KR20140137088A - Micro Magnetic System for Screening Ligand and Uses Thereof - Google Patents

Abstract

The present invention relates to a ligand screening system and method using a soft magnetic microstructure. Particularly, the system and method of the present invention are preferably useful for screening a ligand magnetic particle library consisting of multiple different compounds with respect to a target substance that is a biochemical system. According to the present invention, the ligand screening system using the soft magnetic microstructure comprises a reaction module making the ligand magnetic particle library consisting of multiple test compounds react with the target substance that is a biochemical system to form a reaction mixture comprising a non-bonded ligand magnetic particle and a target substance-ligand magnetic particle complex; a magnetic force generation module controlling an external magnetic field to magnetize the soft magnetic microstructure and the non-bonded ligand magnetic particle and target substance-ligand magnetic particle complex; a transfer module comprising a chained soft magnetic microstructure which generates an internal magnetic field when magnetized by the external magnetic field and controls the movement of the target substance-ligand magnetic particle complex according to the direction of magnetization, a loading site formed on one end of the chained soft magnetic microstructure, into which the reaction mixture is put, and a sensing site formed on the other end of the chained soft magnetic microstructure, to which the target substance-ligand magnetic particle complex is transferred; the non-bonded ligand magnetic particle and target substance-ligand magnetic particle complex of which the movement is controlled by the internal magnetic field generated as the soft magnetic microstructure is magnetized; and an analysis module analyzing a ligand separated from the target substance-ligand magnetic particle complex which has been transferred and an effect of the ligand on the biological activity of the target substance.

Description

TECHNICAL FIELD [0001] The present invention relates to a screening system for a ligand using a soft magnetic microstructure,

The present invention relates to a method and system for screening a ligand using a soft magnetic microstructure, and more particularly to a method and system for screening a ligand magnetic material formed by reacting a ligand magnetic particle library composed of a plurality of different compounds on a target substance, The present invention relates to a method and a system for screening a ligand using a series of soft magnetic microstructures in which a particle complex changes the flow path under the influence of a magnetic force applied from a magnetic force generating module in a microfluidic channel.

Protein binding and biologically active proteins have many biological activities due to their ability to specifically bind to one or more binding partners (ligands), which themselves are proteins or other molecules.

Once the binding partner of a protein is known, the research is relatively focused on how the interaction of the binding protein and its binding partner affects the biological activity. The compounds may also be screened for their ability to competitively inhibit complex formation or to dissociate already formed complexes. Such inhibitors will affect the biological activity of the protein if at least they can be delivered to the site of interaction in vivo.

If the binding protein is a receptor, then the binding partner will be an effector with biological activity, and the inhibitor will antagonize its biological activity. If the binding partner interferes with any biological activity through binding, the inhibitor of that interaction will be the agonist.

The current state of the art on screening for ligands binding to a single isolated protein involves the search for ligand magnetic particles that bind to the ligand binding pocket of a single protein. Through this analysis, it is only possible to search for an appropriate ligand according to the relative affinity of the compound to the protein, and the activity of the compound on the receptor as to whether the compound acts as an agonist or an antagonist of the receptor activity Can not be found.

Previously developed assays that can distinguish agonists from antagonists are cell-based assays and receptor gene systems (McDonnell et al., Molec. Endocrinol., 9: 659 (1995)). This analysis is time-consuming and can lead to different results if performed in other cell lines or with other reporter genes or reaction elements. Therefore, the data must be interpreted with caution.

Both the natural product and the synthetic compound may only be tested for only one activity, but may be comprehensively tested for all biological activities of interest to the test person. The test was originally performed in animals and thereafter a less expensive and simpler system using isolated organs, tissues or cells, or cell culture fluids, membrane extracts or purified receptors was developed for some pharmacological evaluation. For testing in whole animals and in separate organs, large amounts of chemical compounds are typically required to be tested. Since the amount of compound given in the set of potential drug compounds is limited, it is necessary to limit the number of screenings to be performed.

Methods are needed to determine if a protein is likely to be a productivity target for physiological mediators. Even if we know about 10,000 proteins in the target of interest, efficiently screening of tens of thousands of ligands likely to confer useful activity on these 10,000 targets remains a problem. Obtaining a chemical compound library has become a barrier to entry into the field of drug discovery. Since a large amount of chemical is required to test on whole animals and on cells in culture, it must be done in a considerably large amount every time a compound is produced. However, as targets have been miniaturized at the molecular level and screening has become automated, the amount of specific compounds required for analysis has been reduced to very small amounts. This change has opened the door for the use of so-called combinatorial chemical libraries instead of traditional chemical libraries. Combination chemistry allows the synthesis of small amounts of a large number of compounds suitable for automated analysis of molecular targets at a rapid and relatively low cost. A number of laboratories successfully produced a diverse range of combinatorial chemical libraries (Doyle, 1995, Gordon et al., 1994a, Gordon et al., 1994b).

In the combinatorial library, chemical building blocks are randomly combined with large numbers of other compounds (on the order of 10E15), which are then simultaneously screened for binding (or other) activity on one or more targets.

Thousands or even millions of libraries of random oligopeptides have been synthesized (Houghten et al., Nature, 354: 84-6 (1991)) or gene expression (Marks et al., J Mol Biol, 222: (Colas et al., Nature, 380: 548-9 (1991)), gene expression is carried out on a chromatographic support (Lam et al., Nature, (Lu, Bio / Technology, 13: 366-372 (1990), or Phage (Smith, Science, 228: 1315-7 (1985)); antibodies (Valadon et Cell proteins (Schmitz et al., J Mol Biol, 260: 664-677 (1996)), viral proteins (Hong and Boulanger, Embo J, 14 : 4714-4727 (1995)), bacterial proteins (Jacobsson and Frykberg, Biotechniques, 18: 878-885 (1995)), nucleic acids (Cheng et al., Gene, 171: 1-8 Siani et al., J Chem Inf Comput Sci, 34: 588-593 (1994)). Cleaned.

Nucleic acid (Ellington and Szostak, Nature, 246: 818 (1990), carbohydrates and the like) and proteins (Ladner, USP 4,664,989), peptoids (Simon et al., Proc Natl Acad Sci USA, 89: 9367-71 Libraries of small organic molecules (Eichler et al., Med Res Rev, 15: 481-96 (1995)) have also been prepared and proposed for pharmaceutical screening purposes.

The first combinatorial library consisted of peptides or proteins in which all or selected amino acid positions were random. Peptides and proteins can exhibit high and specific binding activity and can act as enzymes. As a result, they are the most important in biological systems. Unfortunately, the peptides themselves are limited to therapy. They are expensive to synthesize, unstable in the presence of proteases, and generally do not pass through cell membranes. Other classes of compounds have better properties as drug candidates.

