KR20140131827A - Use of APE/Ref-1 and JAG1/Notch as a diagnostic marker of colon cancer - Google Patents

Abstract

The present invention relates to a novel diagnostic marker which can diagnose and predict colon cancer early and effectively, a diagnostic kit, a diagnostic method of colon cancer by using the diagnostic marker, a composition for treating colon cancer by using the marker material, and a screening method thereof. According to the present invention, expression amount of Ape1/Ref-1, Jagged1 and Notch3 proteins is improved in tissue or cells of colon cancer compared to normal tissue or cells. Accordingly, when using the proteins or genes coding the same as a diagnostic marker of colon cancer at the same time, the present invention can diagnose and predict colon cancer more precisely, and can be used as a target to develop a medicine for colon cancer.

Description

APE / Ref-1 and JAG1 / Notch as a diagnostic marker for colon cancer

The present invention relates to a novel colon cancer diagnostic marker, a diagnostic kit, a diagnosis method of colon cancer using the diagnostic marker, a composition for treating colorectal cancer using the marker substance, and a screening method thereof, which can effectively diagnose and predict colorectal cancer in an early stage .

Notch signaling pathways play an important role in determining the fate of cells and maintaining the number of progenitor cells as well as maintaining a balance between cell proliferation, differentiation, and apoptosis (Schroeter, et al. 1998. Notch -1 signaling requires ligand-induced proteolytic release of intracellular domain. Nature 393: 382-386). Abnormal activity of the Notch signaling pathway is associated with a variety of developmental disorders and cancers (Yin, et al. 2010. Notch signaling: emerging molecular targets for cancer therapy. Biochem Pharmacol 80: 690-701 and Miele, Notch signaling in cancer. Curr Mol Med 6: 905-918). The Notch signaling pathway is activated when a specific ligand such as Jagged1 binds to four related transmembrane Notch receptors. When ligands bind, Notch proteins are degraded by the gamma-secretase protease complex to secrete the Notch intercellular domain. The truncated Notch protein then migrates to the nucleus and regulates the expression of the target gene by interacting with DNA-binding factor CSL and transcriptional co-activating factors (also known as RBP-J and CBF-1) (Kopan, et al. 2009. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 137: 216-233). Because Notch mutations are rare in solid tumors (Qiao, L., Wong, BC 2009. Role of Notch signaling in colorectal cancer. Carcinogenesis 30: 1979-1986; and Wu, Y., et al. 2010. Therapeutic antibody (Park, et al., 2006. Notch3 gene amplification in ovarian cancer. Cancer Res 66: 6312-6318), reduction of negative regulatory factors (Pece, et al J Cell Biol 167: 215-221), and ligand-mediated activation (Leong, et al. 2007. Jagged 1-mediated Notch activation inducing epithelial-to- Other active mechanisms have been proposed, such as the mesenchymal transition through Slug-induced repression of E-cadherin. J Exp Med 204: 2935-2948. Notch signaling is required for maintenance of intestinal homeostasis and plays an important role in colon cancer development (Qiao, et al., 2009; van Es, JH, et al., 2005. Notch / gamma-secretase inhibition turns proliferative cells Nature 435: 959-963; and Fre, S., et al., 2005. Notch signals control the fate of immature progenitor cells in the intestine. Nature 435: 964-968). Recent studies have revealed cross-talk through beta-catenin-mediated transcriptional activation of the Notch ligand Jagged1 between the Notch and Wnt signaling pathways in colon adenomas. However, the signaling pathways involved in the upregulation of Notch activity have not yet been elucidated.

Ape1 / Ref-1 (apurinic / apyrimidinic endonuclease / redox factor-1) is a multifunctional protein that plays a role of restoring single-stranded DNA cleavage and Ap site. It also increases the DNA-binding activity of many transcription factors associated with cancer development and progression such as AP1, NF-B, p53, Egr1, c-Myb, HLF, and Pax-8 (Tell, et al. 2009; , et al., 2009). Ape1 / Ref-1 is frequently overexpressed in solid tumors, and the expression level and subcellular localization of Ape1 / Ref-1 are found in many cancers including breast, cervical, colon, liver, prostate, and osteosar And poor prognosis.

A number of studies have also reported that Ape1 / Ref-1 is associated with tumorigenicity of cancer cells. For example, Ape1 / Ref-1 plays a role in maintaining cell survival and proliferation in colorectal and breast cancer (Fung, H., and Demple, B. 2005. A vital role for Ape1 / Ref1 protein in repairing spontaneous DNA damage in human cells. Mol Cell 17: 463-470). Knockdown of the Ape1 / Ref-1 in ovarian cancer cells resulted in decreased proliferation in vitro and decreased growth in animal experiments (Fishel, et al. 2008. Knockdown of the DNA repair and redox signaling protein Ape1 / Ref-1 blocks ovarian cancer cell and tumor growth DNA Repair (Amst) 7: 177-186). In pancreatic cancer, Ape1 / Ref-1 inhibits cancer cell migration and invasion (Zou, GM, and Maitra, A. 2008. Small-molecule inhibitor of the AP endonuclease 1 / REF-1 E3330 inhibits pancreatic cancer cell growth and migration. Cancer Ther 7: 2012-2021; Kim, MH, et al. HJ 2009. Ape1 / Ref-1 induces glial cell-derived neurotropic factor (GDNF) responsiveness by upregulating GDNF receptor alpha1 expression. Mol Cell Biol 29: 2264-2277) , Growth inhibition (Fishel, et al 2011. Impact of APE1 / Ref-1 redox inhibition on pancreatic tumor growth. Mol Cancer Ther 10: 1698-1708). In addition, Ape1 / Ref-1 extinction significantly inhibits tumor promoter-induced colony formation of mouse epithelial cells in soft agar (Yang, et al. 2007. Redox effector factor-1, combined with reactive oxygen species, Inhibition of the Ape1 / Ref-1 redox domain inhibited tumor-associated endothelial cell growth and angiogenesis (Zou, et al. 2009). .The Ape-1 / Ref-1 redox antagonist E3330 inhibits the growth of tumor endothelium and endothelial progenitor cells: therapeutic implications in tumor angiogenesis. J Cell Physiol 219: 209-218). There is accumulating evidence that Ape1 / Ref-1 overexpression is associated with progression, and Ape1 / Ref-1 is therefore a potential target for anticancer drugs.

Therefore, the inventors of the present invention have investigated the effect of Ape1 / Ref-1 on the carcinogenesis in colon cancer.

Korean Patent Publication No. 2012-0063910

It is an object of the present invention to provide a colon cancer diagnostic marker comprising Ape1 / Ref-1, Jagged1 and Notch proteins.

Another object of the present invention is to provide a kit for colon cancer diagnosis using the markers.

It is another object of the present invention to provide a method for predicting and diagnosing colorectal cancer using the markers.

Another object of the present invention is to provide a method for screening a substance capable of preventing or treating colon cancer using the markers.

Another object of the present invention is to provide a composition for treating colon cancer which targets the markers.

In order to accomplish the object of the present invention, the present invention provides a marker for colon cancer diagnosis comprising an Ape1 / Ref-1 (Apurinic / apyrimidinic endonuclease / redox factor-1) protein or a polynucleotide encoding the protein .

In one embodiment of the present invention, the polynucleotide may have the nucleotide sequence of SEQ ID NO: 1.

The present invention also provides a colon cancer diagnostic marker comprising a Jagged1 protein or a polynucleotide encoding said protein.

In one embodiment of the present invention, the polynucleotide may have the nucleotide sequence of SEQ ID NO: 2.

The present invention also provides a colon cancer diagnostic marker comprising a Notch3 protein or a polynucleotide encoding said protein.

In one embodiment of the present invention, the polynucleotide may have the nucleotide sequence of SEQ ID NO: 3.

In addition, the present invention provides a colon cancer diagnostic kit comprising a substance for measuring the expression level of Ape1 / Ref-1, Jagged1 and Notch3.

In one embodiment of the present invention, the substance may be a primer set or a probe capable of amplifying genes encoding Ape1 / Ref-1, Jagged1 and Notch3 proteins, respectively.

In one embodiment of the present invention, the substance may be an antibody that specifically recognizes Ape1 / Ref-1, Jagged1 and Notch3 proteins, and the amino acid sequences of the Ape1 / Ref-1, Jagged1 and Notch3 proteins are SEQ ID NOS: 23, 24 and 25.

 The present invention also provides a method for diagnosing colon cancer using the marker of the present invention. (A) measuring the expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins present in a biological sample; And (b) comparing the measurement results of step (a) with Ape1 / Ref-1, Jagged1 and Notch3 expression levels of a control sample.

In one embodiment of the present invention, the biological sample may be selected from the group consisting of, for example, tissues, cells, blood, serum, plasma, saliva and urine.

In one embodiment of the present invention, the measurement may be performed using, for example, reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, Northern blot , Enzyme linked immunosorbent assay (ELISA), immunoblot analysis, immunohistochemical staining, radioimmunoassay (RIA), radioimmunodiffusion, and immunoprecipitation assay. But is not limited thereto.

The present invention also provides a method for screening a substance for the prevention or treatment of colorectal cancer using the marker of the present invention. The screening method comprises the steps of: (a) contacting a sample to be analyzed with colon cancer cells containing genes encoding Ape1 / Ref-1, Jagged1 and Notch3 proteins, respectively; (b) measuring the level or activity of the Ape1 / Ref-1, Jaggedl and Notch3 proteins; And (c) when the expression level or activity of the Ape1 / Ref-1, Jagged1 and Notch3 proteins is decreased as compared with the control, the sample is judged to be a substance for prevention or treatment of colon cancer .

In one embodiment of the present invention, the measurement of step (b) may be performed using, for example, a reverse transcriptase-polymerase chain reaction, a real time-polymerase chain reaction, Western blot, northern blot, enzyme linked immunosorbent assay, immunoblot analysis, immunohistochemical staining, radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay But is not limited thereto.

The present invention also provides a composition for treating colon cancer using the markers of the present invention. The composition includes a substance that inhibits the expression of Ape1 / Ref-1 protein and is characterized in that it has a mechanism of inhibiting tumor formation by inhibiting Notch signaling pathway mediated by Jagged1.

The expression levels of Ape1 / Ref-1, Jagged1 and Notch3 according to the present invention in tissues or cells of colorectal cancer were substantially increased at the same time compared to normal tissues or cells. Therefore, when the proteins or genes encoding them are simultaneously used as markers for colon cancer diagnosis, it is possible to more accurately diagnose and predict colon cancer, and further, it can be usefully used as a target for the development of a therapeutic agent for colon cancer.

FIG. 1 shows that the cell proliferation of APE / Ref-1 over-expressing cell line was markedly increased as compared with the control group after overexpression of APE / Ref-1 in human fibroblast cell line and the growth curve for 72 hours.
Figure 2 shows that APE / Ref-1 was overexpressed in human fibroblast cells and grown on soft agar medium for 14 days. As a result, the cells were observed to proliferate and form clusters similar to those of tumor cells, and they were proliferated more than 4 times when compared with the control group.
FIG. 3 shows a Wound-healing technique for overexpressing APE / Ref-1 in a human fibroblast cell line to examine its mobility. As a result, it was confirmed that the migration rate of APE / Ref-1 over-expressing cell line was fast, and that the APE / Ref-1 over-expressing cell line was almost completely filled with the scratched portion for 28 hours.
FIG. 4 shows the overexpression of APE / Ref-1 in human fibroblast cells to examine the membrane mobility. As a result, it was confirmed that the migration was increased about 8 times as compared with the control.
FIG. 5 shows western blotting of 4 groups of tumor cell lines (gastric cancer, glioma, lung cancer and pancreatic cancer) in order to examine the correlation between expression of APE / Ref-1 and JAG1 expression and Notch activity. As a result, it was observed that the expression of APE / Ref-1 and the activity of JAG1 and Notch1 were increased together.
6 to 13 show that APE / Ref-1 regulates tumor formation in human colorectal cancer cell lines, and FIG. 6 shows growth curves of DLD1 and KM12SM cells expressing control or Ape1 / Ref-1 shRNA and Western blot The results of the analysis. OD, optical density. Figure 7 shows nonadherent colony formation in a soft cloth by DLD1 and KM12SM cells expressing Ape1 / Ref-1 shRNA. Figure 8 shows migration and invasion of DLD1 and KM12SM cells. Data represent the average number of cells in five sites. Figure 9 shows the tube formation assay results obtained by culturing HUVECs. Figure 10 shows the growth of SW480 and HT29 cells transfected with control or Ape1 / Ref-1 expression vectors. Figure 11 shows colony formation of SW480 and HT29 cells in a soft cloth after 14 days of culture. Figure 12 shows the migration and invasion of SW480 and HT29 cells. Figure 13 shows the result of tube formation assay performed by culturing HUVECs.
Figures 14 and 15 are results showing that Ape1 / Ref-1 upregulates Jagged1 transcription. 14 ( A ) is a Venn diagram showing the number of common and specific Ape1 / Ref-1 target genes in migration, proliferation and angiogenesis of DLD1 and SW480 cells. Figure 14 ( B ) shows common genes associated with the three tumorigenic processes of Figure 14 ( A ). Jagged1 is one of them. Figure 14 ( C ) shows quantitative real-time RT-PCR results for the relative Jagged 1 mRNA of DLD1 cells transfected with control or Ape1 / Ref-1 siRNA and SW480 cells transfected with control or Ape1 / Ref-1 expression vectors to be. Figure 14 ( D ) shows Western blot analysis of Jaggedl expression in DLD1 and SW480 cells. 15 ( A ) is a Venn diagram showing the number of common and specific Ape1 / Ref-1 target genes involved in the migration, proliferation / differentiation of GM00637 cells. Figure 15 ( B ) shows seven common genes associated with the two biological processes of Figure 15 ( A ). Figure 15 ( C ) shows the relative expression of Jaggedl mRNA in GM00637 cells transfected with the control or Ape1 / Ref-1 expression vectors. 15 (D) shows the results of western blot analysis of Jagged1 expression in GM00637 cells.
FIGS. 16 to 20 show the results of Jagged1 expression and Notch signaling in colorectal cancer cells expressing Ape1 / Ref-1. Figure 16 is a Western blot analysis of Ape1 / Ref-1, Jagged1, truncated Notch1, truncated Notch2, truncated Notch3, and truncated Notch4 expression levels in 8 colorectal cancer cell lines. Fig. 17 ( A ) shows the results of analysis of Jaggedl mRNA levels in 8 colon cancer cell lines. 17 ( B ) shows the CBF-Luc promoter reporter luciferase assay in colon cancer cells. Indicating relative luciferase activity. Figure 18 ( A ) is the Western blot analysis of Ape1 / Ref-1, Jaggedl, and truncated Notch3 expression in four colorectal cancer cell lines transfected with control or Ape1 / Ref-1 siRNA. Figure 18 (B) shows the results of analysis of Jaggedl mRNA levels in four colorectal cancer cell lines transfected with control or Ape1 / Ref-1 siRNA. Figure 19 ( A ) is a Western blot analysis of Jagged1, truncated Notch1, and truncated Notch3 expression in SW480 and HT29 cells transfected with control or Ape1 / Ref-1 expression vectors. Figure 19 ( B ) shows the results of analysis of Jaggedl mRNA levels in SW480 and HT29 cells. 20 ( A ) is the result of CBF1-Luc promoter reporter luciferase assay in four colon cancer cell lines transfected with control or Ape1 / Ref-1 siRNA. Figure 20 ( B ) shows the results of performing the CBF-Luc promoter reporter luciferase assays in SW480 and HT29 cells transfected with control vector or Ape1 / Ref-1.
FIGS. 21-24 show that Ape1 / Ref-1 positively regulates Notch signaling through Jagged1. Fig. 21 ( A ) is a Western blot analysis result of Notch3 and Jaggedl expression cleaved in DLD1 and KM12SM cells treated with DMSO or DAPT. FIG. 21 ( B ) is a Western blot analysis result of Ape1 / Ref-1, Jagged1, and truncated Notch3 expression in DLD1 and KM12SM cells transfected with the siRNA. Figure 21 ( C ) is the result of CBF-Luc promoter reporter luciferase assay on DLD1 and KM12SM cells transfected with control or Jaggedl siRNA. Figure 22 ( A ) is the Western blot analysis of Ape1 / Ref-1, Jaggedl, truncated Notchl, and truncated Notch3 expression in SW480 and HT29 cells transfected with control or Jaggedl expression vectors. Figure 22 ( B ) shows the result of CBF-Luc promoter reporter luciferase assay in SW480 and HT29 cells. Figure 23 ( A ) is the Western blot analysis of Jaggedl and active Notchl expression in SW480-Ref-1 and HT29-Ref-1 cells transfected with control or Jaggedl siRNA. FIG. 23 ( B ) shows the result of CBF-Luc promoter reporter luciferase assay in SW480-Ref-1 and HT29-Ref-1 cells. Figure 24 ( A ) shows the results of western blot analysis of Ape1 / Ref-1, Jaggedl and truncated Notch3 expression in DLD1 and KM12SM cells transfected with the vector. Figure 24 ( B ) shows the results of CBF-Luc promoter reporter luciferase assay on Ref-1-shRNA DLD1 and Ref-1-shRNA-KM12SM cells transfected with control or Jaggedl expression vectors.
Figures 25-28 show that the tumorigenic effect of Ape1 / Ref-1 is mediated by Jaggedl . Figure 25 shows the growth of SW480-Ref-1 and HT29-Ref-1 cells transfected with control or Jaggedl siRNA. Jagged1 and Ape1 / Ref-1 expression in cell lysates were examined by Western blot. OD, optical density. Figure 26 (A) shows colony formation in a soft cloth after 14 days of culture in SW480-Ref-1 and HT29-Ref-1 cells. Figure 26 (B) shows the migration and invasion of SW480-Ref-1 cells transfected with siRNA. Fig. 26 (C) is a result of tube formation assays performed by culturing HUVECs in the tube formation of SW480-Ref-1 cell supernatant. Figure 27 shows the growth of Ref-1-shRNA-DLD1 and Ref-1-shRNA-KM12SM cells transfected with control or Jaggedl expression vectors. Western blot analysis was performed on Jaggedl and Ape1 / Ref-1 expression in cell lysates. Fig. 28 (A) is a result of colony formation on a soft cloth after 14 days of culturing of Ref-1-shRNA-DLD1 and Ref-1-shRNA-KM12SM cells. Figure 28 (B) shows the migration and invasion of Ref-1-shRNA-DLD1 cells. Fig. 28 (C) is a result of the tube formation assay of Ref-1-shRNA-DLD1 cells.
Figures 29-32 show that Ape1 / Ref-1 regulates tumor growth and metastasis through Jaggedl in a mouse model. 29 ( A ) shows a DLD1 cell subcutaneously injected into a nude mouse. Each condition was repeated three times independently. Immunofluorescence analysis of Ape1 / Ref-1 and Jagged1 in nude mouse tumors injected with DLD1 cells (below). 29 ( B ) shows a growth curve of a nude mouse injected with DLD1 cells. Tumor size was expressed as mean ± SD. 30 ( A ) shows a nude mouse in which SW480 cells were injected into the right flank. Immunofluorescence analysis of Ape1 / Ref-1 and Jagged1 was performed on tumors of nude mice injected with cells (below). Fig. 30 ( B ) is a growth curve of a nude mouse injected with SW480 cells. Tumor size was expressed as mean ± SD. FIG. 31 shows DLD1-RFP cells, FIG. 32 shows the results of fluorescence expression of metastasis to the lung of BALB / c mice injected intraperitoneally into SW480-RFP cells and lung cancer, respectively. The photo was taken on the 28th day. Immunohistochemical analysis showing RFP fluorescence in lung tissue sections of mice injected with DLD1-RFP or SW480-RFP cells is shown below.
Figure 33 shows the correlation between Ape1 / Ref-1 and Jaggedl expression in human colorectal cancer cells. Immunohistochemical analysis of Ape1 / Ref-1 and Jagged1 in human colon cancer and surrounding normal tissue is shown. Brown staining positively showed Ref-1 and Jagged1.

