KR20150012090A - Clinical marker for anti-angiopoietin 2 antibody and uses thereof - Google Patents

Abstract

The present invention relates to biomarkers, IGF1 (Insulin-like growth factor 1), S100A4 (S100 calcium binding protein A4), and SNCG (Synuclein, gamma (breast cancer-specific protein 1)) to evaluate effect, reactivity, prognosis, or capacity of an anti-angiopoietin 2 in treatment of cancer disease, and screen the anti-angiopoietin 2 having higher effect, and to uses thereof.

Description

Clinical markers and anti-angiopoietin 2 antibody and uses thereof for anti-angiopoietin 2 antibody

The present invention relates to a method for evaluating the efficacy, reactivity, prognosis, or dose of an anti-angiopoietin 2 antibody in the treatment of a cancer disease, and a method for screening biomarkers IGF1 -like growth factor 1), S100A4 (S100 calcium binding protein A4) and SNCG (Synuclein, gamma (breast cancer-specific protein 1)), and their use.

Angiopoietin-2 (hereinafter referred to as Ang2) is known as an antagonistic ligand that binds to Tie2, a receptor tyrosine kinase (RTK) present in vascular endothelial cells, and inhibits signal transduction by Tie2 . Ang2 competes with Tie2's agonist Angiopoietin-1, Ang1 for Tie2 binding, thereby inhibiting Ang1-Tie2 mediated signal transduction that maintains vascular endothelial cell stability, As a result, it is possible to promote angiogenesis through dynamic rearrangement of blood vessels. Since angiogenesis is an essential factor in the growth of cancer, it is expected to inhibit Tie2-dependent Ang2 function and inhibit angiogenesis, thereby inhibiting the further growth of cancer. Indeed, Ang2- Research is actively being carried out. Recently, it has been shown that Ang2 promotes the migration and penetration of cancer cells through integrin receptors, thereby increasing cancer metastasis (Cancer Res 2006 Jan 15; 66 (2): 775-83, Cancer Res. 2007 May 1 ; 67 (9): 4254-63). In other words, Ang2 acts on vascular endothelial cells to indirectly promote cancer through neovascularization, but also acts directly on cancer cells to promote cancer metastasis. However, in order to develop an anti-Ang2 antibody as a cancer therapeutic agent , A system that can accurately predict or evaluate the efficacy of anti-Ang2 antibodies, patient responsiveness and prognosis should be established. In particular, such a prediction and evaluation system is essential for determining the clinical application of anti-Ang2 antibodies and for designing therapeutic regimens using anti-Ang2 antibodies.

Accordingly, the present inventors evaluated the efficacy of the antibody, the reactivity and prognosis of the patient, and the effective dose of the anti-Ang2 antibody in the development of a therapeutic agent for cancer by selecting a gene group whose expression is changed by Ang2 in cancer cells, The present invention has been completed by developing a biomarker useful for screening anti-Ang2 antibodies with higher efficacy.

The present invention relates to a method for evaluating the efficacy, reactivity, prognosis, or dose of an anti-angiopoietin 2 antibody in the treatment of a cancer disease, and a method for screening biomarkers IGF1, S100A4 And SNCG, and a clinical use thereof.

More specifically, one object of the present invention is to provide an anti-Ang2 antibody for cancer disease, which comprises an agent for measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, And to provide a composition for evaluating efficacy.

Another object of the present invention is to provide a kit for evaluating the efficacy of an anti-Ang2 antibody against cancer diseases, which comprises the above composition.

It is still another object of the present invention to provide a method for detecting the expression level of mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, And to provide a composition for prediction.

It is another object of the present invention to provide a kit for predicting the reactivity of a cancer patient in the treatment using an anti-Ang2 antibody, which comprises the above composition.

Another object of the present invention is to provide a method for determining the capacity of an anti-Ang2 antibody against a cancer patient, comprising the step of measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, To provide a composition.

It is another object of the present invention to provide a kit for determining the capacity of an anti-Ang2 antibody against a cancer patient, which comprises the above composition.

Another object of the present invention is to provide a composition for screening anti-Ang2 antibodies against cancer diseases, which comprises an agent for measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, .

It is another object of the present invention to provide a kit for screening anti-Ang2 antibodies against cancer diseases, which comprises the above composition.

It is another object of the present invention to provide a method for providing information for evaluating the efficacy of anti-Ang2 antibodies against cancer patients using biomarkers IGF1, S100A4 and SNCG.

Another object of the present invention is to provide a method for providing information for predicting the reactivity of cancer patients in the treatment using anti-Ang2 antibody using biomarkers IGF1, S100A4 and SNCG.

It is another object of the present invention to provide a method for providing information for determining the capacity of an anti-Ang2 antibody against a cancer patient using the biomarkers IGF1, S100A4 and SNCG.

It is another object of the present invention to provide a method for screening cancer treating agents targeting Ang2 using biomarkers IGF1, S100A4 and SNCG.

The present invention provides a technique for measuring the efficacy of an anti-Ang2 antibody through gene expression alteration. To this end, the present invention provides a method for identifying IGF1, S100A4, and SNCG, which express significant gene expression changes by treatment with Ang2 and anti-Ang2 antibodies in cancer cells, and comparing the IGF1, S100A4 and SNCG with anti- It is provided as a marker for evaluating efficacy.