Nucleic acid is also being used in combination libraries. Their greatest advantage is that nucleic acids with appropriate binding activity can be easily amplified. As a result, combinatorial libraries composed of nucleic acids may have low repeatability and thus high diversity. However, the resultant oligonucleotides are not suitable as pharmaceuticals for several reasons. First, oligonucleotides have a high molecular weight and can not be mass-synthesized easily. Second, the oligonucleotide can not pass through the cell membrane because it is a polyvalent anion. Finally, deoxy- and ribo-nucleotides are hydrolyzed by nuclease, which occurs in all living systems and is usually degraded prior to reaching the target.

There has thus been much interest in combinatorial libraries based on small molecules, such as benzodiazepines, which are more suitable for pharmaceutical use, especially those belonging to the chemical class that produced useful pharmacological agents. Combined chemistry was recognized as the most efficient module to find small molecules acting on these targets. At present, small molecule combinatorial chemistry is concerned with the synthesis of pooled or individual molecules representing various arrangements with functionality on conventional scaffolds. These compounds are grouped in libraries that are screened for targets of interest for binding or inhibiting biological activity. Although libraries containing tens of thousands of compounds are routinely synthesized, screening these libraries for binding or inhibition of all full potential targets is not logically possible with current screening techniques, and should be screened for each target Numerous experimental and computational methods are under improvement to reduce the number of compounds.

Paterson, et al., J. Med. Chem., 39: 3049-59 (1996), medicinal chemistry advances through a dual process of " leading discovery "and" leading optimization. &Quot; In "lead discovery", the object of investigation is an "active island", ie a chemical class with a high frequency of active molecules (this class can be mathematically defined as any volume within a multidimensional location defined by various molecular descriptors ). "Lead optimization" and "active island" are studied in detail. If each compound that is synthesized and tested can be regarded as a probe of a "neighbor" of a similar compound in "lead discovery", it is inefficient to test the substances that the neighbors overlap.

Despite improvements achieved using ligand screening and verification using parallel screening methods such as robotic engineering and high throughput detection systems and other technological advances, current screening methods still have a number of associated problems. For example, screening a large number of samples using existing parallel screening methods may require extensive site requirements to accommodate samples and equipment, e.g., robots, large quantities of reagent requirements needed to perform high cost and assays related to the equipment Is required. In addition, in most of the cases, the reaction volume should be small because the amount of test compound available is small. These small volumes add to errors associated with fluid handling and measurement, such as errors due to evaporation, dispensing errors, and the like. In addition, fluid handling equipment and methods have typically been unable to handle these volume ranges with an acceptable level of accuracy, in part due to surface tension effects at these small volumes.

In order to develop a system to solve these problems, various aspects of the verification method should be considered. These aspects include target and compound sources, test compounds and target handling, specific assay requirements, and data acquisition, cleanup storage and analysis. In particular, there is a need for a high throughput screening method and related equipment and systems that can perform repetitive and accurate screening and operate with very small volumes.

According to the above trend, biological screening and assay system for identification of life phenomena and new drug development and diagnosis is performed on the basis of microfluidics, Is developing in the form of a micro-total analysis system (TAS) and a lab-on-a-chip.

The present invention provides a system for screening a ligand binding to a target substance using a molecular transfer system of a molecular transfer system using a soft magnetic microstructure (Korean Patent Registration No. 10-1067695). The present invention meets the need for a ligand screening system and a variety of other needs from a ligand library composed of a plurality of test compounds for a target material that is a biochemical system. In particular, the present invention provides a system for performing screening that presents an important solution to the problems of conventional ligand screening systems.

The present invention has been conceived to overcome the above-described problems, and includes a target substance-ligand magnetic particle composite in which a ligand magnetic particle library composed of a plurality of test compounds in a reaction solution and a target substance, which is a biochemical system, The present invention also provides a method and system for screening a ligand which separates only a target substance-ligand magnetic particle complex using a soft magnetic microstructure from a reaction mixture and binds to a target substance.

It is another object of the present invention to provide a method and system for assaying the effect of a ligand on the biological activity of a target substance in a target substance-ligand magnetic particle complex separated by a single ligand assay system.

It is a further object of the present invention to provide a method and system for qualifying and quantifying a target material using a ligand identified by a qualitative quantitation system of a target material.

According to the present invention, there is provided a ligand screening system (1) using a soft magnetic microstructure for a target substance, which is a biochemical system, from a ligand magnetic particle library composed of a plurality of test compounds.

The screening system for a ligand using the soft magnetic microstructure according to the present invention comprises reacting the ligand magnetic particle library with the target substance to form a reaction mixture comprising unbound ligand magnetic particles and a target substance-ligand magnetic particle composite (300) A reaction module (2) for forming; A magnetic force generating module (3) for controlling the external magnetic field (100) to magnetize the following soft magnetic fine structure (200) and the unbound ligand magnetic particle and the target material - ligand magnetic particle composite (300); A chain soft magnetic microstructure 7 that generates an internal magnetic field 400 when magnetized by the external magnetic field 100 and controls the movement of the target material-ligand magnetic particle composite 300 along the magnetization direction 500; , A loading module (6) for loading the reaction mixture at one end, and a sensing area (8) for transferring the target material-ligand magnetic particle complex at another end; The unbound ligand magnetic particle and the target material-ligand magnetic particle composite 300 controlled to move by the internal magnetic field 400 generated as the soft magnetic fine structure 200 is magnetized; And an analysis module 5 for analyzing the effect of the ligand separated from the transferred target substance-ligand magnetic particle complex 300 and / or the ligand on the biological activity of the target substance.

Preferably, the soft magnetic microstructure is formed by patterning a soft magnetic thin film of any one of NiFe, Fe, Ni, and Co.

Preferably, the soft magnetic microstructure is realized in the form of either a disk or a half-disk.

Preferably, the soft magnetic microstructure is cascaded to attract the target material-ligand magnetic particle complex into the analyte well in the fluidic microchip.

Preferably, the soft magnetic microstructure has a saturation magnetization of about 1 Tesla and has a length of 10 m or less.

Preferably, the degree of change of the internal magnetic field is in the range of about 10 < ⁴ > T / m.

Preferably, the soft magnetic microstructure magnetized by the external magnetic field generates a local magnetic field due to the geometrical structure and softness, and the target material-ligand magnetic particle composite is magnetized by the internal magnetic field Is moved to the pole of the soft magnetic microstructure having the strongest force.