The present invention relates to the use of APE / Ref-1 (apurinic / apyrimidinic endonuclease / redox factor-1), JAG1 ligand and Notch3 receptor as colon cancer diagnostic markers.

In the present study, the expression of Ape1 / Ref-1 in cancer patients was generally reported (Kelly, et al., 2001; Wang, et al. 2007; Noike, et al., 2008; Kakolyris, et al., 1998). However, the precise role played by tumorigenicity mechanisms in addition to the association between Ape1 / Ref-1 and cancer progression remains to be elucidated. Thus, the present inventors have completed the present invention by demonstrating the positive regulatory effect of Ape1 / Ref-1 on growth and carcinogenesis in immortalized human fibroblasts and colon cancer cells. Knockdown of Ape1 / Ref-1 in DLD1 and KM12SM cells significantly reduced cell proliferation and tumor development. Conversely, overexpression of Ape1 / Ref-1 in SW480 and HT29 cells as well as in GM00637 cells promoted progression of cancer. The in vivo experimental results were also consistent with the in vitro experimental data. That is, after injecting Ape1 / Ref-1 deficient DLD1 cells into nude mice, lung tumor growth and metastasis were significantly reduced compared to the control. On the other hand, tumor growth and metastasis of Ape1 / Ref-1-overexpressing SW480 cells in nude mice increased significantly. These results demonstrate that Ape1 / Ref-1 induces transformation in SW480 cells, thereby increasing invasion and mobility and thus lung metastatic potential. Thus, Ape1 / Ref-1 can be a novel target gene in the treatment of colorectal cancer.

Further, the present inventors identified the Notch ligand Jagged1 as a direct transcriptional target of Ape1 / Ref-1. Jagged1 is known to be upregulated in several cancers including prostate cancer, breast cancer, ovarian cancer and rectal cancer (Guilmeau, et al. 2010. Heterogeneity of Jagged1 expression in human and mouse intestinal tumors: implications for targeting Notch signaling. Oncogene 29: 992-1002; Reedijk, et al 2005. High-level coexpression of JAG1 and NOTCH1 has been observed in human breast cancer and associated with poor overall survival. Cancer Res 65: 8530-8537; Santagata, et al 2004 Jagged-1 and Notch3 juxtacrine loop regulates ovarian tumor growth and adhesion. Cancer Res 68: 5716-5723). It is related to cancer progression. (Sedim et al., 2004). Tumor cells were overexpressed in prostate and breast cancer patients with poor prognosis and showed osteolytic bone metastasis in breast cancer (Reedijk, et al., 2005; -derived JAGGED1 promotes osteolytic bone metastasis of breast cancer by engaging notch signaling in bone cells. Cancer Cell 19: 192-205). In the intestine, Jagged1 expression is confined to enteroendocrine cells in the normal human intestinal epithelium and increased in approximately 50% of human colorectal cancers. In recent years, it has been reported that Notch activity is essential for the development of intestinal tumors, along with Wnt-mediated upregulation of Jagged1 (Pannequin, et al. 2009. The wnt target jagged-1 mediates the activation of notch signaling by progastrin in human colorectal cancer cells. Cancer Res 69: 6065-6073). Thus, the expression level of Jagged1 in other types of colorectal cancer appears to be positively correlated with pathological grade and metastatic status.

The present inventors have confirmed that Ape1 / Ref-1 expression is quantitatively correlated with Jagged1 and truncated Notch expression in human colorectal cancer cells. Notch signaling was activated in Jagged1-upregulated colorectal cancer cells by overexpression of Ape1 / Ref-1, and Jagged1 expression in A [beta] 1 / Ref-1 overexpressed colorectal cancer cell line and nude mice resulted in tumor growth and lung metastasis And malignant features. Conversely, the knockdown of Ape1 / Ref-1 in colorectal cancer cells did not result in Jagged1 / Notch signaling, which resulted in decreased tumor growth and metastasis, as well as cell proliferation, migration, invasion and angiogenesis . Jagged1 expression in Ape1 / Ref-1-knockdown cells partially restored these tumorigenic features. The results of the present invention show that Ape1 / Ref-1 is a major regulator of the Jagged1 / Notch signaling pathway in colorectal cancer and is a key component of colorectal cancer progression induced by upregulation of Jagged1 expression.

In addition, the present invention shows that knockdown or overexpression of Jaggedl has a significant effect on activation of Notch signaling in colorectal cancer cells. However, Jagged1 expression was not affected by the pharmacological or chemical inhibitor of the Notch receptor, indicating that Jagged1 is a positive regulator of Notch signaling in colorectal cancer. We also found that Ape1 / Ref-1-mediated Jagged1 transcription increased with increasing Egr1 transcription factor binding to the Jagged1 promoter and increased Jagged1 levels with increased expression of Ape1 / Ref-1 in colon cancer following Egr1 knockdown Downward regulation. These results indicate that Ape1 / Ref-1 increases Egr1 activity and activates the Notch signaling pathway through a mechanism that upregulates Jagged1 expression in the transcriptional stage.

In one embodiment of the present invention, the inventors of the present invention used a full-length Ref-1 (GM00637-Ref-1) or a control group in order to measure the effect of Ape1 / Ref- GM00637 cell lines (immortalized human fibroblasts) were prepared.

First, the effect of Ape1 / Ref-1 overexpression on cell growth was measured in low-serum (1% FBS) medium. Compared to control cells, GM00637-Ref-1 cells were more easily identified and proliferated well. Next, the effect of Ape1 / Ref-1 on anchorage-independent growth was examined through a soft agar colony formation assay. Control cells produced only a few colonies on a soft cloth. In contrast, GM00637-Ref-1 cells formed numerous colonies after 4 weeks, indicating that Ape1 / Ref-1 induces a trait change. Additionally, as a result of wound-healing assay and Transwell assay, Ape1 / Ref-1 overexpression increased the mobility of GM00637 cells.

In one embodiment of the present invention, the effect of Ape1 / Ref-1 on the progression of colorectal cancer was examined. Western blot analysis of Ape1 / Ref-1 expression levels in different human colon cancer cell lines revealed that Ape1 / Ref-1 was expressed at high levels in NCI-H548, NCI-H716, DLD1, KM12SM, and KM12C cells , SW480, HT29, and NCI-H747 cells (Fig. 16, lane 1).

In order to investigate the effect of Ape1 / Ref-1 on the tumor formation of colon cancer cells, the effect of Ape1 / Ref-1 removal on the non-adherent proliferation and growth ability of these cells was analyzed. In order to produce a cell line expressing stably reduced levels of Ape1 / Ref-1, siRNAs were used to temporarily decrease Ape1 / Ref-1 protein levels and DLD1 and KM12SM colon cancer cell lines were used to increase knockdown efficiency . Thus, shRNA constructs encoding the Ape1 / Ref-1-target shRNA were made and the stable Ape1 / Ref-1 knockdown DLD1 (Ref-1-shRNA / DLD1) and KM12SM (Ref-1-shRNA / KM12SM) . Cell proliferation significantly decreased with the removal of Ape1 / Ref-1 (FIG. 6), and colony formation by DLD1 and KM12SM cells was also significantly reduced in soft agar (FIG. 7). In addition, DLD1 and KM12SM cells in which Ape1 / Ref-1 was removed showed about 60-80% reduction in migration and penetration ability compared to the control (Fig. 8). Ape1 / Ref-1-depleted neovascularization was also significantly inhibited in DLD1 and KM12SM cells (Fig. 9). These results indicate that Ape1 / Ref-1 regulates the tumorigenic action of colorectal cancer cells. We next examined the effect of epeopic expression of Ape1 / Ref-1 on the tumorigenesis of SW480 and HT29 colon cancer cell lines with low levels of endogenous Ape1 / Ref-1. After transfection with the Ape1 / Ref-1 cDNA expression constructs, SW480 (SW480-Ref-1) and HT29 (HT29-Ref-1) cells underwent cell proliferation (Figure 10), colony- ), Penetration and migration ability (Fig. 12), and angiogenesis (Fig. 13). These results also show that expression of endogenous Ape1 / Ref-1 plays an important role in maintaining proliferation, migration, invasion and angiogenic potential in colorectal cancer cells.

In order to investigate the effect of Ape1 / Ref-1 on gene expression regulation and the resulting colon cancer progression, cDNA microarrays were performed to determine whether SW480Ref-1, Ref-1shRNA / DLD1, , Especially in SW480-Ref-1 cells, but decreased in Ref-1-shRNA / DLD1 cells. Using the 3-fold induction threshold in SW480Ref-1 cells and the 1.5-fold reduction threshold in Ref-1shRNA / DLD1 cells, 81 genes were matched to the above criteria. Using ontology consisting of proliferation, migration, and neovascularization, we found four genes that met the above three biological criteria (Figure 14, A and B). Among them, there have been previous studies showing that Notch signaling is associated with human colorectal cancer (Qiao, L., and Wong, 2009; Rodilla, et al. Koduru, et al, 2010), and the Notch ligand, Jagged1. Expression microarray profiling of the control and Ref-1-GM00637 cells was also performed. A Venn diagram containing genes expressed at 3-fold increase in Ref-1-GM00637 cells identified seven common genes involved in migration and proliferation / differentiation (Fig. 15, A and B). Importantly, Jagged1 has also been shown to be up-regulated in Ref-1-overexpressing GM00637 cells and further suggests that Jagged1 may be a downstream target of Ape1 / Ref-1. In order to confirm the microarray data, the expression level of Jagged1 was examined through real-time RT-PCR and Western blot analysis on Ref-1-shRNA / DLD1 and SW480-Ref-1 cells. Both Jagged1 mRNA (Fig. 14C) and protein (Fig. 14D) levels were upregulated and downregulated, respectively, by transfection of Ape1 / Ref-1 siRNA or Ape1 / Ref-1 expression vectors. In addition, we confirmed the upregulation of Jaggedl by Ref-1 in GM00637 cells (Fig. 15, C and D).

To confirm the correlation between expression levels of Ape1 / Ref-1 and Jagged1 in colorectal cancer, Western blot and real-time RT-PCR analysis were performed on a number of different colon cancer cells. Ape1 / Ref-1 and Jaggedl were coexpressed in human colon cancer cell lines. Expression of Jagged1 protein (Fig. 16) and Jaggedl mRNA (Fig. 17A) was increased in human colorectal cancer with high expression level of Ape1 / Ref-1 including NCI-H548, NCI-H716, DLD1, KM12SM and KM12C. On the other hand, Jaggedl protein and Jaggedl mRNA were hardly expressed in human colorectal cancer cells expressing low Ape1 / Ref-1 expression levels, including SW480, HT-29, and H747. Also, SNU638, AGS, SNU216, and SNU484 (stomach cancer); DMS53, H460, H1299, Calu-1, and SK-MES-1 (lung cancer); U87, U373, M059J, and M059K (glioma); And endogenous levels of Ape1 / Ref-1 and Jagged1 in 17 human cancer cell lines, including PANC-1, ASPC-1, MIAPaCa-2 and BXPC-3 (pancreatic cancer). Ape1 / Ref-1 and Jagged1 did not coexpress in some gliomas and pancreatic cancers, but Ape1 / Ref-1 was expressed almost simultaneously with Jagged1 in gastric and lung cancer cell lines.

Notch signaling is activated when a particular ligand such as Jagged1 binds to four related transmembrane receptors, Notch1-Notch4, after which the Notch protein is cleaved (Kopan, R., and Ilagan, MX 2009) . Therefore, experiments were performed to determine the cleaved form of Notch protein by Western blot analysis in 8 colorectal cancer cell lines. Activated Notch3 was found at higher levels in Ape1 / Ref-1 expressing colon cancer cell lines and lower in Ape1 / Ref-1 expressing colon cancer cell lines (Fig. 16).

Notch activation levels were then quantified by luciferase activity by a Notch-dependent CBF1-responsive reporter transfected into a colon cancer cell line. The activity of the CBF1-dependent luciferase reporter gene was higher in high colorectal cancer cell lines expressing Ape1 / Ref-1 as compared to the activity of colorectal cancer cell lines expressing low levels of Ape1 / Ref-1 (Fig. 17B).

Based on the above results, the present inventors examined whether knockdown or overexpression of Ape1 / Ref-1 causes abnormal Jagged1 / Notch signaling pathway activity. The Ape1 / Ref-1 siRNA was transfected into colon cancer cells including NCI-H716, DLD1, KM12SM, and KM12C to knock down Ape1 / Ref-1 and the Jagged1 protein (Fig. 18A) and Jaggedl mRNA The level dropped sharply. In contrast, levels of Jaggedl mRNA (Fig. 19A) and Jaggedl protein (Fig. 19B) in Ape1 / Ref-l-overexpressing SW480 and HT29 cells were rapidly increased. This implies that Ape1 / Ref-1 affects transcription of the gene in various colorectal cancer cell lines and upregulates Jagged1.

Next, Notch signaling was examined in colorectal cancer cell lines. When the expression of Ape1 / Ref-1 was decreased by siRNA, the expression of Notch3 activated in a high colorectal cancer cell line expressing Ape1 / Ref-1 was significantly reduced (Fig. 18A). On the other hand, Ape1 / Ref-1 overexpressing SW480 and HT29 cells showed a significant increase in truncated Notch1 and Notch3 proteins (Fig. 19A), suggesting that Ape1 / Ref-1 has an efficient activity of Notch1 or Notch3 signaling in colorectal cancer cells It is important to note that

To investigate whether Ape1 / Ref-1-mediated upregulation of notch cut in colorectal cancer cells is functional, we examined whether Ape1 / Ref-1 protein can regulate CBF1-Luc activity. Ape1 / Ref-1 siRNA-transfected NCI-H716, DLD1, KM12SM, and KM12C cells exhibited reduced CBF1-Luc activity (Fig. 20A). In contrast, SW480 and HT29 cells overexpressing Ape1 / Ref-1 showed increased CBF1 promoter activity (Fig. 20B). These results show that increased Notch signaling in colorectal cancer cells is Ape1 / Ref-1-dependent.

Notch receptors and their ligands use a variety of positive- and negative- feedback mechanisms to regulate signal transduction (Bray, SJ 2006. Notch signaling: a simple pathway becomes complex. Nat Rev Mol Cell Biol 7: 678-689; Liu, et al. 2009. NOTCH3 expression is induced in mural cells through an autoregulatory loop that requires endothelial-expressed JAGGED1. Circ Res 104: 466-475). However, the effect of each of them on the expression of each other is unknown. We investigated the functional relationship between Jagged1 expression and Notch activity through a pharmacological and genetic approach to investigate the mechanism by which Ape1 / Ref-1 leads to the activity of Notch signaling in colorectal cancer. DLD1 and KM12SM cells were treated with DAPT to inhibit Notch cleavage and activity, and Jaggedl protein was analyzed in the cells. Notch3 cleaved in DAPT treated cells was significantly reduced (Figure 21A). However, DAPT only slightly decreased Jaggedl expression in DLD1 and KM12SM cells. To determine if the observed Jaggedl expression could then be repeated in DAPT-treated cells, siRNA constructs were used to specifically inhibit Notch3. Western blot analysis showed that Notch3-specific siRNA reduced Notch3 expression by 95% or more compared to control siRNA-transfected DLD1 and KN12SM cells. Consistent with the DAPT data, Notch3 siRNA did not significantly alter the expression of Jagged1 (Figure 21B, fourth lane).

