벡터는 ColE1 origin을 갖는 플라스미드인 재조합 미생물.
6. The recombinant microorganism of claim 5, wherein said vector is a plasmid having a ColE1 origin.
제5항에 있어서, 상기 L-갈락토스 탈수소효소 유전자 및 L-갈락토노락토네이즈 유전자가 벡터 내에 순차로 배열되며, 상기 L-갈락토노락토네이즈 유전자의 전단부에 리보좀 결합부위(RBS, ribosome binding site)가 도입되는 재조합 미생물.
6. The method according to claim 5, wherein the L-galactosse dehydrogenase gene and L-galactonolactonase gene are sequentially arranged in a vector, and a ribosome binding site (RBS, ribosome binding site is introduced into a recombinant microorganism.
제1항에 있어서, 상기 L-갈락토스 운반체 유전자는 p15A origin을 갖는 플라스미드에 의해 도입되는 재조합 미생물
The recombinant microorganism of claim 1, wherein the L-galactose carrier gene is a recombinant microorganism introduced by a plasmid having a p15A origin
제1항에 있어서, 상기 재조합 미생물은 피루브산 탈탄산효소(pyruvate decarboxylase) 유전자 및 알코올 산화환원효소(alcohol dehydrogenase) 유전자가 추가로 도입된 재조합 미생물.
The recombinant microorganism according to claim 1, wherein the recombinant microorganism further comprises a pyruvate decarboxylase gene and an alcohol dehydrogenase gene.
L-갈락토스를 포함하는 바이오매스를 기질로 하여 청구항 제1항 내지 제9항 중 어느 한 항의 재조합 미생물을 이용해 바이오에탄올을 제조하는 재조합 미생물을 이용한 바이오에탄올의 제조방법.
A method for producing bioethanol using a recombinant microorganism which produces bioethanol using the recombinant microorganism of any one of claims 1 to 9, using biomass containing L-galactose as a substrate.
제10항에 있어서, 상기 바이오매스는 홍조류인 재조합 미생물을 이용한 바이오에탄올의 제조방법.
[Claim 11] The method according to claim 10, wherein the biomass is a red algae.
제11항에 있어서, 상기 홍조류는 김 속(Porphyra) 홍조류, 돌가사리 목(Gigartinales) 홍조류, 폴리시포니아 속(Polysiphonia) 홍조류 및 포피리디움 속(Porphyridium) 홍조류로 이루어진 그룹으로부터 선택된 1종 이상인 재조합 미생물을 이용한 바이오에탄올의 제조방법.
12. The method of claim 11, wherein the red algae are at least one recombinant microorganism selected from the group consisting of Porphyra red alga, Gigartinales red alga, Polysiphonia algae, and Porphyridium algae &Lt; / RTI &gt;
제11항에 있어서, 상기 바이오매스는 홍조류를 직접 가수분해하거나 홍조류에 함유된 다당류를 추출한 뒤 가수분해한 것인 재조합 미생물을 이용한 바이오에탄올의 제조방법.
12. The method according to claim 11, wherein the biomass is obtained by directly hydrolyzing red algae or extracting a polysaccharide contained in red algae and hydrolyzing the polysaccharide.
제13항에 있어서, 상기 가수분해는 황산, 염산, 질산, 아세트산, 개미산, 트리플루오로아세트산(trifluoroacetic acid), 테트라부틸암모늄 중황산(tetrabutyl ammonium bisulfate), 1-부틸-3-메틸이미다졸륨 황산수소(1-butyl-3-methylimidazolium hydrogen sulfate), 1-메틸-이미다졸륨 황산수소(1-methylimidazolium hydrogen sulfate)으로 이루어진 그룹으로부터 선택된 1종 이상의 산을 사용하여 수행하는 산 촉매 가수분해인 재조합 미생물을 이용한 바이오에탄올의 제조방법.
14. The method of claim 13, wherein the hydrolysis is carried out in the presence of a reducing agent selected from the group consisting of sulfuric acid, hydrochloric acid, nitric acid, acetic acid, formic acid, trifluoroacetic acid, tetrabutyl ammonium bisulfate, Which is carried out using at least one acid selected from the group consisting of 1-butyl-3-methylimidazolium hydrogen sulfate and 1-methylimidazolium hydrogen sulfate, Process for the production of bioethanol using microorganisms.
KR1020130092180A 2013-08-02 2013-08-02 Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof KR101543845B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130092180A KR101543845B1 (en) 2013-08-02 2013-08-02 Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130092180A KR101543845B1 (en) 2013-08-02 2013-08-02 Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof

Publications (2)

Publication Number Publication Date
KR20150016006A true KR20150016006A (en) 2015-02-11
KR101543845B1 KR101543845B1 (en) 2015-08-11

Family

ID=52573137

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130092180A KR101543845B1 (en) 2013-08-02 2013-08-02 Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof

Country Status (1)

Country Link
KR (1) KR101543845B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017176010A1 (en) * 2016-04-04 2017-10-12 고려대학교 산학협력단 Novel method for purifying 3,6-anhydro-l-galactose by using microorganisms

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0007651D0 (en) 2000-03-29 2000-05-17 Ascorbex Ltd Gene sequence

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017176010A1 (en) * 2016-04-04 2017-10-12 고려대학교 산학협력단 Novel method for purifying 3,6-anhydro-l-galactose by using microorganisms
CN108884120A (en) * 2016-04-04 2018-11-23 高丽大学校产学协力团 For the novel method by using microorganism purifying 3,6- dehydration-L- galactolipin
US11118202B2 (en) 2016-04-04 2021-09-14 Korea University Research And Business Foundation Method for purifying and obtaining 3,6-anhydro-L-galactose using microorganisms
CN108884120B (en) * 2016-04-04 2022-05-17 高丽大学校产学协力团 Method for purifying 3, 6-anhydro-L-galactose

Also Published As

Publication number Publication date
KR101543845B1 (en) 2015-08-11

Similar Documents

Publication Publication Date Title
Möllers et al. Cyanobacterial biomass as carbohydrate and nutrient feedstock for bioethanol production by yeast fermentation
He et al. Lignocellulosic butanol production from Napier grass using semi-simultaneous saccharification fermentation
Valles et al. Comparison of simultaneous saccharification and fermentation and separate hydrolysis and fermentation processes for butanol production from rice straw
CN101883861B (en) Process for the production of ethanol from a medium comprising xylose, employing a recombinant zymomonas strain having a reduced HIMA expression
JP5961886B2 (en) Pentose and glucose fermenting yeast cells
ES2823455T3 (en) Process for the preparation of a fermentation product of material containing lignocellulose
Chow et al. Using recombinant cyanobacterium (Synechococcus elongatus) with increased carbohydrate productivity as feedstock for bioethanol production via separate hydrolysis and fermentation process
KR101293668B1 (en) A novel alpha-neoagarobiose hydrolase and a method of obtaining mono-saccharides using the same
CN102985550A (en) Compositions and methods for fermentation of biomass
Lee et al. The isolation and characterization of simultaneous saccharification and fermentation microorganisms for Laminaria japonica utilization
CN111032854A (en) Recombinant yeast cells
JP2013545491A (en) Enhancement of ethanol production by xylose-utilizing zymomonas mobilis in biomass hydrolyzate medium
JP5711873B2 (en) Simultaneous saccharification and fermentation of cellulosic materials
US7803601B2 (en) Production and secretion of glucose in photosynthetic prokaryotes (cyanobacteria)
KR20100040438A (en) A novel agarase and an enzymatic production method of agarooligosaccharide from agarose using the same
KR101543845B1 (en) Recombinant microorganism having ability to metabolize L-galactose and the method for producing bioethanol from L-galactose-containing biomass using thereof
CN114891774B (en) Xylose isomerase expressed in yeast cells with high activity and application thereof
Zakir et al. Production of biofuel from agricultural plant wastes: corn stover and sugarcane bagasse
Werlang et al. d-lactate production from Spirulina (Arthrospira platensis) biomass using lactogenic Escherichia coli
CN111979167B (en) Recombinant clostridium butyricum for efficiently converting straw biomass carbon source and construction method and application thereof
KR101599997B1 (en) A novel thermostable yeast Pichia guilliermondii Y-2 and use thereof
CN114410562A (en) Klebsiella engineered bacterium and application thereof in ethanol production
EP3262164B1 (en) Hemicellulose-degrading compositions and uses thereof
Chniti et al. Ethanol fuel from biomass: A review
KR101753556B1 (en) Method for promoting xylan degradation by using fungal auxiliary activity 9

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20180807

Year of fee payment: 4

FPAY Annual fee payment

Payment date: 20190806

Year of fee payment: 5