Preferably, the soft magnetic microstructure magnetized by the external magnetic field generates a local internal magnetic field by geometry and softness, and moves the target material-ligand magnetic particle composite by the external magnetic field rotating or vibrating .

Preferably, when the external magnetic field rotates clockwise or counterclockwise and the soft magnetic microstructure is in the form of a disc and the soft magnetic microstructure is in a fluid channel, the target material- To a specific position of the channel.

Preferably, when the external magnetic field rotates in a clockwise direction and the soft magnetic microstructure is in the form of a half disk, the target material-ligand magnetic particle composite moves forward, the external magnetic field rotates counterclockwise, And the target material-ligand magnetic particle composite proceeds backward when the magnetic microstructure is in the form of a half-disk.

Preferably, when the external magnetic field rotates in a clockwise direction and the soft magnetic microstructures are arranged in a diagonal line, the target substance-ligand magnetic interest complexes are concentrated to a portion where the slant lines are collected in the center, And when the soft magnetic microstructures are arranged in an oblique direction, the target material-ligand magnetic particle composites are dispersed from a portion where the oblique lines are collected in the center.

Preferably, the analysis module 600 comprises a device for analyzing the ligand.

Also provided in accordance with the present invention is a system for assaying a ligand using a ligand screening system for a target substance that is a biochemical system from a ligand magnetic particle library composed of a plurality of test compounds.

Preferably, a system for determining the effect of a ligand on the biological activity of a target material is one in which the assay module 600 is capable of performing a cytological, physiological, biochemical, molecular biochemical, Device.

Also provided in accordance with the present invention is a method for screening a ligand for a target substance that is a biochemical system from a ligand magnetic particle library composed of a plurality of test compounds.

The method for screening a ligand using the soft magnetic microstructure according to the present invention comprises: preparing a ligand magnetic particle library; Reacting the ligand magnetic particle library with a target material in the reaction module (2) to prepare a reaction mixture comprising unbound ligand magnetic particles and a target material-ligand magnetic particle composite (300); The reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 3 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Transferring the composite (300) to a sensing location (8) located at the distal end of the soft magnetic microstructure (7); The target substance-ligand magnetic particle composite 300 transferred to the sensing location 8 is transferred to the analysis module 5 using the magnetic force generating module 3 to separate the target substance-ligand magnetic particle composite And separating and analyzing the ligand magnetic particles from the separated complex.

Preferably, the step of washing the target material-ligand magnetic particle composite 300 of the reaction mixture in the reaction module 2 with a washing solution to separate the non-specific or relatively weakly bound ligand magnetic particles to prepare a reaction mixture .

Preferably, the step of amplifying the ligand from the target material-ligand magnetic particle composite 300 transferred from the transport module 4 to the analysis module 5; And preparing ligand magnetic particles and then; A reaction step; Washing step; And a separation step; Is repeated two or more times.

Also provided in accordance with the present invention is a ligand assay method using a ligand screening system for a target substance that is a biochemical system from a ligand magnetic particle library composed of a plurality of test compounds.

The method for assaying a ligand according to the present invention comprises the steps of: preparing the identified ligand magnetic particles; Preparing a reaction mixture comprising the target material-ligand magnetic particle composite (300) by reacting the ligand magnetic particles with the target material in the reaction module (2); The reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 2 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Transferring the complex to a sensing location (8) located at the distal end of the soft magnetic microstructure (7); And the magnetic force generating module (2), the separated target substance-ligand magnetic particle composite (300) is transferred to the analysis module (5), and the influence of the identified ligand magnetic particles on the biological activity of the target substance And analyzing and testing.

Preferably, the verification of the ligand magnetic particles carried out in the analysis module (5) analyzes the effect of the ligand magnetic particles on the biological activity of the target material, which is the biochemical system, and includes a cytological analysis, a physiological analysis, Molecular biological analysis, genomic analysis, protein body analysis, and the like.

According to the present invention, there is also provided a method for qualitatively and quantitatively analyzing a target substance using a ligand screening system using a soft magnetic microstructure.

The method for qualitative and quantitative determination of a target substance according to the present invention comprises: preparing ligand magnetic particles binding to the target substance; Preparing a reaction mixture comprising the target substance-ligand magnetic particle composite (300) by reacting the ligand magnetic particle with a sample in the reaction module (2); And the reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 2 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Ligand magnetic particle composite 300 to the analysis module 5 by transferring the target substance-ligand magnetic particle composite 300 to a sensing site 8 located at the end of the soft magnetic microstructure 7.

Preferably, the analysis module 5 comprises a device for qualitatively and quantitatively analyzing a target material from the target material-ligand magnetic particle composite 300 at the detection site 8.

Also, in the screening system (1) for a ligand using the soft magnetic microstructure according to the present invention, the target substance is characterized by a biochemical system including a single molecule, a virus, a cell, and a bacterium.

In addition, in the ligand screening system (1) using the soft magnetic microstructure according to the present invention, the ligand is a substance binding to a target substance including an organic substance, a protein, a peptide, an aptamer and the like.

Further, the ligand magnetic particles that have been verified in the ligand screening system (1) using the soft magnetic microstructure according to the present invention are characterized by being used as a leading material for drug development.

Further, the ligand magnetic particles that have been verified in the ligand screening system (1) using the soft magnetic microstructure according to the present invention are characterized in that the ligand magnetic particles are used as a material for qualitative and quantitative analysis of the target substance.

According to the ligand screening system using the soft magnetic microstructure according to the present invention, it is possible to provide a screening system of a ligand for analyzing a ligand by separating a target substance-ligand magnetic particle complex using a soft magnetic microstructure, The system has far greater potential than the system, is easy to fabricate, requires a small amount of target material, and a ligand library, and the tested ligand can be used as a leading material in the development of diagnostic materials and pharmaceuticals.