Next, we examined whether Jagged1 knockdown or overexpression affects Notch activity. DLD1 and KN12SM cells were transfected with siRNA for Jagged1, the expression of Jagged1 protein was clearly reduced for 48 hours, and the cells with reduced expression of Jagged1 showed a lower level of CBF1 than the control siRNA-transfected cells -Luc activity (Figure 21C), as well as a significantly lower level of truncated Notch3 (Figure 21B, third lane). Transfection of SW480 and HT29 cells with the Jaggedl expression vector resulted in a significant increase in the expression of activated Notch1 and Notch3 (FIG. 22A), which significantly increased the CBF1 promoter activity in these cells (FIG. 22B). These results show that the Notch activity in colorectal cancer is the result of autocrine or paracrine activity of the Notch receptor by Jagged1, although the functional relationship between Jagged1 and Notch activity is complex and not yet known .

Next, we examined whether Jagged1 is essential for Ape1 / Ref-1-induced Notch activity. Levels of endogenous Jagged1 in SW480 and HT29 cells stably expressing Ape1 / Ref-1 were inhibited by siRNA. Thereafter, Notch activity was measured. Jaggedl siRNA in SW480-Ref-1 and HT29-Ref-1 cells decreased the level of truncated Notch1 (Figure 23A). The knockdown of Jagged1 also apparently inhibited CBF1 promoter activity in these cells (Figure 23B). Both the truncated Notch3 (Fig. 24A) and CBF1 promoter activity (Fig. 24B) were completely restored when wild-type Jaggedl was transiently expressed in Ref-1-shRNA / DLD1 and Ref-1-shRNA / KM12SM cells. This means that Jagged1 is required for Ape1 / Ref-1-induced Notch activity.

We investigated the effect of Jagged1 knockdown on Ref-1 function. In the cell proliferation assay, scrambled siRNA-transfected SW480-Ref-1 and HT29-Ref-1 cells showed cell growth, but Jagged 1-knockdown SW480-Ref-1 and HT29- 1 cells (Fig. 25). Next, the effect of Jagged1 on anchorage-independent growth was investigated. Jagged1 knockdown inhibited Ape1 / Ref-1 induced non-adherent growth compared to vector-transfected cells in both SW480-Ref-1 and HT29-Ref-1 cells (Figure 26A). In addition, transfection of Jaggedl siRNA into SW480-Ref-1 cells clearly reduces migration, invasion (Figure 26B), and neovascularization (Figure 26C), suggesting that Ape1 / Ref- Promoting progress. In the transiently transfected Ref-1-shRNA / DLD1 and Ref-1-shRNA / KM12SM cells transiently transfected with Jaggedl cDNA expression constructs for overexpression of Jaggedl, cell proliferation (Fig. 27) and anchorage- independent growth (Fig. 28A). In addition, Jagged1 overexpression in Ref-1-shRNA / DLD1 cells increased invasion, migration ability (Fig. 28B), and neovascularization (Fig. 28C). These results show that Jagged1 is required for the carcinogenic activity of Ape1 / Ref-1 in colorectal cancer.

Next, the present inventors confirmed the influence of the Ref-1 / Jagged1 pathway on tumor formation and progression through in vivo experiments using a xenograft mouse model. First, DLD1 and SW480 cells were transplanted subcutaneously into the right side of a nude mouse. After 36 days, all the mice transplanted with DLD1 cells developed large tumors, but the tumor growth of SW480 cells was almost negligible. Ref-1-shRNA-DLD1 and control DLD1 cells were injected into nude mice and the volume of the tumor was measured to see if the tumors under development were affected by Ape1 / Ref-1. After 12 days of transplantation, control mice showed visible tumors showing exponential growth until day 36 (Fig. 29, A and B). On the other hand, tumors and outgrowth and tumor size were significantly reduced in Ref-1-deficient tumor mice. This means that stable knockdown of Ape1 / Ref-1 in colorectal cancer cells has reduced tumor growth. Jagged1- or vector-transfected Ref-1-shRNA / DLD1 cells were injected into nude mice to determine whether this reduced tumor growth was due to the elimination of Jagged1's influence. No tumor growth was observed at 36 days in vector-transfected Ref-1-shRNA / DLD1 cells, but exponentially growing up to 36 days in Jaggedl-transfected cells (Figure 29. A and B). However, overexpression of Jagged1 in Ape1 / Ref-1-deficient DLD cells did not completely restore tumor growth, which means that there is an additional Ape1 / Ref-1 target that regulates tumor growth. We then compared the tumorigenic potential of SW480-Ref-1 and control cells in mice. At day 36 of transplantation, SW480 cells expressing Ape1 / Ref-1 formed much larger tumors whereas control cells did not form tumors (FIG. 30, A and B). To determine whether this increased tumor growth was due to Jagged1 expression induction, nude mice were injected with Jagged1 siRNA-transfected or control siRNA-transfected SW480-Ref-1 cells. Tumor growth was observed in all mice injected with control-transfected cells after 36 days, but not in Jagged1 siRNA-transfected cells.

In addition, the in vivo effects of the Ref-1 / Jagged1 pathway on lung metastasis of colorectal cancer can be evaluated using an experimental metastasis assay, as the increased or decreased lung metastasis may be due to earlier or slower primary tumor growth, Respectively. Non-invasive bioluminescence imaging based on RFP was used to monitor the presence of tumor cells. DsRed-expressing control or Ref-1-shRNA / DLD1 cells were injected into the tail vein of nude mice. After 4 weeks, the fluorescence images showed various lung metastases in the control DLD1-injected mice, but not in the Ape1 / Ref-1- eliminated DLD1-injected mice (FIG. 31). Conversely, the transfection activity of SW480 cells measured by their fluorescence was significantly increased by Ape1 / Ref-1 as compared to the control (Fig. 32). Finally, we investigated the role of Jagged1 in the process of Ref-1-induced metastasis. Transition activity was significantly increased in the lungs of mice injected with Jaggedl-overexpressing Ref-1 shRNA / DLD1 cells (Figure 31). Jagged 1 knockdown in SW480-Ref-1 cells significantly reduced the number of lung metastases (Figure 32).

Taken together, these results indicate that Ape1 / Ref-1 promotes colon cancer cell growth and in vivo metastasis through upregulation of Jaggedl expression.

Because Ape1 / Ref-1 overexpression is associated with Jagged1 expression and these components are important for colon cancer progression, we measured the positive correlation between Ape1 / Ref-1 and Jagged1 expression in colorectal cancer tissues Respectively. We examined Ape1 / Ref-1 and Jagged1 expression in colon cancer and surrounding normal tissues of patients. Analysis of Ape1 / Ref-1 and Jaggedl expression showed strong expression of Ape1 / Ref-1 and Jagged1 in colorectal cancer tissues, while the proteins were expressed at low levels in normal colon tissues (FIG. 33). These results demonstrate the clinical relevance of Ape1 / Ref-1 and Jagged1 expression in colorectal cancer.

In summary, we have shown that Ape1 / Ref-1 regulates Notch signaling positively by up-regulating Jaggedl expression in both in vitro and in vivo experiments, . The levels of Ape1 / Ref-1, Jagged1, and truncated Notch in human colorectal cancer cells were highly correlated and thus Ape1 / Ref-1 was shown to either treat or prevent colon cancer with strongly activated Jagged1 / Notch signaling It can be an effective target.

Accordingly, the present invention provides a colon cancer diagnostic marker comprising Ape1 / Ref-1, Jaggedl and / or Notch3 protein or a gene encoding them.

In the present invention, the term " diagnosis " means confirming a pathological condition. For the purpose of the present invention, the diagnosis means confirming the presence or absence of expression of a colon cancer diagnostic marker, , The diagnosis in the present invention includes checking whether or not the colon cancer marker is expressed and the expression level thereof to determine the onset, development and alleviation of colorectal cancer.

In addition, the diagnostic marker means a substance capable of distinguishing colon cancer cells from normal cells, and includes a polypeptide or nucleic acid (for example, mRNA, etc.), lipids, glycolipids, glycoproteins, sugars (monosaccharides, disaccharides, oligosaccharides, etc.) and the like. The marker for colon cancer diagnosis provided by the present invention may be an Ape1 / Ref-1, Jagged1 and / or Notch3 protein or a gene encoding the same, wherein the expression level of the Ape1 / Ref-1, Jagged1 and / 1, SEQ ID NO: 2 and SEQ ID NO: 3 for Ape1 / Ref-1, Jagged1 and Notch3, respectively.

Also, the present invention provides a composition for diagnosing colorectal cancer comprising a substance for measuring the level of the marker protein.

In the present invention, the level of the marker protein preferably indicates the level of the mRNA at which the gene encoding the marker protein is expressed, that is, the amount of the mRNA. As the substance capable of measuring the level, Primers or probes. In one embodiment of the present invention, the primers or probes specific to the genes encoding Ape1 / Ref-1, Jagged1 and Notch3 can specifically amplify a specific region of the gene or all of the genes shown in SEQ ID NOS: And the primer or the probe can be designed through a method known in the art.

The term primer in the present invention refers to a single-stranded DNA strand that can act as a starting point for template-directed DNA synthesis under suitable conditions (i. E., Four other nucleoside triphosphates and polymerase) Means an oligonucleotide. The appropriate length of the primer may vary depending on various factors, such as temperature and use of the primer. In addition, the sequence of the primer does not need to have a sequence completely complementary to a partial sequence of the template, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing with the template and acting as a primer. Therefore, the primer in the present invention does not need to have a perfectly complementary sequence to the nucleotide sequence of the template gene, and it is sufficient that the primer has sufficient complementarity within a range capable of hybridizing to the gene sequence to perform the primer action. In addition, it is preferable that the primer according to the present invention can be used for gene amplification reaction. The amplification reaction refers to a reaction for amplifying a nucleic acid molecule. The amplification reactions of these genes are well known in the art, and examples thereof include polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR) (LCR), electron mediated amplification (TMA), nucleic acid sequencing substrate amplification (NASBA), and the like.

In the present invention, the term probe refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, which can specifically hybridize to a target nucleotide sequence, Or artificially synthesized. The probes according to the present invention may be single-stranded, preferably oligodeoxyribonucleotides. Probes of the invention can include natural dNMPs (i.e., dAMP, dGMP, dCMP and dTMP), nucleotide analogs or derivatives. In addition, the probe of the present invention may also include a ribonucleotide. For example, the probes of the present invention can be used in combination with a framework-modified nucleotide such as a peptide nucleic acid (PNA) (M. Egholm et al., Nature, 365: 566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoamidate DNA, amide-linked DNA, MMI-linked DNA, 2'-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2'- 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA, and anhydrohexy Tolyl DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines wherein the substituents are fluoro, bromo, chloro, iodo-, methyl-, ethyl-, vinyl-, formyl-, 7-deazapurines having C-7 substituents (the substituents being fluoro, bromo, chloro, bromo, chloro, , Iodo-, me -, ethyl-, vinyl-, formyl-, alkynyl -, alkenyl-, quinolyl and quinoxalyl thiazol-, quinolyl and quinoxalyl imidazolidin -, pyridyl-), inosine, and may include a diamino purine.

In addition, in the present invention, the substance capable of measuring the level of the marker protein may include an antibody such as a polyclonal antibody, a monoclonal antibody and a recombinant antibody capable of specifically binding to a marker protein. In the present invention, since the Ape1 / Ref-1, Jagged1 and Notch3 proteins have been identified as marker proteins capable of diagnosing colon cancer as described above, a method for producing an antibody using the above- Can be easily manufactured using known techniques. For example, in the case of polyclonal antibodies, the Ape1 / Ref-1, Jaggedl and Notch3 antigens can be produced by methods well known in the art to obtain sera containing antibodies by injection into an animal and blood collection from an animal, respectively, Polyclonal antibodies can be prepared from any animal host host, such as goat, rabbit, sheep, monkey, horse, pig, cow, dog. In the case of monoclonal antibodies, hybridoma methods well known in the art (Kohler et al. European Jounral of Immunology, 6, 511-519, 1976) to be prepared, or phage antibody libraries using (Clackson et al, Nature, 352 , 624-628, 1991, Marks et al, J. Mol Biol, 222:.. 58 , ≪ / RTI > 1-597, 1991). In addition, an antibody according to the present invention may comprise a functional fragment of an antibody molecule as well as a complete form having two full-length light chains and two full-length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least an antigen binding function, and includes Fab, F (ab ') 2, F (ab') 2 and Fv.

In addition, the present invention provides a colon cancer diagnostic kit comprising a composition for diagnosing colorectal cancer capable of measuring expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins or genes encoding the same.

The composition for colon cancer diagnosis contained in the diagnostic kit for colorectal cancer of the present invention may include primers, probes or antibodies capable of measuring the expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins, These definitions are as described above.

When the colon cancer diagnostic kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include a reagent necessary for PCR amplification, such as a buffer, a DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus Thermostable DNA polymerases obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase joins and dNTPs, and the colon cancer diagnostic kit of the present invention may be used for immunological assays When applied, the kits of the invention may optionally comprise a secondary antibody and a labeling substrate. Further, the kit according to the present invention may be manufactured from a number of separate packaging or compartments containing the reagent components described above.

The present invention also provides a microarray for colon cancer diagnosis comprising a colon cancer diagnostic composition capable of measuring the expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins or genes encoding the same.

In the microarray of the present invention, primers, probes or antibodies capable of measuring the expression levels of the Ape1 / Ref-1, Jagged1 and Notch3 proteins or genes encoding the same are used as hybridizable array elements, and immobilized on a substrate. Preferred substrates may include, for example, membranes, filters, chips, slides, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles and capillaries, as suitable rigid or semi-rigid supports have. The hybridization array elements are arranged and immobilized on the substrate, and such immobilization can be performed by chemical bonding methods or covalent bonding methods such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bound by UV on a polylysine coating surface. In addition, the hybridization array element can be coupled to the substrate via a linker (e.g., ethylene glycol oligomer and diamine).

On the other hand, when the sample to be applied to the microarray of the present invention is a nucleic acid, it may be labeled and hybridized with an array element on a microarray. Hybridization conditions may vary, and detection and analysis of hybridization degree may be variously performed depending on the labeled substance.

The present invention also provides a method for diagnosing colon cancer using the marker of the present invention. (A) measuring the expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins present in a biological sample; And (b) comparing the measurement results of step (a) with Ape1 / Ref-1, Jagged1 and Notch3 expression levels of a control sample. Methods for measuring the expression levels of Ape1 / Ref-1, Jagged1 and Notch3 proteins in the above can be carried out using a known technique, including a known process for separating mRNA or protein from a biological sample.

In the present invention, the "biological sample" means an expression level or a protein level of a gene encoding the Ape1 / Ref-1, Jagged1 and Notch3 proteins according to the degree of development or progression of colorectal cancer, And examples thereof include tissues, cells, blood, serum, plasma, saliva, urine and the like, for example, but not limited thereto.

The expression level of the Ape1 / Ref-1, Jagged1, and Notch3 proteins is preferably measured by measuring the level of mRNA, and the level of mRNA may be measured by RT-PCR, RT- Enzyme chain reaction, RNase protection assay, northern blot and DNA chip, but are not limited thereto.

The expression levels of the Ape1 / Ref-1, Jaggedl and Notch3 proteins can be measured using antibodies, in which case the Ape1 / Ref-1, Jaggedl and Notch3 marker proteins and their specific antibodies in the biological sample are bound, Antibody-antibody complex, and the formation amount of the antigen-antibody complex can be quantitatively measured through the size of the signal of the detection label. Such detection labels can be selected from the group consisting of enzymes, minerals, ligands, emitters, microparticles, redox molecules and radioisotopes, but is not limited thereto. Analytical methods for measuring protein levels include, but are not limited to, Western blot, ELISA, radioimmunoassay, radioimmunoprecipitation, Oucheroni immunodiffusion, rocket immunoelectrophoresis, tissue immuno staining, immunoprecipitation assays, Complement fixation assay, FACS, and protein chip.

Accordingly, the present invention provides a method for detecting Ape1 / Ref-1, Jagged1, and Notch3 mRNA expressions or amounts of proteins in Ape1 / Ref-1, Jagged1 and Notch3 of a control group, The amount of Notch3 mRNA expression or the amount of protein can be confirmed and the degree of expression of the Notch3 mRNA can be compared with the control group to predict and diagnose the incidence, progression, or prognosis of colorectal cancer. In the present invention, the amino acid sequences of the Ape1 / Ref-1, Jagged1 and Notch3 proteins can be represented by SEQ ID NOs: 23, 24 and 25, respectively. That is, the amino acid sequence of Ape1 / Ref- The amino acid sequence of SEQ ID NO: 24 and the amino acid sequence of Notch3 is SEQ ID NO: 25.

Further, the present invention provides a method for screening a substance for preventing or treating colorectal cancer using the marker of the present invention. The screening method comprises the steps of: (a) contacting a sample to be analyzed with colon cancer cells containing genes encoding Ape1 / Ref-1, Jagged1 and Notch3 proteins, respectively; (b) measuring the level or activity of the Ape1 / Ref-1, Jaggedl and Notch3 proteins; And (c) when the expression level or activity of the Ape1 / Ref-1, Jagged1 and Notch3 proteins is decreased as compared with the control, the sample is judged to be a substance for prevention or treatment of colon cancer .