Further, the present invention provides a method for evaluating the efficacy, reactivity, prognosis, or dose of an anti-Ang2 antibody in the treatment of cancer disease, and the use of IGF1, S100A4 and SNCG as biomarkers for screening more potent anti- Lt; / RTI >

In a specific example of the present invention, expression of IGF1, S100A4 and SNCG genes, which are genes involved in the development and growth of cancer in Ang2 treatment, is significantly increased in cancer cells, and this increase is reversed by the anti-Ang2 antibody (Figs. 1 and 2). In addition, it was confirmed that the genes were increased in expression depending on the Ang2 treatment concentration (Figs. 3 to 5, Figs. 9 to 10), and this increase was reversed depending on the treatment concentration of the anti-Ang2 antibody 8, Fig. 11). These results indicate that the expression of IGF1, S100A4 and SNCG in the treatment of cancer diseases using the anti-Ang2 antibody can be used as an index of efficacy for evaluating the efficacy of the anti-Ang2 antibody. Further, the following effects can be expected through the present invention.

First, IGF1, S100A4 and SNCG can be used as clinical biomarkers to measure whether the patient is responding well to the antibody when the patient is administered with the anti-Ang2 antibody. Can be used to.

Second, IGF1, S100A4 and SNCG can be used as pharmacodynamic markers (PD markers) for the administration of anti-Ang2 antibodies. The PD marker is a marker that reflects the antibody response and plays a major role in dose optimization during preclinical and clinical entry. In the present invention, IGF1, S100A4 and SNCG genes can be used as PD markers and used as a basis for drug concentration determination.

Third, IGF1, S100A4 and SNCG can be used as biomarkers for rapidly screening the highly effective antibodies by measuring the efficacy of the anti-Ang2 antibody through gene expression changes. In addition, this screening method can be applied not only to antibodies but also to all agents that inhibit Ang2 function, thereby speeding up the development of antibody drugs targeting Ang2.

Hereinafter, the present invention will be described in more detail.

In one embodiment, the present invention provides a method for evaluating the efficacy of an anti-Ang2 antibody against a cancer disease, comprising the step of measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4, and SNCG, ≪ / RTI >

The present invention also relates to a kit for evaluating the efficacy of an anti-Ang2 antibody against cancer diseases, which comprises the above composition.

In another aspect, the present invention provides a method of treating cancer patients, comprising administering an anti-Ang2 antibody, comprising an agent for measuring the expression level of mRNA of the at least one gene selected from the group consisting of IGF1, S100A4 and SNCG, To a composition for predicting reactivity.

The present invention also relates to a kit for predicting the reactivity of a cancer patient in the treatment using an anti-Ang2 antibody comprising the above composition.

In another aspect, the present invention provides a method for determining the capacity of an anti-Ang2 antibody against a cancer patient, comprising the step of measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, ≪ / RTI >

The present invention also relates to a kit for determining the capacity of an anti-Ang2 antibody against a cancer patient, which comprises the above composition.

In another aspect, the present invention provides a composition for screening anti-Ang2 antibodies against cancer diseases, which comprises an agent for measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, .

The present invention also relates to a kit for screening anti-Ang2 antibodies against cancer diseases, comprising the above composition.

The term " insulin-like growth factor 1 "(IGF1) is an insulin-like growth hormone, and its gene and protein information is registered in National Center for Biotechnology Information (NM_000618, NP_000609). IGF1 is known to be involved in the development and growth of cancer (J Clin Oncol, 2010, 28: 4985-4995), but there has been no report of a decrease in the expression of IGF1 gene in cancer cells treated with anti-Ang2 antibody .

The term " S100 calcium binding protein A4 "herein is a protein belonging to the S100 family, and its gene and protein information is registered in National Center for Biotechnology Information (NM_002961, NP_002952). S100A4 is known to be involved in the development and growth of cancer (Cancer Metastasis Rev, 2010, 31: 163-172), but the association of S100A4 with anti-Ang2 antibody is not known at all.

The term "Synuclein, gamma (breast cancer-specific protein 1)" (SNCG) is a protein belonging to the synuclein family, and its gene and protein information is registered in National Center for Biotechnology Information (NCBI) (NM_003087, NP_003078). SNCG is known to be involved in the development and growth of cancer (FASEB, 2007, 13: 3419-3430), but the association of SNCG with anti-Ang2 antibodies is not known at all.

The term "evaluating the efficacy of an antibody" herein refers to the evaluation and evaluation of whether the patient is responsive to the antibody at the time of administration of the anti-Ang2 antibody to the patient. The efficacy of the antibody includes, Preventing or alleviating the symptoms, alleviating all direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, improving or temporarily alleviating the disease state, or improving the prognosis.

For the purpose of the present invention, the present invention provides a method for treating a patient suffering from a cancer, comprising administering to the patient a therapeutically effective amount of at least one compound selected from the group consisting of IGF1, S100A4 and SNCG, Lt; RTI ID = 0.0 > Ang2 < / RTI > antibody.

As used herein, the term "responsiveness to a patient " refers to imparting a clinical or therapeutic benefit to a patient suffering from cancer disease by treatment with an anti-Ang2 antibody, including cellular or biological responses, There is a complete response, partial response, no progression or recurrence of disease, or a delayed relapse of the patient by treatment with the antibody.

For the purpose of the present invention, the present invention provides an anti-angiogenic antibody, which is characterized in that in the patient before and after the administration of the anti-Ang2 antibody, one or more expression changes selected from the group consisting of IGF1, S100A4 and SNCG in the sample obtained from the cancer patient, Can be expected to be responsive to treatment with Ang2 antibodies.

As used herein, the term "determining the capacity of an antibody" refers to determining the effective dose or dose that may indicate efficacy or reactivity to a patient.