1 is a view showing a screening system of a ligand using the soft magnetic microstructure according to the present invention;
FIG. 2 illustrates movement of unbound ligand magnetic particles and a target material-ligand magnetic particle composite by an external magnetic field when the soft magnetic microstructure according to the present invention is in the form of a disk. FIG.
3 is a view showing a chain soft magnetic microstructure in which a plurality of soft magnetic microstructures in the form of a disk are linearly arranged for linear transfer of a target substance-ligand magnetic particle composite according to the present invention.
FIG. 4 is a view showing a series of soft magnetic microstructures in which half-disk type soft magnetic microstructures are continuously arranged for front and back movement of a target material-ligand magnetic particle composite according to the present invention. FIG.
FIGS. 5 and 6 illustrate a series of soft magnetic microstructures in which soft magnetic microstructures are successively arranged in an oblique direction for collecting or scattering target substance-ligand magnetic particle composites according to the rotation direction of an external magnetic field according to the present invention. A drawing.
FIG. 7 is a graph showing an image of an amphoteric ligand bound to hepatocarcinoma cell line and GIBCO hepatocyte using a hepatoma cell line platemaker-based biochip according to the present invention and a primary screened platameric ligand
FIG. 8 is a graph showing the results of confirming the reactivity of hepatocellular carcinoma cell line and GIBCO hepatocyte cell line by screening the screened hepatocellular tumor uterus ligand according to the present invention with a fluorescent substance
FIG. 9 is a graph showing the results of confirming the degree of binding between liver cancer cell line and GIBCO hepatocyte using the screened hepatoma cell line tamameri ligand according to the present invention. FIG.
Fig. 10 shows an example of human cdk2 siRNA according to the present invention
11 shows the effect of cdk2 siRNA according to the present invention on cdk2 mRNA expression of liver cancer cell line.
12 is a graph showing the effect of the hepatocarcinoma cell line tamam ligand-cdk2 siRNA complex according to the present invention on the expression of cdk2 mRNA in liver cancer cell line

Hereinafter, a ligand screening system using the soft magnetic microstructure according to the present invention will be described in detail. The following examples are illustrative of the present invention but are not intended to limit the scope of the present invention.

First, a ligand screening system 1 using the soft magnetic microstructure according to the present invention will be described with reference to FIG.

1, the apparatus 1 according to the present invention basically comprises a reaction module 2, a magnetic force generating module 3, a transfer module 4 and an analysis module 5. [

The reaction module (2) reacts a ligand magnetic particle library composed of a plurality of test compounds with the target substance, which is the biochemical system, to form a reaction mixture comprising unbound ligand magnetic particles and a target substance-ligand magnetic particle composite (300) . In the reaction module (2), the target substance-ligand magnetic particle composite (300) of the reaction mixture may be washed with a washing solution to separate non-specific or relatively weakly bound ligand magnetic particles to prepare a reaction mixture.

Wherein the target substance is a biochemical system including a single molecule, a virus, a cell, a bacterium, and the like. As used herein, the term "biochemical system" generally refers to a chemical interaction involving molecules of the type commonly found in living organisms. Such interactions include a full range of catabolism and assimilation reactions that occur in the survival system, including enzyme binding, signaling, and other reactions. In addition, the biochemical system defined in this disclosure also includes a model system that mimics certain biochemical interactions. Examples of biochemical systems of particular interest in the practice of the present invention include model barrier systems for receptor-ligand interactions, enzyme-substrate interactions, cell signaling pathways, bioavailability screening (e.g., Fractionation), and a variety of other common systems. Cell or organism viability or activity can also be screened, for example, in the toxicology experiment using the methods and apparatus of the present invention. The biological material to be assayed may be selected from the group consisting of cells, cell fractions (membranes, cytosol preparations, etc.), agonists and antagonists of cell membrane receptors (e.g., cell receptor-ligand interactions such as transferrin, c-kit, viral receptor ligands (CD4-HIV), cytokine receptors, chemokine receptors, interleukin receptors, immunoglobulin receptors and antibodies, the cadherin family, the intergrin family, the selectin family, etc. See Pigott and Power (1993) The Adhesion Molecule FactsBook Academic Press New York and Hulme (ed) Receptor Ligand Interactions A Practical Approach Rickwood and Hames (series editors) IRL Press at Oxford Press NY), toxins and toxins, viral epitopes, hormones Mediates the effect of a variety of small ligands, including, for example, corticosteroids, opioids, steroids, etc.), intracellular receptors (e.g., steroids, thyroid hormones, retinoids and vitamin D ; Burn et al., (1989), Ann, Rev. Physiol., ≪ RTI ID = 0.0 > (D- or L-) polymers, enzymes such as enzymes, enzymes, enzymes, enzymes, enzymes, enzymes, But are not limited to, enzymatic substrates, cofactors, drugs, lectins, sugars, nucleic acids (both linear and spherical polymer arrangements), oligosaccharides, proteins, phospholipids and antibodies.

The ligand is characterized by being a substance binding to a target substance including an organic substance, a protein, a peptide, an ultramammer, and the like. The term "ligand" as used herein refers to a compound that is screened for its ability to affect a particular biochemical system. The test compound may be a chemical compound, a mixture of chemical compounds such as a polysaccharide, a small organic or inorganic molecule, a biological macromolecule such as a peptide, a protein, a nucleic acid, an abstamer or bacteria, a plant, a fungus, Extracts prepared from tissues, natural or synthetic compositions, and the like.

The magnetic force generating module 3 controls the external magnetic field 100 to magnetize the following soft magnetic fine structures 200 and the unmated ligand magnetic particles and the target material-ligand magnetic particle composite 300, And an electrode arrangement spaced apart from the electrode array. The magnetic force generating means according to the present invention controls the external magnetic field 100 to magnetize the soft magnetic fine structure 200 and the magnetic particles. For example, the magnetic force generating means can change the direction of rotation of the external magnetic field 100 clockwise or counterclockwise.

The transfer module 4 generates an internal magnetic field 400 when magnetized by the external magnetic field 100 and controls the movement of the target substance-ligand magnetic particle composite 300 along the magnetization direction 500 A module 4 consisting of a soft magnetic microstructure 7, a loading well 6 for loading the reaction mixture at one end and a sensing location 8 for transporting the target substance-ligand magnetic particle complex to the other end )to be. The soft magnetic microstructure 200 generates an internal magnetic field 400 when magnetized by the external magnetic field 100 and generates the internal magnetic field 400 in accordance with the magnetization direction 500 of the soft magnetic microstructure 200, ).

The soft magnetic microstructure 200 may be formed by patterning a soft magnetic thin film of any one of NiFe, Fe, Ni, and Co.

3 to 4, the soft magnetic microstructure 200 according to an embodiment of the present invention includes a target material-ligand magnetic particle composite 300, So that the soft magnetic microstructure 7 can be constituted.

As shown in FIG. 2, as the external magnetic field 100 rotates, the magnetization direction of the soft magnetic microstructure 200 changes. The difference in force of the internal magnetic field 400 attracts the partially magnetized target material-ligand magnetic particle composite 300 to the pole of the soft magnetic microstructure 200 where the stronger internal magnetic field 400 is present. That is, the attracting force between the soft magnetic microstructure 200 and the target material-ligand magnetic particle composite 300 depends on the aspect ratio of the soft magnetic microstructure 200 and the various internal magnetic fields 400 in different directions .