According to the method of the present invention, a sample to be analyzed can be first contacted with colon cancer cells containing genes encoding Ape1 / Ref-1, Jagged1 and Notch3 proteins, respectively. Wherein said sample refers to an unknown substance used in screening to check the expression level or activity of Ape1 / Ref-1, Jagged1 and Notch3 proteins. The sample may include, but is not limited to, chemicals, nucleotides, antisense-RNA, small interference RNA (siRNA), and natural extracts. Thereafter, expression levels or activities of the Ape1 / Ref-1, Jaggedl and Notch3 proteins can be measured in the cells to which the sample has been treated and the measurement results show that the expression levels or activities of the Ape1 / Ref-1, Jaggedl and Notch3 proteins are inhibited Is measured, the sample can be judged as a substance capable of treating or preventing colon cancer.

Methods for measuring the expression level or activity of the Ape1 / Ref-1, Jagged1 and Notch3 proteins in the above can be performed through various methods known in the art, including, but not limited to, A reverse transcriptase-polymerase chain reaction, a real time-polymerase chain reaction, Western blot, northern blot, enzyme linked immunosorbent assay, immunoblot analysis, immunohistochemical staining, Radioimmunoassay (RIA), radioimmunodiffusion, and immunoprecipitation assay, for example.

The present invention also provides a pharmaceutical composition for the prevention or treatment of colorectal cancer comprising as an active ingredient a substance which inhibits the expression or activity of Ape1 / Ref-1, Jagged1 and Notch3.

The pharmaceutical composition according to the present invention may contain a chemical substance, a nucleotide, an antisense, an siRNA oligonucleotide or a natural product extract as an active ingredient, and preferably the nucleotide sequence of the Ape1 / Ref-1, Jagged1 and Notch3 genes of the present invention Or an antisense or siRNA (small interference RNA) oligonucleotide having a complementary sequence as an active ingredient.

In the present invention, the term "antisense oligonucleotide " refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to the sequence of a specific mRNA, and is capable of binding to a complementary sequence in mRNA, The antisense sequence of the present invention means a DNA or RNA sequence complementary to Ape1 / Ref-1, Jagged1 and Notch3 mRNA and capable of binding to Ape1 / Ref-1, Jagged1 and Notch3 mRNAs, and Ape1 / Can inhibit essential activities for translation, translocation, maturation, or any other overall biological function of the Ref-1, Jagged1 and Notch3 mRNAs.

In addition, the antisense nucleic acid may be modified at one or more bases, sugars, or backbone locations to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol ., 5, 3, 343-55, 1995). The nucleic acid backbone can be modified with phosphorothioate, phosphotriester, methylphosphonate, short chain alkyl, cycloalkyl, short chain heteroatomic, heterocyclic biantennary bond, and the like. In addition, the antisense nucleic acid may comprise one or more substituted sugar moieties. The antisense nucleic acid may comprise a modified base. Modified bases include hypoxanthane, 6-methyladenine, 5-methylpyrimidine (especially 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, genentioyl HMC, -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine . In addition, the antisense nucleic acid of the present invention may be chemically combined with one or more moieties or conjugates that enhance the activity and cytotoxicity of the antisense nucleic acid. A cholesterol moiety, a cholesteryl moiety, a cholic acid, a thioether, a thiocholesterol, an aliphatic chain, a phospholipid, a polyamine, a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, octadecylamine, hexylamino- And liposoluble moieties such as Cole sterol moieties. Oligonucleotides, including liposoluble moieties, and methods of preparation are well known in the art (U.S. Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid may increase the stability to nuclease and increase the binding affinity of the antisense nucleic acid with the target mRNA.

The antisense oligonucleotides may be synthesized in vitro in a conventional manner and administered in vivo or may allow the synthesis of antisense oligonucleotides in vivo. An example of synthesizing an antisense oligonucleotide in a test tube is to use RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to allow the antisense RNA to be transcribed using a vector whose recognition site (MCS) origin is in the opposite direction. Such antisense RNAs are preferably made such that translation stop codons are present in the sequence so that they are not translated into the peptide sequence.

In the present invention, the term "siRNA " refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (International Patent Publication Nos. 00/44895, 01/36646, 99/32619, 01/29058, 99/07409 and 00 / 44914). SiRNA is provided as an efficient gene knock-down method or as a gene therapy method because it can inhibit the expression of a target gene.

The siRNA molecule of the present invention may have a structure in which a sense strand and an antisense strand are located on opposite sides to form a double strand, and the siRNA molecule of the present invention has a self-complementary sense and antisense strand May have a single-stranded structure. Furthermore, siRNAs are not limited to the complete pairing of double-stranded RNA moieties in RNA pairs, but may be mated by mismatch (corresponding bases are not complementary), bulge (no bases corresponding to one strand) And a portion that is not achieved may be included. In addition, the siRNA terminal structure can be blunt or cohesive, as long as it can inhibit the expression of Ape1 / Ref-1, Jagged1 and Notch3 genes by the RNAi effect, and the 3'- Both the terminal protruding structure and the 5'-terminal protruding structure are possible.

In addition, the siRNA molecule of the present invention may have a form in which a short nucleotide sequence is inserted between self-complementary sense and antisense strands, in which case the siRNA molecule formed by the expression of the nucleotide sequence is Thereby forming a hairpin structure, which in turn forms a stem-and-loop structure. This stem-and-loop structure is processed in vitro or in vivo to produce an active siRNA molecule capable of mediating RNAi.

Methods for preparing siRNA include a method of directly synthesizing siRNA in a test tube, introducing the siRNA into a cell through transformation, and a method of expressing siRNA expression vector or PCR-derived siRNA expression cassette into a cell There is a way to convert or infect.

In addition, the composition of the present invention comprising a gene-specific siRNA may include an agent that promotes intracellular infiltration of siRNA. Agents that promote intracellular inflow of siRNA can generally include agents that promote nucleic acid inflow. Examples of such agents include liposomes or one lipophilic one of a number of sterols, including cholesterol, cholate, and deoxycholic acid Can be combined with the carrier. It is also possible to use poly-L-lysine, spermine, polysilazane, polyethylenimine (PEI), polydihydroimidazolenium, polyallylamine Cationic polymers such as chitosan, chitosan and the like may be used, and succinylated PLL, succinylated PEI, polyglutamic acid, polyaspartic acid, anionic polymers such as polyaspartic acid, polyacrylic acid, polymethacylic acid, dextran sulfate, heparin, hyaluronic acid, and the like, Can be used.

In addition, when an antibody specific to the protein is used as a substance that increases the expression and activity of the Ape1 / Ref-1, Jagged1 and Notch3 proteins, the antibody may be indirectly coupled to the existing therapeutic agent directly or through a linker For example, covalent bonding). Therapeutic agents capable of binding to the antibody include, but are not limited to, radionuclides such as 131I, 90Y, 105Rh, 47Sc, 67Cu, 212Bi, 211At, 67Ga, 125I, 186Re, 188Re, 177Lu, 153Sm, 123I, ); A biologically reactive variant or drug, such as methotrexate, adriamycin, and lympokine, such as interferon; Toxins such as lysine, avrine, diphtheria and the like; Heterofunctional antibodies, that is, antibodies that bind to other antibodies to bind the complex to both cancer cells and effector cells (e. G., K cells such as T cells) - associated or non-conjugated antibodies.

The pharmaceutical composition according to the present invention may further comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" as used herein refers to a composition that is physiologically acceptable and does not normally cause an allergic reaction such as gastrointestinal disorder, dizziness, or the like when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid and the like, water for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols And may further contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. Other pharmaceutically acceptable carriers can be found in Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, Pa., 1995). The pharmaceutical composition according to the present invention, together with a pharmaceutically acceptable carrier as described above, may be formulated into a suitable form according to a method known in the art. That is, the pharmaceutical composition of the present invention can be prepared in various parenteral or oral administration forms according to known methods, and isotonic aqueous solutions or suspensions are preferred for injection formulations typical of parenteral administration formulations. The injectable formulations may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving in saline or buffer. In addition, formulations for oral administration include, but are not limited to, powders, granules, tablets, pills, and capsules.

The pharmaceutical composition formulated as described above may be administered in an effective amount through various routes including oral, transdermal, subcutaneous, intravenous, or muscular, and the administration may include introducing a predetermined substance into the patient by any suitable method And the route of administration of the agent may be administered through any conventional route so long as it can reach the target tissue.

The term "effective amount" as used herein refers to an amount that shows a preventive or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention may be varied depending on various factors such as the type and severity of the patient, age, sex, body weight, sensitivity to the drug, kind of the current treatment method, administration method, target cell, Can be easily determined by experts of the present invention. In addition, the pharmaceutical composition of the present invention may be administered in combination with a conventional therapeutic agent, and may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. Preferably, all of the above factors are taken into consideration, so that an amount capable of achieving the maximum effect in a minimal amount without side effects can be administered, more preferably 1 to 10000 / kg of body weight / day, more preferably 10 to 1000 / kg / day. < / RTI >

In particular, conventional gamma-secretase (-secretase) has been noted as a target to prevent Notch signaling in order to treat colon cancer. However, gamma-secretase inhibitors were highly effective in in vitro experiments, but were found to be toxic enough to affect their activity in normal stem cells (Miele, et al., 2006; 2007. Notch emerges as new cancer drug target. J Natl Cancer Inst 99: 1284-1285). Thus, in the cancer associated with the up-regulated expression of both Ape1 / Ref-1 and Jaggedl, when an Ape1 / Ref-1 inhibitor according to the invention is administered with a gamma-secretase inhibitor, a lower amount of gamma- Cretacease inhibitors may also be able to exert a better effect.

Hereinafter, the present invention will be described in detail with reference to examples. However, these examples are intended to further illustrate the present invention, and the scope of the present invention is not limited to these examples.

< Example  1>

Cell culture, reagents, and tissue samples

Human fibroblast GM00637 cells were obtained from the Coriell Institute for Medical Research and then cultured in EMEM (Eagle's minimal essential medium) medium. HUVECs (human umbilical vein endothelial cells) were obtained from Cambrex Bio Science (Walkersville, Md.) And cultured in EGM-2 (Cambrex Bio Science). (NCI-H460 and NCIH1299), colorectal cancers (SW480, HT29, NCI-H548, NCI-H716, and DLD1), gastric cancer cells (AGS, SNU216, SNU484 and SNU638), glioblastomas (U87MG and U373MG) ), And pancreatic cancer (Capan-1, BXPC-3, and ASPC-1) cells were cultured in RPMI-1640 (Gibco, Grand Island, NY). Human glioblastomas (M059J and M059K) were cultured in DMEM (Dulbecco 'modified Eagle' medium) / F12. DMS53 (human lung cancer) cells were cultured on a WayMouth medium (Life Technologies, Rockville, Md.) And Calu-1 (human lung cancer) cells in McCoy5A medium, respectively. SK-MES-1 (lung cancer), NCI-H747 (colorectal cancer), KM12SM (colorectal cancer), and PANC1 and MIA PaCa-2 (pancreatic cancer) cells were cultured in DMEM. KM12C (colon cancer) cells were cultured in EMEM. All cancer cell lines were purchased from the American Type Culture Collection (ATCC, Manassas, Va.) Except for three gastric cancer cell lines. Human gastric cancer cell lines SNU216, SNU484 and SNU638 were obtained from Korean Cell Line Bank. All media were supplemented with 10% pyrogen-free fetal bovine serum (FBS) and 1% penicillin / streptomycin. Cells were maintained at 37 in a 5% CO2 atmosphere. DAPT (N- [N- (3,5-difluorophenacetyl) -L-alanyl] - (S) -phenylglycinet-butyl ester) and DMSO (dimethyl sulfoxide) were purchased from Calbiochem (San Diego, CA). Colon adenocarcinoma and normal tissue were obtained from the same patient.

< Example  2>

Gene expression analysis

(Invitrogen Life Technologies, Carlsbad, Calif.) And GM00637-Ape1 / Ref-1 cells, control and Ape1 / Ref-1-shRNA- DLD1 and control and SW480- , And RNeasy columns (Qiagen, Valencia, CA) were purified using the manufacturer's manual. The amount and purity of RNA was determined by determining OD260 / 280 using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, Calif.). Total RNA was amplified and purified using the AgilentLow RNA Input Linear Amplification Kit (Agilent Technologies) to generate cyanine-labeled cRNA. After purification, cRNA was quantified using ND-1000 spectrophotometer (NanoDrop, Wilmington, DE) and hybridized to the microarray. Gene expression profiling was performed using an A Whole Human Genome Microarray 44K (Agilent Technologies) containing 40,000 or more 60-mer polynucleotide probes. The analysis was performed in duplicate according to the manufacturer's instructions. After hybridization, arrays were examined using a DNA microarray scanner (Agilent Technologies) and quantified with Feature Extraction Software (Agilent Technologies). All data normalization and "old-changed genes" screening were performed with GeneSpringGX 7.3 (Agilent Technologies). The normalized ratio averages were calculated by dividing the average normalized signal channel intensity by the average normalized control channel intensity. Biological path- and ontology-based analyzes were performed using the Gene Ontology Database (http://www.geneontology.org/) and the Gene Cards Database ( http://www.genecards.org ).

< Example  3>

Plasmid production, RNAi , And the production of stable cell lines

Human Jagged1 cDNA was amplified from human fibroblast GM00637 cells using RT-PCR. The primers used were as follows:

forward, 5'-ATGCGTTCCCCACGGAC-3 '(SEQ ID NO: 4),

reverse, 5'-CTATACGATGTACTCCATTCGGTTTAAGCTC-3 '(SEQ ID NO: 5).

The amplified cDNA was cloned into pcDNA3.1 mammalian expression vector (Invitrogen, Carlsbad, Calif.). Ape1 / Ref-1 expression vector (pcDNA3-Ape1 / Ref-1) was the same as that reported previously (Kim, MH, et al. 2009. Ape1 / Ref-1 induces glial cell-derived neurotropic factor ) responsiveness by upregulating GDNF receptor alpha1 expression. Mol Cell Biol 29: 2264-2277). Cells were transfected with siRNA using RNA max-i (Invitrogen). The siRNA target sequence is as follows:

Target sequence 5'-AAGTCTGGTACGACTGGAGTA-3 '(SEQ ID NO: 6) for Ref-1 siRNA,

The target sequence 5'-AAATGGGATGATGACTGTAAT-3 '(SEQ ID NO: 7) for Jaggedl siRNA,

Target sequence 5'-AACTGCGAAGTGAACATTGAC-3 '(SEQ ID NO: 8) for Notch3 siRNA,

Target sequence 5'-AAGAGGCATACCAAGATCCACTT-3 '(SEQ ID NO: 9) for Egrl siRNA.

GFP siRNA (sc-45924) was used as a negative control (Santa Cruz Biotechnology, Santa Cruz, Calif.). To make a cell line that stably overexpresses Ape1 / Ref-1 shRNA or JAG1 shRNA;

(SEQ ID NO: 10), reverse: 5'-AGCTTTTCCAAAAAAGTCTGGTACGACTGGAGTATCTCTTGAATACTCCAGTCGTACCAGACG-3 '(SEQ ID NO: 11) encoding the target sequence for Ape / Ref-1 (forward: 5'-GATCCGTCTGGTACGACTGGAGTATTCAAGAGATACTCCAGTCTATTCAAGAGATACTCCAGTCTATTCAAGAGATACTCCAGTCGTACCAGACTTTTTTGGGAAA- (SEQ ID NO: 12), reverse: 5'-AGCTTTTCCAAAAAAATGGGATGATGACTGTAATTCTCTTGAAATTACAGTCATCATCCCATG-3 '(SEQ ID NO: 13)) was annealed and psilencer2.1-U6 Ambion, Austin, Tex.).

For the control shRNA, a nontargeting "scramble" sequence was constructed using psilencer2.1-U6. DLD1 and KM12SM cells were transfected with Ape1 / Ref-1 shRNA or control scrambled shRNA using Lipofectamine 2000 (Invitrogen), followed by selection with 400ug / ml hygromycin And cultured in medium for 4-5 weeks. To construct stable GM00637, SW480, and HT29 cells overexpressing Ape1 / Ref-1, cells were transfected with empty vector, pcDNA3, or Ape1 / Ref-1 expression vector using Lipofectamine 2000 (Invitrogen). The cells were then cultured in media containing 400 mg / ml G418 for 4-5 weeks.

< Example  4>

Quantitative real-time RT - PCR  ( Quantitative real - time RT - PCR )

Total RNA was purified from cells using Trizol (Invitrogen) according to the manufacturer's protocol. CDNA was synthesized using 1 g RNA, M-MLV reverse transcriptase (Invitrogen), and random hexamers (Promega, Madison, Wis.). Real-time PCR analysis was performed using SYBR Premix Ex Taq ^™ kit (TaKaRa Bio, Shiga, Japan) and Mx3000P kit (Stratagene, La Jolla, Calif.). The primers used for real-time RT-PCR were as follows:

Jagged1

- forward: 5'-GAAACAGCTCGCTGATTGCT-3 '(SEQ ID NO: 14),

- reverse: 5'-ACCAAGCAACAGATCCAAGC-3 '(SEQ ID NO: 15):

Ape1 / Ref-1

- forward: 5'-TGAAGCCTTTCGCAAGTTCCT-3 '(SEQ ID NO: 16),

- reverse: 5'-TGAGGTCTCCACACAGCACAA-3 '(SEQ ID NO: 17);

q18S rRNA

- forward: 5'-CGCCGCTAGAGGTGAAATTC-3 '(SEQ ID NO: 18),

- reverse: 5'-TTGGCAAATGCTTTCGCTC-3 '(SEQ ID NO: 19).