For the purpose of the present invention, the present invention can be used as a pharmacodynamic marker (PD marker) for the change of gene expression in the treatment of an anti-Ang2 antibody with one or more selected from the group consisting of IGF1, S100A4 and SNCG, It can be used as a basis for dose optimization and drug concentration determination.

The term "antibody screening" herein refers to screening for an antibody exhibiting a change in the expression level of at least one selected from the group consisting of IGF1, S100A4 and SNCG before and after the administration of the antibody. And one or more selected from the group consisting of IGF1, S100A4, and SNCG may be used as the biomarker for rapidly screening the more effective antibody by measuring the antibody. In addition, this screening method can be applied not only to antibodies but also to all agents that inhibit Ang2 function, thereby speeding up the development of antibody drugs targeting Ang2.

As used herein, the term " agent that measures one or more levels of expression selected from the group consisting of IGF1, S100A4, and SNCG "means that the expression is increased by the treatment of Ang2 and the expression is decreased by the treatment of the anti- Refers to a molecule that can be used for the detection of a marker by identifying at least one expression level selected from the group consisting of IGF1, S100A4 and SNCG, which are markers, and preferably a marker-specific oligonucleotide, a primer, a probe, an antibody, .

One or more expression levels selected from the group consisting of IGF1, S100A4, and SNCG may be identified by determining the expression level of one or more mRNAs selected from the group consisting of IGF1, S100A4, and SNCG or the expression level of a protein encoded by the gene have.

In the present invention, "measurement of mRNA expression level" is a process of confirming the presence and expression level of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG in a biological sample and measuring the amount of mRNA . RT-PCR (competitive RT-PCR), real-time RT-PCR, and so on. ), hybridization methods (Northern blotting, Microarray, etc.), Taq-based techniques (SAGE, RNA-seq, etc.), DNA chips and the like.

In the present invention, "measurement of protein expression level" is a process for confirming the presence and expression level of a protein expressed in at least one gene selected from the group consisting of IGF1, S100A4 and SNCG in a biological sample. The amount of the protein is confirmed by using an antibody specifically binding to the protein. Immunochromatography, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), enzyme immunoassay (ELISA), and enzyme immunoassay But are not limited to, EIA, fluorescence immunoassay (FIA), luminescence immunoassay (LIA), Western blot, FACS, protein chip and the like.

Since the nucleic acid sequence of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG is known, the agent for measuring the mRNA level of the gene is preferably an oligonucleotide, a primer pair or a probe, A primer or a probe that specifically amplifies a specific region of a gene can be designed.

Herein, the oligonucleotide is a nucleotide sequence complementary to 10 to 100, particularly 10 to 50, particularly 10 to 30, consecutive base sequences of the genes of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG ≪ / RTI > oligonucleotides having a sequence. The oligonucleotide having the complementary base sequence means having a nucleotide sequence capable of hybridizing with the marker gene. The nucleotide sequence of the marker gene is 80% or more, specifically 90% or more, more specifically 95%, such as 99 Or more or 100% sequence identity to the nucleotide sequence of SEQ ID NO:

As used herein, the term "primer" refers to a nucleic acid sequence having a short, free 3 ' hydroxyl group that can form base pairs with a complementary template and is a starting point for template strand copy Short nucleic acid sequence " Primers can initiate DNA synthesis in the presence of reagents and different quaternary nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In the present invention, it is possible to evaluate the efficacy of the anti-Ang2 antibody through PCR amplification using a sense of one or more polynucleotide selected from the group consisting of IGF1, S100A4 and SNCG and an antisense primer to produce a desired product. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

As used herein, the term "probe" means a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or a few hundred nucleotides capable of specifically binding to mRAN, and the presence or absence of a specific mRNA can be confirmed have. The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization can be performed using a probe complementary to a polynucleotide of at least one gene selected from the group consisting of IGF1, S100A4, and SNCG to evaluate the efficacy of the anti-Ang2 antibody through hybridization. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, (E.g., phosphoramidate, carbamate, etc.) or charged linkages (e.g., phosphorothioate, phosphorodithioate, etc.).

The agent for measuring the protein level is preferably an antibody or an umbilical.

As used herein, the term "antibody" refers to a specific protein molecule directed against an antigenic site. For purposes of the present invention, an antibody refers to an antibody that specifically binds to a marker protein, and includes a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a human antibody, a humanized antibody, or an antigen binding fragment thereof. Such an antibody can be prepared by a hybridoma method, a phage antibody library method, a gene recombinant method, or the like, which is commonly used in the art. The term "antigen-binding fragment" refers to a functional fragment of an antibody molecule which has at least the antigen-binding function, e.g., scFv, (scFv) _2, Fab, Fab 'or F (ab') ₂ il But is not limited thereto.

Meanwhile, the present invention is characterized by using at least one selected from the group consisting of IGF1, S100A4 and SNCG as a biomarker to evaluate the efficacy, reactivity and effective dose of the anti-Ang2 antibody in cancer diseases.

Herein, the anti-Ang2 antibody refers to all antibodies or antigen-binding fragments thereof that specifically bind to Ang2 and includes both monoclonal antibodies, polyclonal antibodies, chimeric antibodies, human antibodies, humanized antibodies, or antigen-binding fragments thereof do.

As used herein, the term "heavy chain ", as used in connection with an antibody, refers to a variable region domain V _H comprising an amino acid sequence having a sufficient variable region sequence to confer specificity to an antigen and three constant region domains C _H1 , C _H2 and C _H3, and a hinge, as well as fragments thereof. The term "light chain" also encompasses both the full-length light chain comprising the variable region domain V _L and the constant region domain C _L comprising the amino acid sequence having a sufficient variable region sequence to confer specificity to the antigen and fragments thereof Is interpreted to mean inclusive.