As shown in FIG. 2, the soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local magnetic field 400 due to the geometry and softness of the soft magnetic microstructure 200. In this case, due to the difference in the force of the internal magnetic field 400, the target substance-ligand magnetic particle composite 300 moves to the pole of the soft magnetic microstructure 200 having the strongest force of the internal magnetic field 400.

That is, the soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local internal magnetic field 400 by a geometrical structure and softness, and generates a local magnetic field by the external magnetic field 100 rotating or vibrating, The magnetic particle composite 300 can be moved.

FIG. 3 is a diagram showing a chain soft magnetic microstructure 7 in which a soft magnetic microstructure in the form of a disk is continuously arranged for linear transport of a target material-ligand magnetic particle composite according to an embodiment of the present invention.

As shown in FIG. 3, the local difference in the force of the internal magnetic field 400 when the external magnetic field 100 rotates governs the movement of the target material-ligand magnetic particle composite 300. That is, the target material-ligand magnetic particle composite 300 is moved along the magnetization direction of each soft magnetic microstructure 200 and is moved to another soft magnetic microstructure 300 adjacent to the one soft magnetic microstructure 300 300).

When the external magnetic field 100 rotates clockwise or counterclockwise as shown in FIG. 3 and the soft magnetic microstructure 200 is in the form of a disk and the soft magnetic microstructure 200 is in the fluid channel, Ligand magnetic particle composite 300 to a specific location in the fluid channel.

According to an embodiment of the present invention, as shown in FIG. 3, when the external magnetic field 100 rotates clockwise and the target material-ligand magnetic particle composite 300 is positioned above the soft magnetic fine structure 200 The target material-ligand magnetic particle composite 300 is advanced.

In addition, when the external magnetic field 100 rotates clockwise and the target material-ligand magnetic particle composite 300 is located below the soft magnetic microstructure 200, the target material-ligand magnetic particle composite 300 moves backward .

The direction of movement of the target material-ligand magnetic particle composite 300 in the path as shown in FIG. 3 is determined by the geometry of the soft magnetic microstructure 200 and the position of the target material-ligand magnetic particle composite 300 .

FIG. 4 is a view showing a continuous microstructure 7 in which a half-disk type soft magnetic microstructure is continuously arranged for front-back movement of a target substance-ligand magnetic particle composite according to the present invention.

As shown in FIG. 4, the target material-ligand magnetic particle composite 300 can be moved forward or backward according to the rotation direction of the external magnetic field 100. The movement of the target material-ligand magnetic particle composite 300 shown in FIG. 4 as compared to the movement of the target material-ligand magnetic particle composite 300 shown in FIG. 3 occurs only by the direction of rotation of the external magnetic field 100 There is a difference.

As shown in FIG. 4, when the external magnetic field 100 rotates in a clockwise direction and the soft magnetic microstructure 200 is in the form of a half-disk, the target material-ligand magnetic particle composite 300 moves forward. In addition, when the external magnetic field 100 rotates counterclockwise and the soft magnetic microstructure 200 is in the form of a half-disk, the target material-ligand magnetic particle composite 300 proceeds backward.

FIGS. 5 to 6 show a series soft magnetic structure 7 in which soft magnetic microstructures for collecting or scattering micro beads are continuously arranged in an oblique direction according to the rotation direction of an external magnetic field according to an embodiment of the present invention. Fig.

When the external magnetic field 100 rotates clockwise and the soft magnetic microstructures 200 are arranged diagonally as shown in FIGS. 5 to 6, the target material-ligand magnetic particle composites 300 are arranged such that the slant lines And concentrated in the middle. In addition, when the external magnetic field 100 rotates counterclockwise and the soft magnetic microstructures 200 are arranged diagonally, the target material-ligand magnetic particle composites 300 are dispersed from the portion where the oblique lines converge to the center .

In this case, it is preferable that the center of the slanting line is formed as a sensing location in the fluidic microchip. According to the present invention, it is possible to induce the path change of the target substance-ligand magnetic particle composite only by forming a minute magnetic force. In addition, according to the present invention, a lab-on-a-chip can be implemented by performing a series of bio-analysis processes in a microfluidic chip.

The analysis module 5 includes a module for screening the ligand from the target material-ligand magnetic particle complex 300 delivered from the transfer module 4 and / or analyzing the effect of the screened ligand on the biological activity of the target material to be.

The analysis module 5 can be used for screening ligands, analyzing the effect of the screened ligand magnetic particles on the biological activity of the target material, which is the biochemical system, and for qualitative analysis of the target material, Biochemical analysis, molecular biology analysis, genome analysis, and protein body analysis. As described above, the screening method of the present invention is generally performed in a fine fluidic device or "microtest experimental system ", which performs the assay, automation, and environmental impacts of the assay system, , Human error, and so on. Numerous apparatus for performing the assay and qualitative quantification methods of the present invention are described in the Detailed Description section below. However, it can be seen that the specific arrangement of such devices generally depends on the type of assay and / or the desired assay orientation. For example, in some embodiments, the screening method of the present invention can be performed using a fine fluidic device having two crossed channels. For more complex black or black orientations, multiple channel / crossing devices are used arbitrarily. The low range of integration and self-containment characteristics of this device ultimately takes into account any calibration arrangement that is intended to be realized in the environment of the microtest system.

Hereinafter, the present invention will be described by way of specific examples.

Example 1 Preparation of ligand magnetic particle library

The first step of the method for screening a ligand using the soft magnetic microstructure according to the present invention is a ligand magnetic particle library composed of a plurality of different compounds, that is, a single-stranded nucleic acid having a random base sequence in this embodiment (hereinafter, (Hereinafter referred to as " aptamer ligand ") that binds to a target substance that is a biochemical system by reacting a single-stranded nucleic acid (hereinafter referred to as " random single-stranded nucleic acids "

Nucleic acid can serve as a ligand for a specific substance containing a protein, and it is possible to obtain a high binding force and specificity through a certain sorting process and a base sequence determination from a combined library of single-stranded nucleic acids arranged in various base sequences Nucleotides that bind to specific substances are being screened. A method for screening nucleic acids that bind to a specific substance is called SELEX (Systematic Evolution of Ligand by Exponential Enrichment), and the selected nucleic acid is called an aptamer (Tuerk C. and Gold L .; Science, 249, pp505-510, 1990), molecules capable of binding with very high affinity to a variety of biomolecules including proteins not capable of binding nucleic acids in a natural state, as well as nucleic acids, are selected through SELEX have.

A double-stranded DNA was prepared by PCR using a single-stranded DNA oligonucleotide having a random base sequence as shown below, and the single-stranded RNA library (random single-stranded nucleic acids ).