Each sample was repeated three times and the target genes were normalized against a reference housekeeping gene, 18S rRNA.

< Example  5>

Immunoblotting  ( immunoblotting )

Cells were washed with 1x PBS (phosphate buffered saline) and resuspended in lysis buffer [20 mM HEPES (pH 7.4), 2 mM EGTA, 50 mM glycerol phosphate, 1% Triton X-100, 10% glycerol, 1 mM DTT, phenylmethylsulfonyl fluoride, 10 ug / ml leupeptin, 10 ug / ml aprotinin, 1 mM Na3VO4, and 5 mM NaF]. Protein content was determined using a dye-binding microassay (Bio-Rad, Hercules, Calif.) And 10-160 ug protein per lane in 8-12% SDS polyacrylamide gel Were electrophoresed. Protein was blotted onto a Hybond ECL membrane (Amersham Pharmacia Biotech, Piscataway, NJ), and the mouse anti-Ref-1 (sc-17774) purchased from Santa Cruz Biotechnology and Cell Signaling Technology (Beverly, Mass.), Rabbit anti- (sc-8303), goat anti-Notch1 (sc-6014), rabbit anti-Notch2 (sc-5545), rabbit anti-Notch3 Anti-beta-actin (sc-47778), and mouse anti-a-tubulin (sc-23948) antibodies. Two protein ladders (# PM1001 and # SM0671) were used for molecular weight determination (Fermentas, Glen Burnie, MD). Blotted proteins were detected using an enhanced chemiluminescence detection system (iNtRON, Seoul, Korea).

< Example  6>

Jagged1  Promoter Cloning  And a reporter Assay

The Jagged1 promoter (-1473 to +14) was amplified from the genomic DNA of HeLa cells. The ~ 1.5-kb PCR product was cloned into the pGL3-Basic vector (Promega) to create the pGL-Jagged1 luciferase reporter (pA) vector and the deletion fragments of the Jaggedl promoter were cloned into the pA Jagged1 promoter as a template And amplified using one PCR. The pB Jaggedl promoter construct has a nucleotide of -1091 to +14, the pC Jaggedl promoter construct has a nucleotide of -850 to +14, the pD Jaggedl promoter construct has a nucleotide of -1476 to -850, the pE Jaggedl promoter construct has a nucleotide- To +14, respectively. The mEgr1-1, mEgr1-2, and mEgr1-3 Jagged1 promoter constructs contain three mutant Egr1-binding sites, E1, E2, and E3, respectively, which are mutated using the pC Jagged1 promoter construct, Kit (Intron Biotechnology, Suwon, Korea). The mutated nucleotide sequence (in upper case) is:

mutated El, 5'-gttggaaatCGcc-3 '(SEQ ID NO: 20);

mutated E2, 5'-ggTAgagtctccg-3 '(SEQ ID NO: 21); And

mutated E3, 5'-cccggagttGGct-3 '(SEQ ID NO: 22).

< Example  7>

Luciferase  Reporter Assay  ( Luciferase reporter assay )

The cells were co-transfected with pGL3-Basic vector, Jaggedl promoter construct or CBF-1 promoter construct and pSV-gal (Promega) for 24 hours using Fugene 6 (Roche Diagnostics, Indianapolis, IN) Luciferase activity and beta-galactosidase activity were analyzed using the enzyme assay system and the beta-galactosidase enzyme assay system (Promega). In order to measure relative luciferase activity, luciferase activity was normalized based on beta-galactosidase activity and adjusted using an empty pGL3-Basic vector. Each sample was analyzed with three replicates, and the experiment was performed at least three times.

< Example  8>

Immunostaining ( immunostaining )

7-micron tumor cryosections were stained with Ape1 / Ref-1 (sc-17774, 1: 500; Santa Cruz Biotechnology) or Jagged1 (sc-8303, 1: 200; Santa Cruz Biotechnology) antibodies . For immunohistochemistry, biotinylated goat anti-mouse or rabbit antibody (Vector Laboratories, Burlingame, Calif.) Followed by horseradish peroxidase-conjugated streptavidin (Vector Laboratories, ) Were used. For immunofluorescence, FITC-conjugated secondary antibodies, goat anti-rabbit Alexa Fluor 594 (Invitrogen), and goat anti-mouse Alexa Fluor 488 (Invitrogen) were used and nuclei were stained with DAPI (Sigma-Aldrich, St. Louis, MO). Immunofluorescence was detected by confocal microscopy (Carl Zeiss, Oberkochen, Germany).

< Example  9>

Light cloth Colony  formation Assay  ( Soft agar colony formation assay )

A light cloth assay was performed in a 6-well plate. The bottom layer of each well consisted of 2 ml of final concentration 1x medium and 0.6% low melting point agarose (Duchefa, Haarlem, The Netherlands). The plate was cooled to 4 ° C and a 1-ml growth agar layer was poured so that 5x10 ⁴ cells were suspended in 1x medium and 0.3% low melting point agarose. The plate was again cooled to 4 ° C to harden the growth layer. In addition, 1 ml of 1x medium is added onto the growth layer without agarose. The cells were cultured at 37 ° C and 5% carbon dioxide for 14 days, and total colonies were stained with 0.005% Crystal Violet (Sigma-Aldrich) and counted. Images were analyzed using Image-Pro Plus 4.5 software (Media Cybernetics, Silver Spring, MD). The assay was performed with a total of three replicates.

< Example  10>

Cell migration and invasion Assay

Cell migration was measured in a 24-well Transwell plate containing an 8-μm polyethylene terephthalate membrane filter (BD Biosciences, Bedford, Mass.) Separating the upper and lower layers of the culture chamber. Cells were grown to subconfluency (~ 75-80%) and serum-starved for 24 h. After isolating trypsin, the cells were washed with PBS and resuspended in serum-free medium. The cell suspension (2x10 ⁴ cells) was then placed in the upper chamber. Complete medium was added to the bottom of the chamber. Non-migrated cells were removed from the upper surface of the filter using a cotton swab. Cells migrating to the lower layer of the filter were fixed with 4% formaldehyde and stained with 0.1% crystal violet. Three images of 10x fields arbitrarily selected from each membrane were captured to count the number of mobile cells.

The average of three iterations was used for each experimental condition. Cell invasion assays are similar to cell migration assays except that the membrane filter is coated with Matrigel.

< Example  11>

Wound healing ( Wound healing ) And cell growth Assay

GM00637 cells transfected with the Ape1 / Ref-1 expression vector or the control vector were inoculated into a T6-well culture dish at a concentration of 15x10 &lt; ⁴ &gt; A core wound was made after 24 hours and cultured for an additional 28 hours. At 0, 12, 24, 28, and 36 hours, phase contrast images were taken on the inverted microscope using an inverted microscope.

Cell growth assays were performed using a WST-1 assay (Roche Molecular Biochemicals, Mannheim, Germany). The same number of cells were inoculated into triplicate wells of 48-well plates and cultured in low serum medium (0.1% FBS). The WST-1 reagent was then added to the cells at defined time intervals and incubated at 37 ° C for 2 hours. Absorbance was measured at 450 nm using an Ultra Multifunctional Microplate Reader (Tecan, Durham, NC).

< Example  12>

Tumorigenesis and metastasis in nude mice metastasis ) For measurement Abdominal cavity  injection

Six-week-old male nude mice purchased from Orient Bios Inc. (Seongnam, Korea) were maintained in a sterile facility according to standard protocols. shRNA, or DLD1 and SW480 cells transfected with expression vector and control cells were collected and resuspended in DMEM. Then 5x10 ⁶ cells were subcutaneously injected into the right flank of nude mice. Mice were killed after 36 days and tumor sites were excised. Tumor size was measured every 3 days with a caliper.

For colon cancer cell metastasis assay, all cells were transfected with pCMV-DsRed expression vector. In order to test Ape1 / Ref-1 or Jagged1-deficiency in a colorectal cancer metastasis model, mock DLD1, control-shRNA-DLD1, Ape1 / Ref-1-shRNA- DLD1, vector- transfected Ape1 / Ref- 1-shRNA-DLD1, or Jaggedl-transfected Ape1 / Ref-1-shRNA-DLD1 were injected intraperitoneally into BALB / cAnN / CrlBgi-nu / nuSPF mice. After 5 weeks, mice (n = 6-7 for each group) were killed and the development of metastasis in lung tissues was analyzed. DLD1-Ape1 / Ref-1, control siRNA-transfected DLD1-Ape1 / Ref-1, or Jagged1-transspecific in order to investigate the role of Ape1 / Ref-1 or Jagged1 over- Seong DLD1-Ape1 / Ref-1 cells were injected into the abdominal cavity of Balb / c mice. After 8 weeks, mice (n = 6-7 for each group) were anesthetized and placed in a Kodak MI 2000 imaging system, MSFX PRO (Carestream Health, Rochester, NY). The excitation filter was set at 465 nm and the exposure time was 30 seconds for each image. The animals were then killed and the lungs were excised and image analysis was performed under the same conditions. After total imaging, the lungs were frozen and 4 um fragments were made and used for confocal laser scanning fluorescence microscopy and hematoxylin and eosin staining.

< Example  13>

Neovascularization ( Angiogenesis ) Assay

48-well culture plates were coated with Matrigel (BD Biosciences) and allowed to polymerize at 37 占 폚 for 30 minutes. HUVECs cultured in endothelial cell basal medium (Cambrex Bio Science) for 24 hours were inoculated onto coated plates at a concentration of 2 x ¹⁰ cells / well and cultured in endothelial cell basal medium. Then, the cells were cultured at 37 DEG C under 5% carbon dioxide for 4-6 hours. Cells were washed with Hankbalanced salt solution and stained with Calcein-AM (Molecular Probes, Eugene, OR) in Hankbuffered saline for 1 hour at 37 ° C. The network formation was measured using a fluorescence microscope (Olympus, Tokyo, Japan) and a CoolPix 4500 digital camera (Nikon, Tokyo, Japan). Tube formation quantification was performed using Adobe Photoshop 7.0 (Adobe Systems, San Jose, CA) or Image-Pro Plus 4.5 software (Media Cybernetics).