The term "CDR (complementarity determining region)" refers to the amino acid sequence of the heavy chain of the immunoglobulin and the hypervariable region of the light chain. The heavy and light chains may each contain three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3). The CDRs may provide the major contact residues for binding of the antibody to the antigen or epitope. In the present specification, the terms "specifically binding" or "specifically recognizing" are the same as those conventionally known to those skilled in the art, and the antigen and the antibody specifically interact to effect an immunological reaction .

In the present invention, cancer diseases include all cancers for which the anti-Ang2 antibody can exhibit, such as cervical cancer, lung cancer, pancreatic cancer, non-small cell lung cancer, liver cancer, colon cancer, bone cancer, skin cancer, head cancer, Cancer, breast cancer, endometrial carcinoma, endometrial carcinoma, vaginal cancer, vulvar carcinoma, Hodgkin's disease (carcinoma), ovarian cancer, rectal cancer, brain tumor, bladder cancer, blood cancer, gastric cancer, Pancreatic cancer, prostate cancer, bladder cancer, renal cancer, ureteral cancer, renal cell carcinoma, renal pelvic carcinoma, brain cancer, central nervous system Tumor, spinal cord tumor, brainstem glioma, pituitary adenoma, and the like. More preferably, the present invention can be applied to evaluate the efficacy of an anti-Ang2 antibody against brain cancer such as glioblastoma or colon cancer.

As used herein, the term "patient " means an animal, including, but not limited to a human, including a monkey, a cow, a horse, a sheep, a pig, a chicken, a turkey, a quail, a cat, a dog, a mouse, a rat, , Mammal in one embodiment, and human in another embodiment.

As used herein, the term "kit" is intended to encompass all other factors necessary to determine one or more levels of expression selected from the group consisting of IGF1, S100A4, and SNCG, as well as agents that measure one or more levels of expression selected from the group consisting of IGF1, S100A4, Lt; / RTI >

For example, the kit of the present invention may be a kit containing elements necessary for carrying out PCR. For this purpose, specific one or more specific genes designed by a person skilled in the art for one or more marker genes selected from the group consisting of IGF1, S100A4 and SNCG (DNTPs), enzymes such as Taq polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC-water, and the like. And sterile water.

As another example, the kit of the present invention may be a kit containing elements necessary for carrying out a DNA chip. To this end, the kit includes a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached by a probe, Or a cDNA corresponding to a gene or a fragment thereof.

As another example, the kit of the present invention may be a kit for measuring the level of expression of at least one protein selected from the group consisting of IGF1, S100A4 and SNCG. For immunological detection using the antibody, a substrate, a suitable buffer solution, A secondary antibody labeled with a chromogenic enzyme or a fluorescent substance, and a chromogenic substrate. The substrate may be a nitrocellulose membrane, a 96-well plate synthesized from polyvinyl resin, a 96-well plate synthesized from polystyrene resin, a slide glass made of glass, etc. The chromogenic enzyme may be peroxidase, Alkaline phosphatase may be used as the fluorescent substance, FITC, RITC or the like may be used as the fluorescent substance, and the coloring substrate solution may be ABTS (2,2'-azino-bis- (3-ethylbenzothiazolin- (O-phenylenediamine), OPD (o-phenylenediamine), TMB (tetramethylbenzidine), and the like.

In another aspect, the present invention relates to a method for providing information for evaluating the efficacy of an anti-Ang2 antibody against a cancer patient using biomarkers IGF1, S100A4 and SNCG.

In a preferred embodiment,

mRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before the administration of the anti-Ang2 antibody and the sample of the cancer patient after the administration of the anti-Ang2 antibody, Measuring the expression level of the protein encoded by the gene; And (b) comparing the mRNA expression level of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene in each sample before and after administration of the anti-Ang2 antibody / RTI >

And to methods for providing information for evaluating the efficacy of anti-Ang2 antibodies against cancer patients.

Herein, when the expression of one or more genes or proteins selected from the group consisting of IGF1, S100A4 and SNCG is significantly decreased in a sample of a cancer patient after administration compared with before administration of the anti-Ang2 antibody, It can be judged that the anti-Ang2 antibody is exerting an effect on the anti-angi antibody.

In another aspect, the present invention relates to a method for providing information for predicting the responsiveness of a cancer patient in the treatment with an anti-Ang2 antibody using the biomarkers IGF1, S100A4 and SNCG.

In a preferred embodiment,

mRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before the administration of the anti-Ang2 antibody and the sample of the cancer patient after the administration of the anti-Ang2 antibody, Measuring the expression level of the protein encoded by the gene; And (b) comparing the mRNA expression level of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene in each sample before and after administration of the anti-Ang2 antibody / RTI >

The present invention relates to a method for providing information for predicting the reactivity of a cancer patient in the treatment using an anti-Ang2 antibody.

Herein, when the expression of one or more genes or proteins selected from the group consisting of IGF1, S100A4 and SNCG is significantly decreased in a sample of a cancer patient after administration compared with before administration of the anti-Ang2 antibody, Can be expected to show reactivity to the anti-Ang2 antibody.

In another aspect, the present invention relates to a method for providing information for determining the capacity of an anti-Ang2 antibody against a cancer patient using the biomarkers IGF1, S100A4 and SNCG.