 5'-GGGAGAGCGGAAGCGTGCTGGGCC N40 CATAACCCAGAGGTCGATGGATCC CCCC-3 '(Here, the underlined nucleotide sequence is a fixed region of the nucleic acid library, and N40 means that bases such as A, G, T and C exist at each position.

The FW primer (5'-GGGGGAATTCTAATACGACTCACTATAGGGAGAGCGGAAGC GTGCTGGG-3 ': SEQ ID NO: 1) used for PCR (Polymerase Chain Reaction) can bind to the 5' end of the underlined nucleotides of the above base sequence and can bind to the RNA polymer of bacteriophage T7 Lt; / RTI > nucleotides.

The RE primer of the PCR (5'-GGGGGGATCCATCGACCTCTGGGTTATG-3 ': SEQ ID NO: 2) can bind to the 3' end of the underlined nucleotides of the above base sequence. The FW and RE primers contain restriction enzyme cleavage sequences such as EcoRI and BamHI for subsequent cloning, respectively.

Random single-stranded nucleic acids to be reacted with a biological sample are RNA libraries containing 2'-F-substituted pyrimidines. DNA nucleic acid library transcripts and PCR primers were designed and prepared as described above and prepared by PCR and in vitro transcription method.

PCR was carried out in the presence of a primer pair (5P7) of 1,000 pmoles single-stranded nucleic acid transcripts and 2,500 pmoles of PCR in 50 mM KCl, 10 mM Tris-Cl (pH 8.3), 3 mM MgCl2, 0.5 mM dNTP (dATP, dCTP, dGTP, and dTTP ) And 0.1 U Taq DNA Polymerase (Perkin-Elmer, Foster City Calif.) And purified with a QIAquick-spin PCR purification column (QIAGEN Inc., Chatsworth Calif.).

Random single-stranded nucleic acids containing 2'-F-substituted pyrimidines were prepared by in vitro transcription and purified. 200 pmoles double-stranded DNA transcript, 40 mM Tris-Cl (pH 8.0), 12 mM MgCl2, 5 mM DTT, 1 mM spermidine, 0.002% Triton X-100, 4% PEG 8000, 5 U T7 RNA Polymerase and 1 mM ATP, GTP and 3 mM 2'F-CTP and 2'F-UTP were reacted at 37 for 6 to 12 hours and purified with a Bio-Spin 6 chromatography column (Bio-Rad Laboratories, Hercules Calif.), The amount of purified nucleic acid and its purity were retrieved using a UV spectrometer.

Biotin was attached to the 3-terminal of the prepared RNA single-stranded nucleic acid with a T4 RNA ligase (Thermo Scientific Pierce RNA 3 End Biotinylation Kit) and purified by reacting with streptavidin to obtain a single strand of RNA as a ligand magnetic particle library A nucleic acid magnetic particle library was prepared.

Example 2. Preparation of a reaction mixture comprising a target material-ligand magnetic particle composite

The target material includes a single molecule, a virus, a cell, a bacterium, and the like as a biochemical system. In this embodiment, a hepatoma cell line (Hep3B) was used. In the reaction module (2) of the ligand screening system (1) using the soft magnetic microstructure of the present invention, the liver cancer cell line and the prepared RNA single stranded nucleic acid magnetic particle library were reacted to prepare a reaction mixture.

A concentration solution of 10 ¹⁵ base sequences / 1 of the random RNA single-stranded nucleic acid magnetic particle library synthesized above was added to a selective buffer (50 mM TrisCl (pH 7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2, 0.1% NaN3) at 80 for 10 minutes, and then left on ice for 10 minutes. The reaction solution was prepared by adding 5 times yeast tRNA (yeast tRNA, Life Technologies) and 0.2% BSA (bovine serum albumin, Merck) to the single strand nucleic acid used.

The RNA single-stranded nucleic acid magnetic particle library prepared above was treated with a liver cancer cell line and reacted for 30 minutes. The wash buffer of the liver cancer cell line-RNA single-stranded nucleic acid magnetic particle composites contained in the reaction mixture prepared above was 0 to 1 x Serex buffer or 0 to 500 mM EDTA solution. The RNA single-stranded nucleic acid binding to hepatocarcinoma cell line is isolated from RNA single-stranded nucleic acid magnetic particles which bind primarily to liver cancer cell line. After the reaction, To obtain liver cancer cell line-RNA single stranded nucleic acid magnetic particle complexes.

The reaction mixture was prepared by separating the RNA single-stranded nucleic acid ligand magnetic particles, which were nonspecific or relatively weakly bound in the liver cancer cell line-RNA single-stranded nucleic acid ligand magnetic particle complex using the washing solution.

Example 3. Separation of Target Material-Ligand Magnetic Particle Complex from Reaction Mixture

The reaction mixture comprising the liver cancer cell line-RNA single-stranded nucleic acid magnetic particle composite prepared in the reaction module 2 of the ligand screening system 1 using the soft magnetic microstructure of the present invention is applied to the transfer module 4 Magnetic force generating module 3 generates a magnetic force in the soft magnetic microstructure 200 so that only the cell lung cancer cell line-RNA single-stranded nucleic acid magnetic particle complex is reacted with the chain- Was transferred to a sensing location (8) located at the end of the structure (7). The transferred liver cancer cell line-RNA single strand nucleic acid magnetic particle complex was transferred to the analysis module 5 using the magnetic force generating module 3, and liver cancer cell line-RNA single strand nucleic acid ligand magnetic particle complex was harvested.

The DNA pool indicating the RNA single-stranded nucleic acid ligand binding to the liver cancer cell line was amplified by performing RT-PCR on the liver cancer cell line-RNA single-stranded nucleic acid ligand magnetic particle complex harvested in the analysis module (5).

At this time, the biomolecule-binding single-stranded nucleic acid magnetic particle library of biomolecule-binding RNA may be repetitively prepared by repeating the above-mentioned selection and amplification steps a plurality of times. The ligand magnetic particles may be amplified in the separated target substance-ligand magnetic particle complex to prepare the ligand magnetic particles, and the reaction step, the washing step, and the separation step may be repeated.

Example 4. Analysis of Ligand

In the process of securing a single clone by cloning the RT-PCR product DNA obtained in the analysis module 5 of the ligand screening system 1 using the soft magnetic microstructure of the present invention into a plasmid, a biomolecule-binding single-stranded nucleic acid . The nucleotide sequences of single-stranded nucleic acids that bind to these liver cancer cell lines were performed by standard methods.