Statistical processing

Data were expressed as mean ± standard deviation of three replicate experiments, and statistical significance was measured by two-tailed paired Student's t-test. ** P <0.01 was considered statistically significant.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Industry Academic Cooperation Foundation of Chosun University <120> Use of APE Ref-1 and JAG1 Notch as a diagnostic marker of colon          cancer <130> pn1207-348 <160> 25 <170> Kopatentin 2.0 <210> 1 <211> 957 <212> DNA <213> Unknown <220> <223> APE / Ref-1 cDNA sequence <400> 1 atgccgaagc gtgggaaaaa gggagcggtg gcggaagacg gggatgagct caggacagag 60 ccagaggcca agaagagtaa gacggccgca aagaaaaatg acaaagaggc agcaggagag 120 ggcccagccc tgtatgagga ccccccagat cagaaaacct cacccagtgg caaacctgcc 180 acctcaaga tctgctcttg gaatgtggat gggcttcgag cctggattaa gaagaaagga 240 ttagattggg taaaggaaga agccccagat atactgtgcc ttcaagagac caaatgttca 300 gagaacaaac taccagctga acttcaggag ctgcctggac tctctcatca atactggtca 360 gctccttcgg acaaggaagg gtacagtggc gtgggcctgc tttcccgcca gtgcccactc 420 aaagtttctt acggcatagg cgatgaggag catgatcagg aaggccgggt gattgtggct 480 gaatttgact cgtttgtgct ggtaacagca tatgtaccta atgcaggccg aggtctggta 540 cgactggagt accggcagcg ctgggatgaa gcctttcgca agttcctgaa gggcctggct 600 tcccgaaagc cccttgtgct gtgtggagac ctcaatgtgg cacatgaaga aattgacctt 660 cgcaacccca aggggaacaa aaagaatgct ggcttcacgc cacaagagcg ccaaggcttc 720 ggggaattac tgcaggctgt gccactggct gacagcttta ggcacctcta ccccaacaca 780 ccctatgcct acaccttttg gacttatatg atgaatgctc gatccaagaa tgttggttgg 840 cgccttgatt actttttgtt gtcccactct ctgttacctg cattgtgtga cagcaagatc 900 cgttccaagg ccctcggcag tgatcactgt cctatcaccc tatacctagc actgtga 957 <210> 2 <211> 3657 <212> DNA <213> Unknown <220> <223> JAGGED1 cDNA sequence <400> 2 atgcgttccc cacggacgcg cggccggtcc gggcgccccc taagcctcct gctcgccctg 60 ctctgtgccc tgcgagccaa ggtgtgtggg gcctcgggtc agttcgagtt ggagatcctg 120 tccatgcaga acgtgaacgg ggagctgcag aacgggaact gctgcggcgg cgcccggaac 180 ccgggagacc gcaagtgcac ccgcgacgag tgtgacacat acttcaaagt gtgcctcaag 240 gagtatcagt cccgcgtcac ggccgggggg ccctgcagct tcggctcagg gtccacgcct 300 gtcatcgggg gcaacacctt caacctcaag gccagccgcg gcaacgaccg caaccgcatc 360 gtgctgcctt tcagtttcgc ctggccgagg tcctatacgt tgcttgtgga ggcgtgggat 420 tccagtaatg acaccgttca acctgacagt attattgaaa aggcttctca ctcgggcatg 480 atcaacccca gccggcagtg gcagacgctg aagcagaaca cgggcgttgc ccactttgag 540 tatcagatcc gcgtgacctg tgatgactac tactatggct ttggctgcaa taagttctgc 600 cgccccagag atgacttctt tggacactat gcctgtgacc agaatggcaa caaaacttgc 660 atggaaggct ggatgggccc cgaatgtaac agagctattt gccgacaagg ctgcagtcct 720 aagcatgggt cttgcaaact cccaggtgac tgcaggtgcc agtacggctg gcaaggcctg 780 tactgtgata agtgcatccc acacccggga tgcgtccacg gcatctgtaa tgagccctgg 840 cagtgcctct gtgagaccaa ctggggcggc cagctctgtg acaaagatct caattactgt 900 gggactcatc agccgtgtct caacggggga acttgtagca acacaggccc tgacaaatat 960 cagtgttcct gccctgaggg gtattcagga cccaactgtg aaattgctga gcacgcctgc 1020 ctctctgatc cctgtcacaa cagaggcagc tgtaaggaga cctccctggg ctttgagtgt 1080 gagtgttccc caggctggac cggccccaca tgctctacaa acattgatga ctgttctcct 1140 aataactgtt cccacggggg cacctgccag gacctggtta acggatttaa gtgtgtgtgc 1200 cccccacagt ggactgggaa aacgtgccag ttagatgcaa atgaatgtga ggccaaacct 1260 tgtgtaaacg ccaaatcctg taagaatctc attgccagct actactgcga ctgtcttccc 1320 ggctggatgg gtcagaattg tgacataaat attaatgact gccttggcca gtgtcagaat 1380 gacgcctcct gtcgggattt ggttaatggt tatcgctgta tctgtccacc tggctatgca 1440 ggcgatcact gtgagagaga catcgatgaa tgtgccagca acccctgttt gaatgggggt 1500 cactgtcaga atgaaatcaa cagattccag tgtctgtgtc ccactggttt ctctggaaac 1560 ctctgtcagc tggacatcga ttattgtgag cctaatccct gccagaacgg tgcccagtgc 1620 tacaaccgtg ccagtgacta tttctgcaag tgccccgagg actatgaggg caagaactgc 1680 tcacacctga aagaccactg ccgcacgacc ccctgtgaag tgattgacag ctgcacagtg 1740 gccatggctt ccaacgacac acctgaaggg gtgcggtata tttcctccaa cgtctgtggt 1800 cctcacggga agtgcaagag tcagtcggga ggcaaattca cctgtgactg taacaaaggc 1860 ttcacgggaa catactgcca tgaaaatatt aatgactgtg agagcaaccc ttgtagaaac 1920 ggtggcactt gcatcgatgg tgtcaactcc tacaagtgca tctgtagtga cggctgggag 1980 ggggcctact gtgaaaccaa tattaatgac tgcagccaga acccctgcca caatgggggc 2040 acgtgtcgcg acctggtcaa tgacttctac tgtgactgta aaaatgggtg gaaaggaaag 2100 acctgccact cacgtgacag tcagtgtgat gaggccacgt gcaacaacgg tggcacctgc 2160 tatgatgagg gggatgcttt taagtgcatg tgtcctggcg gctgggaagg aacaacctgt 2220 aacatagccc gaaacagtag ctgcctgccc aacccctgcc ataatggggg cacatgtgtg 2280 gtcaacggcg agtcctttac gtgcgtctgc aaggaaggct gggaggggcc catctgtgct 2340 cagaatacca atgactgcag ccctcatccc tgttacaaca gcggcacctg tgtggatgga 2400 gacaactggt accggtgcga atgtgccccg ggttttgctg ggcccgactg cagaataaac 2460 atcaatgaat gccagtcttc accttgtgcc tttggagcga cctgtgtgga tgagatcaat 2520 ggctaccggt gtgtctgccc tccagggcac agtggtgcca agtgccagga agtttcaggg 2580 agaccttgca tcaccatggg gagtgtgata ccagatgggg ccaaatggga tgatgactgt 2640 aatacctgcc agtgcctgaa tggacggatc gcctgctcaa aggtctggtg tggccctcga 2700 ccttgcctgc tccacaaagg gcacagcgag tgccccagcg ggcagagctg catccccatc 2760 ctggacgacc agtgcttcgt ccacccctgc actggtgtgg gcgagtgtcg gtcttccagt 2820 ctccagccgg tgaagacaaa gtgcacctct gactcctatt accaggataa ctgtgcgaac 2880 atcacattta cctttaacaa ggagatgatg tcaccaggtc ttactacgga gcacatttgc 2940 agtgaattga ggaatttgaa tattttgaag aatgtttccg ctgaatattc aatctacatc 3000 gcttgcgagc cttccccttc agcgaacaat gaaatacatg tggccatttc tgctgaagat 3060 atacgggatg atgggaaccc gatcaaggaa atcactgaca aaataatcga tcttgttagt 3120 aaacgtgatg gaaacagctc gctgattgct gccgttgcag aagtaagagt tcagaggcgg 3180 cctctgaaga acagaacaga tttccttgtt cccttgctga gctctgtctt aactgtggct 3240 tggatctgtt gcttggtgac ggccttctac tggtgcctgc ggaagcggcg gaagccgggc 3300 agccacacac actcagcctc tgaggacaac accaccaaca acgtgcggga gcagctgaac 3360 cagatcaaaa accccattga gaaacatggg gccaacacgg tccccatcaa ggattatgag 3420 aacaagaact ccaaaatgtc taaaataagg acacacaatt ctgaagtaga agaggacgac 3480 atggacaaac accagcagaa agcccggttt gccaagcagc cggcgtacac gctggtagac 3540 agagaagaga agccccccaa cggcacgccg acaaaacacc caaactggac aaacaaacag 3600 gacaacagag acttggaaag tgcccagagc ttaaaccgaa tggagtacat cgtatag 3657 <210> 3 <211> 6966 <212> DNA <213> Unknown <220> <223> Notch3 cDNA sequence <400> 3 atggggccgg gggcccgtgg ccgccgccgc cgccgtcgcc cgatgtcgcc gccaccgcca 60 ccgccacccg tgcgggcgct gcccctgctg ctgctgctag cggggccggg ggctgcagcc 120 cccccttgcc tggacggaag cccgtgtgca aatggaggtc gttgcaccca gctgccctcc 180 cgggaggctg cctgcctgtg cccgcctggc tgggtgggtg agcggtgtca gctggaggac 240 ccctgtcact caggcccctg tgctggccgt ggtgtctgcc agagttcagt ggtggctggc 300 accgcccgat tctcatgccg gtgcccccgt ggcttccgag gccctgactg ctccctgcca 360 gatccctgcc tcagcagccc ttgtgcccac ggtgcccgct gctcagtggg gcccgatgga 420 cgcttcctct gctcctgccc acctggctac cagggccgca gctgccgaag cgacgtggat 480 gagtgccggg tgggtgagcc ctgccgccat ggtggcacct gcctcaacac acctggctcc 540 ttccgctgcc agtgtccagc tggctacaca gggccactat gtgagaaccc cgcggtgccc 600 tgtgcaccct caccatgccg taacgggggc acctgcaggc agagtggcga cctcacttac 660 gactgtgcct gtcttcctgg gtttgagggt cagaattgtg aagtgaacgt ggacgactgt 720 ccaggacacc gatgtctcaa tggggggaca tgcgtggatg gcgtcaacac ctataactgc 780 cagtgccctc ctgagtggac aggccagttc tgcacggagg acgtggatga gtgtcagctg 840 cagcccaacg cctgccacaa tgggggtacc tgcttcaaca cgctgggtgg ccacagctgc 900 gtgtgtgtca atggctggac aggcgagagc tgcagtcaga atatcgatga ctgtgccaca 960 gccgtgtgct tccatggggc cacctgccat gaccgcgtgg cttctttcta ctgtgcctgc 1020 cccatgggca agactggcct cctgtgtcac ctggatgacg cctgtgtcag caacccctgc 1080 cacgaggatg ctatctgtga cacaaatccg gtgaacggcc gggccatttg cacctgtcct 1140 cccggcttca cgggtggggc atgtgaccag gatgtggacg agtgctctat cggcgccaac 1200 ccctgcgagc acttgggcag gtgcgtgaac acgcagggct ccttcctgtg ccagtgcggt 1260 cgtggctaca ctggacctcg ctgtgagacc gatgtcaacg agtgtctgtc ggggccctgc 1320 cgaaaccagg ccacgtgcct cgaccgcata ggccagttca cctgtatctg tatggcaggc 1380 ttcacaggaa cctattgcga ggtggacatt gacgagtgtc agagtagccc ctgtgtcaac 1440 ggtggggtct gcaaggaccg agtcaatggc ttcagctgca cctgcccctc gggcttcagc 1500 gt; aaatgcgtgg accagcccga tggctacgag tgccgctgtg ccgagggctt tgagggcacg 1620 ctgtgtgatc gcaacgtgga cgactgctcc cctgacccat gccaccatgg tcgctgcgtg 1680 gatggcatcg ccagcttctc atgtgcctgt gctcctggct acacgggcac acgctgcgag 1740 agccaggtgg acgaatgccg cagccagccc tgccgccatg gcggcaaatg cctagacctg 1800 gtggacaagt acctctgccg ctgcccttct gggaccacag gtgtgaactg cgaagtgaac 1860 attgacgact gtgccagcaa cccctgcacc tttggagtct gccgtgatgg catcaaccgc 1920 tacgactgtg tctgccaacc tggcttcaca gggccccttt gtaacgtgga gatcaatgag 1980 tgtgcttcca gcccatgcgg cgagggaggt tcctgtgtgg atggggaaaa tggcttccgc 2040 tgcctctgcc cgcctggctc cttgccccca ctctgcctcc ccccgagcca tccctgtgcc 2100 catgagccct gcagtcacgg catctgctat gatgcacctg gcgggttccg ctgtgtgtgt 2160 gagcctggct ggagtggccc ccgctgcagc cagagcctgg cccgagacgc ctgtgagtcc 2220 cagccgtgca gggccggtgg gacatgcagc agcgatggaa tgggtttcca ctgcacctgc 2280 ccgcctggtg tccagggacg tcagtgtgaa ctcctctccc cctgcacccc gaacccctgt 2340 gagcatgggg gccgctgcga gtctgcccct ggccagctgc ctgtctgctc ctgcccccag 2400 ggctggcaag gcccacgatg ccagcaggat gtggacgagt gtgctggccc cgcaccctgt 2460 ggccctcatg gtatctgcac caacctggca gggagtttca gctgcacctg ccatggaggg 2520 tacactggcc cttcctgcga tcaggacatc aatgactgtg accccaaccc atgcctgaac 2580 ggtggctcgt gccaagacgg cgtgggctcc ttttcctgct cctgcctccc tggtttcgcc 2640 ggcccacgat gcgcccgcga tgtggatgag tgcctgagca acccctgcgg cccgggcacc 2700 tgtaccgacc acgtggcctc cttcacctgc acctgcccgc caggctacgg aggcttccac 2760 tgcgaacagg acctgcccga ctgcagcccc agctcctgct tcaatggcgg gacctgtgtg 2820 gacggcgtga actcgttcag ctgcctgtgc cgtcccggct acacaggagc ccactgccaa 2880 catgaggcag acccctgcct ctcgcggccc tgcctacacg ggggcgtctg cagcgccgcc 2940 caccctggct tccgctgcac ctgcctcgag agcttcacgg gcccgcagtg ccagacgctg 3000 gtggattggt gcagccgcca gccttgtcaa aacgggggtc gctgcgtcca gactggggcc 3060 tattgccttt gtccccctgg atggagcgga cgcctctgtg acatccgaag cttgccctgc 3120 agggaggccg cagcccagat cggggtgcgg ctggagcagc tgtgtcaggc gggtgggcag 3180 tgtgtggatg aagacagctc ccactactgc gtgtgcccag agggccgtac tggtagccac 3240 tgtgagcagg aggtggaccc ctgcttggcc cagccctgcc agcatggggg gacctgccgt 3300 ggctatatgg ggggctacat gtgtgagtgt cttcctggct acaatggtga taactgtgag 3360 gacgacgtgg acgagtgtgc ctcccagccc tgccagcacg ggggttcatg cattgacctc 3420 gtggcccgct atctctgctc ctgtccccca ggaacgctgg gggtgctctg cgagattaat 3480 gaggatgact gcggcccagg cccaccgctg gactcagggc cccggtgcct acacaatggc 3540 acctgcgtgg acctggtggg tggtttccgc tgcacctgtc ccccaggata cactggtttg 3600 cgctgcgagg cagacatcaa tgagtgtcgc tcaggtgcct gccacgcggc acacacccgg 3660 gactgcctgc aggacccagg cggaggtttc cgttgccttt gtcatgctgg cttctcaggt 3720 cctcgctgtc agactgtcct gtctccctgc gagtcccagc catgccagca tggaggccag 3780 tgccgtccta gcccgggtcc tgggggtggg ctgaccttca cctgtcactg tgcccagccg 3840 ttctggggtc cgcgttgcga gcgggtggcg cgctcctgcc gggagctgca gtgcccggtg 3900 ggcgtcccat gccagcagac gccccgcggg ccgcgctgcg cctgcccccc agggttgtcg 3960 ggaccctcct gccgcagctt cccggggtcg ccgccggggg ccagcaacgc cagctgcgcg 4020 gccgccccct gtctccacgg gggctcctgc cgccccgcgc cgctcgcgcc cttcttccgc 4080 tgcgcttgcg cgcagggctg gaccgggccg cgctgcgagg cgcccgccgc ggcacccgag 4140 gtctcggagg agccgcggtg cccgcgcgcc gcctgccagg ccaagcgcgg ggaccagcgc 4200 tgcgaccgcg agtgcaacag cccaggctgc ggctgggacg gcggcgactg ctcgctgagc 4260 gtgggcgacc cctggcggca atgcgaggcg ctgcagtgct ggcgcctctt caacaacagc 4320 cgctgcgacc ccgcctgcag ctcgcccgcc tgcctctacg acaacttcga ctgccacgcc 4380 ggtggccgcg agcgcacttg caacccggtg tacgagaagt actgcgccga ccactttgcc 4440 gacggccgct gcgaccaggg ctgcaacacg gaggagtgcg gctgggatgg gctggattgt 4500 gccagcgagg tgccggccct gctggcccgc ggcgtgctgg tgctcacagt gctgctgccg 4560 ccagaggagc tactgcgttc cagcgccgac tttctgcagc ggctcagcgc catcctgcgc 4620 acctcgctgc gcttccgcct ggacgcgcac ggccaggcca tggtcttccc ttaccaccgg 4680 cctagtcctg gctccgaacc ccgggcccgt cgggagctgg cccccgaggt gatcggctcg 4740 gtagtaatgc tggagattga caaccggctc tgcctgcagt cgcctgagaa tgatcactgc 4800 ttccccgatg cccagagcgc cgctgactac ctgggagcgt tgtcagcggt ggagcgcctg 4860 gacttcccgt acccactgcg ggacgtgcgg ggggagccgc tggagcctcc agaacccagc 4920 gtcccgctgc tgccactgct agtggcgggc gctgtcttgc tgctggtcat tctcgtcctg 4980 ggtgtcatgg tggcccggcg caagcgcgag cacagcaccc tctggttccc tgagggcttc 5040 tcactgcaca aggacgtggc ctctggtcac aagggccggc gggaacccgt gggccaggac 5100 gcgctgggca tgaagaacat ggccaagggt gagagcctga tgggggaggt ggccacagac 5160 tggatggaca cagagtgccc agaggccaag cggctaaagg tagaggagcc aggcatgggg 5220 gctgaggagg ctgtggattg ccgtcagtgg actcaacacc atctggttgc tgctgacatc 5280 cgcgtggcac cagccatggc actgacacca ccacagggcg acgcagatgc tgatggcatg 5340 gatgtcaatg tgcgtggccc agatggcttc accccgctaa tgctggcttc cttctgtggg 5400 ggggctctgg agccaatgcc aactgaagag gatgaggcag atgacacatc agctagcatc 5460 atctccgacc tgatctgcca gggggctcag cttggggcac ggactgaccg tactggcgag 5520 actgctttgc acctggctgc ccgttatgcc cgtgctgatg cagccaagcg gctgctggat 5580 gctggggcag acaccaatgc ccaggaccac tcaggccgca ctcccctgca cacagctgtc 5640 acagccgatg cccagggtgt cttccagatt ctcatccgaa accgctctac agacttggat 5700 gcccgcatgg cagatggctc aacggcactg atcctggcgg cccgcctggc agtagagggc 5760 atggtggaag agctcatcgc cagccatgct gatgtcaatg ctgtggatga gcttgggaaa 5820 tcagccttac actgggctgc ggctgtgaac aacgtggaag ccactttggc cctgctcaaa 5880 aatggagcca ataaggacat gcaggatagc aaggaggaga cccccctatt cctggccgcc 5940 cgcgagggca gctatgaggc tgccaagctg ctgttggacc actttgccaa ccgtgagatc 6000 accgaccacc tggacaggct gccgcgggac gtagcccagg agagactgca ccaggacatc 6060 gtgcgcttgc tggatcaacc cagtgggccc cgcagccccc ccggtcccca cggcctgggg 6120 cctctgctct gtcctccagg ggccttcctc cctggcctca aagcggcaca gtcggggtcc 6180 aagaagagca ggaggccccc cgggaaggcg gggctggggc cgcaggggcc ccgggggcgg 6240 ggcaagaagc tgacgctggc ctgcccgggc cccctggctg acagctcggt cacgctgtcg 6300 cccgtggact cgctggactc cccgcggcct ttcggtgggc cccctgcttc ccctggtggc 6360 ttcccccttg aggggcccta tgcagctgcc actgccactg cagtgtctct ggcacagctt 6420 ggtggcccag gccgggcggg tctagggcgc cagccccctg gaggatgtgt actcagcctg 6480 ggcctgctga accctgtggc tgtgcccctc gattgggccc ggctgccccc acctgcccct 6540 ccaggcccct cgttcctgct gccactggcg ccgggacccc agctgctcaa cccagggacc 6600 cccgtctccc cgcaggagcg gcccccgcct tacctggcag tcccaggaca tggcgaggag 6660 tacccggcgg ctggggcaca cagcagcccc ccaaaggccc gcttcctgcg ggttcccagt 6720 gagcaccctt acctgacccc atcccccgaa tcccctgagc actgggccag cccctcacct 6780 ccctccctct cagactggtc cgaatccacg cctagcccag ccactgccac tggggccatg 6840 gccaccacca ctggggcact gcctgcccag ccacttccct tgtctgttcc cagctccctt 6900 gctcaggccc agacccagct ggggccccag ccggaagtta cccccaagag gcaagtgttg 6960 gcctga 6966 <210> 4 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> Jagged1 F primer <400> 4 atgcgttccc cacggac 17 <210> 5 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Jagged1 R primer <400> 5 ctatacgatg tactccattc ggtttaagct c 31 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ref-1 siRNA target sequence <400> 6 aagtctggta cgactggagt a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Jagged1 siRNA target sequence <400> 7 aaatgggatg atgactgtaa t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Notch3 siRNA target sequence <400> 8 aactgcgaag tgaacattga c 21 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Egr1 siRNA target sequence <400> 9 aagaggcata ccaagatcca ctt 23 <210> 10 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Ape / Ref-1 F primer <400> 10 gatccgtctg gtacgactgg agtattcaag agatactcca gtcgtaccag acttttttgg 60 aaa 63 <210> 11 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> Ape / Ref-1 R primer <400> 11 agcttttcca aaaaagtctg gtacgactgg agtatctctt gaatactcca gtcgtaccag 60 acg 63 <210> 12 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> JAG1 F primer <400> 12 gatccatggg atgatgactg taatttcaag agaattacag tcatcatccc atttttttgg 60 aaa 63 <210> 13 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> JAG1 R primer <400> 13 agcttttcca aaaaaatggg atgatgactg taattctctt gaaattacag tcatcatccc 60 atg 63 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JAG1 RT-PCR F primer <400> 14 gaaacagctc gctgattgct 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> JAG1 RT-PCR R primer <400> 15 accaagcaac agatccaagc 20 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ape1 / Ref-1 RT-PCR F primer <400> 16 tgaagccttt cgcaagttcc t 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Ape1 / Ref-1 RT-PCR R primer <400> 17 tgaggtctcc acacagcaca a 21 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > q18S rRNA RT-PCR F primer <400> 18 cgccgctaga ggtgaaattc 20 <210> 19 <211> 19 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > q18S rRNA RT-PCR R primer <400> 19 ttggcaaatg ctttcgctc 19 <210> 20 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> mutated E1 sequence <400> 20 gttggaaatc gcc 13 <210> 21 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> mutated E2 sequence <400> 21 ggtagagtct ccg 13 <210> 22 <211> 13 <212> DNA <213> Artificial Sequence <220> <223> mutated E3 sequence <400> 22 cccggagttg gct 13 <210> 23 <211> 318 <212> PRT <213> Artificial Sequence <220> <223> APE / Ref-1 amino acid sequence <400> 23 Met Pro Lys Arg Gly Lys Lys Gly Ala Val Ala Glu Asp Gly Asp Glu   1 5 10 15 Leu Arg Thr Glu Pro Glu Ala Lys Lys Ser Lys Thr Ala Ala Lys Lys              20 25 30 Asn Asp Lys Glu Ala Ala Gly Glu Gly Pro Ala Leu Tyr Glu Asp Pro          35 40 45 Pro Asp Gln Lys Thr Ser Pro Ser Gly Lys Pro Ala Thr Leu Lys Ile      50 55 60 Cys Ser Trp Asn Val Asp Gly Leu Arg Ala Trp Ile Lys Lys Lys Gly  65 70 75 80 Leu Asp Trp Val Lys Glu Glu Ala Pro Asp Ile Leu Cys Leu Gln Glu                  85 90 95 Thr Lys Cys Ser Glu Asn Lys Leu Pro Ala Glu Leu Gln Glu Leu Pro             100 105 110 Gly Leu Ser His Gln Tyr Trp Ser Ala Pro Ser Asp Lys Glu Gly Tyr         115 120 125 Ser Gly Val Gly Leu Leu Ser Arg Gln Cys Pro Leu Lys Val Ser Tyr     130 135 140 Gly Ile Gly Asp Glu Glu His Asp Gln Glu Gly Arg Val Valle Ala 145 150 155 160 Glu Phe Asp Ser Phe Val Leu Val Thr Ala Tyr Val Pro Asn Ala Gly                 165 170 175 Arg Gly Leu Val Arg Leu Glu Tyr Arg Gln Arg Trp Asp Glu Ala Phe             180 185 190 Arg Lys Phe Leu Lys Gly Leu Ala Ser Arg Lys Pro Leu Val Leu Cys         195 200 205 Gly Asp Leu Asn Val Ala His Glu Glu Ile Asp Leu Arg Asn Pro Lys     210 215 220 Gly Asn Lys Lys Asn Ala Gly Phe Thr Pro Gln Glu Arg Gln Gly Phe 225 230 235 240 Gly Glu Leu Leu Gln Ala Val Pro Leu Ala Asp Ser Phe Arg His Leu                 245 250 255 Tyr Pro Asn Thr Pro Tyr Ala Tyr Thr Phe Trp Thr Tyr Met Met Asn             260 265 270 Ala Arg Ser Lys Asn Val Gly Trp Arg Leu Asp Tyr Phe Leu Leu Ser         275 280 285 His Ser Leu Leu Pro Ala Leu Cys Asp Ser Lys Ile Arg Ser Lys Ala     290 295 300 Leu Gly Ser Asp His Cys Pro Ile Thr Leu Tyr Leu Ala Leu 305 310 315 <210> 24 <211> 1218 <212> PRT <213> Artificial Sequence <220> <223> JAGGED1 amino acid sequence <400> 24 Met Arg Ser Pro Arg Thr Arg Gly Arg Ser Gly Arg Pro Leu Ser Leu   1 5 10 15 Leu Leu Ala Leu Leu Cys Ala Leu Arg Ala Lys Val Cys Gly Ala Ser              20 25 30 Gly Gln Phe Glu Leu Glu Ile Leu