In a preferred embodiment,

mRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before the administration of the anti-Ang2 antibody and the sample of the cancer patient after the administration of the anti-Ang2 antibody, Measuring the expression level of the protein encoded by the gene; And (b) comparing the mRNA expression level of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene in each sample before and after the administration of the anti Ang2 antibody ≪ RTI ID = 0.0 > Ang2 < / RTI >

To a method of providing information for determining the capacity of an anti-Ang2 antibody to a cancer patient.

In another aspect, the present invention relates to a method for screening cancer treating agents targeting Ang2 using biomarkers IGF1, S100A4 and SNCG.

In a preferred embodiment,

(a) treating a sample of a cancer cell or cancer patient with an anti-Ang2 antibody candidate; And (b) measuring the mRNA expression level of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene from the cancer cell or cancer patient sample.

The present invention relates to a method for screening cancer therapeutic agents targeting Ang2.

The term "patient sample" in the present invention means a sample such as tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine which have different expression levels of at least one selected from the group consisting of IGF1, S100A4 and SNCG But is not limited thereto.

Methods for measuring mRNA levels include, but are not limited to, reverse transcriptase polymerase, competitive reverse transcriptase polymerase, real-time reverse transcriptase polymerase, RNase protection assay, northern blotting, and DNA chip. Through the above detection methods, it is possible to compare mRNA expression levels before and after the administration of the anti-Ang2 antibody and to increase or decrease the expression levels of at least one mRNA selected from the group consisting of IGF1, S100A4 and SNCG The activity, the reactivity and the effective dose of the anti-Ang2 antibody can be evaluated.

The mRNA expression level can be measured by various polymerase chain reaction methods, hybridization methods, or DNA chips using a primer specific to one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, It is not.

For example, the reverse transcriptase polymerase can be confirmed by the electrophoresis after the reaction to check the band pattern and the band thickness to determine the mRNA expression and degree of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, , The efficacy, reactivity and effective dose of the anti-Ang2 antibody can be evaluated.

As another example, a DNA chip uses a DNA chip in which at least one gene selected from the group consisting of IGF1, S100A4 and SNCG, or a nucleic acid corresponding to the fragment is attached to a substrate such as glass at a high density, A cDNA probe labeled with a fluorescent substance at the end or inside thereof can be prepared, hybridized to a DNA chip, and then the efficacy, reactivity and effective dose of the anti-Ang2 antibody can be evaluated.

Immunochromatography, immunohistochemical staining, ELISA, radioimmunoassay, enzyme immunoassay, fluorescence immunoassay, luminescence immunoassay, western blot, FACS, protein chip, etc. It is not. Through these analytical methods, it is possible to compare the formation amount of the antigen-antibody complex from the sample of the patient before and after the administration of the anti-Ang2 antibody, judge whether the expression level of the marker gene is significantly increased, The efficacy, reactivity, and effective dose of the Ang2 antibody can be assessed.

The term "antigen-antibody complex" as used herein means a combination of a protein encoded by one or more genes selected from the group consisting of IGF1, S100A4 and SNCG and an antibody specific thereto, It can be quantitatively measured through the size of the signal of the detection label.

For example, the level of protein expression can be determined by ELISA. ELISAs include direct ELISA using labeled antibodies that recognize the antigen attached to the solid support, indirect ELISA using labeled antibodies that recognize the capture antibody in a complex of antibodies recognizing the antigen attached to the solid support, A direct sandwich ELISA using another labeled antibody that recognizes an antigen in the complex of antibody and antigen, a method of reacting with another antibody recognizing an antigen in a complex of an antibody and an antigen attached to a solid support, Indirect sandwich ELISA using a secondary antibody, and various ELISA methods. More preferably, the antibody is attached to a solid support, the sample is reacted, and the labeled antibody recognizing the antigen of the antigen-antibody complex is adhered to produce an enzyme, or an antibody that recognizes the antigen of the antigen-antibody complex Is detected by a sandwich ELISA method in which a labeled secondary antibody is attached and the enzyme is developed. IGF1, S100A4, and SNCG to determine the complex formation of one or more proteins selected from the group consisting of antibodies to the antibody, and to evaluate the efficacy, reactivity, and effective dose of the anti-Ang2 antibody.

As another example, Western blotting using one or more antibodies selected from the group consisting of IGF1, S100A4 and SNCG may be used. In this method, the whole protein is separated from the sample, and the protein is separated according to the size by electrophoresis, and then transferred to the nitrocellulose membrane to react with the antibody. The efficacy, reactivity, and effective dose of the anti-Ang2 antibody can be evaluated by confirming the amount of the produced antigen-antibody complex using the labeled antibody.

As another example, immunohistochemical staining using at least one antibody against at least one selected from the group consisting of IGF1, S100A4 and SNCG may be performed. This method involves collecting and fixing cancer tissues before and after the administration of the anti-Ang2 antibody and then preparing paraffin-embedded blocks by methods well known in the art. They are made into sections with a thickness of several micrometers and attached to a glass slide, and then reacted with a selected one of the above antibodies by a known method. Thereafter, the unreacted antibody is washed and labeled with one of the above-mentioned detection labels to read the label of the antibody on a microscope.

As another example, a protein chip in which one or more antibodies selected from the group consisting of IGF1, S100A4 and SNCG is arranged at a predetermined position on a substrate and immobilized at high density can be used. In this method, a method of analyzing a sample using a protein chip is a method of separating a protein from a sample, hybridizing the separated protein with a protein chip to form an antigen-antibody complex, reading the protein, To evaluate the efficacy, reactivity and effective dose of the anti-Ang2 antibody.