Based on the nucleotide sequence, a hepatocellular cell line-based thamer-based biochip was prepared by a standard method, and the platamer binding to the hepatocellular cell line was fluorescently labeled and reacted with the hepatocellular carcinoma cell line and hepatocyte, Ligand was determined (Fig. 7). After confirming the secondary structure and structure free energy using the MFOLD program that models the secondary structure of the nucleic acid based on the nucleotide sequence of the single-stranded nucleic acids bound to the determined liver cancer cell line, the liver cancer cell line uterus ligand having the most stable secondary structure Were selected

Binding ability was observed at the cell level with the hepatocellular cell line tamam ligand screened above. The binding capacity of screened platelets, hepatocellular carcinoma cells and GIBCO hepatocytes was determined by binding a specific platelet to both cells and then amplifying the combined platemater for electrophoresis (FIG. 8). The stronger band in hepatocarcinoma cell line than the hepatocyte cell line indicates that the screened hepatocellular carcinoma tympanic ligand binds more strongly to liver cancer cell line than hepatocyte.

Example 5. Analysis of target material with screened ligand

The analysis module (5) in the ligand screening system (1) using the soft magnetic microstructure of the present invention was constructed with a fluorescence microscope to determine whether the liver cancer cell line tamameric ligand screened above specifically binds to the liver cancer cell line. Respectively. The screened hepatoma cell line uterus ligand was labeled with Rhodamine staining reagent and stained with liver cancer cell line and GIBCO hepatocyte and observed with an optical microscope to confirm that it binds specifically to liver cancer cell line and hardly binds to GIBCO hepatocyte (Fig. 9). Therefore, the hepatocellular carcinoma cell line can be distinguished from the hepatocellular carcinoma cell line by the above-described analysis with the screened hepatocellular carcinoma plastomer ligand.

Example 6. Determination of the ligand

The assay of the ligand with the assay module (5) in the ligand screening system (1) using the soft magnetic microstructure of the present invention is based on the analysis of the effect of the screened ligand on the biological activity of the target substance, Analysis, biochemical analysis, molecular biological analysis, genome analysis, and protein body analysis. In this example, the role of siRNA as a carrier was investigated using liver cancer cell line specific binding potamal ligand.

Four types of cdk2 siRNAs, which are highly expressed in cancer cells and inhibit the function of the cdk2 gene, which is known as a tumor gene, were prepared (Fig. 10).

After transfection of the prepared cdk2 siRNA into hepatocellular carcinoma cells, quantitative analysis of cdk2 mRNA by RNA isolation revealed that cdk2-1 siRNA> cdk2-2 siRNA> cdk2-4 siRNA> cdk2-3 siRNA functions in this order (Fig. 11).

The prepared cdk2 siRNA was bound to a hepatocarcinoma cell line specific platelet ligand to develop a complex specifically acting on hepatocellular carcinoma cell line (FIG. 12). Liver cancer cell line-specific platelet ligand-cdk 2 siRNA complex. 100 nM (1) and 250 nM (2) complexes were treated with 100 nM cdk 2 siRNA (3), and the cells were treated with no treatment (4) and cultured for 3 days Total RNA was isolated and quantitated by quantitative analysis of cdk2 mRNA. The upper figure shows transfection and the lower figure shows direct reagent treatment. Total RNA was isolated from each of them to quantitatively analyze cdk2 mRNA. When transfected, the amount of cdk2 mRNA was decreased in both hepatocarcinoma cell line-specific platelet ligand-cdk2 siRNA complex and cdk2 siRNA. In direct treatment, however, only hepatocellular carcinoma-specific platelet ligand-cdk 2 siRNA complexes reduced the amount of cdk2 mRNA. As a result, in the case of hepatocellular carcinoma-specific platelet ligand-cdk 2 siRNA complex, the platelet ligand in the complex specifically binds to the protein on the cell surface of hepatocellular carcinoma cell, migrates into the cell, acts as siRNA, Of the total population.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed exemplary embodiments, but, on the contrary, Modification is possible. Accordingly, the spirit of the present invention should be understood only in accordance with the following claims, and all equivalents or equivalent variations thereof are included in the scope of the present invention.

1: Screening system of ligand using soft magnetic microstructure
2: Reaction module
3: magnetic force generating module
4: Feed module
5: Analysis module
6: Loading place
7: chain soft magnetic microstructure
8: Location of detection
100: external magnetic field
200: soft magnetic microstructure
300: Target material-ligand magnetic particle complex
400: internal magnetic field
500: magnetization direction of soft magnetic microstructure

Claims (25)