Ser Met Gln Asn Val Asn Gly Glu          35 40 45 Leu Gln Asn Gly Asn Cys Cys Gly Gly Ala Arg Asn Pro Gly Asp Arg      50 55 60 Lys Cys Thr Arg Asp Glu Cys Asp Thr Tyr Phe Lys Val Cys Leu Lys  65 70 75 80 Glu Tyr Gln Ser Arg Val Thr Ala Gly Gly Pro Cys Ser Phe Gly Ser                  85 90 95 Gly Ser Thr Pro Val Ile Gly Gly Asn Thr Phe Asn Leu Lys Ala Ser             100 105 110 Arg Gly Asn Asp Arg Asn Arg Ile Val Leu Pro Phe Ser Phe Ala Trp         115 120 125 Pro Arg Ser Tyr Thr Leu Leu Val Glu Ala Trp Asp Ser Ser Asn Asp     130 135 140 Thr Val Gln Pro Asp Ser Ile Ile Glu Lys Ala Ser His Ser Gly Met 145 150 155 160 Ile Asn Pro Ser Arg Gln Trp Gln Thr Leu Lys Gln Asn Thr Gly Val                 165 170 175 Ala His Phe Glu Tyr Gln Ile Arg Val Thr Cys Asp Asp Tyr Tyr Tyr             180 185 190 Gly Phe Gly Cys Asn Lys Phe Cys Arg Pro As Asp Phe Phe Gly         195 200 205 His Tyr Ala Cys Asp Gln Asn Gly Asn Lys Thr Cys Met Glu Gly Trp     210 215 220 Met Gly Pro Glu Cys Asn Arg Ala Ile Cys Arg Gln Gly Cys Ser Pro 225 230 235 240 Lys His Gly Ser Cys Lys Leu Pro Gly Asp Cys Arg Cys Gln Tyr Gly                 245 250 255 Trp Gln Gly Leu Tyr Cys Asp Lys Cys Ile Pro His Pro Gly Cys Val             260 265 270 His Gly Ile Cys Asn Glu Pro Trp Gln Cys Leu Cys Glu Thr Asn Trp         275 280 285 Gly Gly Gln Leu Cys Asp Lys Asp Leu Asn Tyr Cys Gly Thr His Gln     290 295 300 Pro Cys Leu Asn Gly Gly Thr Cys Ser Asn Thr Gly Pro Asp Lys Tyr 305 310 315 320 Gln Cys Ser Cys Pro Glu Gly Tyr Ser Gly Pro Asn Cys Glu Ile Ala                 325 330 335 Glu His Ala Cys Leu Ser Asp Pro Cys His Asn Arg Gly Ser Cys Lys             340 345 350 Glu Thr Ser Leu Gly Phe Glu Cys Glu Cys Ser Pro Gly Trp Thr Gly         355 360 365 Pro Thr Cys Ser Thr Asn Ile Asp Asp Cys Ser Pro Asn Asn Cys Ser     370 375 380 His Gly Gly Thr Cys Gln Asp Leu Val Asn Gly Phe Lys Cys Val Cys 385 390 395 400 Pro Pro Gln Trp Thr Gly Lys Thr Cys Gln Leu Asp Ala Asn Glu Cys                 405 410 415 Glu Ala Lys Pro Cys Val Asn Ala Lys Ser Cys Lys Asn Leu Ile Ala             420 425 430 Ser Tyr Tyr Cys Asp Cys Leu Pro Gly Trp Met Gly Gln Asn Cys Asp         435 440 445 Ile Asn Ile Asn Asp Cys Leu Gly Gln Cys Gln Asn Asp Ala Ser Cys     450 455 460 Arg Asp Leu Val Asn Gly Tyr Arg Cys Ile Cys Pro Pro Gly Tyr Ala 465 470 475 480 Gly Asp His Cys Glu Arg Asp Ile Asp Glu Cys Ala Ser Asn Pro Cys                 485 490 495 Leu Asn Gly Gly His Cys Gln Asn Glu Ile Asn Arg Phe Gln Cys Leu             500 505 510 Cys Pro Thr Gly Phe Ser Gly Asn Leu Cys Gln Leu Asp Ile Asp Tyr         515 520 525 Cys Glu Pro Asn Pro Cys Gln Asn Gly Ala Gln Cys Tyr Asn Arg Ala     530 535 540 Ser Asp Tyr Phe Cys Lys Cys Pro Glu Asp Tyr Glu Gly Lys Asn Cys 545 550 555 560 Ser His Leu Lys Asp His Cys Arg Thr Thr Pro Cys Glu Val Ile Asp                 565 570 575 Ser Cys Thr Val Ala Met Ala Ser Asn Asp Thr Pro Glu Gly Val Arg             580 585 590 Tyr Ile Ser Ser Asn Val Cys Gly Pro His Gly Lys Cys Lys Ser Gln         595 600 605 Ser Gly Gly Lys Phe Thr Cys Asp Cys Asn Lys Gly Phe Thr Gly Thr     610 615 620 Tyr Cys His Glu Asn Ile Asn Asp Cys Glu Ser Asn Pro Cys Arg Asn 625 630 635 640 Gly Gly Thr Cys Ile Asp Gly Val Asn Ser Tyr Lys Cys Ile Cys Ser                 645 650 655 Asp Gly Trp Glu Gly Ala Tyr Cys Glu Thr Asn Ile Asn Asp Cys Ser             660 665 670 Gln Asn Pro Cys His Asn Gly Gly Thr Cys Arg Asp Leu Val Asn Asp         675 680 685 Phe Tyr Cys Asp Cys Lys Asn Gly Trp Lys Gly Lys Thr Cys His Ser     690 695 700 Arg Asp Ser Gln Cys Asp Glu Ala Thr Cys Asn Asn Gly Gly Thr Cys 705 710 715 720 Tyr Asp Glu Gly Asp Ala Phe Lys Cys Met Cys Pro Gly Gly Trp Glu                 725 730 735 Gly Thr Thr Cys Asn Ile Ala Arg Asn Ser Ser Cys Leu Pro Asn Pro             740 745 750 Cys His Asn Gly Gly Thr Cys Val Val Asn Gly Glu Ser Phe Thr Cys         755 760 765 Val Cys Lys Glu Gly Trp Glu Gly Pro Ile Cys Ala Gln Asn Thr Asn     770 775 780 Asp Cys Ser Pro His Pro Cys Tyr Asn Ser Gly Thr Cys Val Asp Gly 785 790 795 800 Asp Asn Trp Tyr Arg Cys Glu Cys Ala Pro Gly Phe Ala Gly Pro Asp                 805 810 815 Cys Arg Ile Asn Ile Asn Glu Cys Gln Ser Ser Pro Cys Ala Phe Gly             820 825 830 Ala Thr Cys Val Asp Glu Ile Asn Gly Tyr Arg Cys Val Cys Pro Pro         835 840 845 Gly His Ser Gly Ala Lys Cys Gln Glu Val Ser Gly Arg Pro Cys Ile     850 855 860 Thr Met Gly Ser Val Ile Pro Asp Gly Ala Lys Trp Asp Asp Asp Cys 865 870 875 880 Asn Thr Cys Gln Cys Leu Asn Gly Arg Ile Ala Cys Ser Lys Val Trp                 885 890 895 Cys Gly Pro Arg Pro Cys Leu Leu His Lys Gly His Ser Glu Cys Pro             900 905 910 Ser Gly Gln Ser Cys Ile Pro Ile Leu Asp Asp Gln Cys Phe Val His         915 920 925 Pro Cys Thr Gly Val Gly Glu Cys Arg Ser Ser Ser Leu Gln Pro Val     930 935 940 Lys Thr Lys Cys Thr Ser Asp Ser Tyr Tyr Gln Asp Asn Cys Ala Asn 945 950 955 960 Ile Thr Phe Thr Phe Asn Lys Glu Met Met Ser Pro Gly Leu Thr Thr                 965 970 975 Glu His Ile Cys Ser Glu Leu Arg Asn Leu Asn Ile Leu Lys Asn Val             980 985 990 Ser Ala Glu Tyr Ser Ile Tyr Ile Ala Cys Glu Ser Ser Ser Ala         995 1000 1005 Asn Asn Glu Ile His Val Ala Ile Ser Ala Glu Asp Ile Arg Asp Asp    1010 1015 1020 Gly Asn Pro Ile Lys Glu Ile Thr Asp Lys Ile Ile Asp Leu Val Ser 1025 1030 1035 1040 Lys Arg Asp Gly Asn Ser Ser Leu Ile Ala Ala Val Ala Glu Val Arg                1045 1050 1055 Val Gln Arg Arg Pro Leu Lys Asn Arg Thr Asp Phe Leu Val Pro Leu            1060 1065 1070 Leu Ser Ser Val Leu Thr Val Ala Trp Ile Cys Cys Leu Val Thr Ala        1075 1080 1085 Phe Tyr Trp Cys Leu Arg Lys Arg Arg Lys Pro Gly Ser His Thr His    1090 1095 1100 Ser Ala Ser Glu Asp Asn Thr Thr Asn Asn Val Arg Glu Gln Leu Asn 1105 1110 1115 1120 Gln Ile Lys Asn Pro Ile Glu Lys His Gly Ala Asn Thr Val Pro Ile                1125 1130 1135 Lys Asp Tyr Glu Asn Lys Asn Ser Lys Met Ser Lys Ile Arg Thr His            1140 1145 1150 Asn Ser Glu Val Glu Glu Asp Asp Met Asp Lys His Gln Gln Lys Ala        1155 1160 1165 Arg Phe Ala Lys Gln Pro Ala Tyr Thr Leu Val Asp Arg Glu Glu Lys    1170 1175 1180 Pro Pro Asn Gly Thr Pro Thr Lys His Pro Asn Trp Thr Asn Lys Gln 1185 1190 1195 1200 Asp Asn Arg Asp Leu Glu Ser Ala Gln Ser Leu Asn Arg Met Glu Tyr                1205 1210 1215 Ile Val         <210> 25 <211> 2321 <212> PRT <213> Artificial Sequence <220> <223> Notch3 amino acid sequence <400> 25 Met Gly Pro Gly Ala Arg Gly Arg Arg Arg Arg Arg Arg Pro Met Ser   1 5 10 15 Leu Leu Leu Pro Leu Leu              20 25 30 Leu Ala Gly Pro Gly Ala Ala Pro Pro Cys Leu Asp Gly Ser Pro          35 40 45 Cys Ala Asn Gly Gly Arg Cys Thr Gln Leu Pro Ser Arg Glu Ala Ala      50 55 60 Cys Leu Cys Pro Pro Gly Trp Val Gly Glu Arg Cys Gln Leu Glu Asp  65 70 75 80 Pro Cys His Ser Gly Pro Cys Ala Gly Arg Gly Val Cys Gln Ser Ser                  85 90 95 Val Val Ala Gly Thr Ala Arg Phe Ser Cys Arg Cys Pro Arg Gly Phe             100 105 110 Arg Gly Pro Asp Cys Ser Leu Pro Asp Pro Cys Leu Ser Ser Pro Cys         115 120 125 Ala His Gly Ala Arg Cys Ser Val Gly Pro Asp Gly Arg Phe Leu Cys     130 135 140 Ser Cys Pro Pro Gly Tyr Gln Gly Arg Ser Ser Cys Arg Ser Asp Val Asp 145 150 155 160 Glu Cys Arg Val Gly Glu Pro Cys Arg His Gly Gly Thr Cys Leu Asn                 165 170 175 Thr Pro Gly Ser Phe Arg Cys Gln Cys Pro Ala Gly Tyr Thr Gly Pro             180 185 190 Leu Cys Glu Asn Pro Ala Val Pro Cys Ala Pro Ser Pro Cys Arg Asn         195 200 205 Gly Gly Thr Cys Arg Gln Ser Gly Asp Leu Thr Tyr Asp Cys Ala Cys     210 215 220 Leu Pro Gly Phe Glu Gly Gln Asn Cys Glu Val Asn Val Asp Asp Cys 225 230 235 240 Pro Gly His Arg Cys Leu Asn Gly Gly Thr Cys Val Asp Gly Val Asn                 245 250 255 Thr Tyr Asn Cys Gln Cys Pro Pro Glu Trp Thr Gly Gln Phe Cys Thr             260 265 270 Glu Asp Val Asp Glu Cys Gln Leu Gln Pro Asn Ala Cys His Asn Gly         275 280 285 Gly Thr Cys Phe Asn Thr Leu Gly Gly His Ser Cys Val Cys Val Asn     290 295 300 Gly Trp Thr Gly Glu Ser Cys Ser Gln Asn Ile Asp Asp Cys Ala Thr 305 310 315 320 Ala Val Cys Phe His Gly Ala Thr Cys His Asp Arg Val Ala Ser Phe                 325 330 335 Tyr Cys Ala Cys Pro Met Gly Lys Thr Gly Leu Leu Cys His Leu Asp             340 345 350 Asp Ala Cys Val Ser Asn Pro Cys His Glu Asp Ala Ile Cys Asp Thr         355 360 365 Asn Pro Val Asn Gly Arg Ala Ile Cys Thr Cys Pro Pro Gly Phe Thr     370 375 380 Gly Gly Ala Cys Asp Gln Asp Val Asp Glu Cys Ser Ile Gly Ala Asn 385 390 395 400 Pro Cys Glu His Leu Gly Arg Cys Val Asn Thr Gln Gly Ser Phe Leu                 405 410 415 Cys Gln Cys Gly Arg Gly Tyr Thr Gly Pro Arg Cys Glu Thr Asp Val             420 425 430 Asn Glu Cys Leu Ser Gly Pro Cys Arg Asn Gln Ala Thr Cys Leu Asp         435 440 445 Arg Ile Gly Gln Phe Thr Cys Ile Cys Met Ala Gly Phe Thr Gly Thr     450 455 460 Tyr Cys Glu Val Asp Ile Asp Glu Cys Gln Ser Ser Pro Cys Val Asn 465 470 475 480 Gly Gly Val Cys Lys Asp Arg Val Asn Gly Phe Ser Cys Thr Cys Pro                 485 490 495 Ser Gly Phe Ser Gly Ser Thr Cys Gln Leu Asp Val Asp Glu Cys Ala             500 505 510 Ser Thr Pro Cys Arg Asn Gly Ala Lys Cys Val Asp Gln Pro Asp Gly         515 520 525 Tyr Glu Cys Arg Cys Ala Glu Gly Phe Glu Gly Thr Leu Cys Asp Arg     530 535 540 Asn Val Asp Asp Cys Ser Pro Asp Pro Cys His His Gly Arg Cys Val 545 550 555 560 Asp Gly Ile Ala Ser Phe Ser Cys Ala Cys Ala Pro Gly Tyr Thr Gly                 565 570 575 Thr Arg Cys Glu Ser Gln Val Asp Glu Cys Arg Ser Gln Pro Cys Arg             580 585 590 His Gly Gly Lys Cys Leu Asp Leu Val Asp Lys Tyr Leu Cys Arg Cys         595 600 605 Pro Ser Gly Thr Thr Gly Val Asn Cys Glu Val Asn Ile Asp Asp Cys     610 615 620 Ala Ser Asn Pro Cys Thr Phe Gly Val Cys Arg Asp Gly Ile Asn Arg 625 630 635 640 Tyr Asp Cys Val Cys Gln Pro Gly Phe Thr Gly Pro Leu Cys Asn Val                 645 650 655 Glu Ile Asn Glu Cys Ala Ser Ser Pro Cys Gly Glu Gly Gly Ser Cys             660 665 670 Val Asp Gly Glu Asn Gly Phe Arg Cys Leu Cys Pro Pro Gly Ser Leu         675 680 685 Pro Pro Leu Cys Leu Pro Pro Ser His Pro Cys Ala His Glu Pro Cys     690 695 700 Ser His Gly Ile Cys Tyr Asp Ala Pro Gly Gly Phe Arg Cys Val Cys 705 710 715 720 Glu Pro Gly Trp Ser Gly Pro Arg Cys Ser Gln Ser Leu Ala Arg Asp                 725 730 735 Ala Cys Glu Ser Gln Pro Cys Arg Ala Gly Gly Thr Cys Ser Ser Asp             740 745 750 Gly Met Gly Phe His Cys Thr Cys Pro Pro Gly Val Gln Gly Arg Gln         755 760 765 Cys Glu Leu Ser Pro Cys Thr Pro Asn Pro Cys Glu His Gly Gly     770 775 780 Arg Cys Glu Ser Ala Pro Gly Gln Leu Pro Val Cys Ser Cys Pro Gln 785 790 795 800 Gly Trp Gln Gly Pro Arg Cys Gln Gln Asp Val Asp Glu Cys Ala Gly                 805 810 815 Pro Ala Pro Cys Gly Pro His Gly Ile Cys Thr Asn Leu Ala Gly Ser             820 825 830 Phe Ser Cys Thr Cys His Gly Gly Tyr Thr Gly Pro Ser Cys Asp Gln         835 840 845 Asp Ile Asn Asp Cys Asp Pro Asn Pro Cys Leu Asn Gly Gly Ser Cys     850 855 860 Gln Asp Gly Val Gly Ser Phe Ser Cys Ser Cys Leu Pro Gly Phe Ala 865 870 875 880 Gly Pro Arg Cys Ala Arg Asp Val Asp Glu Cys Leu Ser Asn Pro Cys                 885 890 895 Gly Pro Gly Thr Cys Thr Asp His Val Ala Ser Phe Thr Cys Thr Cys             900 905 910 Pro Pro Gly Tyr Gly Gly Phe His Cys Glu Gln Asp Leu Pro Asp Cys         915 920 925 Ser Pro Ser Ser Cys Phe Asn Gly Gly Thr Cys Val Asp Gly Val Asn     930 935 940 Ser Phe Ser Cys Leu Cys Arg Pro Gly Tyr Thr Gly Ala His Cys Gln 945 950 955 960 His Glu Ala Asp Pro Cys Leu Ser Arg Pro Cys Leu His Gly Gly Val                 965 970 975 Cys Ser Ala Ala His Pro Gly Phe Arg Cys Thr Cys Leu Glu Ser Phe             980 985 990 Thr Gly Pro Gln Cys Gln Thr Leu Val Asp Trp Cys Ser Arg Gln Pro         995 1000 1005 Cys Gln Asn Gly Gly Arg Cys Val Gln Thr Gly Ala Tyr Cys Leu Cys    1010 1015 1020 Pro Pro Gly Trp Ser Gly Arg Leu Cys Asp Ile Arg Ser Leu Pro Cys 1025 1030 1035 1040 Arg Glu Ala Ala Gln Ile Gly Val Arg Leu Glu Gln Leu Cys Gln                1045 1050 1055 Ala Gly Gly Gln Cys Val Asp Glu Asp Ser Ser His Tyr Cys Val Cys            1060 1065 1070 Pro Glu Gly Arg Thr Gly Ser His Cys Glu Gln Glu Val Asp Pro Cys        1075 1080 1085 Leu Ala Gln Pro Cys Gln His Gly Gly Thr Cys Arg Gly Tyr Met Gly    1090 1095 1100 Gly Tyr Met Cys Glu Cys Leu Pro Gly Tyr Asn Gly Asp Asn Cys Glu 1105 1110 1115 1120 Asp Asp Val Asp Glu Cys Ala Ser Gln Pro Cys Gln His Gly Gly Ser                1125 1130 1135 Cys Ile Asp Leu Val Ala Arg Tyr Leu Cys Ser Cys Pro Pro Gly Thr            1140 1145 1150 Leu Gly Val Leu Cys Glu Ile Asn Glu Asp Asp Cys Gly Pro Gly Pro        1155 1160 1165 Pro Leu Asp Ser Gly Pro Arg Cys Leu His Asn Gly Thr Cys Val Asp    1170 1175 1180 Leu Val Gly Gly Phe Arg Cys Thr Cys Pro Pro Gly Tyr Thr Gly Leu 1185 1190 1195 1200 Arg Cys Glu Ala Asp Ile Asn Glu Cys Arg Ser Gly Ala Cys His Ala                1205 1210 1215 Ala His Thr Arg Asp Cys Leu Gln Asp Pro Gly Gly Gly Phe Arg Cys            1220 1225 1230 Leu Cys His Ala Gly Phe Ser Gly Pro Arg Cys Gln Thr Val Leu Ser        1235 1240 1245 Pro Cys Glu Ser Gln Pro Cys Gln His Gly Gly Gln Cys Arg Pro Ser    1250 1255 1260 Pro Gly Pro Gly Gly Gly Leu Thr Phe Thr Cys His Cys Ala Gln Pro 1265 1270 1275 1280 Phe Trp Gly Pro Arg Cys Glu Arg Val Ala Arg Ser Cys Arg Glu Leu                1285 1290 1295 Gln Cys Pro Val Gly Val Pro Cys Gln Gln Thr Pro Arg Gly Pro Arg            1300 1305 1310 Cys Ala Cys Pro Pro Gly Leu Ser Gly Pro Ser Cys Arg Ser Phe Pro        1315 1320 1325 Gly Ser Pro Pro Gly Ala Ser Asn Ala Ser Cys Ala Ala Ala Pro Cys    1330 1335 1340 Leu His Gly Gly Ser Cys Arg Pro Ala Pro Leu Ala Pro Phe Phe Arg 1345 1350 1355 1360 Cys Ala Cys Ala Gln Gly Trp Thr Gly Pro Arg Cys Glu Ala Pro Ala                1365 1370 1375 Ala Ala Pro Glu Val Ser Glu Glu Pro Arg Cys Pro Arg Ala Ala Cys            1380 1385 1390 Gln Ala Lys Arg Gly Asp Gln Arg Cys Asp Arg Glu Cys Asn Ser Pro        1395 1400 1405 Gly Cys Gly Trp Asp Gly Gly Asp Cys Ser Leu Ser Val Gly Asp Pro    1410 1415 1420 Trp Arg Gln Cys Glu Ala Leu Gln Cys Trp Arg Leu Phe Asn Asn Ser 1425 1430 1435 1440 Arg Cys Asp Pro Ala Cys Ser Ser Pro Ala Cys Leu Tyr Asp Asn Phe                1445 1450 1455 Asp Cys His Ala Gly Gly Arg Glu Arg Thr Cys Asn Pro Val Tyr Glu            1460 1465 1470 Lys Tyr Cys Ala Asp His Phe Ala Asp Gly Arg Cys Asp Gln Gly Cys        1475 1480 1485 Asn Thr Glu Glu Cys Gly Trp Asp Gly Leu Asp Cys Ala Ser Glu Val    1490 1495 1500 Pro Ala Leu Leu Ala Arg Gly Val Leu Val Leu Thr Val Leu Leu Pro 1505 1510 1515 1520 Pro Glu Glu Leu Arg Ser Ser Ala Asp Phe Leu Gln Arg Leu Ser                1525 1530 1535 Ala Ile Leu Arg Thr Ser Leu Arg Phe Arg Leu Asp Ala His Gly Gln            1540 1545 1550 Ala Met Val Phe Pro Tyr His Arg Pro Ser Pro Gly Ser Glu Pro Arg        1555 1560 1565 Ala Arg Arg Glu Leu Ala Pro Glu Val Ile Gly Ser Val Val Met Leu    1570 1575 1580 Glu Ile Asp Asn Arg Leu Cys Leu Gln Ser Pro Glu Asn Asp His Cys 1585 1590 1595 1600 Phe Pro Asp Ala Gln Ser Ala Ala Asp Tyr Leu Gly Ala Leu Ser Ala                1605 1610 1615 Val Glu Arg Leu Asp Phe Pro Tyr Pro Leu Arg Asp Val Arg Gly Glu            1620 1625 1630 Pro Leu Glu Pro Pro Glu Pro Ser Val Pro Leu Leu Pro Leu Leu Val        1635 1640 1645 Ala Gly Ala Val Leu Leu Leu Val Ile Leu Val Leu Gly Val Met Val    1650 1655 1660 Ala Arg Arg Lys Arg Glu His Ser Thr Leu Trp Phe Pro Glu Gly Phe 1665 1670 1675 1680 Ser Leu His Lys Asp Val Ala Ser Gly His Lys Gly Arg Arg Glu Pro                1685 1690 1695 Val Gly Gln Asp Ala Leu Gly Met Lys Asn Met Ala Lys Gly Glu Ser            1700 1705 1710 Leu Met Gly Glu Val Ala Thr Asp Trp Met Asp Thr Glu Cys Pro Glu        1715 1720 1725 Ala Lys Arg Leu Lys Val Glu Glu Gly Aly Glu Gly Aly    1730 1735 1740 Val Asp Cys Arg Gln Trp Thr Gln His His Leu Val Ala Ala Asp Ile 1745 1750 1755 1760 Arg Val Ala Pro Ala Met Ala Leu Thr Pro Pro Gln Gly Asp Ala Asp                1765 1770 1775 Ala Asp Gly Met Asp Val Asn Val Arg Gly Pro Asp Gly Phe Thr Pro            1780 1785 1790 Leu Met Leu Ala Ser Phe Cys Gly Aly Leu Glu Pro Met Pro Thr        1795 1800 1805 Glu Glu Asp Glu Ala Asp Asp Thr Ser Ala Ser Ile Ile Ser Asp Leu    1810 1815 1820 Ile Cys Gln Gly Ala Gln Leu Gly Ala Arg Thr Asp Arg Thr Gly Glu 1825 1830 1835 1840 Thr Ala Leu His Leu Ala Ala Arg Tyr Ala Arg Ala Asp Ala Ala Lys                1845 1850 1855 Arg Leu Leu Asp Ala Gly Ala Asp Thr Asn Ala Gln Asp His Ser Gly            1860 1865 1870 Arg Thr Pro Leu His Thr Ala Val Thr Ala Asp Ala Gln Gly Val Phe        1875 1880 1885 Gln Ile Leu Ile Arg Asn Arg Ser Thr Asp Leu Asp Ala Arg Met Ala    1890 1895 1900 Asp Gly Ser Thr Ala Leu Ile Leu Ala Ala Arg Leu Ala Val Glu Gly 1905 1910 1915 1920 Met Val Glu Glu Leu Ile Ala Ser His Ala Asp Val Asn Ala Val Asp                1925 1930 1935 Glu Leu Gly Lys Ser Ala Leu His Trp Ala Ala Ala Val Asn Asn Val            1940 1945 1950 Glu Ala Thr Leu Ala Leu Leu Lys Asn Gly Ala Asn Lys Asp Met Gln        1955 1960 1965 Asp Ser Lys Glu Glu Thr Pro Leu Phe Leu Ala Ala Arg Glu Gly Ser    1970 1975 1980 Tyr Glu Ala Ala Lys Leu Leu Leu Asp His Phe Ala Asn Arg Glu Ile 1985 1990 1995 2000 Thr Asp His Leu Asp Arg Leu Pro Arg Asp Val Ala Gln Glu Arg Leu                2005 2010 2015 His Gln Asp Ile Val Arg Leu Leu Asp Gln Pro Ser Gly Pro Arg Ser            2020 2025 2030 Pro Pro Gly Pro His Gly Leu Gly Pro Leu Leu Cys Pro Pro Gly Ala        2035 2040 2045 Phe Leu Pro Gly Leu Lys Ala Ala Gln Ser Gly Ser Lys Lys Ser Arg    2050 2055 2060 Arg Pro Pro Gly Lys Ala Gly Leu Gly Pro Gln Gly Pro Arg Gly Arg 2065 2070 2075 2080 Gly Lys Lys Leu Thr Leu Ala Cys Pro Gly Pro Leu Ala Asp Ser Ser                2085 2090 2095 Val Thr Leu Ser Pro Val Asp Ser Leu Asp Ser Pro Arg Pro Phe Gly            2100 2105 2110 Gly Pro Pro Ala Ser Pro Gly Gly Phe Pro Leu Glu Gly Pro Tyr Ala        2115 2120 2125 Ala Ala Thr Ala Thr Ala Val Ser Leu Ala Gln Leu Gly Gly Pro Gly    2130 2135 2140 Arg Ala Gly Leu Gly Arg Gln Pro Pro Gly Gly Cys Val Leu Ser Leu 2145 2150 2155 2160 Gly Leu Leu Asn Pro Val Ala Val Pro Leu Asp Trp Ala Arg Leu Pro                2165 2170 2175 Pro Pro Ala Pro Pro Gly Pro Ser Phe Leu Leu Pro Leu Ala Pro Gly            2180 2185 2190 Pro Gln Leu Leu Asn Pro Gly Thr Pro Val Ser Pro Gln Glu Arg Pro        2195 2200 2205 Pro Pro Tyr Leu Ala Val Pro Gly His Gly Glu Glu Tyr Pro Ala Ala    2210 2215 2220 Gly Ala His Ser Ser Pro Pro Lys Ala Arg Phe Leu Arg Val Ser Ser 2225 2230 2235 2240 Glu His Pro Tyr Leu Thr Pro Ser Pro Glu Ser Pro Glu His Trp Ala                2245 2250 2255 Ser Pro Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser            2260 2265 2270 Pro Ala Thr Ala Thr Gly Ala Met Ala Thr Thr Thr Gly Ala Leu Pro        2275 2280 2285 Ala Gln Pro Leu Pro Leu Ser Val Pro Ser Ser Leu Ala Gln Ala Gln    2290 2295 2300 Thr Gln Leu Gly Pro Gln Pro Glu Val Thr Pro Lys Arg Gln Val Leu 2305 2310 2315 2320 Ala    