Using the biomarkers IGF1, S100A4 and SNCG provided in the present invention, it is possible to predict the therapeutic effect by the marker that reflects whether the drug acts on the patient after the treatment of the drug that targets Ang2 in the clinical application, and the PD It is also available as a marker (pharmacodynamic marker). In addition, biomarkers IGF1, S100A4 and SNCG can be used to rapidly screen for more potent antibodies.

FIG. 1 is a graph showing changes in relative expression levels of mRNAs of IGF1, S100A4 and SNCG in Ang2 alone or in combination with Ang2 and anti-Ang2 antibodies in U87MG cell line.
FIG. 2 is a graph showing changes in relative expression levels of mRNAs of IGF1, S100A4 and SNCG when treated with Ang2 alone or in combination with anti-Ang2 antibody in a U87MG cell line by a primer set different from that of FIG.
FIG. 3 is a graph showing changes in the relative expression level of IGF1 mRNA according to Ang2 treatment concentration in U87MG cell line. FIG.
FIG. 4 is a graph showing the relative amount of expression of S100A4 mRNA according to Ang2 treatment concentration in U87MG cell line. FIG.
FIG. 5 is a graph showing the relative amount of expression of SNCG mRNA according to Ang2 treatment concentration in U87MG in U87MG cell line. FIG.
FIG. 6 is a graph showing changes in the relative expression level of IGF1 mRNA according to the treatment concentration of anti-Ang2 antibody in the treatment of Ang2 and anti-Ang2 antibodies in the U87MG cell line.
FIG. 7 is a graph showing changes in the relative expression level of S100A4 mRNA according to the treatment concentration of the anti-Ang2 antibody in the U87MG cell line when the Ang2 and anti-Ang2 antibodies were treated.
FIG. 8 is a graph showing changes in the relative expression level of SNCG mRNA according to the treatment concentration of anti-Ang2 antibody in the treatment of Ang2 and anti-Ang2 antibodies in the U87MG cell line.
FIG. 9 is a graph showing a change in the relative expression level of S100A4 mRNA according to Ang2 treatment concentration in Colo205 cell line. FIG.
10 is a graph showing changes in the relative expression level of SNCG mRNA according to Ang2 treatment concentration in Colo205 cell line.
FIG. 11 is a graph showing changes in the relative expression level of S100A4 mRNA according to the treatment concentration of anti-Ang2 antibody in the case of treatment with Ang2 and anti-Ang2 antibodies in Colo205 cell line.

EXAMPLES The following examples are described in more detail through the present invention. However, these embodiments are intended to illustrate one or more embodiments only, and the scope of the invention is not limited to these embodiments.

Example  1. In the brain cancer cell line Ang2  And term Ang2  Analysis of expression of cancer-related genes during antibody treatment

1-1. term- Ang2  Preparation of antibodies

An anti-Ang2 antibody comprising a heavy chain variable region encoded by the nucleotide sequence of SEQ ID NO: 1 and a light chain variable region encoded by the nucleotide sequence of SEQ ID NO: 2 was prepared in the following manner.

The heavy chain of the antibody was designed to be composed of 'EcoRI-signal sequence-VH-NheI-CH-XhoI', and the gene was synthesized by biona. The light chain was designed to consist of the EcoRI-signal sequence-VL-BsiWI-CL-XhoI, and the gene was synthesized by requesting bionan. Then, the DNA fragment having the nucleotide sequence corresponding to the heavy chain was inserted into the pOptiVECTM-TOPO TA Cloning Kit contained in the OptiCHOTM Antibody Express Kit (Cat No. 12762-019) manufactured by Invitrogen Inc., and the pcDNATM3.3-TOPOTA Cloning Kit 8300-01) was cloned by using restriction enzymes EcoRI (NEB, R0101S) and XhoI (NEB, R0146S), respectively, to construct a vector for expression of the antibody .

The thus obtained heavy chain and light chain vectors were transfected into 293-F cells (invitrogen). The cells were cultured at 37 ° C in a serum-free 293-f expression medium (Invitrogen), and the culture broth was recovered on day 5. The culture containing the expressed antibody was centrifuged at 1000 xg for 10 minutes to remove residual cells and impurities. Affinity chromatography using Protein A (GE-Healthcare), which has strong affinity for the antibody Fc region, The antibody was purified by low PH elution.

1-2. Ang2  And term Ang2  Analysis of Gene Expression by Antibody Treatment

In order to select genes whose expression is altered by Ang2 and anti-Ang2 antibodies in a glioblastoma cell line U87MG in which Tie2 is not expressed, either Ang2 alone or Ang2 and anti-Ang2 antibodies were treated together and Superarray was performed. The superarray is a focused array divided into cellular pathways. The array used in the present invention is an array (Qiagen, PAHS-033F) in which primers related to 84 Cancer pathways are inserted.

First frequency divider at a concentration of the U87MG cell lines in 6 well plates 2.0 x 10 ⁵ cells / well to extract the RNA required for Superarray and cultured for one day. After 2 days of serum starvation, Ang2 (5 ug / ml) alone or Ang2 (5 ug / ml) and anti Ang2 antibody (20 ug / ml) were treated together for 24 hours. Serum free media was used as a control, and all experiments were conducted under serum-free conditions. RNA was extracted using RNeasy Mini kit (Qiagen, # 74106), and 1.5 ug of total RNA was synthesized with cDNA using RT2 SYBR Green qPCR Master Mix (Qiagene, # 330503). The synthesized cDNA was subdivided into Superarray plates according to the protocol of the manufacturer and qPCR was performed according to the following procedure. Step 1: 95 ° C, 10 min; Step 2 (45 cycles): Step 2-1: 95 ° C, 15 seconds; Step 2-2: 60 占 폚, 1 minute; Step 3: 65 ° C, 15 seconds; Step 4: 95 ° C, continuous (every 20 ° C); Step 6: 40 ℃, 10 seconds.

qPCR was performed using the LightCycler®480 Real-Time PCR System (Roche) and HPRT1 , one of the internal controls, was used to calibrate the amount of RNA in the sample 　 Respectively. The expression of Ang2 and anti-Ang2 antibody-treated groups was calculated by setting the expression level of the control group in which the C _T value of each plate was corrected by the internal control group. When the fold changes were compared, it was found that the Ang2-induced effects were inhibited by treatment with anti-Ang2 antibody, and the three types of IGF1, S100A4 and SNCG Genes were finally selected (Fig. 1 and Table 1).