A ligand screening system (1) using a soft magnetic microstructure for a target substance which is a biochemical system from a ligand magnetic particle library composed of a plurality of test compounds,
A reaction module (2) for reacting the ligand magnetic particle library with the target material to form a reaction mixture comprising unbound ligand magnetic particles and a target material-ligand magnetic particle composite (300);
A magnetic force generating module (3) for controlling the external magnetic field (100) to magnetize the following soft magnetic fine structure (200) and the unbound ligand magnetic particle and the target material - ligand magnetic particle composite (300);
A chain soft magnetic microstructure 7 that generates an internal magnetic field 400 when magnetized by the external magnetic field 100 and controls the movement of the target material-ligand magnetic particle composite 300 along the magnetization direction 500; , A loading module (6) for loading the reaction mixture at one end, and a sensing area (8) for transferring the target material-ligand magnetic particle complex at another end;
The unbound ligand magnetic particle and the target material-ligand magnetic particle composite 300 controlled to move by the internal magnetic field 400 generated as the soft magnetic fine structure 200 is magnetized; And
An analysis module 5 for analyzing the effect of the ligand separated from the transferred target substance-ligand magnetic particle complex 300 and / or the separated ligand on the biological activity of the target substance; Wherein the soft magnetic microstructures are used for screening a ligand using the soft magnetic microstructure. The method according to claim 1,
Wherein the soft magnetic microstructure (200) is formed by patterning a soft magnetic thin film of any one of NiFe, Fe, Ni, and Co. The system for screening a ligand using the soft magnetic microstructure according to claim 1, The method according to claim 1,
Wherein the soft magnetic microstructure (200) is embodied in the form of a disk, a turntable, and a half turntable. The method according to claim 1,
Characterized in that said chain soft magnetic microstructure (7) is cascaded to attract said target material-ligand magnetic particle composite (300) to a sensing location (8) in a fluidic microchip. Screening system of ligand. The method according to claim 1,
The soft magnetic microstructure (200) has a saturation magnetization of about 1 Tesla and has a length of 10 m or less. The system for screening a ligand using the soft magnetic microstructure. The method according to claim 1,
Wherein the degree of change of the internal magnetic field (400) is within a range of about 10 ⁴ T / m. The method according to claim 1,
The soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local magnetic field 400 due to geometry and softness and generates a local magnetic field 400 due to a difference in the force of the internal magnetic field 400, Ligand magnetic particle composite 300 is moved to a pole of the soft magnetic microstructure 200 having the strongest force of the internal magnetic field 400. The screening system of the ligand using the soft magnetic microstructure 300 is shown in FIG. The method according to claim 1,
The soft magnetic microstructure 200 magnetized by the external magnetic field 100 generates a local magnetic field 400 due to geometry and softness and generates the local magnetic field 400 by the external magnetic field 100, - ligand magnetic particle composite (300) is moved. The system for screening a ligand using the soft magnetic microstructure. The method according to claim 1,
When the external magnetic field 100 rotates clockwise or counterclockwise and the soft magnetic microstructure 200 is in the form of a disc and the soft magnetic microstructure 200 is in a fluid channel, Wherein the magnetic particle composite (300) is transferred to a specific position of the fluid channel. The method according to claim 1,
When the external magnetic field 100 rotates in a clockwise direction and the soft magnetic microstructure 200 is in the form of a half disk, the target material-ligand magnetic particle composite 300 moves forward, Ligand magnetic particle composite 300 is rotated in the counterclockwise direction and the target material-ligand magnetic particle composite 300 proceeds backward when the soft magnetic fine structure 200 is in the form of a half- Screening system. The method according to claim 1,
The soft magnetic microstructure 7 in which the external magnetic field 100 rotates in a clockwise direction and the soft magnetic microstructures 200 are arranged in a diagonal line has a structure in which the target material- And the soft magnetic microstructure (7), in which the soft magnetic fine structure (200) is arranged in a diagonal line, is concentrated to the target material-ligand magnetic particle And the complex 300 is dispersed from a portion where the slant line is collected in the middle. 12. The method of claim 11,
Wherein the portion of the slanting line that is collected in the center is a sensing site (8) in the fluidic microchip. In the first aspect,
Wherein the analysis module (600) comprises a device for analyzing a ligand. In the first aspect,
The analysis module 600 includes a device for performing a cytological analysis, a physiological analysis, a biochemical analysis, a molecular biological analysis, a genomic analysis, a proteomic analysis, etc. to analyze the effect of the ligand on the biological activity of the target substance A screening system for ligands using soft magnetic microstructures. A method for screening a ligand using a soft magnetic microstructure for a target substance, which is a biochemical system, from a ligand magnetic particle library composed of a plurality of test compounds,
Preparing a ligand magnetic particle library;
Reacting the ligand magnetic particle library with a target material in the reaction module (2) to prepare a reaction mixture comprising unbound ligand magnetic particles and a target material-ligand magnetic particle composite (300);
The reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 3 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Transferring the composite (300) to a sensing location (8) located at the distal end of the soft magnetic microstructure (7);
The target substance-ligand magnetic particle composite 300 transferred to the sensing location 8 is transferred to the analysis module 5 using the magnetic force generating module 3 to separate the target substance-ligand magnetic particle composite Separating and analyzing the ligand magnetic particles in the separated complex; Wherein the soft magnetic microstructure is coated with a ligand. The method according to claim 15,
And washing the target substance-ligand magnetic particle composite (300) of the reaction mixture with the washing solution in the reaction module (2) to separate the non-specific or relatively weakly bound ligand magnetic particles to prepare a reaction mixture A method for screening a ligand using the soft magnetic microstructure. The method according to claim 15,
Following the step of amplifying the ligand from the target material-ligand magnetic particle conjugate (300) transferred from the transfer module (4) to the analysis module (5) to prepare ligand magnetic particles; A reaction step; Washing step; And a separation step; Is repeated twice or more. The method for screening a ligand using the soft magnetic microstructure according to claim 1, A method for assaying a ligand using a ligand screening system (1) using a soft magnetic microstructure for a target substance, which is a biochemical system, from a ligand magnetic particle library composed of a plurality of test compounds,
Preparing the identified ligand magnetic particles;
Reacting the ligand magnetic particles with a target material in the reaction module (2) to prepare a reaction mixture comprising unbound ligand magnetic particles and a target material-ligand magnetic particle composite (300);
The reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 2 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Transferring the complex to a sensing location (8) located at the distal end of the soft magnetic microstructure (7); And
The separated target substance-ligand magnetic particle composite 300 is transferred to the analysis module 5 using the magnetic force generating module 2 to analyze the influence of the identified ligand magnetic particles on the biological activity of the target substance And assaying the ligand; The method of claim 1, wherein the soft magnetic microstructure is selected from the group consisting of: The method according to claim 18,
The verification of the ligand in the analysis module (5) analyzes the effect of the ligand magnetic particle on the biological activity of the target substance, and includes a cytological analysis, a physiological analysis, a biochemical analysis, a molecular biological analysis, Analysis of the ligand, and analysis of the ligand using the soft magnetic microstructure. A method for qualitative and quantitative determination of a target substance using a ligand screening system (1) using a soft magnetic microstructure for a biochemical system from a ligand magnetic particle library composed of a plurality of test compounds,
Preparing ligand magnetic particles that bind to the target material;
Preparing a reaction mixture comprising the target substance-ligand magnetic particle composite (300) by reacting the ligand magnetic particle with a sample in the reaction module (2); And
The reaction mixture is placed in a loading site 6 and a magnetic force is generated in the soft magnetic microstructure 200 in the magnetic force generating module 2 so that only the target material-ligand magnetic particle composite 300 in the reaction mixture Ligating magnetic particle composite (300) to an assay module (8) located at the distal end of the soft magnetic microstructure (7) to qualify and quantify the target material from the target substance-ligand magnetic particle complex (300); The method comprising the steps of: (a) forming a soft magnetic microstructure on a substrate; 20. The method of claim 20,
Ligand magnetic particle composite (300) in the sensing location (8) using the analysis module (5), characterized in that it comprises a device for qualitatively and quantitatively analyzing the target material from the target material- How to qualify and quantify materials. Wherein the target material is a biochemical system including a single molecule, a virus, a cell, a bacterium, etc. The ligand screening system using the soft magnetic microstructure. Wherein the ligand is a substance that binds to a target substance including an organic substance, a protein, a peptide, an ultramammal, and the like, and a ligand screening system using the soft magnetic microstructure. The ligand screening system using the soft magnetic microstructure, wherein the proved ligand magnetic particle is used as a leading material in drug development. Wherein the proved ligand magnetic particles are used as a material for qualitative and quantitative analysis of a target substance.

Images