Claims (15)

A composition for marker diagnosis of colon cancer comprising an Ape1 / Ref-1 (apurinic / apyrimidinic endonuclease / redox factor-1) protein or a polynucleotide encoding said protein. The method according to claim 1,
Wherein the polynucleotide has the nucleotide sequence of SEQ ID NO: 1. A composition for a colon cancer diagnostic marker comprising a Jagged1 protein or a polynucleotide encoding said protein. The method of claim 3,
Wherein the polynucleotide has the nucleotide sequence of SEQ ID NO: 2. A Notch3 protein or a polynucleotide encoding the protein. 6. The method of claim 5,
Wherein the polynucleotide has the nucleotide sequence of SEQ ID NO: 3. Ape1 / Ref-1, Jagged1, and Notch3. 8. The method of claim 7,
Wherein the substance is a primer set or a probe capable of amplifying genes encoding Ape1 / Ref-1, Jagged1 and Notch3 proteins, respectively. 8. The method of claim 7,
Wherein said substance is an antibody that specifically recognizes Ape1 / Ref-1, Jagged1, and Notch3 proteins, respectively. (a) measuring the level of expression of the Ape1 / Ref-1, Jaggedl and Notch3 proteins present in the biological sample; And
(b) comparing the measurement results of step (a) with Ape1 / Ref-1, Jaggedl and Notch3 expression levels of a control sample. 11. The method of claim 10,
Wherein the biological sample is selected from the group consisting of tissue, cells, blood, serum, plasma, saliva, and urine. The method according to claim 10 or 11,
The measurement may be performed using a reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, Western blot, northern blot, enzyme linked immunosorbent assay (ELISA), immunoblot, Wherein the method is selected from the group consisting of immunohistochemistry, immunohistochemical staining, radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay. (a) contacting a sample to be analyzed with colon cancer cells containing genes encoding Ape1 / Ref-1, Jaggedl and Notch3 proteins, respectively;
(b) measuring the level or activity of the Ape1 / Ref-1, Jaggedl and Notch3 proteins; And
(c) determining the sample as a substance for the prophylactic or therapeutic treatment of colorectal cancer when the expression level or activity of the Ape1 / Ref-1, Jagged1 and Notch3 proteins is decreased as compared with the control, Wherein the method comprises the step of screening for a substance for preventing or treating colorectal cancer. 14. The method of claim 13,
The measurement of step (b) may be performed using a reverse transcriptase-polymerase chain reaction, a real time-polymerase chain reaction, a Western blot, Northern blot, an enzyme linked immunosorbent assay (ELISA) Wherein the method is selected from the group consisting of immunoblot analysis, immunohistochemical staining, radioimmunoassay (RIA), radioimmunodiffusion and immunoprecipitation assay. A composition for prevention and treatment of colorectal cancer, which comprises a substance that inhibits the expression of Ape1 / Ref-1 protein and has a mechanism of inhibiting tumor formation by inhibiting Notch signaling pathway mediated by Jagged1.

Images