NCBI  Registration Number Gene Title Gene Symbol Change in expression level
( compared to to medium ) Ang2 Ang2  + Ab NM_000618 Insulin-like growth factor 1 (somatomedin C) IGF1 3.31 2.57 NM_002961 S100 calcium binding protein A4 S100A4 2.57 1.27 NM_003087 Synuclein, gamma (breast cancer-specific protein 1) SNCG 3.56 2.3

Example  2. Selection of the gene qPCR Verification through

Individual qPCRs were performed to verify the genes selected by Superarray. Table 2 shows the PCR primer sequences used in the verification procedure.

Representative  Public ID Gene Symbol PCR primer sequence  (5 ' - > 3 ') sense antisense NM_000618 IGF1 tgtggagacagggggctttta
(SEQ ID NO: 3) atccacgatgcctgtctga
(SEQ ID NO: 4) NM_002961 S100A4 cgcttcttctttcttggtttg
(SEQ ID NO: 5) gagtacttgtggaaggtggaca
(SEQ ID NO: 6) NM_003087 SNCG gcggtggaaaagaccaag
(SEQ ID NO: 7) cacgctctgtacaacattctcc
(SEQ ID NO: 8)

QPCR for verification was performed by cell preparation, RNA extraction, cDNA synthesis and qPCR reaction. The cells were treated under the same conditions as those of Superarray of Example 1-2. RNA was extracted using RNeasy Mini kit (Qiagen, # 74106), and 2ug RNA was synthesized with cDNA using Transcriptor First Strand cDNA synthesis kit (Roche, # 04 896 866 001). For pPCR reaction, RT2 SYBR Green Mastermix (Qiagen, # 330502) and LightCycler®480 Real-Time PCR System (Roche) were used. HPRT1 was used as an internal control to correct the amount of RNA in the sample, and qPCR proceeded to the next step for all the primers. Step 1: 95 캜, 10 min; Step 2 (45 cycles): Step 2-1: 95 ° C, 15 seconds; Step 2-2: 60 占 폚, 1 minute; Step 3: 65 ° C, 15 seconds; Step 4: 95 ° C, continuous (every 20 ° C); Step 6: 40 ° C, 10 seconds. As a result, as in the results of Example 1-2, expression of IGF1, S100A4 and SNCG genes was increased by treatment with Ang2 and then decreased by treatment with anti-Ang2 antibody (FIG. 2)

Example  3. In the brain cancer cell line Ang2  Analysis of gene expression changes by treatment concentration

For RNA extraction for RT required dispense the U87MG cell lines in 6 well plates at a concentration of 2.0 x 10 ⁵ cells / well and cultured for one day. After 2 days of serum starvation, various concentrations of Ang2 from 0 to 20 μg / ml were treated and cultured for 24 hours. Subsequently, qPCR was performed under the same conditions as in Example 1-2, and the expression levels of IGF1, S100A4 and SNCG genes were observed. As a result, expression of IGF1, S100A4 and SNCG genes was dependent on the treatment concentration of Ang2 (Figs. 3 to 5).

Example  In the brain cancer cell line, Ang2  Analysis of gene expression changes by antibody treatment concentration

For RNA extraction for RT required dispense the U87MG cell lines in 6 well plates at a concentration of 2.0 x 10 ⁵ cells / well and cultured for one day. After 2 days of serum starvation, Ang2 (5 ug / ml) and 0 to 8.3 μg / ml of anti Ang2 antibody were treated and incubated for 24 hours. Subsequently, qPCR was performed under the same conditions as in Example 1-2 to observe changes in expression levels of IGF1, S100A4 and SNCG genes. As a result, expression of IGF1, S100A4 and SNCG genes was dependent on the treatment concentration of anti-Ang2 antibody (Figs. 6 to 8).

Example  5. In colorectal cancer cell lines Ang2  Analysis of gene expression changes by treatment concentration

For RNA extraction required for RT, Colo205 cell line was seeded at a concentration of 5.0 × 10 ⁵ cells / well in a 6-well plate and cultured for 1 day. After 1 day of serum starvation, Ang2 was treated with various concentrations of 0 to 20 μg / ml and cultured for 24 hours. Thereafter, qPCR was performed under the same conditions as in Example 1-2 to observe changes in expression amounts of S100A4 and SNCG genes. As a result, it was confirmed that expression of S100A4 and SNCG genes was dependent on Ang2 treatment concentration 9 and 10).

Example  6. In colorectal cancer cell lines, Ang2  Analysis of gene expression changes by antibody treatment concentration

For RNA extraction required for RT, Colo205 cell line was seeded at a concentration of 5.0 × 10 ⁵ cells / well in a 6-well plate and cultured for 1 day. After 1 day of serum starvation, Ang2 (5 ug / ml) and 0 to 25 ug / ml of anti Ang2 antibody were treated and incubated for 24 hours. Thereafter, qPCR was performed under the same conditions as in Example 1-2, and the expression of the gene was observed. As a result, it was confirmed that the expression of S100A4 gene was decreased depending on the treatment concentration of anti-Ang2 antibody (FIG. 11).

<110> SAMSUNG ELECTRONICS CO., LTD. <120> Clinical marker for anti-angiopoietin2 antibody and uses thereof <130> DPP20126814KR <160> 8 <170> Kopatentin 1.71 <210> 1 <211> 321 <212> DNA <213> Artificial Sequence <220> <223> heavy chain variable region of anti-Ang2 antibody <400> 1 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga aagagccacc 60 ctctcctgca gggccagtca gagtgttagc agcacctact tagcctggta ccagcagaaa 120 cctggccagg ctcccaggct cctcatctat ggtgcatcca gcagggccac tggcatccca 180 gacaggttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cattatgata actcacaaac gttcggccaa 300 gggaccaagg tggaaatcaa a 321 <210> 2 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> light chain variable region of anti-Ang2 antibody <400> 2 gaggtgcagc tggtggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctacgaca tgcactgggt ccgccaagct 120 acaggaaaag gtctggagtg ggtctcagct attggtcctg ctggtgacac atactatcca 180 ggctccgtga agggccgatt caccatctcc agagaaaatg ccaagaactc cttgtatctt 240 caaatgaaca gcctgagagc cggggacacg gctgtgtatt actgtgcaag aggtttgatt 300 acgtttgggg ggcttatcgc cccgtttgac tactggggcc agggaaccct ggtcaccgtc 360 tcctcacgt 369 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> sense primer for IGF1 <400> 3 tgtggagaca ggggctttta 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for IGF1 <400> 4 atccacgatg cctgtctga 19 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> sense primer for S100A4 <400> 5 cgcttcttct ttcttggttt g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for S100A4 <400> 6 gagtacttgt ggaaggtgga ca 22 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> sense primer for SNCG <400> 7 gcggtggaaa agaccaag 18 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Antisense primer for SNCG <400> 8 cacgctctgt acaacattct cc 22

Claims (15)

MRNA of at least one gene selected from the group consisting of insulin-like growth factor 1 (IGF1), S100A4 (S100 calcium binding protein A4) and SNCG (Synuclein, gamma (breast cancer-specific protein 1) A composition for evaluating the efficacy of an anti-Ang2 antibody against cancer disease,
A composition for predicting the reactivity of a cancer patient in the treatment with an anti-Ang2 antibody, comprising an agent for measuring an expression level of mRNA of the at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or a protein thereof.
A composition for determining the capacity of an anti-Ang2 antibody against a cancer patient, comprising an agent for measuring an expression level of mRNA of the at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or a protein thereof.
A composition for screening anti-Ang2 antibodies against cancer diseases, comprising an agent for measuring the mRNA of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG, or an expression level thereof.
The method according to any one of claims 1 to 4, wherein the agent for measuring the expression level of the gene mRNA is selected from the group consisting of an oligonucleotide which specifically binds to at least one gene selected from the group consisting of IGF1, S100A4 and SNCG, Or a probe.
5. The method according to any one of claims 1 to 4, wherein the agent for measuring the expression level of the protein is one comprising an antibody or an excreta specific to at least one protein selected from the group consisting of IGF1, S100A4 and SNCG / RTI &gt;
5. The composition of any one of claims 1 to 4, wherein said anti-Ang2 antibody comprises a monoclonal antibody, polyclonal antibody, chimeric antibody, human antibody, humanized antibody, or antigen-binding fragment thereof.
A kit for evaluating the efficacy of an anti-Ang2 antibody against a cancer disease, comprising the composition of claim 1.
A kit for predicting the response of a cancer patient to treatment with an anti-Ang2 antibody comprising the composition of claim 2.
A kit for determining the capacity of an anti-Ang2 antibody against a cancer patient, comprising the composition of claim 3.
A kit for screening anti-Ang2 antibodies against cancer disease, comprising the composition of claim 4.
MRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before administration of the anti-Ang2 antibody and the sample of the cancer patient after administration of the anti-Ang2 antibody, Determining the level of expression of the protein; And
Comparing the mRNA expression level of the at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene in each of the samples before and after the administration of the anti-Ang2 antibody.
A method of providing information for assessing the efficacy of an anti-Ang2 antibody against a cancer patient.
MRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before administration of the anti-Ang2 antibody and the sample of the cancer patient after administration of the anti-Ang2 antibody, Determining the level of expression of the protein; And
Comparing the mRNA expression level of the at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene in each of the samples before and after the administration of the anti-Ang2 antibody.
A method of providing information for predicting the responsiveness of cancer patients in treatment with anti-Ang2 antibodies.
MRNA expression levels of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG from the sample of the cancer patient before administration of the anti-Ang2 antibody and the sample of the cancer patient after administration of the anti-Ang2 antibody, Determining the level of expression of the protein; And
Based on comparing the mRNA expression level of one or more genes selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by the gene before and after administering the anti-Ang2 antibody, Comprising the step of adjusting the dose of the antibody,
A method of providing information for determining the capacity of an anti-Ang2 antibody to a cancer patient.
Treating an anti-Ang2 antibody candidate substance in a sample of a cancer cell or cancer patient; And
Measuring the mRNA expression level of at least one gene selected from the group consisting of IGF1, S100A4 and SNCG or the expression level of the protein encoded by said gene from the sample of said cancer cell or cancer patient,
A method for screening cancer treating agents targeting Ang2.

Images